DOCSLIB.ORG

Supporting Information for Proteomics DOI 10.1002/Pmic.200500112

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Information for Proteomics DOI 10.1002/Pmic.200500112 Supporting Information for Proteomics DOI 10.1002/pmic.200500112 Bindu Nanduri, Mark L. Lawrence, Sucharith Vanguri and Shane C. Burgess Proteomic analysis using an unfinished bacterial genome: The effects of subminimum inhibitory concentrations of antibiotics on Mannheimia haemolytica virulence factor expression ª 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de Supplementary Material. List of all identified M. haemolytica proteins GI #a % AAb COGc Protein/COG#d Protein description identity M. haemolytica proteins in the nrpd database 56788308 C Mdh Malic Enzyme 56606831 E Asd Aspartate-semialdehyde dehydrogenase 38046578 E LapT Arginine-binding periplasmic protein 2 56606845 G GalE UDP-glucose 4-epimerase 97190 G O-sialoglycoprotein endopeptidase 2645727 I FabI Short-chain alcohol dehydrogenase homolog (enoyl-acyl-carrier-protein ) 2731435 K FIS Factor for inversion stimulation Fis, transcriptional activator 28974007 L Tnp Transposase 279565 M Ssa1 Serotype-specific antigen precursor 1683632 M KdsA 3-deoxy-D-manno-octulosonic acid synthetase KdsA 3283200 M PlpD Lipoprotein Plp4 6424988 M CpxD 6424993 M UDP-N-acetylglucosamine-2-epimerase 6424995 M PhyA Capsule polysaccharide export protein 45758047 M OmpA Heat-modifiable outer membrane protein 541237 M Outer membrane 30K protein 6424994 M WecC UDP-N-acetylmannosamine dehydrogenase 2738813 O DnaK Molecular chaperone 15987895 O LktC Leukotoxin C 11762018 O LktA Leukotoxin A 3978164 P FbpA Iron binding protein FbpA precursor 1353671 R GS60 antigen 282115 NAe Hypothetical protein 2 3947938 NA PlpE Outer membrane lipoprotein PlpE 6424991 NA Unknown Proteins confirmed by gene/protein name or COG number from draft genome 15602146 87 C SucD Succinyl-CoA synthetase, alpha subunit 15602586 65 C TtrA Anaerobic dehydrogenases, typically selenocysteine-containing 15603357 83 C AtpA F0F1-type ATP synthase, alpha subunit 15603471 90 C Idp Isocitrate dehydrogenases 32033610 80 C Ppc Phosphoenolpyruvate carboxylase 32033738 82 C GlcD FAD/FMN-containing dehydrogenases 32034038 98 C IscU NifU homolog involved in Fe-S cluster formation 32034767 87 C SucA 2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) co 32034775 71 C LldP L-lactate permease 32035015 84 C PckA Phosphoenolpyruvate carboxykinase (ATP) 32035743 86 C COG1139 Uncharacterized conserved protein containing a ferredoxin-l domain PM1854 46143536 90 C SdhA Succinate dehydrogenase/fumarate reductase, flavoprotein su 46143581 84 C BisC Anaerobic dehydrogenases, typically selenocysteine-containing 52424094 77 C OadA Na+-transporting methylmalonyl-CoA/oxaloacetate decarboxylase, alpha subunit 52424975 48 C NqrA Na+-transporting NADHubiquinone oxidoreductase alpha subunit 52425391 80 C AceE Pyruvate dehydrogenase complex, dehydrogenase (E1) component 52426187 33 C PutA Delta 1-pyrroline-5-carboxylate dehydrogenase 53728869 84 C NqrF Na+-transporting NADH:ubiquinone oxidoreductase, subunit NqrF 53728986 90 C Lpd Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase (E3) component 53728987 76 C AceF Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide acyltransferase (E2) component 53729160 86 C AckA Acetate kinase 32033425 76 CH HemG Flavodoxin 15603350 81 D GidA NAD/FAD-utilizing enzyme apparently involved in cell divisi 32033984 83 D Mrp ATPases involved in chromosome partitioning 46143719 81 D MukB Uncharacterized protein involved in chromosome partitioning 581456 70 E AroA 3-phosphoshikimate-1-carboxyvinyltransferase 15603060 80 E HisG ATP phosphoribosyltransferase 15603295 83 E CysE Serine acetyltransferase 15603439 78 E AsnA Asparagine synthetase A 15603490 75 E IlvD