US 2014.0004156A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0004156A1 Mellstedt et al. (43) Pub. Date: Jan. 2, 2014

(54) BOLOGICAL INHIBITORS OF ROR1 Publication Classification CAPABLE OF INDUCING CELL, DEATH (51) Int. C. (76) Inventors: Hakan Mellstedt, Stockholm (SE): C07K 6/28 (2006.01) Hodjattallah Rabbani, Stockholm (SE); CI2N IS/II3 (2006.01) Ingrid Teige, Lund (SE) (52) U.S. C. CPC ...... C07K 16/28 (2013.01); CI2N 15/1138 (21) Appl. No.: 13/516,925 (2013.01) USPC ...... 424/400; 530/387.9; 536/24.5:536/23.1; (22) PCT Filed: Dec. 10, 2010 435/320.1; 435/325; 435/375; 424/139.1; (86). PCT No.: PCT/EP2010/007524 514/44. A:536/23.53; 435/331 S371 (c)(1), (57) ABSTRACT (2), (4) Date: Mar. 1, 2013 The invention relates to antibodies and siRNA molecules for (30) Foreign Application Priority Data inducing cell death by the specific binding of ROR1, domains thereof of nucleotide molecules encoding ROR1. There are Dec. 18, 2009 (GB) ...... O922143.3 also provided methods involving and uses of the antibodies Jun. 3, 2010 (GB) ...... 1OO93O7.8 and siRNA molecules of the invention. Patent Application Publication Jan. 2, 2014 Sheet 1 of 25 US 2014/0004156A1

L/S.*L/SdXL|-WLIXCRIO6] N

Patent Application Publication Jan. 2, 2014 Sheet 2 of 25 US 2014/0004156A1

a bi-saw exit-8 ext:

xx x:

i. s: s x 8. :

xxx xx . ex* x8. gri syst {{..} : twic s

yxi-xxii. 33. 8 M. : : ised-east x 8. Patent Application Publication Jan. 2, 2014 Sheet 3 of 25 US 2014/0004156A1

8x8 is .

sixx 88.888

883 & 8::${

** $: c:

six is: Patent Application Publication Jan. 2, 2014 Sheet 4 of 25 US 2014/0004156A1

| i i O5 O ) O2 to P i Patent Application Publication Jan. 2, 2014 Sheet 5 of 25 US 2014/0004156A1

kD a Progressive Non-Progressive CLL

N-ROr1 CO

B-actin

N-ROr1-46

B-actin

C-ROr1-904

B-actin CLL-15 CL-12 CLL-6 CL-8 Control CLL-13 CLL-10 CL-4 CLL-7

Fig. 5 Patent Application Publication Jan. 2, 2014 Sheet 6 of 25 US 2014/0004156A1

isotype control ROr1 Progressive CLL

Nums

Non-progressive Se Š CLL N

o' 10' 0. o 10'

5 Healthy donor

O' 10 o 10 Fluorescence intensity

Fig. 6 Patent Application Publication Jan. 2, 2014 Sheet 7 of 25 US 2014/0004156A1

o E st 8 O O Z Z kDa M as Extracellular part of a Ror? * recombinant protein 28- . . . . )

71- ... a sa Intracellular part of a Ror recombinant protein 55 .06 .12.25 0.5 1 2 pig C-ROr1-904

Fig. 7 Patent Application Publication Jan. 2, 2014 Sheet 8 of 25 US 2014/0004156A1

A B

-- rs - - . . . . . L. d - - - - i.

NH- W-in-as-s-s-ad anti-ROr1 Mab PY99 N-ROr Purified activated Purified activated normal B cell normal B cell

Fig. 8 Patent Application Publication Jan. 2, 2014 Sheet 9 of 25 US 2014/0004156A1

kDa 111

Fig. 9 Patent Application Publication Jan. 2, 2014 Sheet 10 of 25 US 2014/0004156A1

%| || 2 III. Lll a

2

O O ?o O O. O. O L O D r v c cro N (N v (%) Seo of Ododw Patent Application Publication Jan. 2, 2014 Sheet 11 of 25 US 2014/0004156A1

h O cy 7 / I % II. %525 | 2 (9%) Seo oododv

Patent Application Publication Jan. 2, 2014 Sheet 13 of 25 US 2014/0004156A1

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Patent Application Publication Jan. 2, 2014 Sheet 14 of 25 US 2014/0004156A1

neg control KNG

Fig. 14 Patent Application Publication Jan. 2, 2014 Sheet 15 of 25 US 2014/0004156A1

3

S&SZŽ 2 | | | | O O o O O O O O C. C. C. C. C. C. C. C O O O O O O O O v GN O CO o Q N V Vo V Patent Application Publication Jan. 2, 2014 Sheet 16 of 25 US 2014/0004156A1

-T-I-T-I-T-5 N LILLILLILF

NN ILLILLIII: 227 2

NN. N IIIs 2.

N.rNN is

S.

N i %

O O O O O OO N CO Vr S. S.

Patent Application Publication Jan. 2, 2014 Sheet 20 of 25 US 2014/0004156A1

Patent Application Publication Jan. 2, 2014 Sheet 21 of 25 US 2014/0004156A1

LZ61

Sue/ JOJequnN Patent Application Publication US 2014/0004156A1 Patent Application Publication Jan. 2, 2014 Sheet 23 of 25 US 2014/0004156A1

-09 Ë}08(%) Seo Jo be Patent Application Publication Jan. 2, 2014 Sheet 24 of 25 US 2014/0004156A1

SN

(%) AbXOOAO Patent Application Publication Jan. 2, 2014 Sheet 25 of 25 US 2014/0004156A1

GZ-61-I p00npu?S??poq??ueleuO|OOuOUuV-JOXEXIS??L SII00TTOu?360Ae010dx}\/d US 2014/0004156 A1 Jan. 2, 2014

BIOLOGICAL INHIBITORS OF ROR1 derm (Reddy U R et al., Oncogene 1996; 13:1555-9). A CAPABLE OF INDUCING CELL, DEATH shorter transcript from exons 1-7 including a short part of 0001. The present invention relates to biological mol intron 7 has also been described with a predicted length of 393 ecules that inhibit ROR1. In particular there is provided amino acids and a molecular weight of 44 kDa (Ensembl ID: inhibitors such as antibodies and siRNA molecules that are ENSG00000185483). capable of inducing cell death by the specific binding of 0009. In a first aspect of the invention there is provided a ROR1, domains thereof or nucleotide molecules encoding biological inhibitor of ROR1. ROR1. 0010 Biological inhibitors can take many forms and 0002 The work leading to this invention has received include differing modes of action. By Biological inhibition funding from the European Community’s Seventh Frame we mean that the amount of or action of ROR1 is reduced, and work Programme FP7/2007-2013/under grant agreement No may be caused by exposure to a biological inhibitor. For HEALTH-F5-2008-200755. example, the inhibitor may act directly by binding to ROR1 or 0003 Chronic lymphocytic leukaemia (CLL) is a white a nucleotide sequence encoding ROR1. The inhibitor may blood cell cancer that is characterised by an abnormal neo alternatively act by preventing ROR1 interacting with mol plastic proliferation of B lymphocyte cells (B cells). The B ecules that it normally interacts with e.g. by blocking recep cells of CLL differ from normal B cells in their activation and tors, sequestering molecules that bind to or associate with maturation stage and are in particular derived from antigen ROR1, preventing insertion of ROR1 or its binders from experienced B cells with different immunoglobulin heavy inserting into a membrane, such as the cell membrane. chain variable (IgVH) gene mutations (Chiorazzi Net al., N 0011 Preferably, the biological inhibitor binds specifi Engl J Med 2005; 352:804-15). CLL patients with mutated cally to either an extracellular domain of ROR1, an intracel IgVH genes have a better prognosis compared to patients with lular domain of ROR1 or to a nucleotide sequence encoding unmutated genes (Damle RNet al., Blood 1999;94:1840-7: ROR1. Hamblin TJ et al., Blood 1999;94:1848-54). 0012. The biological inhibitor is conveniently one of an 0004 Global gene expression profiling studies have antibody, an interfering nucleic acid molecule or a soluble revealed partly distinguishing but in general overlapping receptor. expression profiles in mutated and unmutated leukaemic B 0013. In one embodiment the biological inhibitor is an cells, Suggesting a common phenotype (Klein Uet al., J Exp antibody. By antibody we mean to complete antibodies and Med 2001; 194:1625-38: Rosenwald A et al., J Exp Med antigen binding fragments thereof. Such fragments are 2001; 194; 1639-47). defined below. 0005 Gene expression profiling studies have shown a 43.8 0014 Antibodies comprise two identical polypeptides of fold increase of the orphan receptor tyrosine kinase (RTK) M, 50,000-70,000 (termed “heavy chains”) that are linked ROR1 in CLL cells (Klein U et al., J Exp Med 2001; 194: together by a disulphide bond, each of which is linked to one 1625-38). Ror1 is a member of the RTK family of orphan of an identical pair of polypeptides of M, 25,000 (termed receptors related to muscle specific kinase (MUSK) and Trk “light chains'). There is considerable sequence variability neurotrophin receptors (Glass DJ, et al., Cell 1996: 85:513 between individual N-termini of heavy chains of different 23; Masiakowski Pet al., J Biol Chem 1992; 267:26181-90; antibody molecules and between individual light chains of Valenzuela D M et al., Neuron 1995; 15:573-84). different antibody molecules and these regions have hence 0006 Ror receptors are cell surface receptors participating been termed “variable domains”. Conversely, there is consid in signal transduction, cell-cell interaction, regulation of cell erable sequence similarity between individual C-termini of proliferation, differentiation, cell metabolism and survival heavy chains of different antibody molecules and between (Masiakowski Petal., Biol Chem 1992: 267:26181-90;Yoda individual light chains of different antibody molecules and A et al., J Recept Signal Transduct Res 2003: 23: 1-15). They these regions have hence been termed "constant domains’. are evolutionarily highly conserved between different species 0015 The antigen-binding site is formed from hyper-vari e.g. human, mouse, Drosophila, and C. elegans. able regions in the variable domains of a pair of heavy and 0007. The human ROR1 gene has a coding region of 2814 light chains. The hyper-variable regions are also known as bp with a predicted 937 amino acids sequence and 105 kDa complementarity-determining regions (CDRS) and deter protein size including an Ig-like domain, cysteine-rich mine the specificity of the antibody for a ligand. The variable domain, kringle domain, tyrosine kinase domain, and pro domains of the heavy chain (V) and light chain (V) typi line-rich domain (FIG. 1) (Yoda A et al., J Recept Signal cally comprise three CDRs, each of which is flanked by Transduct Res 2003: 23: 1-15). sequence with less variation, which are known as framework 0008 ROR1 is located on chromosomal region 1 p31.3 regions (FRS). (http://www.ensembl.org), a region where chromosomal 0016. The variable heavy (V) and variable light (V) aberrations are not frequently seen in haematological malig domains of the antibody are involved in antigen recognition, nancies (FIG. 2). The human ROR1 is expressed in heart, a fact first recognised by early protease digestion experi lung, and kidney but less in placenta, pancreas and skeletal ments. Further confirmation was found by “humanisation' of muscles (Reddy U R et al., Oncogene 1996; 13:1555-9). rodent antibodies. Variable domains of rodent origin may be ROR1 was originally cloned from a neuroblastoma cell line fused to constant domains of human origin Such that the (Masiakowski Petal., J Biol Chem 1992: 267:26181-90) and resultant antibody retains the antigenic specificity of the Subsequently a shorter form lacking the entire extracellular rodent parented antibody (Morrison et al., 1984, Proc. Natl. domain but containing the transmembrane domain was iso Acad. Sci. USA, 81,6851-6855). lated from a foetal brain library. Truncated Ror1 (t-Rorl) 0017. That antigenic specificity is conferred by variable gene has been reported in foetal and adult human central domains and is independent of the constant domains is known nervous system, in human leukaemias, lymphoma cell lines, from experiments involving the bacterial expression of anti and in a variety of human cancers derived from neuroecto body fragments, all containing one or more variable domains. US 2014/0004156 A1 Jan. 2, 2014

