Philippine Journal of Science 148 (S1): 267-273, Special Issue on Genomics ISSN 0031 - 7683 Date Received: 14 May 2019
Genome-wide Profiling and Characterization of Terpene Synthase-linked Simple Sequence Repeats in Coffea canephora Pierre ex A. Froehner for Identification of Potential Markers for Aroma in Philippine-grown Coffee Varieties
Daisy May C. Santos1, Angelo Joshua A. Victoria1,2, Carla Francesca F. Besa2, and Ernelea P. Cao1
1Institute of Biology, College of Science 2Philippine Genome Center (PGC) University of the Philippines (UP) Diliman, Quezon City 1101 Philippines
Aroma plays an important role in determining the market value of coffee. The Philippines produces four coffee varieties – namely, Arabica, Robusta, Liberica, and Excelsa for commercial use. In this study, simple sequence repeats (SSRs) linked to terpene synthase (TPS) genes were used to characterize and differentiate the Philippine coffee varieties. SSR loci were mined from the existing sequenced genome of Coffea canephora. Data mining yielded 759,747 perfect SSRs, of which 317 were linked to the aroma. Two hundred were screened using Philippine Arabica, Robusta, Liberica, and Excelsa samples. There were 27 loci that were successfully amplified for all specimens and showed clear polymorphisms. These were used to characterize the coffee varieties based on number of alleles and heterozygosity. The number of alleles ranged from 2 to 8, while the expected heterozygosity ranged from 0.18 to 0.85. There were 26 bands from 17 loci that could differentiate among varieties, of which 15 bands were unique to C. arabica (Arabica variety), three to C. canephora (Robusta variety), three to C. liberica (Liberica and Excelsa varieties), and five that were shared by C. arabica and C. canephora. This study is the first to characterize TPS-linked SSR markers in Philippine grown coffee varieties.
Keywords: aroma, coffee, microsatellites, terpene synthase
INTRODUCTION because it is high-yielding and tolerant to diseases (Butt and Sultan 2011). Coffea liberica has two varieties The Philippines is one of the few countries that cultivate – Liberica and Excelsa. Coffea liberica var. liberica four coffee varieties for commercial use. These are the (Liberica) is locally known as the “kapeng barako.” It is Arabica, Robusta, Liberica, and Excelsa coffee. Coffea characterized by its strong, woody, and bitter taste with arabica (Arabica) is considered as the world’s best a pungent aroma (N’Diaye et al. 2005). Coffea liberica coffee due to its superior taste and aroma (Vieira et al. var. dewevrei (Excelsa), on the other hand, has a sweet 2010). Coffea canephora (Robusta) accounts for 69% and fruity aroma. of Philippine coffee production (2017–2022 Philippine Coffee Industry Roadmap). Although inferior to Arabica In the coffee industry, bean quality is valued for its taste in terms of taste and aroma, it is of certain advantage and aroma. The coffee bean contains a complex mixture of different substances such as lipids, trigonelline, chlorogenic *Corresponding Author: [email protected]
267 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee acid, and volatile compounds. Volatile compounds are said genetic aspect of Philippine coffee aroma. SSR analysis to be emitted to give coffee its characteristic aroma. These provides a cheaper and quicker method of differentiating volatile organic compounds can be classified according to TPS genes of Philippine coffee varieties. their metabolic origins. Examples are terpenes, benzenoids, and small organic compounds such as alcohols, ketones, aldehydes, and esters (Del Terra et al. 2013). Among the classes of volatile compounds, terpenes were determined to MATERIALS AND METHODS be the major component of the ripe coffee berries (Mathieu et al. 1998). These terpenes are catalyzed from prenyl Reference Genome Retrieval, Pre-processing, and diphosphates by TPSs. SSR Loci Mining Volatile compounds in coffee are usually determined The Coffea canephora reference genome (Denoeud et through gas chromatography/mass spectrometry analysis. al. 2014) was downloaded from the Coffee Genome Hub Volatile profiling of coffee beans can be used to database (Dereeper et al. 2015). The genome was split into discriminate between species, determine place of origin, 12 files – one for each of the 11 chromosomes (Chr1, ..., and determine bean quality (Agresti et al. 2008, Cheong Chr11) – with an additional file for the non-mapped reads et al. 2013, Scholz et al. 2014). Indirect aroma profile (Chr0). The files were pre-processed by cleaving the reads characterization of coffee varieties may be done by wherever there were ambiguous bases (N). characterizing TPS-linked SSR markers. SSR markers are Mining of SSR loci consisting of at least eight repeats from short, tandem repeats of DNA present in the coding and each of the C. canephora chromosomes was done using non-coding portions of the genome (Wang et al. 2009). three SSR-mining tools with different search algorithms The abundance and highly polymorphic property of to cover as many SSR loci as possible – namely MISA SSRs make them good markers for plant genetic studies, with a dictionary approach (Thiel et al. 2003), MREPS identification of cultivars, and evaluating varieties with a with a two-phased algorithm (Kolpakov et al. 2003), and narrow genetic base (Vieira et al. 2010, Wang et al. 2009). SciRoko with a sliding window approach (Kofler et al. SSRs have already been used for varietal identification 2007). The results of the three search tools were then and evaluation of genetic diversity in coffee (Anthony collated into a non-redundant list of SSR loci for the C. et al. 2001, 2002; Geleta et al. 2012; Lashermes et al. canephora reference genome. 1999; Teressa et al. 2010; Vieira et al. 2010). In other studies, Arabica DNA fingerprinting using SSR markers Prior to primer design, the predicted SSR loci were filtered has also been developed as a method to distinguish from according to the following criteria: (a) the locus must be the Robusta variety to ensure authenticity of the coffee perfect/pure (no interruptions by any base in the motif), product sold in the market (Tornincasa et al. 2010). SSRs (b) the locus must not have a mononucleotide repeating have also been used to evaluate certain traits such as leaf unit, and (c) the locus must be at least 20 bases away from miner resistance in Arabica coffee (Pereira et al. 2011). either end of a contig. Sequences of SSR loci that passed the aforementioned criteria were then extracted to generate The sequencing of the diploid (2n = 2x = 22) C. canephora the input files for primer design. Pierre ex A. Froehner genome by Denoeud and co-workers (2014) has provided information on the genes associated with the biosynthesis of terpenes. The elucidation of the Primer Design whole genome sequence allows for the development of To design primer pairs for the amplification of the markers using bioinformatics analysis, namely genome- predicted perfect SSR loci, which were the candidate wide SSR mining and primer design. Mining of SSRs loci for marker development, Primer3 (Untergasser et al. in C. canephora has been previously reported by Ogutu 2012) was used. The designed primers were set to have et al. (2016) using a single motif-finding tool for use in the following properties: (a) the resulting amplicon must Kenyan C. canephora. This study aimed to: (1) utilize be 100–500 bases, (b) primer length must be between 17 the sequenced genome of C. canephora to mine SSR loci and 25 bases with an optimal length of twenty bases, (c) using three SSR-mining tools, (2) design primers for the primer melting temperature must be between 53 and 60 loci, (3) use the annotation information of the reference °C, with an optimal melting temperature of 55 °C, (d) genome to guide the selection of SSR loci that are likely primer G-C content must be between 20 and 80% with to be related to genes contributing to aroma, and (4) an optimal G-C content of 50%, and (e) a primer must characterize the designed SSR primers using Philippine not have a homopolymer stretch longer than three bases. coffee grown varieties. Since very little information is The output of Primer3 was collated into a tab-separated available in the literature regarding the aroma of Philippine matrix with information on the chromosome number, coffee, this study will provide baseline information on the primer sequence, melting temperature, G-C content, and estimated product length.