Dihydroxyacid dehydratase/phosphogluconate dehydratase 15603633 58 E SelA Selenocysteine synthase 15603772 99 E OppD ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component 32033631 83 E MetC Cystathionine beta-lyases/cystathionine gamma-synthases 32034037 94 E NifS Cysteine sulfinate desulfinase/cysteine desulfurase and rel 32034165 90 E ArgF Ornithine carbamoyltransferase 32034923 81 E GlnB Nitrogen regulatory protein PII 32035348 86 E AroG 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase 32035370 84 E LysC Aspartokinases 32035395 92 E DppB ABC-type dipeptide/oligopeptide/nickel transport systems, p 46143264 91 E PotD Spermidine/putrescine-binding periplasmic protein 46143274 95 E ArgG Argininosuccinate synthase 46143474 90 E ThrB Homoserine kinase 46143532 88 E LysA Diaminopimelate decarboxylase 46143754 78 E DapD Tetrahydrodipicolinate N-succinyltransferase 46143847 91 E PotA ABC-type spermidine/putrescine transport systems, ATPase co 46143854 80 E DdpA ABC-type dipeptide transport system, periplasmic component 46143878 91 E DapA Dihydrodipicolinate synthase/N-acetylneuraminate lyase 52424921 88 E AroC Chorismate synthase 52425089 72 E PepN Aminopeptidase N 52425157 67 E TyrA Chorismate mutase 52425659 68 E ProA Gamma-glutamyl phosphate reductase 52425712 72 E PheA Prephenate dehydratase 52426248 62 E TrpE Anthranilate/para-aminobenzoate synthases component I 53728921 40 E HisM ABC-type amino acid transport system, permease component 53728984 72 E SstT Na+/serine symporter 53729180 77 E KamA Lysine 2,3-aminomutase 15602089 80 F PurD Phosphoribosylamine-glycine ligase 15602485 71 F PurK Phosphoribosylaminoimidazole carboxylase (NCAIR synthetase) 15602743 57 F Dgt dGTP triphosphohydrolase 15603676 45 F CyaA Adenylate cyclase 32033968 63 F NupC Nucleoside permease 32033969 71 F DeoC Deoxyribose-phosphate aldolase 32033970 92 F DeoD Purine-nucleoside phosphorylase 32034124 76 F CpdB 5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases 32034191 62 F Cdd Cytidine deaminase 32034313 85 F PurL Phosphoribosylformylglycinamidine (FGAM) synthase, syntheta 32035815 92 F Apt Adenine/guanine phosphoribosyltransferases and related PRPP 46143444 98 F Adk Adenylate kinase 46143460 95 F PurA Adenylosuccinate synthase 46143605 88 F Upp Uracil phosphoribosyltransferase 46143710 85 F GuaB IMP dehydrogenase/GMP reductase 46143711 93 F GuaA GMP synthase, PP-ATPase domain/subunit 52424682 67 F PurN Folate-dependent phosphoribosylglycinamide formyltransferase PurN 52425378 81 F PurU Formyltetrahydrofolate hydrolase 53728853 79 F ThyA Thymidylate synthase 53728876 88 F NrdF Ribonucleotide reductase, beta subunit 15601934 74 G PfkA 6-phosphofructokinase 15602035 46 G PtsN Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) 15602900 55 G GalK Galactokinase 15602903 77 G MglB ABC-type sugar transport system, periplasmic component MglB 15603237 22 G RbsK Sugar kinases, ribokinase family 15603371 91 G GpmA Phosphoglycerate mutase 1 32034150 96 G GmhA Phosphoheptose isomerase 32034170 81 G FruB Phosphotransferase system, HPr-related proteins 32034172 88 G NagE Phosphotransferase system IIA components 32034335 51 G ManZ Phosphotransferase system, mannose/fructose/N-acetylgalacto 32034786 82 G TpiA Triosephosphate isomerase 32035456 83 G AraD Ribulose-5-phosphate 4-epimerase and related epimerases and 32035526 91 G Eno Enolase 32035646 65 G MalQ 4-alpha-glucanotransferase 46143450 89 G Gnd 6-phosphogluconate dehydrogenase 46143685 93 G RpiA Ribose 5-phosphate isomerase 46143789 91 G TktA Transketolase 46143806 70 G GlgB 1,4-alpha-glucan branching enzyme 52424113 75 G AraA L-arabinose isomerase 52424299 85 G Fba Fructose/tagatose bisphosphate aldolase 52424592 82 G UxuA D-mannonate dehydratase 52424698 80 G RbsB ABC-type sugar transport system, periplasmic component 52425466 