Genetic Tools for High Yield Protein Production with Bacillus Megaterium
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
An Atpase Domain Common to Prokaryotic Cell Cycle Proteins
Proc. Natl. Acad. Sci. USA Vol. 89, pp. 7290-7294, August 1992 Biochemistry An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, actin, and hsp7O heat shock proteins (structural comparison/property pattern/remote homology) PEER BORK, CHRIS SANDER, AND ALFONSO VALENCIA European Molecular Biology Laboratory, D-6900 Heidelberg, Federal Republic of Germany Communicated by Russell F. Doolittle, March 6, 1992 ABSTRACT The functionally diverse actin, hexokinase, and hsp7O protein families have in common an ATPase domain of known three-dimensional structure. Optimal superposition ofthe three structures and alignment ofmany sequences in each of the three families has revealed a set of common conserved residues, distributed in five sequence motifs, which are in- volved in ATP binding and in a putative interdomain hinge. From the multiple sequence aliment in these motifs a pattern of amino acid properties required at each position is defined. The discriminatory power of the pattern is in part due to the use of several known three-dimensional structures and many sequences and in part to the "property" method ofgeneralizing from observed amino acid frequencies to amino acid fitness at each sequence position. A sequence data base search with the pattern significantly matches sugar kinases, such as fuco-, glucono-, xylulo-, ribulo-, and glycerokinase, as well as the prokaryotic cell cycle proteins MreB, FtsA, and StbA. These are predicted to have subdomains with the same tertiary structure as the ATPase subdomains Ia and Ha of hexokinase, actin, and Hsc7O, a very similar ATP binding pocket, and the capacity for interdomain hinge motion accompanying func- tional state changes. -
WO 2017/014762 Al 26 January 2017 (26.01.2017) P O P C T
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/014762 Al 26 January 2017 (26.01.2017) P O P C T (51) International Patent Classification: DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C12Q 1/68 (2006.01) HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, (21) International Application Number: MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PCT/US201 5/0414 15 PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (22) International Filing Date: SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 2 1 July 20 15 (21 .07.2015) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, (71) Applicant: OMNIOME, INC. [US/US]; 4225 Executive TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, Square, Suite 440, La Jolla, California 92037 (US). TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, (72) Inventors: VIJAYAN, Kandaswamy; 4465 Vision Drive, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Unit 6, San Diego, California 92121 (US). -
Supplementary Materials
Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16 -
DNA Methylation Seeing the Forest for the Trees: a Wide Perspective on RNA-Directed
Downloaded from genesdev.cshlp.org on August 16, 2012 - Published by Cold Spring Harbor Laboratory Press Seeing the forest for the trees: a wide perspective on RNA-directed DNA methylation Huiming Zhang and Jian-Kang Zhu Genes Dev. 2012 26: 1769-1773 Access the most recent version at doi:10.1101/gad.200410.112 References This article cites 31 articles, 9 of which can be accessed free at: http://genesdev.cshlp.org/content/26/16/1769.full.html#ref-list-1 Related Content Spatial and functional relationships among Pol V-associated loci, Pol IV-dependent siRNAs, and cytosine methylation in the Arabidopsis epigenome Andrzej T. Wierzbicki, Ross Cocklin, Anoop Mayampurath, et al. Genes Dev. August 15, 2012 26: 1825-1836 Email alerting Receive free email alerts when new articles cite this article - sign up in the box at the service top right corner of the article or click here Topic Articles on similar topics can be found in the following collections Collections Chromatin and Gene Expression (146 articles) Plant Biology (29 articles) To subscribe to Genes & Development go to: http://genesdev.cshlp.org/subscriptions Copyright © 2012 by Cold Spring Harbor Laboratory Press Downloaded from genesdev.cshlp.org on August 16, 2012 - Published by Cold Spring Harbor Laboratory Press PERSPECTIVE Seeing the forest for the trees: a wide perspective on RNA-directed DNA methylation Huiming Zhang1 and Jian-Kang Zhu1,2,3 1Department of Horticulture and Landscape Architecture, Purdue University, West Lafayette, Indiana 47907, USA; 2Shanghai Center for Plant Stress Biology, Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China In this issue of Genes & Development, Wierzbicki and remaining subunits of Pol IV and/or Pol V are different but colleagues (pp. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
The Pennsylvania State University