268 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
Filtering of TPS-linked Primer Pairs RESULTS AND DISCUSSION The output of Primer3 was then filtered to collect primer pairs that hit or has at least one base-pair overlap with The study reports the genome-wide analysis of SSR motifs exons as indicated in the Generic File Format (GFF3) in C. canephora and primer design was guided with the annotation file of the C. canephora genome. Primers were use of gene annotations for aroma. After dereplication of filtered according to the annotations by Denoeud et al. results from the three SSR-mining tools MISA, MREPS, (2014). Primers with hits for TPS genes were classified for and SciRoKo, a total of 2,640,056 SSR loci were mined the aroma trait. The output tab-separated matrix preserved from the C. canephora reference genome. Among these, the information from the original output from Primer3. 1,880,309 (71.22%) were found to be ambiguous and The primers were synthesized by a commercial company. 759,747 (28.78%) were perfect. These results were contingent on the search criteria used and may not reflect the actual distribution of SSRs in the Coffea canephora Plant Material and DNA Extraction reference genome. However, the use of the three tools Young leaf samples from four Philippine grown coffee with differing search algorithms aimed to ensure that as varieties (Arabica, Robusta, Liberica, and Excelsa) were many SSR loci as possible were included. As reviewed by used in this study. The NSIC-registered Coffea arabica Grover et al. (2012), MISA – with a dictionary approach – (Arabica) varieties – Red Bourbon, Yellow Bourbon, uses the input repeat motif as a pattern and recognizes the and Caturra – were collected from the Bureau of Plant input pattern across a string of text – the genome. MREPS Industry in Baguio City, Benguet; Coffea canephora uses sequence-alignment with a heuristic approach (Robusta) leaf samples were collected from the National to facilitate the relatively time-consuming algorithm Coffee Research, Development and Extension Center at inherent in sequence-alignment. SciRoKo uses a sliding- the Cavite State University in Indang, Cavite; C. liberica window approach wherein a repeat motif with length i var. liberica (Liberica) and C. liberica var. dewevrei is increased until it meets the minimum score, either for (Excelsa) leaf samples were collected from a coffee farm a minimum repeat length or number of repeats, before in Barangay Tipakan, Lipa, Batangas. Three replicates for being designated as an SSR. The optimal length of twenty each variety were processed for DNA extraction using bases was selected in Primer3 for its efficiency in marker DNeasy Plant Mini Kit (Qiagen). The concentration development (Temnykh et al. 2001). and purity of the DNA samples were determined using Nanodrop (Thermo Fisher). The summary of genome-wide SSR search results is shown graphically in Figure 1. The distribution of perfect SSRs per motif type is shown in Figure 2. In summary, Polymerase Chain Reaction (PCR) and the most abundant perfect SSR motif was tetranucleotide Electrophoresis repeats (369,366; 48.62%) – followed by pentanucleotide A total of 200 SSR primers that are linked to TPSs were (126,493; 16.65%), mononucleotide (96,237, 12.67%), screened using PCR (Table 1). The PCR mix contained hexanucleotide (66,503; 8.75%), trinucleotide (53,135, 10 µL of the following: 1.0 µL 10x PCR buffer, 1.0 µL 6.99%), and dinucleotide repeats being the least abundant Q buffer, 0.4 µL 25 mM MgCl2, 0.5µL 10 µM primer, 0.2 µL 2.5mM dNTPs, 0.05 µL 5U/µL Taq Polymerase (Qiagen), and 0.5 µL 20ng DNA. The following PCR conditions were used: initial denaturation at 94 ºC for 10 min, 35 cycles of denaturation at 94 ºC for 30 s, annealing at 50 ºC for 30 s, and extension at 72 ºC for 1 min and a final extension at 72 ºC for 7 min (Teressa et al. 2010). The amplicons were run in 1% agarose gels for initial screening. Since the expected band sizes were around 100–500 bp, the amplified PCR products were further run in 29:1 polyacrylamide gels for better resolution. A 25-bp ladder (Bioline) was used as molecular weight marker.
Data Analysis The SSR primers were characterized based on their ability to amplify all the samples and based on the size of the amplicons. The number and sizes of alleles were recorded. Expected heterozygosity was computed by subtracting 1 Figure 1. Summary of SSR loci search indicating the distribution of from the square of allele frequency. motifs between ambiguous and perfect SSRs.
269 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
Filtering according to genes was performed last to select primers likely to be related to the aroma. There were 317 primer pairs for aroma. Genes for aroma, specifically TPS genes, have been studied and annotated (Denoeud et al. 2014). TPSs have also been discovered in C. arabica flowers and fruits using transcriptome data and qPCR (Del Terra et al. 2013, Ivamoto et al. 2017). The discovery of other genes involved in fruit development and production of compounds will have implications in understanding beverage desirability and taste. Of the SSR loci that were mined, the first 200 were selected for screening. Of the 200 that were screened, 44 were amplified for all 18 sample specimens. Of these, 33 were polymorphic when subjected to PAGE. Six of these turned out to have bands that were ambiguous and too many to count. The remaining 27 were scored and characterized for subsequent analysis (Table 1). The number of alleles ranged from 2 to 8 while the expected heterozygosity ranged from 0.18 to 0.85, which is an Figure 2. Motif distribution of 759,747 perfect SSRs from the C. canephora genome. indication of how polymorphic these markers are. There were 26 bands from 17 loci that could differentiate (47,193, 6.21%). The tetranucleotide repeats being the among varieties (Table 2). On the other hand, there most abundant motif is in concordance with the report were 15 bands that were unique to C. arabica (Arabica of Ogutu et al. (2016). The use of genomic SSRs is variety) – three that were unique to C. canephora (Robusta preferred overexpressed sequence tag SSRs because of variety), three that were unique to C. liberica (Liberica and the information they can provide for genotyping and Excelsa varieties), and five that were shared by C. arabica diversity analyses. and C. canephora. These bands show potential use for
Table 1. List of polymorphic loci linked to aroma. SSR Motif Gene Primer sequences Number Size range Expected marker of alleles heterozygosity SSR 11 (AAAC)2 Cc00_g06390 (-)-germacrene D aagtatccaacagggcacgg 2 325–375 0.5 synthase agcccaaatattgcctcgct SSR 12 (GAAAA)2 Cc00_g06390 (-)-germacrene D acttcagcgcttcctccaaa 2 350–400 0.48 synthase tgatggatggagagcacacg SSR 13 (AAAAG)2 Cc00_g06390 (-)-germacrene D caagacgtcggatggtgtca 2 125–300 0.38 synthase ccgccaattgtcatccaagc SSR 22 (AAGATG)2 Cc00_g06420 (-)-germacrene D acagccaaggcatggaaaga 2 185–300 0.18 synthase gtcgggacaggatcaacgag SSR 23 (AAGATG)2 Cc00_g06420 (-)-germacrene D agacagccaaggcatggaaa 2 185–300 0.46 synthase atgtcgggacaggatcaacg SSR 24 (AAGATG)2 Cc00_g06420 (-)-germacrene D agacagccaaggcatggaaa 2 185–250 0.48 synthase gggacaggatcaacgagcat SSR 27 (TTCA)2 Cc00_g13600 (E,E)-alpha-farnesene agagctcaaccaaggcttcc 3 135–400 0.61 synthase ttccaactccagatcaccgc SSR 34 (CTAT)2 Cc00_g16490 R-linalool synthase, accagtccagtttccacagc 8 160–500 0.85 chloroplastic gggacatcaagaacaggcca SSR 35 (AAGC)2 Cc00_g16490 R-linalool synthase, agctggctcttgaattggct 3 300–400 0.65 chloroplastic ccatgtaggctcctgctgtt SSR 36 (AAGC)2 Cc00_g16490 R-linalool synthase, agctggctcttgaattggct 4 100–550 0.64 chloroplastic gcggtccctaaatcatccca SSR 47 (TAAT)2 Cc00_g17280 Putative Ent-copalyl aaacctctacgcgttgctca 3 500–600 0.65 diphosphate synthase, chloroplastic gtgcaatccatgctgtgtcg
270 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
Table 1 continuation . . .