57 G XylB Xylulokinase 53728742 75 G ProP Permeases of the major facilitator superfamily 53728801 95 G Pgk 3-phosphoglycerate kinase 53728880 26 G GntT H+/gluconate symporter and related permeases 53728901 81 G SuhB Archaeal fructose-1,6-bisphosphatase and related enzymes of 53729272 84 G MtlD Mannitol-1-phosphate/altronate dehydrogenases 53729273 72 G mtlA Phosphotransferase system, mannitol-specific IIBC component 15602961 90 H MenB Dihydroxynaphthoic acid synthase 15603097 53 H Snz1 Pyridoxine biosynthesis enzyme 15603526 58 H RibF FAD synthase 15603551 89 H UbiE Methylase involved in ubiquinone/menaquinone biosynthesis 15603766 96 H BioF 7-keto-8-aminopelargonate synthetase and related enzymes 15603795 86 H LipA Lipoate synthase 32033744 85 H MoaE Molybdopterin converting factor, large subunit 32033974 87 H HemC Porphobilinogen deaminase 32034922 90 H MoaB Molybdopterin biosynthesis enzymes 46143459 83 H ThiI Thiamine biosynthesis ATP pyrophosphatase 52424724 85 H MetK S-adenosylmethionine synthetase 52424860 73 H PdxK Pyridoxal/pyridoxine/pyridoxamine kinase 52425228 55 H FolC Folylpolyglutamate synthase 53729101 80 H NadR Predicted ATPase/kinase involved in NAD metabolism 15602110 60 I IspE 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate synthase 32034925 89 I LytB Penicillin tolerance protein 46143750 92 I AccC Biotin carboxylase 46143902 80 I FabD (acyl-carrier-protein) S-malonyltransferase 53728816 85 I AccA Acetyl-CoA carboxylase alpha subunit 46143558 91 I FabB 3-oxoacyl-(acyl-carrier-protein) synthase 46143901 89 I FabG Dehydrogenases with different specificities 2500221 96 J RpL2 Ribosomal protein L2 2500232 94 J RpL4 Ribosomal protein L4 13274359 25 J DcbE Seryl-tRNA synthetase 15602028 95 J COG0012 Predicted GTPase, probable translation factor 15602458 88 J ThrS Threonyl-tRNA synthetase 15602963 89 J GlyQ Glycyl-tRNA synthetase, alpha subunit 15603007 92 J RpL31 Ribosomal protein L31 15603268 96 J RpL5 Ribosomal protein L5 15603436 83 J MiaB 2-methylthioadenine synthetase
Load more

Recommended publications
  • An Atpase Domain Common to Prokaryotic Cell Cycle Proteins
    Proc. Natl. Acad. Sci. USA Vol. 89, pp. 7290-7294, August 1992 Biochemistry An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, actin, and hsp7O heat shock proteins (structural comparison/property pattern/remote homology) PEER BORK, CHRIS SANDER, AND ALFONSO VALENCIA European Molecular Biology Laboratory, D-6900 Heidelberg, Federal Republic of Germany Communicated by Russell F. Doolittle, March 6, 1992 ABSTRACT The functionally diverse actin, hexokinase, and hsp7O protein families have in common an ATPase domain of known three-dimensional structure. Optimal superposition ofthe three structures and alignment ofmany sequences in each of the three families has revealed a set of common conserved residues, distributed in five sequence motifs, which are in- volved in ATP binding and in a putative interdomain hinge. From the multiple sequence aliment in these motifs a pattern of amino acid properties required at each position is defined. The discriminatory power of the pattern is in part due to the use of several known three-dimensional structures and many sequences and in part to the "property" method ofgeneralizing from observed amino acid frequencies to amino acid fitness at each sequence position. A sequence data base search with the pattern significantly matches sugar kinases, such as fuco-, glucono-, xylulo-, ribulo-, and glycerokinase, as well as the prokaryotic cell cycle proteins MreB, FtsA, and StbA. These are predicted to have subdomains with the same tertiary structure as the ATPase subdomains Ia and Ha of hexokinase, actin, and Hsc7O, a very similar ATP binding pocket, and the capacity for interdomain hinge motion accompanying func- tional state changes.