These molecules include Fab-like molecules (Better et al., (0023. By “ScFv molecules' we mean molecules wherein 1988, Science, 240:1041). Fv molecules (Skerra et al., 1988, the V and V, partner domains are linked via a flexible oli Science, 240, 1038); single-chain FV (Sclv) molecules where gopeptide. the V, and V, partner domains are linked via a flexible oli 0024. The advantages of using antibody fragments which gopeptide (Bird et al., 1988, Science 242:423; Huston et al., have antigen-binding activity, rather than whole antibodies, 1988, Proc. Natl. Acad. Sci. USA, 85:5879) and single are several-fold. The smaller size of the fragments may lead to domain antibodies (dAbs) comprising isolated V domains improved pharmacological properties. Such as better penetra (Ward et al., 1989 Nature 341, 544). A general review of the tion of solid tissue. Effector functions of whole antibodies, techniques involved in the synthesis of antibody fragments such as complement binding, are removed. Fab, Fv, Sclv and which retain their specific binding sites is to be found in dAb antibody fragments can all be expressed in and secreted Winter et al., 1991, Nature, 349, 293–299. from Escherichia coli (E. coli), thus allowing the facile pro 0018 For the production of polyclonal antibodies, various duction of large amounts of the said fragments. Suitable host animals (e.g., rabbit, goat, mouse or other mam 0025. Whole antibodies, and F(ab') fragments are “biva mal) may be immunized by one or more injections with the lent”. By “bivalent we mean that the said antibodies and native protein, a synthetic variant thereof, or a derivative of F(ab')2 fragments have two antigen combining sites. In con the foregoing. An appropriate immunogenic preparation can trast, Fab, Fv, Sclv and dAb fragments are monovalent, hav contain, for example, the naturally occurring immunogenic ing only one antigen combining site. protein, a chemically synthesized polypeptide representing 0026 Methods for generating, isolating and using anti the immunogenic protein, or a recombinantly expressed bodies for a desired antigen or epitope are well known to immunogenic protein. Furthermore, the protein may be con those skilled in the relevant art. For example, an antibody may jugated to a second protein known to be immunogenic in the be raised in a Suitable host animal (such as, for example, a mammal being immunized. Examples of such immunogenic mouse, rabbit or goat) using standard methods known in the proteins include but are not limited to keyhole limpet art and either used as crude antisera or purified, for example hemocyanin, serum albumin, bovine thyroglobulin, and Soy by affinity purification. An antibody of desired specificity bean trypsin inhibitor. The preparation can further include an may alternatively be generated using well-known molecular adjuvant. Various adjuvants used to increase the immunologi biology methods, including selection from a molecular cal response include, but are not limited to, Freund's (com library of recombinant antibodies, or grafting or shuffling of plete and incomplete), mineral gels (e.g., aluminum hydrox complementarity-determining regions (CDRs) onto appro ide), Surface-active Substances (e.g., lysolecithin, pluronic priate framework regions. Human antibodies may be selected polyols, polyanions, peptides, oil emulsions, dinitrophenol, from recombinant libraries and/or generated by grafting etc.), adjuvants usable in humans such as Bacille Calmette CDRs from non-human antibodies onto human framework Guerin and Corynebacterium parvum, or similar immuno regions using well-known molecular biology techniques. stimulatory agents. Additional examples of adjuvants that can 0027 Antibodies of one embodiment of the invention may be employed include MPL-TDM adjuvant (monophosphoryl possess the sequences shown in FIGS. 17, 18 and 19. Lipid A, synthetic trehalose dicorynomycolate). 0028 By extracellular domain we mean the part of a bio 0019. The polyclonal antibody molecules directed against logical molecule that extends beyond the membrane Surface the immunogenic protein can be isolated from the mammal of the cell, where said biological molecule is integrated (e.g., from the blood) and further purified by well known in/embedded in the cell membrane. An example of such a techniques, such as affinity chromatography using protein A biological molecule is a receptor which possess an extracel or protein G, which provide primarily the IgG fraction of lular portion to which ligands bind. If the polypeptide chain of immune serum. Subsequently, or alternatively, the specific the receptor crosses the bilayer several times, the external antigen which is the target of the immunoglobulin sought, or domain can comprise several “loops' sticking out of the an epitope thereof, may be immobilized on a column to purify membrane. Any one or combination of which may form a the immune specific antibody by immunoaffinity chromatog binding site for a ligand. raphy. Purification of immunoglobulins is discussed, for (0029 Preferably the extracellular domain to which the example, by D. Wilkinson (The Scientist, published by The antibody binds has an amino acid sequence selected from: Scientist, Inc., Philadelphia Pa., Vol. 14, No. 8 (Apr. 17. 2000), pp. 25-28). WNISSELNKDSYLTL. 0020. The term “monoclonal antibody” (mAb) or “mono clonal antibody composition', as used herein, refers to a RSTIYGSRLRIRNLDTTDTGYFO. population of antibody molecules that contain only one molecular species of antibody molecule consisting of a YMESLHMOGEIENOI unique light chain gene product and a unique heavy chain COPWNSOYPHTHTFTALRFP gene product. In particular, the complementarity determining regions (CDRs) of the monoclonal antibody are identical in 0030 Alternatively the intracellular domain to which the all the molecules of the population. MAbs thus contain an antibody binds has the amino acid sequence NKSQKPYKID antigen-binding site capable of immunoreacting with a par SKQAS. ticular epitope of the antigen characterized by a unique bind 0031 Conveniently the antibody induces cell death in a ing affinity for it. cell expressing ROR1 upon specific binding of the antibody to an ROR1 molecule or domain thereof. 0021. The antibody may be a human or humanised anti 0032 Preferably the biological inhibitor causes death of a body or fragment thereof. cell expressing ROR1. By cell death we include all forms of 0022. The antibody may be a fragment including scFv cell death, including apoptosis, necrosis and autophagic cell molecules or Fab molecules. death. US 2014/0004156 A1 Jan. 2, 2014

0033 Apoptosis (programmed cell death, type I), is the (2002) RNA interference in adult mice. Nature (London) 418, process by which cells deliberately destroy themselves by 38-39) followed by the publication of Song et al. that showed systematically dismantling their contents which are then that siRNA may be used for therapeutic intervention. This taken up by Surrounding cells. study showed that RNA interference targeting Fas protected 0034. Autophagic cell death (also know as cytoplasmic or mice from fulminant hepatitis. (Song, E., Lee, S. K., Wang, J. programmed cell death, type II) is characterised by charac et al. (2003) Nat. Med. 9, 347-351). terized by the formation of large vacuoles which eat away 0043 siRNA molecules may be single-stranded (ss) or organelles in a specific sequence prior to the nucleus being double-stranded (ds). The siRNA molecules may be delivered destroyed. using a construct, which is capable of expressing the siRNA 0035 Necrosis is premature cell death that occurs without molecule upon delivery to the target cell. the controlled systematic dismantling of the cell and its con 0044. A “small interfering RNA or “short interfering stituent parts. Typically necrosis is characterised by rupturing RNA or “siRNA” or “short hairpin RNA or “shRNA is a of organelles and leakage of enzymatic compounds such as double-stranded RNA molecule that is complementary to a lysozymes which then damage and cause necrosis of neigh target nucleic acid sequence. A double-stranded RNA mol bouring cells. ecule is formed by the complementary pairing between a first 0036 Antibodies may be used in therapy—for example, a RNA portion and a second RNA portion. The length of each medicament comprising therapeutic antibodies may be intro portion generally is less than 30 nucleotides in length (e.g., duced into a subject to modulate the immune response of that 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, Subject. For example, a therapeutic antibody specific for an 12, 11, or 10 nucleotides). In some embodiments, the length antigen in the Subject will stimulate an immune response to of each portion is 19 to 25 nucleotides in length. In some that antigen, thereby inducing and/or promoting an immune siRNA molecules, the complementary first and second por response and aiding recovery. Methods for administering tions of the RNA molecule are the “stem of a hairpin struc therapeutic antibodies to a patient in need thereof are well ture. The two portions can be joined by a linking sequence, known in the art. which can form the “loop” in the hairpin structure. The link 0037. In an alternative embodiment the biological inhibi ing sequence can vary in length. In some embodiments, the tor may be an interfering nucleic acid molecule including linking sequence can be 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucle siRNA, antisense RNA and dsRNA. otides in length. A representative linking sequence is 5'-TTC 0038 Preferably the interfering nucleic acid molecule is AGA AGG-3', but any of a number of sequences can be used an antisense polynucleotide which is capable of hybridising to join the first and second portions. The first and second to the nucleotide sequence encoding ROR1 or fragments or portions are complementary but may not be completely sym variants thereof. metrical, as the hairpin structure may contain 3' or 5' overhang 0039 Hybridisation may occur under any appropriate nucleotides (e.g., a 1, 2, 3, 4, or 5 nucleotide overhang). stringency conditions, for example 2XSSC at 65° C. 0040. By “polynucleotide' we include single-stranded 0045 RNA molecules have been shown by many and/or double-stranded molecules of DNA (deoxyribo researchers to be effective in Suppressing mRNA accumula nucleic acid) and/or RNA (ribonucleic acid) and derivatives tion. SiRNA-mediated Suppression of nucleic acid expression thereof. By “encoding polynucleotide' we include a poly is specific as even a single base pair mismatch between nucleotide the sequence of which that may be translated to siRNA and the targeted nucleic acid can abolish the action of form a desired polypeptide. RNA interference. siRNAs generally do not elicit anti-viral 0041. It has now also been found that angiogenesis inhi responses. bition can be induced using siRNA (small interfering RNA 0046 Conveniently, the siRNA is complementary to either molecules). a nucleotide sequence encoding an extracellular domain of 0042 RNA interference (RNAi) is a natural mechanism ROR1 or a nucleotide sequence encoding an intracellular for silencing specific genes. Genes provide cells with the domain of ROR1. instructions for making proteins, and when a gene is silenced, 0047 Preferably the siRNA molecule has the siRNA the cell stops making the protein specified by that gene. RNA sequence as shown in the table below:

Target sequence siRNA. Sequence siRNA (cDNA, 5'-->3') (5'-->3') ale

AT GAA CCA. ATG AAT AAC ATC AAU GAA CCA AUG AAU AAC AUC ROR 1

AAA AAT CTA TAA AGG CCA TCT AAA AAU CUA UAA AGG CCA UCU ROR 2

AC ATG TCA ATT CCA. AAT CAT AAC AUG UCA AUU CCA. AAU CAU ROR 3 interference was first observed in plants, but the first crucial 0048. In a second aspect of the invention there is provided breakthrough in understanding the RNAi mechanism came a nucleotide sequence encoding a biological inhibitor of the from studies of worms. This came in 1998 with the recogni first aspect. tion that double-stranded RNA (dsRNA) played a pivotal role 0049. The terms “nucleotide sequence' or “nucleic acid in RNAi. The first evidence for in vivo silencing of genes or “polynucleotide' or "oligonucleotide' are used inter using siRNA was published 2002 (McCaffrey, A. P. Meuse, changeably and refer to a heteropolymer of nucleotides or the L., Pham, T.T., Conklin, D. S., Hannon, G.J. and Kay, M.A. sequence of these nucleotides. These phrases also refer to US 2014/0004156 A1 Jan. 2, 2014