SSR 48 (TAAT)2 Cc00_g17280 Putative Ent-copalyl acctctacgcgttgctcaaa 4 450–700 0.68 diphosphate synthase, chloroplastic gtgcaatccatgctgtgtcg SSR 63 (TTTCA)2 Cc01_g19400 Putative Ent-copalyl cagtgctgccttcttccaga 3 300–450 0.63 diphosphate synthase, chloroplastic atgaggatccctgccctgat SSR 64 (TTTCA)2 Cc01_g19400 Putative Ent-copalyl cagtgctgccttcttccaga 4 150–250 0.73 diphosphate synthase, chloroplastic gtagcacgctttccagtcct SSR 65 (TTTCA)2 Cc01_g19400 Putative Ent-copalyl cagtgctgccttcttccaga 3 200–250 0.63 diphosphate synthase, chloroplastic tcttcggtgtagcacgcttt SSR 68 (AT)9; AT(9.5); Cc01_g19400 Putative Ent-copalyl ctaggctagacaccacgcaa 6 300–750 0.79 (CCCA)2 diphosphate synthase, chloroplastic aatatggcggcgaagacgat SSR 80 (GGTA)2 Cc01_g19400 Putative Ent-copalyl gctgccttaggagcctgaaa 2 500–1000 0.5 diphosphate synthase, chloroplastic atcgtctcaaactgctgcca SSR 81 (GGTA)2 Cc01_g19400 Putative Ent-copalyl gctgccttaggagcctgaaa 3 300–450 0.6 diphosphate synthase, chloroplastic gaggtaaatagacgccgcca SSR 82 (GGTA)2 Cc01_g19400 Putative Ent-copalyl gctgccttaggagcctgaaa 3 275–450 0.64 diphosphate synthase, chloroplastic ggtaaatagacgccgccaga SSR 88 (TTTCA)2 Cc01_g19400 Putative Ent-copalyl tcagtgctgccttcttccag 3 200–300 0.63 diphosphate synthase, chloroplastic tcttcggtgtagcacgcttt SSR 92 (GAAAAA)2; Cc01_g19400 Putative Ent-copalyl tgagacgcatgagctgttga 2 400–500 0.38 GAAAAA(2.5) diphosphate synthase, chloroplastic atcagctgtctttggacgca SSR 95 (GAAAAA)2; Cc01_g19400 Putative Ent-copalyl tgcgcactgtaagttctgct 8 160–600 0.84 GAAAAA(2.5) diphosphate synthase, chloroplastic caaggattgctcaggacggt SSR 96 (GAAAAA)2; Cc01_g19400 Putative Ent-copalyl tgcgcactgtaagttctgct 6 250–600 0.8 GAAAAA(2.5) diphosphate synthase, chloroplastic gacggtacttggaacgctga SSR (AT)9; AT(9.5); Cc01_g19400 Putative Ent-copalyl ttaccagcgaaagacccgac 7 115–700 0.77 102 (CCCA)2 diphosphate synthase, chloroplastic aatatggcggcgaagacgat SSR (AAAG)2 Cc02_g12800 Putative (E,E)- aattggcaaggcatggaaga 2 350–500 0.44 140 geranyllinalool synthase atttccgctcgttgggatgt SSR (ATGGCC)2 Cc10_g12360 Myrcene synthase, tgcagtgaatgttgccagga 2 115–350 0.43 193 chloroplastic tgggctcaaagagcagtgac SSR (CAGA)2 Cc10_g12360 Myrcene synthase, tttggaggcaaggtggttca 3 270–550 0.48 199 chloroplastic cagctaggcctgtactgctc
Table 2. List of loci that distinguishes among varieties. SSR_65 250bp Arabica SSR marker Variety SSR_68 700bp Arabica SSR_13 125bp Excelsa, Liberica SSR_68 750bp Arabica SSR_27 135bp Excelsa, Liberica SSR_81 300bp Arabica, Robusta SSR_34 185bp Arabica SSR_82 350bp Arabica SSR_34 240bp Arabica SSR_88 250bp Arabica SSR_34 450bp Arabica SSR_88 300bp Arabica SSR_34 475bp Arabica SSR_92 500bp Excelsa, Liberica SSR_35 350bp Arabica, Robusta SSR_95 160bp Robusta SSR_35 400bp Arabica, Robusta SSR_129 300bp Arabica, Robusta SSR_36 550bp Robusta SSR_140 500bp Arabica SSR_47 550bp Arabica, Robusta SSR_48 450bp Robusta species identification. However, the Liberica and Excelsa SSR_48 600bp Arabica varieties – which belong to the same species – could not be SSR_63 400bp Arabica distinguished by any band among the loci examined. This SSR_63 450bp Arabica may imply that differences exist in the aroma-linked genes found in C. arabica and C. canephora that may be absent or SSR_65 225bp Arabica different in the C. liberica varieties. Among the Philippine
271 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee cultivated varieties, Arabica has been priced for its superior L.) using molecular markers. Euphytica 118: 53–65. taste, rich aroma, and low caffeine content. On the other ANTHONY F, COMBES MC, ASTORGA C, BERTRAND hand, Robusta has a more inferior taste but is resistant to B, GRAZIOSI G, LASHERMES P. 2002. The origin many pests and diseases. Liberica or “kapeng barako” has of cultivated Coffea arabica L. varieties revealed by a very strong taste and flavor but is also resistant to many AFLP and SSR markers. Theor Appl Genet 104(5): pests and diseases compared to Dewevrei or “kapeng 894–900. excelsa,” which has a fruity taste and aroma (Pohlan and Janssens 2010). Terpenes are also stored in glycosylated and BUTT MS, SULTAN MT. 2011. Coffee and its oxidized forms that make it more stable and less volatile. consumption: benefits and risks. Crit Rev Food Sci Hydrolysis of these compounds would lead to the release of Nutr 51(4): 363–373. terpene compounds contributing to fruit aroma (Yazaki et CHEONG MW, TONG KH, ONG JJM, LIU SQ, al. 2017). Glycosyltransferase activity is also worth looking CURRAN P, YU B. 2013. Volatile composition and into in future studies in order to monitor as to when these antioxidant capacity of Arabica coffee. Food Res Int terpenes are synthesized and released. 51(1): 388–396. This study is the first to characterize TPS-linked SSR DEL TERRA L, LONZARICH V, ASQUINI E, NAVARINI markers in Philippine grown coffee varieties. Since L, GRAZIOSI G, LIVERANI FS, PALLAVICINI A. very limited data is available in the literature regarding 2013. Functional characterization of three Coffea the characterization of Philippine coffee aroma, this arabica L. monoterpene synthases: Insights into the study provides baseline genetic information regarding enzymatic machinery of coffee aroma. Phytochemistry polymorphisms in the TPSs of the different coffee 89: 6–14. varieties. These markers may be used to indirectly differentiate the terpene profile of the coffee varieties DENOEUD F, CARRETERO-PAULET L, DEREEPER and to discriminate between species. The potential of A, DROC G, GUYOT R, PIETRELLA M, ZHENG these markers for use in studying important traits in C, ALBERTI A, ANTHONY F, APREA G, AURY coffee such as aroma can be further explored. The use of JM, BENTO P, BERNARD M, BOCS S, CAMPA these markers also provides a cheap and quick method of C, CENCI A, COMBES MC, CROUZILLAT D, DA indirect aroma profiling. SILVA C, DADDIEGO L, DE BELLIS F, DUSSERT S, GARSMEUR O, GAYRAUD T, GUIGNON V, JAHN K, JAMILLOUX V, JOËT T, LABADIE K, LAN T, LECLERCQ J, LEPELLEY M, LEROY T, ACKNOWLEDGEMENTS LI L-T, LIBRADO P, LOPEZ L, MUÑOZ A, NOEL B, PALLAVICINI A, PERROTTA G, PONCET The authors would like to thank the following: Institute V, POT D, PRIYONO RIGOREAU M, ROUARD of Biology, College of Science, UP Diliman and the M, ROZAS J, TRANCHANT-DUBREUIL C, Core Facility for Bioinformatics, PGC for the use of VANBUREN R, ZHANG Q, ANDRADE A.C, their facilities; Department of Science and Technology – ARGOUT X, BERTRAND B, DE KOCHKO A, Philippine Council for Agriculture, Aquatic and Natural GRAZIOSI G, HENRY R.J, JAYARAMA MING R, Resources Research and Development for the research NAGAI C, ROUNSLEY S, SANKOFF D, GIULIANO