The Pennsylvania State University The Graduate School Graduate Program in Plant Biology IDENTIFICATION OF SMALL RNA PRODUCING GENES IN THE MOSS PHYSCOMITRELLA PATENS A Dissertation in Plant Biology by Ceyda Coruh 2014 Ceyda Coruh Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 The dissertation of Ceyda Coruh was reviewed and approved* by the following: Michael J. Axtell Associate Professor of Biology Dissertation Advisor Chair of Committee Claude dePamphilis Professor of Biology Sarah M. Assmann Waller Professor of Biology Anton Nekrutenko Associate Professor of Biochemistry and Molecular Biology Teh-hui Kao Distinguished Professor of Biochemistry and Molecular Biology Chair, Intercollege Graduate Degree Program in Plant Biology *Signatures are on file in the Graduate School iii ABSTRACT In plants, a significant fraction of the genome is responsible for making regulatory small RNAs. These ubiquitous, endogenous small RNAs are currently categorized into two groups: microRNAs (miRNAs) and small interfering RNAs (siRNAs). They are produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins to guide repressive regulation of target mRNAs and/or chromatin selected on the basis of small RNA-target complementarity at the transcriptional or post-transcriptional levels. 21 nt miRNAs and 24 nt heterochromatic siRNAs are the two major types of small RNAs found in angiosperms (flowering plants). The small RNA populations in angiosperms are dominated by 24 nt heterochromatic siRNAs which derive from intergenic, repetitive regions and mediate DNA methylation and repressive histone modifications to targeted loci in angiosperms. However, the existence and extent of heterochromatic siRNAs in other land plant lineages has been less clear. -
Materials and Methods
Effects of Hybridization on Heterochromatic Small Interfering RNA and Gene Expression in Zea mays by Travis Korry Coleman A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Doctor of Philosophy in Plant Agriculture Guelph, Ontario, Canada © Travis Coleman, January, 2017 ABSTRACT EFFECTS OF HYBRIDIZATION ON HETEROCHROMATIC SMALL INTERFERING RNA AND GENE EXPRESSION IN ZEA MAYS Travis Korry Coleman Advisor: University of Guelph, 2016 Associate Professor Lewis N. Lukens Despite decades of research, the molecular nature of heterosis is not completely understood. Heterosis for quantitative traits is controlled by the cumulative effects of multiple genes and regulatory elements, each of which may exhibit differing modes of action. While dominance and over-dominance theories can account for some of the genetic control of heterosis, neither provides a complete account. There is a growing body of evidence that implicates small RNAs as non-coding elements which may play a role in the manifestation of heterosis upon hybridization. In particular, 24-nt heterochromatic small interfering RNAs (hetsiRNAs) may play a role in mediating trans-genomic interactions via DNA methylation when two genomes come into contact in an F1 nucleus. Recent research in Arabidopsis thaliana has demonstrated that hetsiRNAs show non-additive expression upon hybridization, with the majority of hetsiRNAs being downregulated. This research seeks to examine such trends in non-additive hetsiRNA expression in commercial maize germplasm. Small RNA were isolated and deep sequenced from leaf tissue samples of two inbred lines and their F1 hybrid. In order to examine the effects of reducing hetsiRNAs in hybridization, each genotype was also sampled in each of two mediator of paramutation 1 (mop1) allelic states. -
The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota. -
Generated by SRI International Pathway Tools Version 25.0, Authors S
Authors: Pallavi Subhraveti Peter D Karp Ingrid Keseler An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Anamika Kothari Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Gcf_000442315Cyc: Rubellimicrobium thermophilum DSM 16684 Cellular Overview Connections between pathways are omitted for legibility. Ron Caspi lipid II (meso phosphate diaminopimelate sn-glycerol containing) phosphate dCTP 3-phosphate predicted ABC RS07495 RS12165 RS03605 transporter RS13105 of phosphate lipid II (meso dCTP sn-glycerol diaminopimelate phosphate 3-phosphate containing) phosphate Secondary Metabolite Degradation Storage Compound Biosynthesis Tetrapyrrole Biosynthesis Hormone Biosynthesis Aromatic Compound Aldehyde Degradation UDP-N-acetyl- Biosynthesis undecaprenyl- a mature (4R)-4-hydroxy- an L-glutamyl- a [protein]-L- queuosine at Macromolecule Modification myo-inositol degradation I α-D-glucosamine adenosylcobinamide a purine L-canavanine 5'-deoxyadenosine sec Metabolic Regulator Biosynthesis Amine and Polyamine Biosynthesis polyhydroxybutanoate biosynthesis siroheme biosynthesis methylglyoxal degradation I diphospho-N- peptidoglycan 2-oxoglutarate Gln β-isoaspartate glu position 34 ser a tRNA indole-3-acetate -