DNA or RNA of genomic or synthetic origin which may be fill in recessed 3'ends. Synthetic linkers, pieces of blunt single-stranded or double-stranded and may represent the ended double-stranded DNA which contain recognition sense or the antisense strand, to peptide nucleic acid (PNA) or sequences for defined restriction enzymes, can be ligated to to any DNA-like or RNA-like material. In the sequences blunt-ended DNA fragments by T4 DNA ligase. They are herein A is adenine, C is cytosine, T is thymine, G is guanine Subsequently digested with appropriate restriction enzymes and N is A, C, G or T (U). It is contemplated that where the to create cohesive ends and ligated to an expression vector polynucleotide is RNA, the T (thymine) in the sequences with compatible termini. Adaptors are also chemically syn provided herein is substituted with U (uracil). Generally, thesised DNA fragments which contain one blunt end used nucleic acid segments provided by this invention may be for ligation but which also possess one preformed cohesive assembled from fragments of the genome and short oligo end nucleotide linkers, or from a series of oligonucleotides, or 0057 Synthetic linkers containing a variety of restriction from individual nucleotides, to provide a synthetic nucleic endonuclease sites are commercially available from a number acid which is capable of being expressed in a recombinant of sources including International Biotechnologies Inc., New transcriptional unit comprising regulatory elements derived Haven, Conn., USA. from a microbial or viral operon, or a eukaryotic gene. 0.058 A desirable way to modify the DNA encoding the 0050. In a third aspect of the invention there is provided an polypeptide of the invention is to use the polymerase chain expression vector containing a nucleotide sequence as reaction as disclosed by Saiki et al (1988) Science 239, 487 described in the second aspect of the invention. 491. In this method the DNA to be enzymatically amplified is 0051 Typical prokaryotic vector plasmids are: puC18, flanked by two specific oligonucleotide primers which them pUC19, pBR322 and pBR329 available from Biorad Labo selves become incorporated into the amplified DNA. The said ratories (Richmond, Calif., USA); pTrc99A, pKK223-3, specific primers may contain restriction endonuclease recog pKK233-3, pIDR540 and pRIT5 available from Pharmacia nition sites which can be used for cloning into expression (Piscataway, N.J., USA); pBS vectors, Phagescript vectors, vectors using methods known in the art. Bluescript vectors, pNH8A, pNH16A, pNH18A, pNH46A 0059. In a fourth aspect of the invention there is provided available from Stratagene Cloning Systems (La Jolla, Calif. a host cell comprising a nucleotide sequence or expression 92037, USA). vector as described in the second and third aspects of the 0052 A typical mammalian cell vector plasmid is pSVL invention. available from Pharmacia (Piscataway, N.J., USA). This vec 0060. The DNA is then expressed in a suitable host to toruses the SV40 late promoter to drive expression of cloned produce a polypeptide comprising the compound of the genes, the highest level of expression being found in T anti invention. Thus, the DNA encoding the polypeptide consti gen-producing cells, such as COS-1 cells. An example of an tuting the compound of the invention may be used in accor inducible mammalian expression vector is pMSG, also avail dance with known techniques, appropriately modified in view able from Pharmacia (Piscataway, N.J., USA). This vector of the teachings contained herein, to construct an expression uses the glucocorticoid-inducible promoter of the mouse vector, which is then used to transform an appropriate host mammary tumour virus long terminal repeat to drive expres cell for the expression and production of the polypeptide of sion of the cloned gene. the invention. Such techniques include those disclosed in U.S. 0053 Useful yeast plasmid vectors are pRS403-406 and Pat. Nos. 4,440,859 issued 3 Apr. 1984 to Rutter et al. 4,530, pRS413-416 and are generally available from Stratagene 901 issued 23 Jul. 1985 to Weissman, 4,582,800 issued 15 Cloning Systems (La Jolla, Calif. 92037, USA). Plasmids Apr. 1986 to Crowl, 4,677,063 issued 30 Jun. 1987 to Market pRS403, pRS404, pRS405 and pRS406 are Yeast Integrating al, 4,678,751 issued 7 Jul. 1987 to Goeddel, 4,704,362 issued plasmids (YIps) and incorporate the yeast selectable markers 3 Nov. 1987 to Itakura et al., 4,710,463 issued 1 Dec. 1987 to HIS3, TRP1, LEU2 and URA3. Plasmids pRS413-416 are Murray, 4,757,006 issued 12 Jul. 1988 to Toole, Jr. et al. Yeast Centromere plasmids (YCps). 4,766,075 issued 23 Aug. 1988 to Goeddeletal and 4,810,648 0054 Methods well known to those skilled in the art can issued 7 Mar. 1989 to Stalker, all of which are incorporated be used to construct expression vectors containing the coding herein by reference. sequence and, for example appropriate transcriptional or 0061 The DNA encoding the polypeptide constituting the translational controls. One such method involves ligation via compound of the invention may be joined to a wide variety of homopolymer tails. Homopolymer polydA (or polydC) tails other DNA sequences for introduction into an appropriate are added to exposed 3'OH groups on the DNA fragment to be host. The companion DNA will depend upon the nature of the cloned by terminal deoxynucleotidyl transferases. The frag host, the manner of the introduction of the DNA into the host, ment is then capable of annealing to the polydT (or polydC) and whether episomal maintenance or integration is desired. tails added to the ends of a linearised plasmid vector. Gaps left 0062 Generally, the DNA is inserted into an expression following annealing can be filled by DNA polymerase and the vector, Such as a plasmid, in proper orientation and correct free ends joined by DNA ligase. reading frame for expression. If necessary, the DNA may be 0055 Another method involves ligation via cohesive ends. linked to the appropriate transcriptional and translational Compatible cohesive ends can be generated on the DNA regulatory control nucleotide sequences recognised by the fragment and vector by the action of suitable restriction desired host, although Such controls are generally available in enzymes. These ends will rapidly anneal through comple the expression vector. Thus, the DNA insert may be opera mentary base pairing and remaining nicks can be closed by tively linked to an appropriate promoter. Bacterial promoters the action of DNA ligase. include the E. coli lacI and lacz promoters, the T3 and T7 0056. A further method uses synthetic molecules called promoters, the gpt promoter, the phage X PR and PL promot linkers and adaptors. DNA fragments with blunt ends are ers, the phoA promoter and the Up promoter. Eukaryotic generated by bacteriophage T4 DNA polymerase or E. coli promoters include the CMV immediate early promoter, the DNA polymerase I which remove protruding 3' termini and HSV thymidine kinase promoter, the early and late SV40 US 2014/0004156 A1 Jan. 2, 2014

promoters and the promoters of retroviral LTRs. Other suit 0071. In a seventh aspect of the invention there is provided able promoters will be known to the skilled artisan. The a biological inhibitor as described in the first aspect of the expression constructs will desirably also contain sites for invention for use in medicine. transcription initiation and termination, and in the transcribed 0072. In an eighth aspect of the invention there is provided region, a ribosome binding site for translation. (WO a biological inhibitor as described in the first aspect of the 98/16643) invention for use in treating Chronic Lymphocytic Leu 0063. The vector is then introduced into the host through kaemia, Acute lymphocytic leukaemia, Acute myeloid leu standard techniques. Generally, not all of the hosts will be kaemia, non-Hodgkins lymphomas, chronic myeloid leu transformed by the vector and it will therefore be necessary to kaemia, multiple myeloma, ovarian carcinoma, prostate select for transformed host cells. One selection technique cancer, breast cancer, melanoma, lung cancer, colorectal can involves incorporating into the expression vector a DNA cer, glioblastoma, pancreatic cancer and hepatocellular can sequence marker, with any necessary control elements, that C. codes for a selectable trait in the transformed cell. These 0073. By “treatment' we include the meanings that the markers include dihydrofolate reductase, G418 or neomycin number of cancer cells characterising the disease to be treated resistance for eukaryotic cell culture, and tetracyclin, kana is reduced and/or further cancer cell growth is retarded and/or mycin or amplicillin resistance genes for culturing in E. coli prevented and/or cancer cells are killed. and other bacteria. Alternatively, the gene for such selectable 0074 Chronic Lymphocytic Leuakemia can be identified trait can be on another vector, which is used to co-transform using the criteria laid out in Example 1 which is based on the the desired host cell. World Health Organisation classification of Neoplasms of 0064. Host cells that have been transformed by the recom Haemopoietic and lymphoid tissues. binant DNA of the invention are then cultured for a sufficient 0075. In a ninth aspect of the invention there is provided time and under appropriate conditions known to those skilled the use of a biological inhibitor as described in the first aspect in the art in view of the teachings disclosed herein to permit of the invention in the manufacture of a medicament for the expression of the polypeptide, which can then be recov treating Chronic Lymphocytic Leukaemia, Acute lympho ered. cytic leukaemia, Acute myeloid leukaemia, non-Hodgkins 0065. The polypeptide of the invention can be recovered lymphomas, chronic myeloid leukaemia, multiple myeloma, and purified from recombinant cell cultures by well-known methods including ammonium Sulphate or ethanol precipita ovarian carcinoma, prostate cancer, breast cancer, melanoma, tion, acid extraction, anion or cation exchange chromatogra lung cancer, colorectal cancer, glioblastoma, pancreatic can phy, phosphocellulose chromatography, hydrophobic inter cer and hepatocellular cancer. action chromatography, affinity chromatography, 0076. The biological inhibitors of the invention can be hydroxylapatite chromatography and lectin chromatography. used to manufacture a pharmaceutical composition (medica Most preferably, high performance liquid chromatography ment) that can be used to treat diseases such as Chronic (“HPLC) is employed for purification. Lymphocytic Leukaemia, Acute lymphocytic leukaemia, 0066. Many expression systems are known, including (but Acute myeloid leukaemia, non-Hodgkins lymphomas, not limited to) systems employing: bacteria (eg. E. coli and chronic myeloid leukaemia, multiple myeloma, ovarian car Bacillus subtilis) transformed with, for example, recombi cinoma, prostate cancer, breast cancer, melanoma, lung can nant bacteriophage, plasmid or cosmid DNA expression vec cer, colorectal cancer, glioblastoma, pancreatic cancer and tors; yeasts (eg. Saccaromyces cerevisiae) transformed with, hepatocellular cancer. for example, yeast expression vectors; insect cell systems 0077. In a tenth aspect of the invention there is provided a transformed with, for example, viral expression vectors (eg. method of treating a disease comprising the step of adminis baculovirus); plant cell systems transfected with, for example tering to a subject a biological inhibitor as described in the viral or bacterial expression vectors; animal cell systems first aspect of the invention, wherein the disease is selected transfected with, for example, adenovirus expression vectors. from Chronic Lymphocytic Leukaemia, Acute lymphocytic 0067. The vectors can include a prokaryotic replicon, such leukaemia, Acute myeloid leukaemia, non-Hodgkins lym as the Col E1 ori, for propagation in a prokaryote, even if the phomas, chronic myeloid leukaemia, multiple myeloma, ova vector is to be used for expression in other, non-prokaryotic rian carcinoma, prostate cancer, breast cancer, melanoma, cell types. The vectors can also include an appropriate pro lung cancer, colorectal cancer, glioblastoma, pancreatic can moter Such as a prokaryotic promoter capable of directing the cer and hepatocellular cancer. expression (transcription and translation) of the genes in a 0078. The term “subject” means all animals including bacterial host cell, such as E. coli, transformed therewith. humans. Examples of Subjects include humans, cows, dogs, 0068 A promoter is an expression control element formed cats, goats, sheep, and pigs. The term "patient’ means a by a DNA sequence that permits binding of RNA polymerase Subject having a disorder in need of treatment. and transcription to occur. Promoter sequences compatible 007.9 The disease to be treated may be progressive, i.e. with exemplary bacterial hosts are typically provided in plas that the disease worsens overtime (i.e. is not stable or does not mid vectors containing convenient restriction sites for inser improve). In the case of CLL, patients are considered to have tion of a DNA segment of the present invention. progressive disease if the following criteria were met: pro 0069. In a fifth aspect of the invention there is provided the gression during the preceding 3 months in disease-related use of a biological inhibitor as described in the first aspect of anaemia (haemoglobin-100 g/l), thrombocytopenia (<100x the invention in the induction of cell death. 10/1) and/oran increase in spleen/liver/lymph-node size and/ 0070. In a sixth aspect of the invention there is provided a or more than a 2-fold increase in the blood lymphocyte count, method of inducing cell death in one or more cells comprising if not the patients were considered non-progressive. exposing a cell expressing ROR1 to a biological inhibitor as 0080. In an eleventh aspect of the invention there is pro described in the first aspect of the invention. vided a pharmaceutical composition comprising a biological US 2014/0004156 A1 Jan. 2, 2014