funding; Bureau of Plant Industry in Baguio City, Benguet, G, ALBERT VA, WINCKER P, LASHERMES P. the National Coffee Research Development and Extension 2014. The coffee genome provides insight into the Center of the Cavite State University in Indang, Cavite convergent evolution of caffeine biosynthesis. Science – particularly Dr. Ruel M. Mojica and Ed Silva of Katy’s 345: 1181–1184. Farm in Lipa, Batangas – for providing the leaf samples. DEREEPER A, BOCS S, ROUARD M, GUIGNON V, RAVEL S, TRANCHANT-DUBREUIL C, PONCET V, GARSMEUR O, LASHERMES P, DROC G. 2015. REFERENCES The coffee genome hub: a resource for coffee genomes. Nucleic Acids Res 43(D1): D1028–D1035. AGRESTI PDM, FRANCA AS, OLIVEIRA LS, AUGUSTI R. 2008. Discrimination between defective GELETA M, HERRERA I, MONZON A, BRYNGELSSON and non-defective Brazilian coffee beans by their T. 2012. Genetic diversity of arabica coffee (Coffea volatile profile. Food Chem 106(2): 787–796. arabica L.) in Nicaragua estimated by simple sequence repeat (SSR) markers. Sci World J 2012: 1–11. ANTHONY F, BERTRAND B, QUIROS O, WILCHES A, LASHERMES P, BERTHAUD J, CHARRIER A. GROVER A, AISHWARYA V, SHARMA PC. 2012. 2001. Genetic diversity of wild coffee (Coffea arabica Searching microsatellites in DNA sequences:
272 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
Approaches used and tools developed. Physiol Mol TEMNYKH S, DECLERCK G, LUKASHOVA A, Biol Plants 18: 11–19. LIPOVICH L, CARTINHOUR S, MCCOUCH S. 2001. Computational and experimental analysis of IVAMOTO ST, JÚNIOR OR, DOMINGUES DS, DOS microsatellites in rice (Oryza sativa L.): Frequency, SANTOS TB, DE OLIVEIRA FF, POT D, LEROY length variation, transposon associations, and genetic T, VIEIRA LG, CARAZZOLLE MF, PEREIRA GA, marker potential. Genome Res 11(8): 1441–1452. PEREIRA LF. 2017. Transcriptome analysis of leaves, flowers and fruits perisperm of Coffea arabica L. TERESSA A, CROUZILLAT D, PETIARD V, BROUHAN reveals the differential expression of genes involved P. 2010. Genetic diversity of Arabica coffee (Coffea in raffinose biosynthesis. PLOS One 12(1): e0169595. arabica L.) collections. EJAST 1(1): 63–79. KOFLER R, SCHLÖTTERER C, LELLEY T. 2007. THIEL T, MICHALEK W, VARSHNEY R, GRANER A. SciRoKo: A new tool for whole genome microsatellite 2003. Exploiting EST databases for the development search and investigation. Bioinformatics 23(13): and characterization of gene-derived SSR-markers 1683–1685. in barley (Hordeum vulgare L.). Theor Appl Genet 106(3): 411–422. KOLPAKOV R, BANA G, KUCHEROV G. 2003. mreps: Efficient and flexible detection of tandem repeats in TORNINCASA P, FURLAN M, PALLAVICINI A, DNA. Nucleic Acids Research (13): 3672–3678. GRAZIOSI G. 2010. Coffee species and varietal identification. EUT Edizioni Università di Trieste. LASHERMES P, COMBES MC, ROBERT J, TROUSLOT R, D’HONT A, ANTHONY F, CHARRIER A. 1999. UNTERGASSER A, CUTCUTACHE I, KORESSAAR T, Molecular characterization and origin of the Coffea YE J, FAIRCLOTH BC, REMM M, ROZEN SG. 2012. arabica L. genome. Mol Gen Genet 261(2): 25266. Primer3—New capabilities and interfaces. Nucleic Acids Res 40(15): e115. MATHIEU F, MALOSSE C, FRÉROT B. 1998. Identification of the volatile components released by VIEIRA ESN, VONPINHO EVD, CARVALHO MGG, fresh coffee berries at different stages of ripeness. J ESSELINK DG, VOSMAN B. 2010. Development of Agric Food Chem 46(3): 1106–1110. microsatellite markers for identifying Brazilian Coffea arabica varieties. Genet Mol Biol 33(3): 507–514. N’DIAYE A, PONCET V, LOUARN J, HAMON S, NOIROT M. 2005. Genetic differentiation between WANG ML, BARKLEY, NA, JENKINS TM. 2009. Coffea liberica var. liberica and C. liberica var. Microsatellite Markers in Plants and Insects, Part I: dewevrei and comparison with C. canephora. Plant Applications of Biotechnology. Genes, Genomes and Syst Evol 253(1–4): 95–104. Genomics 3(1): 1. OGUTU C, FANG T, YAN L, WANG L, HUANG L, YAZAKI K, ARIMURA G, OHNISHI T. 2017. WANG X, MA B, DENG X, OWITI A, NYENDE ‘Hidden’ terpenoids in plants: Their biosynthesis, A, HAN Y. 2016. Characterization and utilization of localization and ecological roles. Plant Cell Physiol microsatellites in the Coffea canephora genome to 58(10): 1615–1621. assess genetic association between wild species in Kenya and cultivated coffee. Tree Genet Genomes 12(3): 54. PEREIRA GS, PADILHA L, PINHO EV, TEIXEIRA RD, CARVALHO CH, MALUF MP, CARVALHO BL. 2011. Microsatellite markers in analysis of resistance to coffee leaf miner in Arabica coffee. Pesq Agropec Bras 46(12): 1650–1656. POHLAN HAJ, JANSSENS MJJ. 2010. Growth and Production of Coffee. In: Soils, Plant Growth and Crop Production. Verheye WH ed. Oxford: Eolss Publishers. 30p. SCHOLZ MBDS, PAGIATTO NF, KITZBERGER CS, PEREIRA LFP, DAVRIEUX F, CHARMETANT P, LEROY T. 2014. Validation of near-infrared spectroscopy for the quantification of cafestol and kahweol in green coffee. Food Res Int 61: 176–182.
273 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
APPENDIX
Table I. List of aroma-linked SSR markers screened.
SSR marker Location Motif Gene Primer sequences Expected Amplifica- AGE profile PAGE profile Number of Remarks size tion rate alleles
SSR 001 chr0 (TACC)2 Cc00_g06380 Vetispiradiene aaggcagcctacactttggt 484 94% synthase 1 agtgaaacttgtcctcgcgt
SSR 002 chr0 (TAAT)2; (TAT)3 Cc00_g06380 Vetispiradiene acatggtaggcaacatagca 404 89% synthase 1 agaaacagctcaaaccctgtca
SSR 003 chr0 (AAAT)2 Cc00_g06380 Vetispiradiene acgacttggcatctcgtatca 482 100% Monomorphic Monomorphic 1 synthase 1 gctgctcaagggcatgtttc
SSR 004 chr0 (GGAA)2 Cc00_g06380 Vetispiradiene acttccattgaggcaccagc 483 89% synthase 1 gtcccttgcgtatggaacct
SSR 005 chr0 (TTTCC)2 Cc00_g06380 Vetispiradiene agcatcggatagcagcacag 177 83% synthase 1 gcatgtagcccaccatgcta
SSR 006 chr0 (TACC)2 Cc00_g06380 Vetispiradiene aggcagcctacactttggtt 483 78% synthase 1 agtgaaacttgtcctcgcgt
SSR 007 chr0 (TTTCC)2 Cc00_g06380 Vetispiradiene cagcacagaggatcccaact 165 94% synthase 1 gcatgtagcccaccatgcta
SSR 008 chr0 (GGAA)2 Cc00_g06380 Vetispiradiene cagtgggcgggtctaagatt 459 83% synthase 1 gtcccttgcgtatggaacct
SSR 009 chr0 (GGAA)2 Cc00_g06380 Vetispiradiene cattgaggcaccagctctcc 478 83% synthase 1 gtcccttgcgtatggaacct
SSR 010 chr0 (AAAC)2 Cc00_g06390 (-)-germacrene aagtatccaacagggcacgg 419 89% D synthase aagagaccgactggtggagt
SSR 011 chr0 (AAAC)2 Cc00_g06390 (-)-germacrene aagtatccaacagggcacgg 369 100% Monomorphic Polymorphic 2 Scored for D synthase agcccaaatattgcctcgct subsequent analysis
SSR 012 chr0 (GAAAA)2 Cc00_g06390 (-)-germacrene acttcagcgcttcctccaaa 344 100% Monomorphic Polymorphic 2 Scored for D synthase tgatggatggagagcacacg subsequent analysis