    [Show full text]
  • WO 2017/014762 Al 26 January 2017 (26.01.2017) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/014762 Al 26 January 2017 (26.01.2017) P O P C T (51) International Patent Classification: DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C12Q 1/68 (2006.01) HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, (21) International Application Number: MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PCT/US201 5/0414 15 PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (22) International Filing Date: SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 2 1 July 20 15 (21 .07.2015) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, (71) Applicant: OMNIOME, INC. [US/US]; 4225 Executive TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, Square, Suite 440, La Jolla, California 92037 (US). TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, (72) Inventors: VIJAYAN, Kandaswamy; 4465 Vision Drive, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Unit 6, San Diego, California 92121 (US).
    [Show full text]
  • Supplementary Materials
    Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16
    [Show full text]
  • DNA Methylation Seeing the Forest for the Trees: a Wide Perspective on RNA-Directed
    Downloaded from genesdev.cshlp.org on August 16, 2012 - Published by Cold Spring Harbor Laboratory Press Seeing the forest for the trees: a wide perspective on RNA-directed DNA methylation Huiming Zhang and Jian-Kang Zhu Genes Dev. 2012 26: 1769-1773 Access the most recent version at doi:10.1101/gad.200410.112 References This article cites 31 articles, 9 of which can be accessed free at: http://genesdev.cshlp.org/content/26/16/1769.full.html#ref-list-1 Related Content Spatial and functional relationships among Pol V-associated loci, Pol IV-dependent siRNAs, and cytosine methylation in the Arabidopsis epigenome Andrzej T. Wierzbicki, Ross Cocklin, Anoop Mayampurath, et al. Genes Dev. August 15, 2012 26: 1825-1836 Email alerting Receive free email alerts when new articles cite this article - sign up in the box at the service top right corner of the article or click here Topic Articles on similar topics can be found in the following collections Collections Chromatin and Gene Expression (146 articles) Plant Biology (29 articles) To subscribe to Genes & Development go to: http://genesdev.cshlp.org/subscriptions Copyright © 2012 by Cold Spring Harbor Laboratory Press Downloaded from genesdev.cshlp.org on August 16, 2012 - Published by Cold Spring Harbor Laboratory Press PERSPECTIVE Seeing the forest for the trees: a wide perspective on RNA-directed DNA methylation Huiming Zhang1 and Jian-Kang Zhu1,2,3 1Department of Horticulture and Landscape Architecture, Purdue University, West Lafayette, Indiana 47907, USA; 2Shanghai Center for Plant Stress Biology, Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China In this issue of Genes & Development, Wierzbicki and remaining subunits of Pol IV and/or Pol V are different but colleagues (pp.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • The Pennsylvania State University
    The Pennsylvania State University The Graduate School Graduate Program in Plant Biology IDENTIFICATION OF SMALL RNA PRODUCING GENES IN THE MOSS PHYSCOMITRELLA PATENS A Dissertation in Plant Biology by Ceyda Coruh 2014 Ceyda Coruh Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 The dissertation of Ceyda Coruh was reviewed and approved* by the following: Michael J. Axtell Associate Professor of Biology Dissertation Advisor Chair of Committee Claude dePamphilis Professor of Biology Sarah M. Assmann Waller Professor of Biology Anton Nekrutenko Associate Professor of Biochemistry and Molecular Biology Teh-hui Kao Distinguished Professor of Biochemistry and Molecular Biology Chair, Intercollege Graduate Degree Program in Plant Biology *Signatures are on file in the Graduate School iii ABSTRACT In plants, a significant fraction of the genome is responsible for making regulatory small RNAs. These ubiquitous, endogenous small RNAs are currently categorized into two groups: microRNAs (miRNAs) and small interfering RNAs (siRNAs). They are produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins to guide repressive regulation of target mRNAs and/or chromatin selected on the basis of small RNA-target complementarity at the transcriptional or post-transcriptional levels. 21 nt miRNAs and 24 nt heterochromatic siRNAs are the two major types of small RNAs found in angiosperms (flowering plants). The small RNA populations in angiosperms are dominated by 24 nt heterochromatic siRNAs which derive from intergenic, repetitive regions and mediate DNA methylation and repressive histone modifications to targeted loci in angiosperms. However, the existence and extent of heterochromatic siRNAs in other land plant lineages has been less clear.