inhibitor as described in the first aspect of the invention and a siRNA having a sequence selected from AAUGAAC pharmaceutically acceptable excipient, diluent or carrier. CAAAGAAUAACAUC, AAAAAUCUAUAAAGGC 0081. The examples describe some methods of producing CAUCU or AACAUGUCAAUUCCAAAUCAU. pharmaceutical formulations, however the skilled person will 0100 13. A nucleotide sequence encoding a biological appreciate that the most appropriate formulation will depend inhibitor as described in any previous paragraph. on a number of factors including route of administration, 0101. 14. An expression vector containing a nucleotide patient type (e.g. patient age, weight/size). sequence as described in paragraph 13. 0082 Preferably the pharmaceutical composition induces 0102 15. A host cell comprising a nucleotide sequence or cell death in a cell expressing ROR1. expression vector as described in paragraphs 13 or 14. 0083. In a twelfth aspect of the invention there is provided 0103 16. Use of a biological inhibitor as defined in para a kit of parts comprising: graphs 1 to 12 in the induction of cell death of a cell. 0084 (i) a biological inhibitor as described in the first 0104 17. A method of inducing cell death in one or more aspect of the invention or a pharmaceutical composition as cells comprising exposing a cell expressing ROR1 to a described in the eleventh aspect of the invention: biological inhibitor as defined in paragraphs 1 to 12. 0085 (ii) apparatus for administering the antibody, siRNA 0105. 18. A biological inhibitor as defined in paragraphs 1 or pharmaceutical composition; and to 12 for use in medicine. I0086 (iii) instructions for use. 0106 19. A biological inhibitor as defined in paragraphs 1 to 12 for use in treating a disease selected from Chronic EMBODIMENTS OF THE INVENTION Lymphocytic Leukaemia, Acute lymphocytic leukaemia, 0087 Embodiments of the invention are described in the Acute myeloid leukaemia, non-Hodgkin lymphomas, following numbered paragraphs. chronic myeloid, multiple myeloma, ovarian carcinoma, I0088 1. A biological inhibitor of ROR1. prostate cancer, breast cancer, melanoma, lung cancer, col 0089 2. A biological inhibitor as described in paragraph 1 orectal cancer, glioblastoma, pancreatic cancer and hepa wherein the inhibitor binds specifically to either an extra tocellular cancer. cellular domain of ROR1, an intracellular domain of ROR1 0107 20. Use of a biological inhibitor as defined in para or to an nucleotide sequence encoding ROR1. graphs 1 to 12 in the manufacture of a medicament for 0090. 3. A biological inhibitor as described in paragraph 1 treating a disease selected from Chronic Lymphocytic Leu or 2 wherein the inhibitor is selected from an antibody, kaemia, Acute lymphocytic leukaemia, Acute myeloid leu interfering nucleic acid molecule or a soluble receptor. kaemia, non-Hodgkin lymphomas, chronic myeloid, mul 0091 4. A biological inhibitor as described in paragraph 3 tiple myeloma, ovarian carcinoma, prostate cancer, breast wherein the antibody is a complete antibody or a fragment cancer, melanoma, lung cancer, colorectal cancer, glioblas thereof. toma, pancreatic cancer and hepatocellular cancer. 0092 5. A biological inhibitor as described in any previ 0108) 21. A method of treating a disease comprising the ous paragraph wherein on specific binding to ROR1 or the step of administering to a Subject a biological inhibitor as nucleotide sequence encoding ROR1, the biological claimed in paragraphs 1 to 12, wherein the disease is inhibitor induces cell death in a cell expressing ROR1. selected from Chronic Lymphocytic Leukaemia, Acute 0093. 6. A biological inhibitor as described in any of para lymphocytic leukaemia, Acute myeloid leukaemia, non graphs 1 to 4 wherein the extracellular domain to which the Hodgkin lymphomas, chronic myeloid, multiple myeloma, biological inhibitor binds has the amino acid sequence ovarian carcinoma, prostate cancer, breast cancer, mela WNISSELNKDSYLTL. noma, lung cancer, colorectal cancer, glioblastoma, pan 0094 7. A biological inhibitor as described in any of para creatic cancer and hepatocellular cancer. graphs 1 to 4 wherein the intracellular domain to which the 0109 22. A biological inhibitor, use or method as claimed biological inhibitor binds has the amino acid sequence in paragraphs 19 to 21 wherein the disease is progressive. NKSQKPYKIDSKQAS. 0110 23. A biological inhibitor, use or method as claimed 0095 8. A biological inhibitor as described in any of para in paragraphs 19 to 22 wherein the disease is Chronic graphs 1 to 5 wherein the interfering nucleic acid molecule Lymphocytic Leukaemia. is an interfering RNA molecule such as a siRNA, an anti 0111 24. A pharmaceutical composition comprising a Sense RNA or a dsRNA. biological inhibitor as defined in paragraphs 1 to 12 and a 0096 9. A biological inhibitor as described in any of para pharmaceutically acceptable excipient, diluent or carrier. graphs 1 to 5 and 8 wherein the interfering nucleic mol 0112) 25. A pharmaceutical composition as claimed in ecule is complementary to the nucleotide sequence encod claim 18 which induces cell) death in a cell expressing ing ROR1 or fragments or variants thereof. ROR1. 0097 10. A biological inhibitor as described in paragraph 0113. 26. A kit of parts comprising: 9 wherein the interfering nucleic acid is an antisense poly 0114 (i) a biological inhibitor as claimed in paragraphs nucleotide which is capable of hybridising to the nucle 1 to 12 or a pharmaceutical composition as claimed in otide sequence encoding ROR1 or fragments or variants paragraphs 24 or 25; thereof. 0115 (ii) apparatus for administering the biological 0098 11. A biological inhibitor as described in paragraph inhibitor or pharmaceutical composition; and 9 or 10 wherein the interfering nucleic acid is complemen 0116 (iii) instructions for use. tary to either a nucleotide sequence encoding an extracel 0117 27. A biological inhibitor substantially as described lular domain of ROR1 or a nucleotide sequence encoding herein with reference to the examples and figures. an intracellular domain of ROR1. 0118, 28. A use of a biological inhibitor substantially as 0099 12. A biological inhibitor as described in any of described herein with reference to the examples and fig paragraphs 5 to 7 wherein the interfering nucleic acid is an U.S. US 2014/0004156 A1 Jan. 2, 2014

0119 29. A method using a biological inhibitor substan 0.137 Shows cell surface staining for Ror1 (M-Ror-1) tially as described herein with reference to the examples and CD19 of leukaemic cells from progressive and non-pro and figures. gressive CLL patients as well as PBMC of a healthy donor. 0120 30. A pharmaceutical composition substantially as 0.138 FIG. 7 Specificity control of the polyclonal anti described herein with reference to the examples and fig bodies. U.S. 0.139 Upper panel: Western blot analyses using a com 0121 31. A kit of parts substantially as described herein mercially available anti-Ror-1 polyclonal antibody (N-Ror with reference to the examples and figures. 1). Both antibodies react with the same 37 kDA band. The recombinant extracellular part of the Ror-1 protein was EXAMPLES expressed in E-coli and Supernatant concentrated 30x. 0140 Lower panel: Western blot using a serially diluted 0122) The following examples embody various aspects of commercially available recombinant Ror-1 protein represent the invention. It will be appreciated that the specific antibod ing a cytoplasmic region and probed with our rabbit poly ies and/orantigens used in the examples serve to illustrate the clonal antibody c-Ror-1-904. The Ror-c-1-904 antibody did principles of the invention and are not intended to limit its not react with the recombinant extra cellular part of the Ror-1 Scope. protein (data not shown). 0123. The following examples are described with refer 0141 FIG. 8 Ror1 protein in activated normal B cell is ence to the accompanying figures in which: not phosphorylated 0.124 FIG.1—Schematic presentation of the ROR1 gene 0.142 PMA/ionomycin activation of normal B cells and the Ror1 protein. induced expression of the Ror-1 protein which is not phos 0.125. The human ROR-1 gene has a coding region of 2814 phorylated. bp which predicted 937 amino acids sequence and 105 kDa 0.143 Panel A=Immunoblotting of cell lysates of purified protein size including an Ig-like domain, cysteine-rich normal peripheral B cells activated with PMA/ionomycin and domain, kringle domain, tyrosine kinase domain, and pro probed with anti-Ror1 Mab line-rich domain. 0144 Panel B=Immunoprecipitation (using anti-Rorl 0126 Positions of antibody recognition sites of N-Ror1-Ig Mab) of purified normal blood B cells activated with PMA/ (RSTIYGSRLRIRNLDTTDTGYFQ), N-Ror1-CRD (YME ionomycin, treated without (-) or with (+) perveanadate (pos SLHMQGEIENQI), N-Ror1-KNG (CQPWNSQYPHTHT control, to induce phosphorylation), stained with PY99 FTALRFP), C-Ror1-17, C-Ror1-904 (NKSQKPYKID monoclonal antibody and reprobed with N-ROrl. SKQAS) (Y) as well as the protein domains: 0145 PMA/ionomycin activated B cells did not show any Immunoglobulin like domain (Ig), cysteine rich domain autophosphorylation. (CRD), Kringle domain (Kr), transmembrane domain (TM), 0146 FIG.9 The Ron protein is constitutively phospho tyrosine kinase domain (TK), serine and threonine rich rylated in CLL cells. domain (S/T), and proline rich domain (P) are indicated. 0147 A representative experiment of a CLL patient. 0127 FIG. 2 Map of human chromosome 1 indicating Immunoblotting performed for protein phosphorylation part of the genes overexpressed in B-CLL. using a phosphotyrosine monoclonal antibody (PY99). Cell 0128 FIG. 3 ROR1 gene expression (RT-PCR) in CLL lysates were subjected to immunoprecipitation with an anti cells vs control donor Rorl monoclonal antibody. The PY99 antibody was used for 0129. Positive control-PCR product cloned into pGEM-T probing of phosphorylation with Subsequent stripping and easy vector reprobing with the N-Rorl polyclonal antibody. 0130 Negative control-reaction mixture without tem 0.148 FIG. 10 Anti-Rorl monoclonal antibodies plate induced Apoptosis (Annexin-V/PI) of CLL cells (CLL 0131 FIG. 4 ROR1 gene expression: PMA/ionomycin patient no. 1) is required to induce expression in normal lymphocytes 0149 Anti Ror-1 monoclonal antibodies against the exter 0132 A representative example of Ror1 expression in nal domain of the Ror-1 receptor induce apoptosis of CLL activated (PMA/ionomycin) normal B and T lymphocytes, cells. The pattern of apoptosis varied between patients. tonsil B cells and leukaemic CLL cells after 48 h of culture. 0150. CRD-cysteine-rich domain KNG-kringle domain; The expression was determined by quantitative real-time Ig immunoglobulin domain PCR. Fold increase was related to the level observed at time 0151 FIG.11—Anti-Rod monoclonal antibodies induced Zero. CLL cells and tonsil B cells, which constitutively Apoptosis (Annexin-V/PI) of CLL cells (CLL patient no. 2) express Ron mRNA could not be further activated, while the 0152 Anti Ror-1 monoclonal antibodies against the exter strong activation signal induced gene expression of Rod in nal domain of the Ror-1 receptor induce apoptosis of CLL normal B and T cells. cells. The pattern of apoptosis varied between patients. 0.133 *=CLL cells and tonsil B cells constitutively 0153. CRD-cysteine-rich domain KNG-kringle domain; expressed ROR1 and could not be further activated Ig immunoglobulin domain 0134 FIG. 5 Ror1 protein expression in CLL cells and 0154 FIG. 12 Anti Rod IgG antibody induced cytotox healthy controls (Western blot) icity in ADCC of CLL cells. 0135 All three antibodies showed a 105 kD band. C-Ror (O155 ADCC (18 hr) using anti-Ror1 MAb and EHEB 1-904 also detected an estimated 130 kDA variant of Ror-1. CLL cell line as target and normal healthy donor PBMC as The blots were stripped and stained with a beta-actin antibody effector cells to show the intriguity of the loaded samples. 0156 ADCC (18 hr) using anti-Ror1 MAb and CLL cells 0.136 FIG. 6—Cell surface staining intensity for Ror1 as target and Syngenic NK cells as effector cells. Results from compared to CD19 in two CLL patients and a healthy donor three different patients are used US 2014/0004156 A1 Jan. 2, 2014