SSR 013 chr0 (AAAAG)2 Cc00_g06390 (-)-germacrene caagacgtcggatggtgtca 281 100% Monomorphic Polymorphic 2 Scored for D synthase ccgccaattgtcatccaagc subsequent analysis
SSR 014 chr0 (GAAAA)2 Cc00_g06390 (-)-germacrene ccatgcactccgaagtttgc 315 78% D synthase tgatggatggagagcacacg
SSR 015 chr0 (AAAAG)2 Cc00_g06390 (-)-germacrene cgccctcttcttccgagaaa 182 100% Monomorphic Monomorphic 1 D synthase ccgccaattgtcatccaagc
SSR 016 chr0 (AAAC)2 Cc00_g06390 (-)-germacrene cttgcccaactcttcctcgt 398 100% Monomorphic Monomorphic 1 D synthase agcccaaatattgcctcgct
SSR 017 chr0 (GAAAA)2 Cc00_g06390 (-)-germacrene ttgccttgctgcaatccttg 463 33% D synthase tgatggatggagagcacacg
SSR 018 chr0 (TTTG)2 Cc00_g06420 (-)-germacrene aagagaccgactggtggagt 368 78% D synthase tccaacaaggcacggtaaca
SSR 019 chr0 (TTTG)2 Cc00_g06420 (-)-germacrene aagagaccgactggtggagt 307 100% Monomorphic Monomorphic 1 D synthase tccacctgttatcagtgccg
SSR 020 chr0 (AAGATG)2 Cc00_g06420 (-)-germacrene acagccaaggcatggaaaga 193 100% Monomorphic Monomorphic 1 D synthase atgtcgggacaggatcaacg
SSR 021 chr0 (AAGATG)2 Cc00_g06420 (-)-germacrene acagccaaggcatggaaaga 188 94% D synthase gggacaggatcaacgagcat
SSR 022 chr0 (AAGATG)2 Cc00_g06420 (-)-germacrene acagccaaggcatggaaaga 191 100% Monomorphic Polymorphic 2 Scored for D synthase gtcgggacaggatcaacgag subsequent analysis
SSR 023 chr0 (AAGATG)2 Cc00_g06420 (-)-germacrene agacagccaaggcatggaaa 195 100% Monomorphic Polymorphic 2 Scored for D synthase atgtcgggacaggatcaacg subsequent analysis
SSR 024 chr0 (AAGATG)2 Cc00_g06420 (-)-germacrene agacagccaaggcatggaaa 190 100% Monomorphic Polymorphic 2 Scored for D synthase gggacaggatcaacgagcat subsequent analysis
SSR 025 chr0 (CTTTT)2 Cc00_g06420 (-)-germacrene tgatggatggagagcacacg 486 89% D synthase ttgccttgctgcaatccttg
SSR 026 chr0 (TTCA)2 Cc00_g13600 (E,E)-alpha- agagctcaaccaaggcttcc 100 100% Monomorphic Monomorphic 1 farnesene synthase gggatggccacatgttcaga
SSR 027 chr0 (TTCA)2 Cc00_g13600 (E,E)-alpha- agagctcaaccaaggcttcc 225 100% Polymorphic Polymorphic 3 Scored for farnesene synthase ttccaactccagatcaccgc subsequent analysis
274 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
SSR 028 chr0 (TTCA)2 Cc00_g13600 (E,E)-alpha- tccagtgcaacggaagactc 232 100% Monomorphic Monomorphic 1 farnesene synthase gggatggccacatgttcaga
SSR 029 chr0 (TTCA)2 Cc00_g13600 (E,E)-alpha- tccagtgcaacggaagactc 357 100% Monomorphic Monomorphic 1 farnesene synthase ttccaactccagatcaccgc
SSR 030 chr0 (TTCA)2 Cc00_g13600 (E,E)-alpha- tccagtgcaacggaagactc 234 100% Monomorphic Monomorphic 1 farnesene synthase ttgggatggccacatgttca
SSR 031 chr0 (TTTGA)2 Cc00_g16490 R-linalool tgggatgatttagggaccgc 479 83% synthase, chloroplastic tatgcttgatgcaaggtcgc
SSR 032 chr0 (TTGA)2 Cc00_g16490 R-linalool aaaggcaactggtttgtggc 490 94% synthase, chloroplastic aagctaatcccagtcgctgc
SSR 033 chr0 (TTGA)2 Cc00_g16490 R-linalool aatatttgcgccagccttcg 359 83% synthase, chloroplastic aagctaatcccagtcgctgc
SSR 034 chr0 (CTAT)2 Cc00_g16490 R-linalool accagtccagtttccacagc 239 100% Monomorphic Polymorphic 8 Scored for synthase, chloroplastic gggacatcaagaacaggcca subsequent analysis
SSR 035 chr0 (AAGC)2 Cc00_g16490 R-linalool agctggctcttgaattggct 313 100% Monomorphic Polymorphic 3 Scored for synthase, chloroplastic ccatgtaggctcctgctgtt subsequent analysis
SSR 036 chr0 (AAGC)2 Cc00_g16490 R-linalool agctggctcttgaattggct 446 100% Polymorphic Polymorphic 3 Scored for synthase, chloroplastic gcggtccctaaatcatccca subsequent analysis
SSR 037 chr0 (AAGC)2 Cc00_g16490 R-linalool agctggctcttgaattggct 447 89% synthase, chloroplastic tgcggtccctaaatcatccc
SSR 038 chr0 (TTGA)2 Cc00_g16490 R-linalool atgtgcatgccaacaccaac 432 94% synthase, chloroplastic aagctaatcccagtcgctgc
SSR 039 chr0 (AAAAT)2 Cc00_g16500 R-linalool aaggctgcattcaacatggc 392 89% synthase, chloroplastic acctgctgtaatgtcaccaat
SSR 040 chr0 (AAAAT)2 Cc00_g16500 R-linalool aaggctgcattcaacatggc 392 94% synthase, chloroplastic acctgctgtaatgtcaccaa
SSR 041 chr0 (TTGA)2 Cc00_g16500 R-linalool acgtgcaacgcctagtatcc 368 94% synthase, chloroplastic tggtaagctaatcccagtcgc
SSR 042 chr0 (AAGC)2 Cc00_g16500 R-linalool agctggctcttgaattggct 315 94% synthase, chloroplastic gccatgtaggttcctgctgt
SSR 043 chr0 (AAGC)2 Cc00_g16500 R-linalool agctggctcttgaattggct 447 94% synthase, chloroplastic gcggtccctaaatcatccca
SSR 044 chr0 (CCAAG)2 Cc00_g16500 R-linalool agggaccgcaaaggtatgtt 480 83% synthase, chloroplastic tatgcttgatgcaaggtcgc
SSR 045 chr0 (TTGA)2 Cc00_g16500 R-linalool atatttgcgccagcctttgg 477 11% synthase, chloroplastic aagctaatcccagtcgctgc
SSR 046 chr0 (AT)4 Cc00_g16500 R-linalool ttgggaggtttagatggtactgc 476 6% synthase, chloroplastic aattccatggcctccagcaa
SSR 047 chr0 (TAAT)2 Cc00_g17280 Putative Ent- aaacctctacgcgttgctca 464 100% Monomorphic Polymorphic 3 Scored for copalyl diphosphate synthase, gtgcaatccatgctgtgtcg subsequent chloroplastic analysis
SSR 048 chr0 (TAAT)2 Cc00_g17280 Putative Ent- acctctacgcgttgctcaaa 462 100% Monomorphic Polymorphic 4 Scored for copalyl diphosphate synthase, gtgcaatccatgctgtgtcg subsequent chloroplastic analysis
SSR 049 chr0 (CAAC)2 Cc00_g17280 Putative Ent- agcatacgacacagcatgga 225 83% copalyl diphosphate synthase, tggtgcgtaccttcagcaat chloroplastic
SSR 050 chr0 (ACAT)2 Cc00_g17280 Putative Ent- agccatgcagtaatgggtcc 254 67% copalyl diphosphate synthase, aaccctcgatgagacgtgtg chloroplastic
SSR 051 chr0 (ACAT)2 Cc00_g17280 Putative Ent- agccatgcagtaatgggtcc 252 67% copalyl diphosphate synthase, ccctcgatgagacgtgtgac chloroplastic
SSR 052 chr0 (ACAT)2 Cc00_g17280 Putative Ent- agccatgcagtaatgggtcc 206 33% copalyl diphosphate synthase, tctaccgagccaaaggagga chloroplastic
SSR 053 chr0 (TGAA)2 Cc00_g17280 Putative Ent- agtggatcggctgaaacgac 372 83% copalyl diphosphate synthase, cctcaaactcaccagggctc chloroplastic
SSR 054 chr0 (AAGA)2 Cc00_g17280 Putative Ent- ttgcgaggcctagttctgct 352 11% copalyl diphosphate synthase, acctcttacaggaaagctcca chloroplastic
275 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
SSR 055 chr1 (CAGGG)2 Cc01_g19400 Putative Ent- aaagcgtgctacaccgaaga 491 6% copalyl diphosphate synthase, acgatcgattcatcggcaca chloroplastic
SSR 056 chr1 (CAGGG)2 Cc01_g19400 Putative Ent- aaagcgtgctacaccgaaga 253 33% copalyl diphosphate synthase, tcagaagaaggcgcatgtgt chloroplastic
SSR 057 chr1 (TCAC)2 Cc01_g19400 Putative Ent- accgtcctgagcaatccttg 365 44% copalyl diphosphate synthase, ctaaccttgaccacaccgct chloroplastic
SSR 058 chr1 (TCAC)2 Cc01_g19400 Putative Ent- accgtcctgagcaatccttg 384 56% copalyl diphosphate synthase, gacttccaacgctcctcctc chloroplastic
SSR 059 chr1 (TCAC)2 Cc01_g19400 Putative Ent- accgtcctgagcaatccttg 366 56% copalyl diphosphate synthase, tctaaccttgaccacaccgc chloroplastic