    [Show full text]
  • Materials and Methods
    Effects of Hybridization on Heterochromatic Small Interfering RNA and Gene Expression in Zea mays by Travis Korry Coleman A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Doctor of Philosophy in Plant Agriculture Guelph, Ontario, Canada © Travis Coleman, January, 2017 ABSTRACT EFFECTS OF HYBRIDIZATION ON HETEROCHROMATIC SMALL INTERFERING RNA AND GENE EXPRESSION IN ZEA MAYS Travis Korry Coleman Advisor: University of Guelph, 2016 Associate Professor Lewis N. Lukens Despite decades of research, the molecular nature of heterosis is not completely understood. Heterosis for quantitative traits is controlled by the cumulative effects of multiple genes and regulatory elements, each of which may exhibit differing modes of action. While dominance and over-dominance theories can account for some of the genetic control of heterosis, neither provides a complete account. There is a growing body of evidence that implicates small RNAs as non-coding elements which may play a role in the manifestation of heterosis upon hybridization. In particular, 24-nt heterochromatic small interfering RNAs (hetsiRNAs) may play a role in mediating trans-genomic interactions via DNA methylation when two genomes come into contact in an F1 nucleus. Recent research in Arabidopsis thaliana has demonstrated that hetsiRNAs show non-additive expression upon hybridization, with the majority of hetsiRNAs being downregulated. This research seeks to examine such trends in non-additive hetsiRNA expression in commercial maize germplasm. Small RNA were isolated and deep sequenced from leaf tissue samples of two inbred lines and their F1 hybrid. In order to examine the effects of reducing hetsiRNAs in hybridization, each genotype was also sampled in each of two mediator of paramutation 1 (mop1) allelic states.
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]
  • Generated by SRI International Pathway Tools Version 25.0, Authors S
    Authors: Pallavi Subhraveti Peter D Karp Ingrid Keseler An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Anamika Kothari Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Gcf_000442315Cyc: Rubellimicrobium thermophilum DSM 16684 Cellular Overview Connections between pathways are omitted for legibility. Ron Caspi lipid II (meso phosphate diaminopimelate sn-glycerol containing) phosphate dCTP 3-phosphate predicted ABC RS07495 RS12165 RS03605 transporter RS13105 of phosphate lipid II (meso dCTP sn-glycerol diaminopimelate phosphate 3-phosphate containing) phosphate Secondary Metabolite Degradation Storage Compound Biosynthesis Tetrapyrrole Biosynthesis Hormone Biosynthesis Aromatic Compound Aldehyde Degradation UDP-N-acetyl- Biosynthesis undecaprenyl- a mature (4R)-4-hydroxy- an L-glutamyl- a [protein]-L- queuosine at Macromolecule Modification myo-inositol degradation I α-D-glucosamine adenosylcobinamide a purine L-canavanine 5'-deoxyadenosine sec Metabolic Regulator Biosynthesis Amine and Polyamine Biosynthesis polyhydroxybutanoate biosynthesis siroheme biosynthesis methylglyoxal degradation I diphospho-N- peptidoglycan 2-oxoglutarate Gln β-isoaspartate glu position 34 ser a tRNA indole-3-acetate
    [Show full text]
  • Engineering Yeast Hexokinase 2 for Improved Tolerance Toward Xylose-Induced Inactivation
    Engineering Yeast Hexokinase 2 for Improved Tolerance Toward Xylose-Induced Inactivation Basti Bergdahl*, Anders G. Sandstro¨ m, Celina Borgstro¨ m, Tarinee Boonyawan¤, Ed W. J. van Niel, Marie F. Gorwa-Grauslund Division of Applied Microbiology, Department of Chemistry, Lund University, Lund, Sweden Abstract Hexokinase 2 (Hxk2p) from Saccharomyces cerevisiae is a bi-functional enzyme being both a catalyst and an important regulator in the glucose repression signal. In the presence of xylose Hxk2p is irreversibly inactivated through an autophosphorylation mechanism, affecting all functions. Consequently, the regulation of genes involved in sugar transport and fermentative metabolism is impaired. The aim of the study was to obtain new Hxk2p-variants, immune to the autophosphorylation, which potentially can restore the repressive capability closer to its nominal level. In