(O157 FIG. 13 Anti Rod IgG antibody induces cell death Example 1 of tumor cell lines originating from lung cancer (A549) and prostate cancer (DU145) Generation of Rorl Specific Antibodies 0158 Treatment of both the A549 lung cancer cell line, and the DU145 prostate cancer cell, line with the KNG anti Generation of Anti-Rorl Antibodies body and cross-linking antibody induces significant cell death compared to control antibody. 0.178 Mouse monoclonal antibodies were generated 0159 FIG. 14. In vivo treatment with anti Ror-1 IgG against four synthetic peptides depicted in Table 1. Immuno antibodies depletes primary CLL cells grafted into SCID grade peptides were purchased from Thermo Electron Cor 1C poration (GmbH, Ulm, Germany). Keyhole limpet hemocya (0160 PBMCs from a severely affected CLL patient were nin (KLH)-conjugated peptides were used for generating grafted into SCID mice. Treatment with anti-ROR MAbs mouse monoclonal antibodies (mAb) according to standard totally depleted the human cells from the peritoneum of the protocol with minor modifications (Kohler and Milstein C, 1CC. (1975) Nature 256 pp. 495-7). (0161 FIG. 15 siRNA downregulation of Ror-1 mRNA 0179 The specificity of the generated monoclonal anti measured by RT-PCR in CLL bodies was determined by ELISA assay using irrelevant pep 0162 siRNA mediated down regulation of Ror-1 mRNA tides and proteins as well as COS-7 cell line transfected with as measured by quantitative real-time PCR in CLL cells. Rorl gene. TABLE 1. Rorl peptides used for monoclonal antibody deneration

Produced Peptide Sequence Location mAb class Ig24 RSTIYGSRLRIRNLDTTDTGYFO 108-130 IgM

CRD16 YMESLHMOGEIENOI 188-202 IgM, IgG1

COPWNSOYPHTHTFTALRFP 334-353 IgM, IgG1

0163 FIG.16—siRNA silencing of Ror-1 induced Apop Preparation of Immunogenic Peptides tosis of CLL cells 0180 A peptide and KLH (Sigma) was made by mixing 1 0164 siRNA mediated silencing of Ror-1 resulted in spe mg of peptide with 5 mg of KLH in 1.03 ml of ionized water, cific apoptosis of CLL cells. Results of three different patients thereafter, 400 ul of PBS was added to the KLH and peptide (three different siRNA constructs were used). solution. After 2 min of mixing, 1.2 ul of 25% glutaraldehyde 0.165 FIG. 17 V, and V. sequences for Anti-Ror1 Ig24 was added. The mixture was shaken for 1 hr at room tempera (clone 2A4) antibody ture. The conjugated peptide was stored at -20°C. for later (0166 FIG. 18 V, and V. sequences for Anti-Ror1 use. The same procedure was performed for conjugation of CRD16 (clone 1C11) antibody peptide to BSA. 0167 FIG. 19 V, and V. sequences for Anti-Ror1 0181. To check the efficiency of conjugation, 10ul of each KNG20 (clone 4C10) peptide-KLH and peptide-BSA was mixed with 5 ul of (0168 FIG.20 Cell surface staining of PBMC of healthy sample buffer and boiled for 2-5 min and cooled on ice. donor Electrophoresis was performed using 10% SDS-PAGE gel 0169 Conducted using six anti-ROR1 antibodies, 2A4, with a mini-PROTEAN electrophoresis instrument (Bio 1C11, 4A7, 3B8, 1 D8 and 4C10. Rad) 100 mA for 1 hour. The gel was stained with Coomassie Blue R-250 (Sigma). The change in mobility shift of conju 0170 FIG.21—Cell surface staining of CLL lymphocytes gated and non-conjugated KLH and BSA represents the effi 0171 Conducted using six anti-ROR1 antibodies, 2A4, ciency of conjugation. 1C11, 4A7, 3B8, 108 and 4C10. 0172 FIG.22 Comparison of frequency of cells stained Immunization Protocol with anti-ROR1 antibodies for CLL patients and healthy donors 0182 Four BALB/c mice were used for each peptide 0173 FIG. 23 Comparison of frequency of cells stained immunization. Each mouse was immunized 5 times with an interval of two weeks. The first immunization was performed with anti-ROR1 antibodies for progressive and non-progres with 100 ug of peptide conjugate mixed at an 1:1 ratio with sive CLL disease Complete Freund's Adjuvant injected intra peritoneal at a 0174 FIG. 24—Anti-Rorl monoclonal antibodies Volume not exceeding 100 ul. For the Subsequent immuniza induced Apoptosis (Annexin-WI) of CLL cells tions, 50 lug of peptide-KLH were mixed with Incomplete 0175 Comparison of six anti-ROR1 antibodies, 2A4, Freund's Adjuvant. 1C11, 4A7, 3B8, 1 D8 and 4C10 0183. One week before the last immunization, blood was (0176 FIG. 25 PARP cleavage in CLL cells collected by a vertical incision of the tail. Serum was prepared 0177 Gel showing cleaved PARP in response to anti and specific antibodies were checked using ELISA. Three ROR1 antibodies in comparison to rituximab, murine anti days before the cell fusion, 201g of KLH-peptide without any body and no antibody controls. adjuvant was injected intravenously. US 2014/0004156 A1 Jan. 2, 2014

Serum ELISA mol/l Tris buffer pH: 9.0. The Eluted antibody was dialyzed 0184 Each well was coated with 20 ug/ml of the immu with PBS pH: 7.5. The method for purification of IgM anti nizing peptide in PBS. ELISA plates were incubated at 37°C. bodies was the same as for IgG antibodies except that the for one hour and thereafter overnight at 4°C. Next day the affinity column was a Sepharose 4B-rabbit anti mouse IgM. plates were washed 3 times with PBS/Tween buffer for 5 min, 0191 The sequences for the three monoclonal antibodies blocked with 2.5% BSA at 37° C. for 1.5 hr and thereafter generated are found in FIGS. 17 to 19. The V, and V. again washed X3 with PBS/Tween buffer. sequences of the Anti-Rorl Ig24 (clone 2A4) antibody are 0185. The serum was serially diluted with PBS (1:100, found in FIG. 17. The V, and V. sequences of the Anti-Ror1 1:250, 1:500, 1:1000, 1:2000). A total volume of 100 ul was CRD16 (clone 1C11) antibody are found in FIG. 19. The V, added to each well and incubated at 37° C. for 1.5 hr, where and V sequences of the Anti-Ror1 KNG20 (clone 4C10) after plates were washed. 100 ul of rabbit anti-mouse Ig antibody are found in FIG. 19. conjugated with HRP diluted 1:1000 was used as secondary Example 2 antibody. After washing 100 ul of tetramethylbenzidine (TMB) substrate was added to each well and the plates were Isolation of Cells incubated at room temperature in a dark place. After 15 min the reaction was stopped by adding 30 Jul of stopping Solution Patients (0.16 M sulphuric acid) to each well. The optical density (OD) was measured at 450 nm using an ELISA reader. Mice (0192. The World Health organisation (WHO) Classifica with an adequate antibody response were ready for fusion and tion of Neoplasms of the Haematopoietic and Lymphoid Tis hybridoma generation. sues was applied (Harris NL et al., Histopathology 2000; 36:69-86). The diagnosis of CLL (n=100) was based on Hybridoma Production immunophenotyping (CD5+/CD19+/CD23+/IgM+) and the presence of >5.0x10/l lymphocytes in peripheral blood. 0186 The mouse myeloma SP2/0 cell line was used for 0193 Patients with CLL were considered to have progres generating the hybridoma. Cells were cultured in RPMI sive disease according to a modification of the criteria of the (GIBCO) and 10% FBS until reaching to >70% confluency. NCI committee National Cancer Institute—sponsored work 0187. One day before cell fusion, murine BALB/C perito ing group guidelines for chronic lymphocytic leukaemia: neal macrophages were isolated by peritoneal lavage of 5 ml revised guidelines for diagnoses and treatment. Cheson Bet RPMI. The isolated peritoneal fluid was washed twice with al, Blood 87, 4990-4997, 1996, if there was a progression RPMI. The cells were incubated in RPMI and 20% FBS for during the preceding 3 months in disease-related anaemia 24-48 hr at 37 C with 5% CO. Spleens of the immunized (haemoglobin-10.0 g/dl), thrombocytopenia (<100x10/1) mouse were removed at Sterile conditions. To acquire a single and/or an increase in spleen/liver/lymph-node size and/or cell suspension, 10 ml of RPMI was injected to the spleen more than a two-fold increase in the blood lymphocyte count. from different angles. The collected cells were washed twice When these criteria were not fulfilled, the patients were con with RPMI for 10 min and centrifuged at 1000 rpm. sidered as having non-progressive disease. 0188 A 50 ml sterile Falcon tube was selected and SP2/0 0194 Heparinized or citrated peripheral blood or bone cells were mixed with the spleen cells at a ratio of 1:10 (1 marrow was collected from patients with CLL and blood was SP2/0 and 10 spleen cells). The mixture was washed twice in also drawn from normal healthy donors (n=10). All samples RPMI. 800 ul of pre-warmed (37° C.) 50% PEG 1500 were collected with informed consent and approval by the (Sigma) was added to the cell pellet slowly by mixing at the local ethics committee. same time. Immediately after adding PEG, 20 ml of pre warmed RPMI was added to the. The cells were washed twice Isolation of Blood Mononuclear Cells, Granulocytes, Band T at 500 rpm. Selective HAT medium was added to the pellet Lymphocytes (2x10 cells/ml) and cells were seeded into a 96-well plate. Cells were incubated at 37°C. with 5% CO and growth and (0195 Peripheral blood mononuclear cells (PBMC) and colony formations were examined daily. Colonies appeared bone marrow mononuclear cells (BMMC) were isolated after 5-10 days. Once the colony diameter reached to 1 mm using Ficoll-Hypaque (GE Healthcare, Uppsala, Sweden) the presence of antibody against the immunized peptide was density-gradient centrifugation as previously described (Rez determined by ELISA. After two weeks of incubation 100 ul vany M Ret al., Br J Haematol 2000: 111:608-17). of supernatant from each well were collected and ELISA 0.196 Granulocytes were recovered from the top of the assay was performed using peptide alone, KLH-peptide, erythrocyte layer after Ficoll-Hypaque density-gradient cen BSA-peptide, and KLH only as coating antigen. trifugation. Erythrocytes were lysed by hypo-osmosis in cold water. More than 98% of the nucleated cells were granulo Antibody Purification cytes as evaluated by immunocytology (data not shown). 0.197 Tonsil tissue was cut and passed through a metal 0189 The monoclonal antibodies were purified by affinity grid and Suspension of tonsil mononuclear cells was prepared chromatography based on their isotypes. For IgG subclasses by Ficoll-Hypaque density-gradient centrifugation (ReZVany Hi-Trap Protein G Column (Pharmacia Biotech) was used. M Ret al., Br J Haematol 2000: 111:608-17). Briefly, the hybridomas were cultured in RPMI with 10% (0198 Tand B lymphocytes were purified from PBMC by FBS and supernatants were collected every 36 hr. The super negative selection using MACS beads (Miltenyi Biotec natants were filter-sterilized (45 nm) and pH was adjusted to GmbH, Bergisch Gladbach, Germany) according to manu 7.5bp adding 10xPBS buffer before loading to the protein G facturers instruction. column. (0199 Leukaemic B cells and tonsil mononuclear cells 0190. The elution was performed using 0.1 mol/l glycine were also enriched using nylon wool purification (Rezvany M pH: 2.7. The pH of eluted antibody was adjusted to 7.0 with 1 Ret al., Br J Haematol 2000: 111:608-17). The purity of US 2014/0004156 A1 Jan. 2, 2014 10 isolated mononuclear cells was analysed by direct immunof TABLE 2-continued luorescence using conjugated monoclonal antibodies (MAb) against CD3, CD19, and CD14 (BD Biosciences, San Jose, ROR1 gene expression (RT-PCR) in CLL patients and healthy Calif., USA) and flow cytometry (FACSCalibur BD Bio control donors Sciences). positive cases total Cell source analysed Results Tonsil B cells 2.2 Granulocytes * Of 10 (0200 PBMC of all CLL patients (n=100) as well as *Purity >90% BMMC (n=2) expressed ROR1 at the mRNA level. ROR1 **purity >98% was weakly expressed also on normal tonsil B cells (2/2) but PBMC = peripheral blood mononuclear cells, not in healthy donor PBMC (0/10), isolated normal B cells BMMC = bone marrow mononuclear cells (0/6) and T cells (0/3) or enriched blood granulocytes (0/10) (Table 2). Example 3 TABLE 2 RT-PCR Amplification ROR1 gene expression (RT-PCR) in CLL patients and healthy RT-PCR and RT-QPCR Amplification of ROR1 control donors 0201 RT-PCR amplification was done using ROR1 spe positive cases total cific primers (Table 3). The amplification profile included 5 Cell source analysed min denaturation at 95°C. followed by 35 cycles of 94° C., 60° C., and 72°C. for 30 sec each, using AmpliTaq Gold DNA CLL polymerase (Applied Biosystems, Foster City, Calif., USA). PMBC 100,100 (0202 Real-Time quantitative PCR(RT-QPCR) was per BMMC 2.2 formed as described earlier (Mikaelsson E et al., Blood 2005; Healthy donors 105:4828-35). The amplification profile included 5 min dena PBMC Of 10 turation at 95°C. followed by 35 cycles of 94, 60 and 72° C. T cells O.3 for 30 sec. each using AmpliTaq Gold DNA polymerase B cells* Of6 (Appl. Biosystems, Foster City, Calif., USA). For further details see Mikaelsson et al, Blood 105, 4828, 2005. TABLE 3 Primers and probes used in ROR1 PCR amplifications and quantifications Amplicon Target Primer (5'-->3') Position size (bp) Reference