SSR 060 chr1 (GGCAAA)2 Cc01_g19400 Putative Ent- acgagaacttcctggcatcg 281 56% copalyl diphosphate synthase, gctttcaggctcctaaggca chloroplastic
SSR 061 chr1 (CAGGG)2 Cc01_g19400 Putative Ent- aggactggaaagcgtgctac 499 61% copalyl diphosphate synthase, acgatcgattcatcggcaca chloroplastic
SSR 062 chr1 (CAGGG)2 Cc01_g19400 Putative Ent- aggactggaaagcgtgctac 261 50% copalyl diphosphate synthase, tcagaagaaggcgcatgtgt chloroplastic
SSR 063 chr1 (TTTCA)2 Cc01_g19400 Putative Ent- cagtgctgccttcttccaga 299 100% Polymorphic Polymorphic 3 Scored for copalyl diphosphate synthase, atgaggatccctgccctgat subsequent chloroplastic analysis
SSR 064 chr1 (TTTCA)2 Cc01_g19400 Putative Ent- cagtgctgccttcttccaga 204 100% Polymorphic Polymorphic 4 Scored for copalyl diphosphate synthase, gtagcacgctttccagtcct subsequent chloroplastic analysis
SSR 065 chr1 (TTTCA)2 Cc01_g19400 Putative Ent- cagtgctgccttcttccaga 212 100% Monomorphic Polymorphic 3 Scored for copalyl diphosphate synthase, tcttcggtgtagcacgcttt subsequent chloroplastic analysis
SSR 066 chr1 (GGCAAA)2 Cc01_g19400 Putative Ent- catcggcaagtacctcctcc 266 100% Monomorphic Monomorphic 1 copalyl diphosphate synthase, gctttcaggctcctaaggca chloroplastic
SSR 067 chr1 (GGCAAA)2 Cc01_g19400 Putative Ent- cgacgagaacttcctggcat 283 100% Monomorphic Monomorphic 1 copalyl diphosphate synthase, gctttcaggctcctaaggca chloroplastic
SSR 068 chr1 (AT)9; AT(9.5); Cc01_g19400 Putative Ent- ctaggctagacaccacgcaa 410 100% Monomorphic Polymorphic 5 Scored for (CCCA)2 copalyl diphosphate synthase, aatatggcggcgaagacgat subsequent chloroplastic analysis
SSR 069 chr1 (GGCAAA)2 Cc01_g19400 Putative Ent- cttcctggcatcggcaagta 274 83% copalyl diphosphate synthase, gctttcaggctcctaaggca chloroplastic
SSR 070 chr1 TA(8.5) Cc01_g19400 Putative Ent- cttgacaggagggaggagga 426 78% copalyl diphosphate synthase, agggtaggttgggagtgaca chloroplastic
SSR 071 chr1 TA(8.5) Cc01_g19400 Putative Ent- cttgacaggagggaggagga 472 89% copalyl diphosphate synthase, ggagcaagaccgggatcaat chloroplastic
SSR 072 chr1 (ATCA)2 Cc01_g19400 Putative Ent- gaatcaccgccatacgttgc 114 11% copalyl diphosphate synthase, acgtcgataatggcagaggc chloroplastic
SSR 073 chr1 (ATCA)2 Cc01_g19400 Putative Ent- gaatcaccgccatacgttgc 113 0% copalyl diphosphate synthase, cgtcgataatggcagaggca chloroplastic
SSR 074 chr1 (ATCA)2 Cc01_g19400 Putative Ent- gaatcaccgccatacgttgc 169 22% copalyl diphosphate synthase, gaatctgcacgctcgtaagc chloroplastic
SSR 075 chr1 (ATCA)2 Cc01_g19400 Putative Ent- gaatcaccgccatacgttgc 454 11% copalyl diphosphate synthase, tctcgtcgctaaatggcacc chloroplastic
SSR 076 chr1 (ATCA)2 Cc01_g19400 Putative Ent- gaatcaccgccatacgttgc 104 0% copalyl diphosphate synthase, tggcagaggcatgttcttga chloroplastic
SSR 077 chr1 (AT)9; AT(9.5); Cc01_g19400 Putative Ent- gatgagccttcctcagcagt 382 83% (CCCA)2 copalyl diphosphate synthase, aatatggcggcgaagacgat chloroplastic
276 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
SSR 078 chr1 (GGTA)2 Cc01_g19400 Putative Ent- gctgccttaggagcctgaaa 452 100% Polymorphic Polymorphic Too many copalyl diphosphate synthase, aaatagacgccgccagacat to count chloroplastic
SSR 079 chr1 (GGTA)2 Cc01_g19400 Putative Ent- gctgccttaggagcctgaaa 456 100% Polymorphic Polymorphic Too many copalyl diphosphate synthase, aggtaaatagacgccgccag to count chloroplastic
SSR 080 chr1 (GGTA)2 Cc01_g19400 Putative Ent- gctgccttaggagcctgaaa 434 100% Polymorphic - 2 Scored for copalyl diphosphate synthase, atcgtctcaaactgctgcca subsequent chloroplastic analysis
SSR 081 chr1 (GGTA)2 Cc01_g19400 Putative Ent- gctgccttaggagcctgaaa 457 100% Polymorphic - 3 Scored for copalyl diphosphate synthase, gaggtaaatagacgccgcca subsequent chloroplastic analysis
SSR 082 chr1 (GGTA)2 Cc01_g19400 Putative Ent- gctgccttaggagcctgaaa 455 100% Polymorphic - 3 Scored for copalyl diphosphate synthase, ggtaaatagacgccgccaga subsequent chloroplastic analysis
SSR 083 chr1 (GGCAAA)2 Cc01_g19400 Putative Ent- gtacctcgccaggcaaatct 362 94% copalyl diphosphate synthase, gctttcaggctcctaaggca chloroplastic
SSR 084 chr1 (CAGGG)2 Cc01_g19400 Putative Ent- gtgctacaccgaagacggaa 248 61% copalyl diphosphate synthase, tcagaagaaggcgcatgtgt chloroplastic
SSR 085 chr1 (TCAC)2 Cc01_g19400 Putative Ent- tcagcgttccaagtaccgtc 379 28% copalyl diphosphate synthase, ctaaccttgaccacaccgct chloroplastic
SSR 086 chr1 (TCAC)2 Cc01_g19400 Putative Ent- tcagcgttccaagtaccgtc 380 22% copalyl diphosphate synthase, tctaaccttgaccacaccgc chloroplastic
SSR 087 chr1 (TTTCA)2 Cc01_g19400 Putative Ent- tcagtgctgccttcttccag 205 0% copalyl diphosphate synthase, gtagcacgctttccagtcct chloroplastic
SSR 088 chr1 (TTTCA)2 Cc01_g19400 Putative Ent- tcagtgctgccttcttccag 213 100% Monomorphic Polymorphic 3 Scored for copalyl diphosphate synthase, tcttcggtgtagcacgcttt subsequent chloroplastic analysis
SSR 089 chr1 TA(8.5) Cc01_g19400 Putative Ent- tcttgacaggagggaggagg 473 94% copalyl diphosphate synthase, ggagcaagaccgggatcaat chloroplastic
SSR 090 chr1 TA(8.5) Cc01_g19400 Putative Ent- tgacaggagggaggaggaag 424 83% copalyl diphosphate synthase, agggtaggttgggagtgaca chloroplastic
SSR 091 chr1 TA(8.5) Cc01_g19400 Putative Ent- tgacaggagggaggaggaag 470 100% Polymorphic Polymorphic Too Many copalyl diphosphate synthase, ggagcaagaccgggatcaat to Count chloroplastic
SSR 092 chr1 (GAAAAA)2; Cc01_g19400 Putative Ent- tgagacgcatgagctgttga 338 100% Polymorphic - 2 Scored for GAAAAA(2.5) copalyl diphosphate synthase, atcagctgtctttggacgca subsequent chloroplastic analysis
SSR 093 chr1 (GAAAAA)2; Cc01_g19400 Putative Ent- tgagatggatgtccggagga 489 100% Polymorphic Polymorphic Too Many GAAAAA(2.5) copalyl diphosphate synthase, atcagctgtctttggacgca to Count chloroplastic
SSR 094 chr1 (GAAAAA)2; Cc01_g19400 Putative Ent- tgcgcactgtaagttctgct 257 89% GAAAAA(2.5) copalyl diphosphate synthase, atcagctgtctttggacgca chloroplastic
SSR 095 chr1 (GAAAAA)2; Cc01_g19400 Putative Ent- tgcgcactgtaagttctgct 291 100% Monomorphic Polymorphic 8 Scored for GAAAAA(2.5) copalyl diphosphate synthase, caaggattgctcaggacggt subsequent chloroplastic analysis
SSR 096 chr1 (GAAAAA)2; Cc01_g19400 Putative Ent- tgcgcactgtaagttctgct 277 100% Polymorphic Polymorphic 6 Scored for GAAAAA(2.5) copalyl diphosphate synthase, gacggtacttggaacgctga subsequent chloroplastic analysis
SSR 097 chr1 (TAC)3 Cc01_g19400 Putative Ent- tgctgtacgttcgcaagcta 282 83% copalyl diphosphate synthase, gagcttctactacaccgccc chloroplastic
SSR 098 chr1 (TAC)3 Cc01_g19400 Putative Ent- tgctgtacgttcgcaagcta 266 89% copalyl diphosphate synthase, gcccattgcaatccaggaac chloroplastic
SSR 099 chr1 (TAC)3 Cc01_g19400 Putative Ent- tgctgtacgttcgcaagcta 283 78% copalyl diphosphate synthase, ggagcttctactacaccgcc chloroplastic