this study we constructed the first condensed, rationally designed combinatorial library targeting the active-site in Hxk2p. We combined protein engineering and genetic engineering for efficient screening and identified a variant with Phe159 changed to tyrosine. This variant had 64% higher catalytic activity in the presence of xylose compared to the wild-type and is expected to be a key component for increasing the productivity of recombinant xylose-fermenting strains for bioethanol production from lignocellulosic feedstocks. Citation: Bergdahl B, Sandstro¨m AG, Borgstro¨m C, Boonyawan T, van Niel EWJ, et al. (2013) Engineering Yeast Hexokinase 2 for Improved Tolerance Toward Xylose-Induced Inactivation. PLoS ONE 8(9): e75055. doi:10.1371/journal.pone.0075055 Editor: Paul Hoskisson, University of Strathclyde, United States of America Received June 29, 2013; Accepted August 5, 2013; Published September 6, 2013 Copyright: ß 2013 Bergdahl et al.
    [Show full text]
  • Supplementary Information
    Supplementary information (a) (b) Figure S1. Resistant (a) and sensitive (b) gene scores plotted against subsystems involved in cell regulation. The small circles represent the individual hits and the large circles represent the mean of each subsystem. Each individual score signifies the mean of 12 trials – three biological and four technical. The p-value was calculated as a two-tailed t-test and significance was determined using the Benjamini-Hochberg procedure; false discovery rate was selected to be 0.1. Plots constructed using Pathway Tools, Omics Dashboard. Figure S2. Connectivity map displaying the predicted functional associations between the silver-resistant gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S3. Connectivity map displaying the predicted functional associations between the silver-sensitive gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S4. Metabolic overview of the pathways in Escherichia coli. The pathways involved in silver-resistance are coloured according to respective normalized score. Each individual score represents the mean of 12 trials – three biological and four technical. Amino acid – upward pointing triangle, carbohydrate – square, proteins – diamond, purines – vertical ellipse, cofactor – downward pointing triangle, tRNA – tee, and other – circle.
    [Show full text]
  • Structural Insights Into Decreased Enzymatic Activity Induced by an Insert Sequence in Mannonate Dehydratase from Gram Negative Bacterium
    Journal of Structural Biology 180 (2012) 327–334 Contents lists available at SciVerse ScienceDirect Journal of Structural Biology journal homepage: www.elsevier.com/locate/yjsbi Structural insights into decreased enzymatic activity induced by an insert sequence in mannonate dehydratase from Gram negative bacterium Xiaoting Qiu, Yuyong Tao, Yuwei Zhu, Ye Yuan, Yujie Zhang, Hejun Liu, Yongxiang Gao, ⇑ ⇑ Maikun Teng , Liwen Niu Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Key Laboratory of Structural Biology, Chinese Academy of Sciences, Hefei, Anhui 230026, PR China article info abstract Article history: Mannonate dehydratase (ManD; EC4.2.1.8) catalyzes the dehydration of D-mannonate to 2-keto-3-deoxyg- Received 30 April 2012 luconate. It is the third enzyme in the pathway for dissimilation of D-glucuronate to 2-keto-3-deoxygluc- Received in revised form 21 June 2012 onate involving in the Entner–Doudoroff pathway in certain bacterial and archaeal species. ManD from Accepted 26 June 2012 Gram negative bacteria has an insert sequence as compared to those from Gram positives revealed by Available online 14 July 2012 sequence analysis. To evaluate the impact of this insert sequence on the catalytic efficiency, we solved the crystal structures of ManD from Escherichia coli strain K12 and its complex with D-mannonate, which Keywords: reveal that this insert sequence forms two a helices locating above the active site. The two insert a helices Mannonate dehydratase introduce a loop that forms a cap covering the substrate binding pocket, which restricts the tunnels of sub- Gram negative bacteria Insert sequence strate entering and product releasing from the active site.
    [Show full text]