t-Ror1 S: CCAAAGGACCTTCTGCAGTGGAA (P10) 687 - 7 O9 450 (10) (truncated) As TCTCATTCCAGCACTCTGTCATGAGG (P9) 1111 1136

ROR1 (RT- S: CTGCTGCCCAAGAAACAGAG (P1) 455 - 474 545 g. b. PCR) AS: CATAGTGAAGGCAGCTGTGATCT (P2) 977-999 M9767s

B-actin (RT- S: ATTAAGGAGAAGCTGTGCTACGTC 7 O7-73. O 215 g. b. PCR) AS: ATGATGGAGTTGAAGGTAGTTTCG 898-921 NM 00110 1.

ROR1 (RT- s: AAAGAGCTACCTCTTTCTGCTGTACG (P3) 1771- 17s g. b. OPCR) 1796 M9767s As: CTTCTTGTTGAAATTCCGTCCATTG (P4) 1921 1945 Probe: QCATGCTCAGCTGGTTGCTATCAAGACC9 1869 - 1896

B-actin (RT- S: CGACAGGATGCAGAAGGAGA 929-948 161 g. b. OPCR) NM 00110 1. AS: CGTCATACTCCTGCTTGCTG 1070 1089 Probe: QAAGATCAAGATCATTGCTCCTCCTGAG 9 975 - 1 OO1

ROR1 (RT- S: ATGAATAACAT CACCACGTCTCTGGGCC (P5) 565-592 1005 g. b. PCR) As: CTCCTTGGAATCCTTTGAATCGCA (P6) 1546- M9767s (Extracellular 1569 domain) US 2014/0004156 A1 Jan. 2, 2014

TABLE 3 - continued Primers and probes used in ROR1 PCR amplifications and quantifications Amplicon Target Primer (5'-->3') Position size (bp) Reference

ROR1 (RT- s: TTCTTCATTTGCGTCTGTCG (P7) 1642- 1116 g. b. PCR) 1661 M9767s (Kinase AS: CTGGCTCGGGAACATGTAAT (P8) 2738 domain) 2757 S = Sense, AS = AntiSense, Q = Blue - 6–FAM, 9 = TAMRA, P1-P8 = primer number as in FIG. 1, g. b. = genebank

Results Results 0203 Representative RT-PCR experiments of healthy 0208 Mutation analysis of cloned extracellular and cyto donors and CLL patients are shown in FIG. 3. plasmic kinase domains of the ROR1 gene was analyzed in 10 CLL patients and showed no major genomic aberrations. E le 4 Only few point mutations (silent mutations) were found (data Xample not shown). PCR amplification to detect a truncated ROR1 (t-Rorl) using primers P9 and P10 did not give rise to any Sequencing amplicon (data not shown) Sequence for truncated Ror. Sense: CCAAAGGACCTTCTGCAGTGGAA; anti-sense: Sequencing of Clonal Immunoglobulin V(D)J TCTCATTCCAGCACTCTGTCATGAGG. Rearrangements and ROR1 Example 5 0204 Amplification of the immunoglobulin V(D)J rear rangements was performed by Expression of ROR1 0205 PCR using cDNA from PBMC, consensus VH fam ily primers as sense and constant LL chain primeras antisense. Activation of B and T Lymphocytes of Healthy Donors and The method has been described in detail previously (Kokhaei B-CLL Cells Pet al., Exp Hematol 2007:35:297-304; Willems P. et al., 0209 CLL cells, isolated normal T and B cells, as well as Belgium-Dutch Hematology-Oncology Group. Blood 2000; tonsil B cells were cultured in 6-wells culture plates (4x10' 96:63-70). The amplification included 5 min denaturation at cells/well) in 2 ml of DMEM medium (Invitrogen, Carlsbad, 95°C. followed by 40 cycles at 94° C. for 30 sec, 60° C. for Calif., USA) supplemented with 10% human AB serum, 100 30 sec and 72° C. for 30 sec using Ampli Taq Gold DNA U/ml penicillin, 100 ug/ml streptomycin and 2 mM polymerase. CH gene family-specific primers were used (see L-Glutamine for 48 hours at 37°C. in humidified air with 5% Kokhaei et al. Exp Hematol 2007, 35,297. CO2 and stimulated with 25 ng/ml PMA+1 ug/ml ionomycin 0206 Both extracellular and intracellular domains of (Sigma, St. Louis, Mo., USA). ROR1 gene were separately amplified by RT-PCR The ampli 0210. After 48 hours of culture the cells were harvested, fication profile included 5 min denaturation at 95° C. fol RNA isolated and cDNA prepared. The expression of ROR1 lowed by 35 cycles at 94, 60 and 72°C. for 30 sec each using was analyzed by Real-Time quantitative PCR (RT-QPCR) Ampli Taq gold DNA polymerase (Mikaelsson et al. Blood using primers and conditions described above. 6-actin 2005, 105, 4828) using cDNA of CLL patients and cloned expression was used as endogenous control to quantify the into pGEM-T easy vector (Promega, Madison, Wis., USA) ROR1 expression. and sequenced. Extracellular domain. Sense: ATGAATAA CATCACCACGTCTCTGGGCC; anti-sense: CTCCTTG Production of Anti-Rorl Antibodies and Specificity Testing GAATCCTTTGAATCGCA. Intracellular domain sense: 0211 Rabbitanti-human Rorl polyclonal antibodies were TTCTTCATTTGCGTCTGTCG anti-sense: CTG produced against synthetic peptides from NKSQKPYKID GCTCGGGAACATGTAAT. The sequences were visually SKQAS aa 904-918 of human Ror1 (designated C-Ror1-904 compared with the ROR1 gene (Ensembl ID: antibody). ENSG00000185483). 0212 Polyclonal antibodies were produced according to a modified method of Hay H (J Clin Lab Immunol 1989; Sequencing of the ROR1 Gene 29:151-5). Rabbits less than 6 months old were injected i.m. (intramuscularly) with 125 ug of KLH-Peptide emulsified in 0207 PBMC of CLL patients were isolated, total RNA complete to Freund's adjuvant (Sigma. St. Louis, Mo., USA). prepared and cDNA synthesized as described above. ROR1 Serum samples were collected prior to injections for later specific primers were designed to amplify truncated t-Rorl titration. Booster injections (125 ug in incomplete Freund's (primers P9 and P10), the extracellular domains including Ig, adjuvant) were given at 2 weeks intervals. After the 4" injec CRD, and kringle domains (primers P5 and P6), as well as the tion, Sera were tested for the presence of anti-peptide anti kinase domain (primers P7 and P8). The PCR products were bodies in ELISA. Rabbits with the highest antibody titres cloned into pGEM-T easy vector (Promega) and subjected to were boosted with two additional immunizations. Sera were sequencing using T7, Sp6 and gene specific primers (Table 3). affinity purified using activated Sepharose 4B column (Phar US 2014/0004156 A1 Jan. 2, 2014 macia, Uppsala, Sweden) conjugated with peptide. The goat IgG antibody (secondary antibody) (Southern biotech, eluted antibody was dialyzed against PBS (0.15M. pH 7.2) Birmingham, Ala., USA) and mouse serum (blocking serum) and stored at -20°C. until use. (DakoCytomation). 0213 Immunograde peptides were purchased from 0222 Surface staining of CLL cells and normal PBMC Thermo Electron Corporation GmBH, Ulm, Germany. Key was performed as described (Rezvany MR et al., Br J Hae hole limpet hemocyanin (KLH)-conjugated peptides were matol 2001; 115:263-71). Briefly, 2x10 cells were washed in used for generating the polyclonal antibodies. The polyclonal PBS and pre-incubated with serum-free RPMI (Invitrogen), antibodies were purified by affinity purification. at 37°C. for 1 h followed by three washings with RPMI. One 0214. A recombinant protein representing an intracellular microgram of the anti-Rorl antibody (N-Rorl) (R&D sys region of Ror1 with a molecular weight of around 70 kD tems) was added and incubated at +4°C. for 30 min. (Carna BioSciences, Inc., Chuo-ku, Kobe, Japan) was used 0223. The cells were washed twice with FACS buffer for specificity control of the C-Ror1-904 polyclonal antibody. (PBS, 0.1% sodium azide, and 0.5% FBS). FITC swine anti 0215 Briefly, the region was PCR amplified using a goat IgG (1:100) (Southern biotech) was added and incubated human full-length cDNA clone EN1031 D08 Ror1 gene at +4° C. for further 30 min. Blocking was performed by (Origene Technologies, Inc., Rockville, Md., USA) as tem adding 10 ul of 10% mouse serum followed by incubation at plate. The PCR products were cloned into pGEM-T easy +4° C. for 20 min. Both CD3 and CD19 antibodies were then vector and subcloned into pcDNA3.1+ vector (Invitrogen) added to the cells and incubated at +4°C. for 30 min. The cells and transformed into E. coli strain Origami (Invitrogen). The were finally washed twice with FACS buffer and fixed by integrity of the insert was verified by DNA sequencing. adding 1% paraformaldehyde in PBS. 0216. After selecting an in-frame clone, the supernatant of 0224. The CellOuest software program (BD Biosciences) 24 h cultured bacteria was collected and concentrated 30 was used to determine the percentage of Ror1 cells of the times using Amicon Ultra-15 Centrifugal Filter Units (sepa CD19 population. ration of polypeptides>10 kDa) (Millipore Corporation, Bed ford, Mass., USA). The concentrated recombinant was sub Results jected to Western blot and probed with anti-Ror1 antibody (goat anti-Rorl polyclonal antibody (N-Rorl) (R&D sys Specificity Control of Antibodies tems, Inc., Minneapolis, Minn., USA)) to determine the spe cific reactivity. 0225. Affinity purified antibodies compared to a commer cially available polyclonal antibody indicate that the affinity Western Blot purified antibodies specifically recognize Ror1 (FIG. 7). 0217. The goat anti-Rorl polyclonal antibody Expression of ROR1 in Activated Cells (N-Rorl) (R&D systems) as well as the antibodies pro duced in our lab (C-Ror1-904) were used in a Western blot. 0226. Thereafter, it was analysed whether ROR1 might be 0218 Cells were lysed in a buffer containing 1% Triton induced following in vitro activation. CLL cells, normal B X-100, 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM and T-lymphocytes and tonsil B cells were cultured with EDTA, and 1% protease inhibitor cocktail (Sigma). Protein PMA/ionomycin for 48 h to provide a strong activation sig concentration was measured by Thermo Scientific BCA Pro nal. CLL cells and normal tonsil B cells, which constitutively tein Assay Kit (Thermo Scientific, Rockford, Ill., USA) expressed Ror1 mRNA, could not be further activated. according to the manufacturers instructions. Fifty micro 0227. In contrast, a 15-25 fold increase in the ROR1 grams of cell lysates were run on a 10% Bis-Tris SDS-PAGE mRNA expression was observed in in vitro activated normal gel (Invitrogen) at 120 V for 3 hunder reducing conditions. Band T cells. A representative experiment is shown in FIG. 4. 0219. After electrophoresis, resolved proteins were trans The activated normal B cells also expressed Ror1 at the pro ferred onto Immobilon-PVDF membranes (Millipore Corpo tein level (Western blot) (FIG. 8). ration) in a mini Transblot cell (Invitrogen). The membranes were blocked for 1.5 h at room temperature with 5% non-fat Rorl Protein Expression milk in PBS plus 0.05% Tween 20 (PBS-T). All immun 0228. The Rorl protein expression in CLL (n=18) was ostainings were performed in PBS-T supplemented with 5% analyzed. Western blot analyses of cell lysates demonstrated non-fat milk. Filters were incubated with appropriate dilu in all CLL samples, the presence of two Rod specific bands, of tions of the anti-Ror1 antibodies over night at +4°C. 105 and an estimated of 130 kDa in size, respectively (FIG. 0220. After extensive washing with PBS-T, the filters were 5). incubated with peroxidase-conjugated goat anti-rabbit 0229. The commercially available antibody (N-Ror1) immunoglobulins (DakoCytomation, Glostrup, Denmark) seemed not to detect the estimated 130 kDa Rod variant. for 1.5 hat room temperature followed by washing and devel 0230. Surface expression of Rod in progressive and non oping with ECL chemiluminescence detection system (GE progressive CLL patients are shown in FIGS. 6, 20, 21, 22 and Healthcare). 23 and Table 4. Surface Staining and Flow Cytometry 0231. The figures show that the anti-ROR1 antibodies bind preferentially to cells from CLL patients and not to cells 0221) Cells were analysed by flow cytometry (FACSCali from healthy patient. All antibodies were able to bind CLL bur BD Biosciences) using N-Ror1 (primary antibody). cells but the antibodies specific for CRD appear to be of PE conjugated anti-CD3 (BD Biosciences, San Jose, Calif., particular use. Cell Surface staining for Rorl was significantly USA), PE-Cy5-conjugated anti-CD19 (e-Bioscience, San higher in patients with progressive disease as compared to Diego, Calif., USA), FITC-conjugated anti-CD19 (BioLeg non-progressive as well as in patients with unmutated IgVH end, San Diego, Calif., USA), FITC-conjugated Swine anti genes as compared to mutated. US 2014/0004156 A1 Jan. 2, 2014 13