Engineering Yeast Hexokinase 2 for Improved Tolerance Toward Xylose-Induced Inactivation
Engineering Yeast Hexokinase 2 for Improved Tolerance Toward Xylose-Induced Inactivation Basti Bergdahl*, Anders G. Sandstro¨ m, Celina Borgstro¨ m, Tarinee Boonyawan¤, Ed W. J. van Niel, Marie F. Gorwa-Grauslund Division of Applied Microbiology, Department of Chemistry, Lund University, Lund, Sweden Abstract Hexokinase 2 (Hxk2p) from Saccharomyces cerevisiae is a bi-functional enzyme being both a catalyst and an important regulator in the glucose repression signal. In the presence of xylose Hxk2p is irreversibly inactivated through an autophosphorylation mechanism, affecting all functions. Consequently, the regulation of genes involved in sugar transport and fermentative metabolism is impaired. The aim of the study was to obtain new Hxk2p-variants, immune to the autophosphorylation, which potentially can restore the repressive capability closer to its nominal level. In this study we constructed the first condensed, rationally designed combinatorial library targeting the active-site in Hxk2p. We combined protein engineering and genetic engineering for efficient screening and identified a variant with Phe159 changed to tyrosine. This variant had 64% higher catalytic activity in the presence of xylose compared to the wild-type and is expected to be a key component for increasing the productivity of recombinant xylose-fermenting strains for bioethanol production from lignocellulosic feedstocks. Citation: Bergdahl B, Sandstro¨m AG, Borgstro¨m C, Boonyawan T, van Niel EWJ, et al. (2013) Engineering Yeast Hexokinase 2 for Improved Tolerance Toward Xylose-Induced Inactivation. PLoS ONE 8(9): e75055. doi:10.1371/journal.pone.0075055 Editor: Paul Hoskisson, University of Strathclyde, United States of America Received June 29, 2013; Accepted August 5, 2013; Published September 6, 2013 Copyright: ß 2013 Bergdahl et al. -
Supplementary Information
Supplementary information (a) (b) Figure S1. Resistant (a) and sensitive (b) gene scores plotted against subsystems involved in cell regulation. The small circles represent the individual hits and the large circles represent the mean of each subsystem. Each individual score signifies the mean of 12 trials – three biological and four technical. The p-value was calculated as a two-tailed t-test and significance was determined using the Benjamini-Hochberg procedure; false discovery rate was selected to be 0.1. Plots constructed using Pathway Tools, Omics Dashboard. Figure S2. Connectivity map displaying the predicted functional associations between the silver-resistant gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S3. Connectivity map displaying the predicted functional associations between the silver-sensitive gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S4. Metabolic overview of the pathways in Escherichia coli. The pathways involved in silver-resistance are coloured according to respective normalized score. Each individual score represents the mean of 12 trials – three biological and four technical. Amino acid – upward pointing triangle, carbohydrate – square, proteins – diamond, purines – vertical ellipse, cofactor – downward pointing triangle, tRNA – tee, and other – circle. -
Dynamics and Function of DNA Methylation in Plants
REVIEWS Dynamics and function of DNA methylation in plants Huiming Zhang1,2*, Zhaobo Lang1,2 and Jian- Kang Zhu 1,2,3* Abstract | DNA methylation is a conserved epigenetic modification that is important for gene regulation and genome stability. Aberrant patterns of DNA methylation can lead to plant developmental abnormalities. A specific DNA methylation state is an outcome of dynamic regulation by de novo methylation, maintenance of methylation and active demethylation, which are catalysed by various enzymes that are targeted by distinct regulatory pathways. In this Review, we discuss DNA methylation in plants, including methylating and demethylating enzymes and regulatory factors, and the coordination of methylation and demethylation activities by a so- called methylstat mechanism; the functions of DNA methylation in regulating transposon silencing, gene expression and chromosome interactions; the roles of DNA methylation in plant development; and the involvement of DNA methylation in plant responses to biotic and abiotic stress conditions. DNA methylation at the 5ʹ position of cytosine contrib- and regulatory factors are generally not lethal. However, utes to the epigenetic regulation of nuclear gene expres- DNA methylation appears to be more crucial for devel- sion and to genome stability1,2. Epigenetic changes, opment and environmental- stress responses in plants including DNA methylation, histone modifications and that have more complex genomes. Recent findings histone variants and some non- coding RNA (ncRNA) have uncovered important