SSR 100 chr1 (TAC)3 Cc01_g19400 Putative Ent- tgctgtacgttcgcaagcta 260 83% copalyl diphosphate synthase, tgcaatccaggaaccgtcaa chloroplastic
277 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
SSR 101 chr1 (TAC)3 Cc01_g19400 Putative Ent- tgctgtacgttcgcaagcta 261 50% copalyl diphosphate synthase, ttgcaatccaggaaccgtca chloroplastic
SSR 102 chr1 (AT)9; AT(9.5); Cc01_g19400 Putative Ent- ttaccagcgaaagacccgac 341 100% Polymorphic Polymorphic 6 Scored for (CCCA)2 copalyl diphosphate synthase, aatatggcggcgaagacgat subsequent chloroplastic analysis
SSR 103 chr1 (AT)9; AT(9.5); Cc01_g19400 Putative Ent- ttaccagcgaaagacccgac 333 72% (CCCA)2 copalyl diphosphate synthase, ggcgaagacgatgtctggat chloroplastic
SSR 104 chr1 (AT)9; AT(9.5); Cc01_g19400 Putative Ent- ttaccagcgaaagacccgac 416 61% (CCCA)2 copalyl diphosphate synthase, tgcaggtcggatacgctcta chloroplastic
SSR 105 chr2 (AAATG)2; Cc02_g11820 Putative (E,E)- accaatgcggttgagaggtt 422 72% (TATT)2 alpha-farnesene synthase accacttagcttccacgagc
SSR 106 chr2 (AAATG)2; Cc02_g11820 Putative (E,E)- accaatgcggttgagaggtt 421 50% (TATT)2 alpha-farnesene synthase ccacttagcttccacgagca
SSR 107 chr2 (AAATG)2 Cc02_g11820 Putative (E,E)- accaatgcggttgagaggtt 442 0% alpha-farnesene synthase tggcgtgtaacccttgttgt
SSR 108 chr2 (CAAG)2 Cc02_g11820 Putative (E,E)- agggaccgagtggttgaaag 384 83% alpha-farnesene synthase cttgctcgatttcagctgcc
SSR 109 chr2 (AAAT)2 Cc02_g11820 Putative (E,E)- agtcaatccaactctctcccA 429 33% alpha-farnesene synthase ttgtgggctcgacaaaggtt
SSR 110 chr2 (AAAT)2 Cc02_g11820 Putative (E,E)- cagtcaatccaactctctcccA 329 39% alpha-farnesene synthase tgcccatggttgttgaagga
SSR 111 chr2 (AAAT)2 Cc02_g11820 Putative (E,E)- cagtcaatccaactctctcccA 430 6% alpha-farnesene synthase ttgtgggctcgacaaaggtt
SSR 112 chr2 (AATA)3; Cc02_g11820 Putative (E,E)- tctggttcttgattgccatgc 446 6% AATA(3.8) alpha-farnesene synthase gtagctatggtgcaaccacct
SSR 113 chr2 (AATA)3; Cc02_g11820 Putative (E,E)- ttctccagatgaaccaatggc 414 17% AATA(3.8) alpha-farnesene synthase gcctaaagcagagtgcggta
SSR 114 chr2 (AAATG)2; Cc02_g11830 Putative (E,E)- accaatgcggttgagaggtt 422 50% (TATT)2 alpha-farnesene synthase accacttagcttccacgagc
SSR 115 chr2 (AAATG)2; Cc02_g11830 Putative (E,E)- accaatgcggttgagaggtt 421 28% (TATT)2 alpha-farnesene synthase ccacttagcttccacgagca
SSR 116 chr2 (AAATG)2 Cc02_g11830 Putative (E,E)- accaatgcggttgagaggtt 442 6% alpha-farnesene synthase tggcgtgtaacccttgttgt
SSR 117 chr2 (CAAG)2 Cc02_g11830 Putative (E,E)- agggaccgagtggttgaaag 384 6% alpha-farnesene synthase cttgctcgatttcagctgcc
SSR 118 chr2 (TTGAA)2 Cc02_g11830 Putative (E,E)- cgctaccgcactctgcttta 472 6% alpha-farnesene synthase ttgagggattcgacgaagga
SSR 119 chr2 (CAAG)2 Cc02_g11830 Putative (E,E)- gagggaccgagtggttgaaa 385 33% alpha-farnesene synthase cttgctcgatttcagctgcc
SSR 120 chr2 (TATT)2 Cc02_g11830 Putative (E,E)- ggcagctgaaatcgagcaag 217 0% alpha-farnesene synthase accacttagcttccacgagc
SSR 121 chr2 (AATA)3; Cc02_g11830 Putative (E,E)- ttgaagcgaaggcaggaact 479 72% AATA(3.8) alpha-farnesene synthase gtagctatggtgcaaccacct
SSR 122 chr2 (AATA)3; Cc02_g11830 Putative (E,E)- ttgaagcgaaggcaggaact 478 28% AATA(3.8) alpha-farnesene synthase tagctatggtgcaaccacct
SSR 123 chr2 (AATTA)2 Cc02_g11870 (3S,6E)- accacaaacgaggcaggaat 257 39% nerolidol synthase 1, tctggagcctgaacgaaacc chloroplastic
SSR 124 chr2 (CAGCT)2; Cc02_g11870 (3S,6E)- aggcatcgatcaccacttcc 473 56% (GAAA)2 nerolidol synthase 1, ggctactaaactccgcagca chloroplastic
SSR 125 chr2 AAATAC(2.7) Cc02_g11870 (3S,6E)- ccaccatttgggttgaagcaa 419 28% nerolidol synthase 1, atgttgacgtttggccctct chloroplastic
SSR 126 chr2 AAATAC(2.7) Cc02_g11870 (3S,6E)- ccaccatttgggttgaagca 419 33% nerolidol synthase 1, atgttgacgtttggccctct chloroplastic
SSR 127 chr2 (TA)4 Cc02_g11870 (3S,6E)- gaggacagttcctcgtggtg 298 61% nerolidol synthase 1, acatgcaactagagccggttt chloroplastic
SSR 128 chr2 (TA)4 Cc02_g11870 (3S,6E)- gaggacagttcctcgtggtg 259 33% nerolidol synthase 1, accaatcgttctagtggtccg chloroplastic
278 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
SSR 129 chr2 (TA)4 Cc02_g11870 (3S,6E)- gaggacagttcctcgtggtg 300 67% Monomorphic Monomorphic 1 nerolidol synthase 1, ctacatgcaactagagccggt chloroplastic
SSR 130 chr2 (AATTA)2 Cc02_g11870 (3S,6E)- tttgtgggcagatggcagat 415 6% nerolidol synthase 1, cacaagctagcccacttcca chloroplastic
SSR 131 chr2 (AATTA)2 Cc02_g11870 (3S,6E)- tttgtgggcagatggcagat 461 50% nerolidol synthase 1, tctggagcctgaacgaaacc chloroplastic
SSR 132 chr2 (GTAC)2 Cc02_g12790 Putative aaggcagcgtcaactcatgt 453 6% S-linalool synthase tctgaggcgacctcaaataca
SSR 133 chr2 (GTAC)2 Cc02_g12790 Putative aatccaaggcagcgtcaact 458 67% S-linalool synthase tctgaggcgacctcaaataca
SSR 134 chr2 (TCAG)2 Cc02_g12790 Putative acgcatcggcatcttgagaa 338 56% S-linalool synthase ctgattgttgcgaaggctgc
SSR 135 chr2 (TCAG)2 Cc02_g12790 Putative acgcatcggcatcttgagaa 336 83% S-linalool synthase gattgttgcgaaggctgcaa
SSR 136 chr2 (TCAG)2 Cc02_g12790 Putative acgcatcggcatcttgagaa 392 61% S-linalool synthase tgctatttcgctgtttcggc
SSR 137 chr2 (GCAA)2; Cc02_g12790 Putative acgcatcggcatcttgagaa 449 56% (TCAG)2 S-linalool synthase tggtccactgagtctggtct
SSR 138 chr2 (TCAG)2 Cc02_g12790 Putative acgcatcggcatcttgagaa 333 0% S-linalool synthase tgttgcgaaggctgcaattc
SSR 139 chr2 (GCAA)2 Cc02_g12790 Putative ttgcagccttcgcaacaatc 133 0% S-linalool synthase tggtccactgagtctggtct
SSR 140 chr2 (AAAG)2 Cc02_g12800 Putative (E,E)- aattggcaaggcatggaaga 331 100% Monomorphic Polymorphic 2 Scored for geranyllinalool synthase atttccgctcgttgggatgt subsequent analysis
SSR 141 chr2 (AGAA)2 Cc02_g12800 Putative (E,E)- agagtactacgcgcatcagc 168 0% geranyllinalool synthase cccttgtggattggaaaggc
SSR 142 chr2 (CAAGT)2 Cc02_g12800 Putative (E,E)- aggatgcctttccaatccaca 497 72% geranyllinalool synthase cgcgcttgtgacttatccac
SSR 143 chr2 (CAAGT)2 Cc02_g12800 Putative (E,E)- aggatgcctttccaatccaca 500 78% geranyllinalool synthase gagcgcgcttgtgacttatc
SSR 144 chr2 (AAAG)2 Cc02_g12800 Putative (E,E)- attggcaaggcatggaagaa 330 83% geranyllinalool synthase atttccgctcgttgggatgt
SSR 145 chr2 (AGAA)2 Cc02_g12800 Putative (E,E)- ccgactgccgaagcttgtaa 430 94% geranyllinalool synthase cccttgtggattggaaaggc
SSR 146 chr2 (AAAAAT)2; Cc02_g12800 Putative (E,E)- ccgctatgcatccctgaact 475 72% (ATTA)2 geranyllinalool synthase agacggtctcgcgctttaat
SSR 147 chr2 (AAAG)2 Cc02_g12800 Putative (E,E)- ttggcaaggcatggaagaat 329 94% geranyllinalool synthase atttccgctcgttgggatgt
SSR 148 chr2 (CTTCCT)2; Cc02_g20930 Myrcene actgatgctgtttgctccca 336 56% (CTTCCT)2 synthase, chloroplastic agaggataggcaagaggcca