TABLE 4 TABLE 4-continued

Protein expression of ROR1 in CLL patients (n = 18) Protein expression of ROR1 in CLL patients (n = 18) in relation to IgVH mutational status and clinical phase. in relation to IgVH mutational status and clinical phase.

Western blot Western blot IgVH C- Freq. (%) of IgVH C Freq (%) of muta- N- Ror1- Ror1 muta- N- Ror1 Ror1 Disease tion Ror1 904 CLL cells Ror1 Disease tion Ror1 904 CLL cells Ror1 Patients phase status (kDa) (kDa) (CD19) MFI Patients phase status (kDa) (kDa) (CD19) MFI CLL-16 Progressive M 105 105, 36 18 CLL-1 Non M 05 O5, 13 130 progressive 30 CLL-17 Progressive M 105 105, 79 2O CLL-2 Non UM 05 O5, 91 25 130 progressive 30 CLL-18 Progressive UM 105 105, 93 33 130 CLL-3 Non UM 05 O5, 36 10 Meant 715 2O2 progressive 30 SEM CLL-4 Non M 05 O5, 86 Healthy <0.1 <0.1 <0.1 progressive 30 controls CLL-5 Non UM 05 O5, 26 donors progressive 30 (n = 10) CLL-6 Non M 05 O5, 91 35 progressive 30 M = Mutated, UM = Unmutated, MFI = Mean Fluorescence Intensity CLL-7 Non UM 05 O5, 37 14 progressive 30 0232. The frequency of CD19 CLL cells expressing Rorl CLL-8 Non M 05 O5, 50 varied (71+5%) (meaniSEM) (range: 36-92%). There was no progressive 30 difference between progressive and non-progressive patients or between IgVH mutated and unmutated cases (Table 3). The CLL-9 Non M 05 O5, 69 mean fluorescence intensity (MFI) varied between 10 and 45 progressive 30 with a mean MFI value of 20. There was no statistical differ CLL-10 Progressive M 05 O5, 63 10 ence between progressive and non-progressive patients. The 30 corresponding mean MFI of CD19 was 26 (range 9-48). Nor mal B cells (CD19) of healthy donors (n=10) were negative CLL-11 Progressive M 05 O5, 65 11 for Ror1 (<0.1%). 30 CLL-12 Progressive UM 05 O5, 81 15 Example 6 30 SiRNA CLL-13 Progressive M 05 O5, 84 14 30 0233 siRNA CLL-14 Progressive UM 05 O5, 92 45 0234. The siRNAs used in this study were designed to 30 target Ror-1 gene using proprietary algorithms and Software CLL-15 Progressive M 05 O5, 61 19 available on the manufacturers website (Dharmacon, Inc. 30 Lafayette, Colo.). Three siRNAS targeting a distinct region of the Ror-1 open reading frame were designed. TABLE 5 Target gene : ROR1 Target sequence siRNA. Sequence siRNA (cDNA, 5" -> 3') (s" -> 3') ale

AT GAA CCA. ATG AAT AAC AAU GAA CCA AUG AAU AAC ROR 1 ATC AUC

AAA AAT CTA TAA AGG CCA AAA AAU CUA UAA AGG CCA ROR 2 TCT UCU

AC ATG TCA ATT CCA. AAT AAC AUG UCA AUU CCA. AAU ROR 3 CAT CAU US 2014/0004156 A1 Jan. 2, 2014

0235. The three siRNAs were used independently or in Antibody Dependent Cell-Mediated Cytotoxicity (ADCC) combination (pool). PBMC from high-count CLL patients Standard Microcytotoxicity Assay were plated in 48-well microwell plates at a density of 100, 000 cells per well in Opti-MEM ITM Reduced-Serum 0243 2x10° target cells (CLL line EHEB) were pelleted Medium. Cells were transfected with the SMARTpool siRNA and resuspended in 100 ul of 10 mCi/ml of Crper 10° cells. reagents (100 nM final concentration) using TranslT-TKOR) Cells were incubated at 37° C. for 1 hour. Cells were washed Transfection Reagent (Mins Bio Corporation, Madison, Wis., three times with AIM-V medium and resuspended in AIM-V USA) at a final concentration of 0.15 uL/well. medium (2.5x10/ml), 20 Jul (50x10) of the cell suspension 0236 Untreated cells and cells transfected with the was added to a 96 well V shaped-bottomed microtitre plate siCONTROL Non-Targeting siRNA Pool (Dharmacon) were (Nunc, Cole-Parmer Instrument, Illinois, USA). used as negative controls. Transfection efficiency was estab 0244 Varying numbers of effector cells (PBMC of healthy lished in prior experiments using the siCLO RISC-FreeTM donor) were added in 0.1 ml volume to achieve desired effec siRNA (Dharmacon), a fluorescently labelled non-targeting tor/target (E/T) ratios of 25:1, 12.5:1 and 6.25:1. siRNA chemically modified to prevent uptake by the RISC 0245. The antibody KNG (mouse IgG1) was added with a complex. Cells were transfected for 4 hours and then trans concentration of 10 ug/ml. The antibody was diluted in ferred to monolayer cultures of NIH-3T3 fibroblasts express AIM-V medium and was added in 0.1 ml volume to achieve ing membrane-bound hCD40L. Cells were cultured for an additional 24-48 hours in RPMI-10% foetal calf serum. a final volume of 200 ul in each well. 0237 Gene silencing was examined by standard RT-PCR 0246 For spontaneous 'Cr-release control, 0.2 ml of or quantified by q-PCR using primers specific for Ror-1 (us AIM-V medium only was added to the target cells. Maximum ing parameters defined above). The housekeeping genes B-ac release was determined by adding 0.2 ml of 1% NP-40. After tin and/or RPLPO were used for normalization. Gene expres 4, 18 and 36 hr of incubation at 37°C., the plate was centri sion in the cells transfected with control, non-targeting fuged at 200xg for 5 min, and 0.1 ml of supernatant was siRNA was considered to be 100% and gene expression in removed for counting in a gamma counter. Ror-1 siRNA treated cells was calculated relative to the con trol. Results 0238 siRNA or control-transfected cells were collected after 24 or 48 hours of culture and examined for apoptosis. 0247 Antibodies against different domains of the external Cells were stained with FITC-tagged Annexin V and pro receptor induced cell death alone and in ADCC. The cytotox pidium iodide (PI) and analyzed by flow cytometry. icity of antibodies alone varied between 15-50% and in Annexin-V or PI positive or dual positive cells were consid ADCC some higher killing was seen at the highest effector to ered to be apoptotic. target cell ratio (FIGS. 10, 11, 12, 24 and 25). Results Example 8 0239 siRNA treatment of CLL cells induced a very marked down-regulation (silencing) of the Rorl gene (FIG. In Vitro Effects of Anti Ror-1 mAbs on Cancer Cell 15) and apoptosis of tumour cells varying from 65-70% (FIG. Lines from Solid Tumours 16). 0248. The prostate cancer cell line DU145 and the lung cancer cell line A459 has previously been tested positive for Example 7 Ror1 expression. Hence, work to test if treating these cell lines with anti-Ror1 MAbs could induce cell death similarly Cytotoxicity Tests to primary CLL cells. Cytotoxicity Assay Using Rorl Monoclonal Antibodies 0249 Cell lines were propagated in DMEM (Invitrogen) containing 10% FCS (Invitrogen). Before the experiment, 0240 Frozen CLL cells were thawed and Ficoll separated cells were harvested and re-seeded at a density of 7000 cells/ to obtain live cells. well together with the anti-Ror1 antibody KNG at 2 or 20 0241 Monoclonal antibodies Ror CRD (IgM), Ror KNG ug/ml, a control antibody at 20 g/ml, only medium, or 3 (IgG1) and Ror Ig24 (IgM) were used in the assay. 10 ug/ml concentrations of the cytostatic agent Paclitaxel (5,0.5, 0.05 of antibodies were used and diluted in AIM-V medium (Invit mg/ml) as positive control. In addition, cross linking antibod rogen, Carlsbad, Calif., USA) (supplemented with ies were added as indicated at a 5 molar excess. The cells were L-glutamine, streptomycin Sulphate and gentamicin Sul incubated at 37°C., 5% CO2, in a humidified atmosphere for phate) and added to a 24-well plate. 48 h. For determining viability, a kit quantifying ATP content, 0242 To each well 1x10° CLL cells were added. Cells which mirrors the number of metabolically active cells, hence were analysed with BD Annexin-V/PI Apoptosis assay kit the number of living cells, were used according to the manu (B-D) after 18 and 36 hr incubation at 37° C. using Flow facturer's instructions (CelTiter-Glo R. Luminescent Cell Cytometry. The cells were washed twice with cold PBS and Viability Assay, Promega). resuspended cells in binding buffer for a concentration of 1x10° cells/ml. 100 ul of the cell suspensions (1x10 cells) Results was transferred to a 5 ml FACS tube. 5ul of Annexin V-FITC and PI respectively, were added. The cells were incubated for (0250 Cross linked KNG antibody induced cell death in 15 min at RT (25° C.) in the dark. 400 ul of binding buffer both A549 and DU145 cell lines, FIG. 13 (A and B). The were added to each tube and the cells were analyzed by flow findings indicate that Rorl is a potential target for treatment cytometry. of a wide variety of cancer types. US 2014/0004156 A1 Jan. 2, 2014