SSR 149 chr2 (CTTCCT)2; Cc02_g20930 Myrcene actgatgctgtttgctccca 276 0% (CTTCCT)2 synthase, chloroplastic gtggtggtggtgagatggag
SSR 150 chr2 (TCT)3 Cc02_g20930 Myrcene agacgagaccgcaggtaaac 448 83% synthase, chloroplastic tgcaggacgaagaagctgtt
SSR 151 chr2 TA(9.5) Cc02_g20930 Myrcene agacgggtggaagaattggc 478 83% synthase, chloroplastic tactggtagggctgcaaacg
SSR 152 chr2 (CTTCCT)2; Cc02_g20930 Myrcene atgctgtttgctcccaaggt 332 89% (CTTCCT)2 synthase, chloroplastic agaggataggcaagaggcca
SSR 153 chr2 (ACAAC)2; Cc02_g20930 Myrcene attcaagacgagaccgcagg 444 89% (TCT)3 synthase, chloroplastic aagaagctgttgtcccgagg
SSR 154 chr2 (ACAAC)2; Cc02_g20930 Myrcene attcaagacgagaccgcagg 453 89% (TCT)3 synthase, chloroplastic tgcaggacgaagaagctgtt
SSR 155 chr2 TA(9.5) Cc02_g20930 Myrcene ttcccaaagacgggtggaag 485 67% synthase, chloroplastic tactggtagggctgcaaacg
SSR 156 chr2 (GCATT)2 Cc02_g29590 Putative accaagctcaatcgagcactt 201 78% Vetispiradiene synthase 1 aaatcctggctccgtcactg
SSR 157 chr2 (GCATT)2 Cc02_g29590 Putative accaagctcaatcgagcactt 199 67% Vetispiradiene synthase 1 atcctggctccgtcactgat
SSR 158 chr2 (GCATT)2 Cc02_g29590 Putative accaagctcaatcgagcactt 196 94% Vetispiradiene synthase 1 ctggctccgtcactgatgtc
279 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
SSR 159 chr2 AGATA(3.2) Cc02_g29590 Putative actttggctggcacatcagt 410 44% Vetispiradiene synthase 1 agaagtcggccagattgtcg
SSR 160 chr2 (TGGA)2 Cc02_g29590 Putative agaaatccgcaatcccatacga 483 17% Vetispiradiene synthase 1 ctagtccgtcgattccgtgg
SSR 161 chr2 AGATA(3.2) Cc02_g29590 Putative agactttggctggcacatca 412 72% Vetispiradiene synthase 1 agaagtcggccagattgtcg
SSR 162 chr2 (AATT)2; Cc02_g29590 Putative agcaaagactactgccctgc 207 22% (CGAT)2 Vetispiradiene synthase 1 gcatcccacctgaaaccaga
SSR 163 chr2 (AATT)2; Cc02_g29590 Putative agcctcaacattctctcggc 239 78% (CGAT)2 Vetispiradiene synthase 1 agcatcccacctgaaaccag
SSR 164 chr2 AGATA(3.2) Cc02_g29590 Putative ttggaagactttggctggca 437 44% Vetispiradiene synthase 1 gacggtgggagttgtgaaga
SSR 165 chr2 AGATA(3.2) Cc02_g29590 Putative ttggaagactttggctggca 438 61% Vetispiradiene synthase 1 agacggtgggagttgtgaag
SSR 166 chr10 (GGCTT)2 Cc10_g12360 Myrcene aaagcaccaccctgtcagtt 355 44% synthase, chloroplastic cctctgggttccgcatttga
SSR 167 chr10 (TTTA)2 Cc10_g12360 Myrcene aagcatacctgcaagaggca 367 89% synthase, chloroplastic actctagaagtcctcgccca
SSR 168 chr10 (ATTTG)2; Cc10_g12360 Myrcene aatcggaattgggtggcagt 484 22% (TTCTC)2; synthase, chloroplastic tggctcgaaacaggagacttt (ATCT)2
SSR 169 chr10 (ATTTG)2; Cc10_g12360 Myrcene aatcggaattgggtggcagt 484 72% (TTCTC)2; synthase, chloroplastic tggctcgaaacaggagactt (ATCT)2
SSR 170 chr10 (ATTTG)2; Cc10_g12360 Myrcene aatcggaattgggtggcagt 485 22% (TTCTC)2; synthase, chloroplastic ttggctcgaaacaggagact (ATCT)2
SSR 171 chr10 (TTTA)2 Cc10_g12360 Myrcene agcatacctgcaagaggcaa 366 61% synthase, chloroplastic actctagaagtcctcgccca
SSR 172 chr10 (ATGGCC)2 Cc10_g12360 Myrcene atgttgccaggatgggacaa 165 72% synthase, chloroplastic actgccacccaattccgatt
SSR 173 chr10 (GGCTT)2 Cc10_g12360 Myrcene ccaccctgtcagttgggatt 349 17% synthase, chloroplastic cctctgggttccgcatttga
SSR 174 chr10 (AT)4; (TTATA)2 Cc10_g12360 Myrcene cccaatcttggctcgtttcg 428 44% synthase, chloroplastic aatttgtgacataggcgtgt
SSR 175 chr10 (AT)4; (TTATA)2 Cc10_g12360 Myrcene cccaatcttggctcgtttcg 430 39% synthase, chloroplastic caaatttgtgacataggcgtgt
SSR 176 chr10 (AATT)2 Cc10_g12360 Myrcene gacaaaggtcgctgctttgg 461 72% synthase, chloroplastic tgcctcttgcaggtatgctt
SSR 177 chr10 (AATT)2 Cc10_g12360 Myrcene gacaaaggtcgctgctttgg 462 44% synthase, chloroplastic ttgcctcttgcaggtatgct
SSR 178 chr10 (ATTTG)2; Cc10_g12360 Myrcene gcaacatcttgcaccatccg 460 72% (TTCTC)2; synthase, chloroplastic tggctcgaaacaggagactt (ATCT)2
SSR 179 chr10 (ATTTG)2; Cc10_g12360 Myrcene gcaacatcttgcaccatccg 461 56% (TTCTC)2; synthase, chloroplastic ttggctcgaaacaggagact (ATCT)2
SSR 180 chr10 (AT)4; (TTATA)2 Cc10_g12360 Myrcene gcccaatcttggctcgtttc 430 0% synthase, chloroplastic aaatttgtgacataggcgtgt
SSR 181 chr10 (AT)4; (TTATA)2 Cc10_g12360 Myrcene gcccaatcttggctcgtttc 429 28% synthase, chloroplastic aatttgtgacataggcgtgt
SSR 182 chr10 (AT)4; (TTATA)2 Cc10_g12360 Myrcene gcccaatcttggctcgtttc 431 50% synthase, chloroplastic caaatttgtgacataggcgtgt
SSR 183 chr10 (GGCTT)2 Cc10_g12360 Myrcene gctgaagcctctagtagccg 447 72% synthase, chloroplastic cctctgggttccgcatttga
SSR 184 chr10 (GGCTT)2 Cc10_g12360 Myrcene gctgaagcctctagtagccg 452 61% synthase, chloroplastic taatccctctgggttccgca
SSR 185 chr10 (TTTA)2 Cc10_g12360 Myrcene ggtatgtgcacgagctggaa 129 89% synthase, chloroplastic actctagaagtcctcgccca
SSR 186 chr10 (AATT)2 Cc10_g12360 Myrcene gtcgctgctttggttactgc 454 39% synthase, chloroplastic tgcctcttgcaggtatgctt
SSR 187 chr10 (AATT)2 Cc10_g12360 Myrcene gtcgctgctttggttactgc 455 0% synthase, chloroplastic ttgcctcttgcaggtatgct
SSR 188 chr10 (GGCTT)2 Cc10_g12360 Myrcene gtcggtctgcaatgctgaag 374 83% synthase, chloroplastic agctcggtctaaccaaaccc
280 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
SSR 189 chr10 (TTTA)2 Cc10_g12360 Myrcene tcagctcctctggtggtagt 281 78% synthase, chloroplastic actctagaagtcctcgccca
SSR 190 chr10 (AATT)2 Cc10_g12360 Myrcene tcgctgctttggttactgct 453 61% synthase, chloroplastic tgcctcttgcaggtatgctt
SSR 191 chr10 (ATGGCC)2 Cc10_g12360 Myrcene tgcagtgaatgttgccagga 173 0% synthase, chloroplastic actgccacccaattccgatt
SSR 192 chr10 (ATGGCC)2 Cc10_g12360 Myrcene tgcagtgaatgttgccagga 109 0% synthase, chloroplastic gggctcaaagagcagtgaca
SSR 193 chr10 (ATGGCC)2 Cc10_g12360 Myrcene tgcagtgaatgttgccagga 110 100% Monomorphic Polymorphic 2 Scored for synthase, chloroplastic tgggctcaaagagcagtgac subsequent analysis
SSR 194 chr10 (CAGA)2 Cc10_g12360 Myrcene tgctttggagcttccactcc 322 100% Monomorphic Polymorphic Too many synthase, chloroplastic cagctaggcctgtactgctc to count
SSR 195 chr10 (CAGA)2 Cc10_g12360 Myrcene tgctttggagcttccactcc 439 100% Monomorphic Polymorphic Too many synthase, chloroplastic ccaaagcagcgacctttgtc to count
SSR 196 chr10 (CAGA)2 Cc10_g12360 Myrcene tgctttggagcttccactcc 446 83% synthase, chloroplastic gcagtaaccaaagcagcgac
SSR 197 chr10 (TTTA)2 Cc10_g12360 Myrcene tgtgcacgagctggaagtaa 125 50% synthase, chloroplastic actctagaagtcctcgccca
SSR 198 chr10 (ATGGCC)2 Cc10_g12360 Myrcene tgttgccaggatgggacaat 164 94% synthase, chloroplastic actgccacccaattccgatt
SSR 199 chr10 (CAGA)2 Cc10_g12360 Myrcene tttggaggcaaggtggttca 286 100% Monomorphic Polymorphic 3 Scored for synthase, chloroplastic cagctaggcctgtactgctc subsequent analysis
SSR 200 chr10 (CAGA)2 Cc10_g12360 Myrcene tttggaggcaaggtggttca 403 94% synthase, chloroplastic ccaaagcagcgacctttgtc
281 Special Issue on Genomics Santos et al.: TPS-linked SSRs in Philippine Coffee
282