Example 9 0258 We used in the siRNA experiments leukaemic cells added to a monolayer of fibroblast transfected with CD40 L. In Vivo Effects of Anti Ror-1 mAbs This is a normal way to keep CLL cells alive. We have also 0251 PBMCs were isolated from peripheral blood of a used CD40 L stimulation of normal B cells, which did not severely affected CLL patient using the Ficoll Hypaque tech induce is expression of Rod in normal B cells. nique. The cells were stained for CD19-PE and CD5-APC (BD) to enumerate CLL cells, which was found to be around Results 80% of the PBMCs. In comparison, only 1.5% were T cells. 0259 Normal B cells did not express Rorl while a strong In addition, the cells were stained for Ror-1 expression (FITC non-physiologic signal (PMA ionomycin) induced Rorl conjugated 1 A8 antibody), which was also found on ca 80% expression (FIG. 8). However, physiological stimulation of the cells. There after, 150x10 cells was injected ip (intra (CD40L) did not seem to induce Ror1 expression in normal peritoneally) and i.v (intravenously) into C.B.17. SCID mice. B-cells nor did it alter expression of Rorl in CLL cells. The mice were treated i.p with 10 mg/kg of two different 0260 Rorl in CLL was constitutively phosphorylated anti-RormAbs, 1 A8 and KNG, or irrelevant negative control (FIG.9) indicating that this receptor tyrosine kinase might be mAb at day 1, 3 and 6 after transfer involved in the pathobiology of CLL. However, Ror protein 0252 Mice were sacrificed day 7 and intra-peritoneal cells expression induced in normal B cells was not phosphorylated were collected using intra-peritoneal lavage of 8 ml PEBS. (FIG. 8). Cells recovered from the peritoneum were stained for anti human CD45-FITC (BD). Example 11 Results Preferred Pharmaceutical Formulations and Modes 0253 Both anti-ROR1 mAbs totally depleted the CLL and Doses of Administration cells from the peritoneum of injected mice (FIG. 14). This is 0261 The polypeptides, polynucleotides and antibodies in sharp contrast to what is observed for the control MAb and of the present invention may be delivered using an injectable shows that treatment with anti-Ror1 specifically depletes pri Sustained-release drug delivery system. These are designed mary human CLL cells in a Xenograft in vivo model. specifically to reduce the frequency of injections. An example of Such a system is Nutropin Depot which encapsulates Example 10 recombinant human growth hormone (rhGH) in biodegrad able microspheres that, once injected, release rhGH slowly ROR1 Phosphorylation over a Sustained period. 0254 PBMC and B cells were isolated and kept on ice in 0262 The polypeptides, polynucleotides and antibodies 10 ml of RPMI-1640 for 10 min. Pervanadate (Sigma) stimu of the present invention can be administered by a Surgically lation was performed as previously described (Lu Yet al: J implanted device that releases the drug directly to the Biol Chem 2003: 278:40057). Briefly, 2 ml of 1 mM fresh required site. For example, Vitrasert releases ganciclovir pervanadate solution (1 ul H.O.--99 ul 20 mM HEPES pH: directly into the eye to treat CMV retinitis. The direct appli 7.4, 20 ul vanadate and 1880 ul dHO) was prepared prior to cation of this toxic agent to the site of disease achieves effec adding to the cells. Two ml of pervanadate solution was added tive therapy without the drugs significant systemic side to 10 ml RPMI-1640 medium containing the cells. Cells were effects. incubated on ice for 1 h. 0263 Electroporation therapy (EPT) systems can also be 0255 Cells were then centrifuged at 1500 rpm at 4°C. for employed for administration. A device which delivers a 5 min and washed once in 1 ml ice-cold PBS. One ml of lysis pulsed electric field to cells increases the permeability of the buffer containing 20 mM Tris, pH 7.5, 0.5% Triton X-100, cell membranes to the drug, resulting in a significant enhance 0.15 MNaCl, 0.5% deoxycholic acid, and 10 mM EDTA was ment of intracellular drug delivery. added to cell pellet. Proteinase inhibitor 1% Trasylol, 1 mM 0264 Polypeptides, polynucleotides and antibodies of the phenyl methyl sulfonyl fluoride (PMSF) and 100 uM van invention can also be delivered by electroincorporation (EI). adae (Sigma) were also added to lysis buffer prior to use and EI occurs when small particles of up to 30 microns in diam incubated on ice for 10 min. Vanadate was heated at 95°C. for eter on the surface of the skin experience electrical pulses 5 min prior to use in lysis buffer. Cell lysates were transferred identical or similar to those used in electroporation. In EI, to 1.5 ml Eppendorf tubes and centrifuged at max. speed for these particles are driven through the stratum corneum and 10 min at 4°C. Supernatants were transferred to new tubes. into deeper layers of the skin. The particles can be loaded or Immunoprecipitation was performed by adding 2-5 ug coated with drugs or genes or can simply act as "bullets' that MabF3C6 antibody to the supernatant and incubation for 1 h generate pores in the skin through which the drugs can enter. at 4°C. with rotation. 0265 An alternative method of administration is the 0256 Equal volume of protein G Sepharose (GE Health ReGel injectable system that is thermosensitive. Below body care, Uppsala, Sweden) and cell lysate (40:40 ul) were mixed temperature, ReGel is an injectable liquid while at body tem and incubated at 4°C. overnight with rotation. perature it immediately forms a gel reservoir that slowly 0257 The protein G Sepharose beads were washed three erodes and dissolves into known, safe, biodegradable poly times with 1 ml of lysis buffer. 15 ul of reducing loading mers. The active drug is delivered over time as the biopoly buffer was added to the beads and subjected to Western blot mers dissolve. analysis using the PY99 antiphosphotyrosine antibody (Santa 0266 Polypeptides, polynucleotides and antibodies of the Cruz, Biotechnology, CA, USA) according to the manufac invention can be introduced to cells by “Trojan peptides'. turer's instruction. The N-Rorl antibody was used for rep These are a class of polypeptides called penetratins which robing of the phosphorylated protein. have translocating properties and are capable of carrying US 2014/0004156 A1 Jan. 2, 2014 hydrophilic compounds across the plasma membrane. This dosage form and may be prepared by any of the methods well system allows direct targeting of oligopeptides to the cyto known in the art of pharmacy. Such methods include the step plasm and nucleus, and may be non-cell type specific and of bringing into association the active ingredient with the highly efficient (Derossi et al., 1998, Trends Cell Biol., 8, carrier which constitutes one or more accessory ingredients. 84-87). In general the formulations are prepared by uniformly and 0267 Preferably, the pharmaceutical formulation of the intimately bringing into association the active ingredient with present invention is a unit dosage containing a daily dose or liquid carriers or finely divided solid carriers or both, and unit, daily Sub-dose or an appropriate fraction thereof, of the then, if necessary, shaping the product. active ingredient. 0275 Preferred unit dosage formulations are those con 0268. The polypeptides, polynucleotides and antibodies taining a daily dose or unit, daily Sub-dose or an appropriate of the invention can be administered by any parenteral route, fraction thereof, of an active ingredient. in the form of a pharmaceutical formulation comprising the 0276 A preferred delivery system of the invention may active ingredient, optionally in the form of a non-toxic comprise a hydrogel impregnated with a polypeptides, poly organic, or inorganic, acid, or base, addition salt, in a phar nucleotides and antibodies of the invention, which is prefer maceutically acceptable dosage form. Depending upon the ably carried on a tampon which can be inserted into the cervix disorder and patient to be treated, as well as the route of and withdrawn once an appropriate cervical ripening or other administration, the compositions may be administered at desirable affect on the female reproductive system has been varying doses. produced. 0269. In human therapy, the polypeptides, polynucle 0277. It should be understood that in addition to the ingre otides and antibodies of the invention can be administered dients particularly mentioned above the formulations of this alone but will generally be administered in admixture with a invention may include other agents conventional in the art Suitable pharmaceutical excipient diluent or carrier selected having regard to the type of formulation in question. with regard to the intended route of administration and stan dard pharmaceutical practice. Example 12 0270. The polypeptides, polynucleotides and antibodies Exemplary Pharmaceutical Formulations of the invention can also be administered parenterally, for 0278 Whilst it is possible for a polypeptides, polynucle example, intravenously, intra-arterially, intraperitoneally, otides and antibodies of the invention to be administered intra-thecally, intraventricularly, intrasternally, intracrani alone, it is preferable to presentitas a pharmaceutical formu ally, intra-muscularly or subcutaneously, or they may be lation, together with one or more acceptable carriers. The administered by infusion techniques. They are best used in carrier(s) must be “acceptable' in the sense of being compat the form of a sterile aqueous Solution which may contain ible with the compound of the invention and not deleterious to other Substances, for example, enough salts or glucose to the recipients thereof. Typically, the carriers will be water or make the Solution isotonic with blood. The aqueous solutions saline which will be sterile and pyrogen-free. should be suitably buffered (preferably to a pH of from 3 to 9), 0279. The following examples illustrate pharmaceutical if necessary. The preparation of Suitable parenteral formula formulations according to the invention in which the active tions understerile conditions is readily accomplished by stan ingredient is a polypeptides, polynucleotides and/orantibody dard pharmaceutical techniques well-known to those skilled of the invention. in the art. 0271 Formulations suitable for parenteral administration Example 12A include aqueous and non-aqueous sterile injection solutions Injectable Formulation which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood 0280 of the intended recipient; and aqueous and non-aqueous ster ille Suspensions which may include Suspending agents and thickening agents. The formulations may be presented in Active ingredient 0.200 g unit-dose or multi-dose containers, for example sealed Sterile, pyrogen free phosphate buffer (pH7.0) to 10 ml ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the 0281. The active ingredient is dissolved in most of the sterile liquid carrier, for example water for injections, imme phosphate buffer (35-40°C.), then made up to volume and diately prior to use. Extemporaneous injection solutions and filtered through a sterile micropore filter into a sterile 10 ml Suspensions may be prepared from sterile powders, granules amberglass vial (type 1) and sealed with sterile closures and and tablets of the kind previously described. overseals. 0272 Generally, in humans, oral or parenteral administra tion of the polypeptides, polynucleotides and antibodies of Example 12B the invention is the preferred route, being the most conve Intramuscular Injection nient. 0273 For veterinary use, the polypeptides, polynucle 0282 otides and antibodies of the invention are administered as a Suitably acceptable formulation in accordance with normal Veterinary practice and the veterinary Surgeon will determine Active ingredient 0.20 g Benzyl Alcohol 0.10 g the dosing regimen and route of administration which will be Glucofuro 75 (R) 1.45g most appropriate for a particular animal. Water for Injection q.S. to 3.00 ml 0274 The formulations of the pharmaceutical composi tions of the invention may conveniently be presented in unit US 2014/0004156 A1 Jan. 2, 2014 17

0283. The active ingredient is dissolved in the glycofurol. The benzyl alcohol is then added and dissolved, and water added to 3 ml. The mixture is then filtered through a sterile micropore filter and sealed in Sterile 3 ml glass vials (type 1).

SEQUENCE LISTING

<16O is NUMBER OF SEO ID NOS: 4 O

<210s, SEQ ID NO 1 &211s LENGTH: 15 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Extracellular domain to which antibody binds <4 OOs, SEQUENCE: 1 Trp Asn. Ile Ser Ser Glu Lieu. Asn Lys Asp Ser Tyr Lieu. Thir Lieu. 1. 5 1O 15

<210s, SEQ ID NO 2 &211s LENGTH: 23 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: N-Ror1-Ig recognition site

<4 OOs, SEQUENCE: 2 Arg Ser Thir Ile Tyr Gly Ser Arg Lieu. Arg Ile Arg Asn Lieu. Asp Thr 1. 5 1O 15 Thr Asp Thr Gly Tyr Phe Glin 2O

<210s, SEQ ID NO 3 &211s LENGTH: 15 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: N-Ror1- CRD recognition site <4 OOs, SEQUENCE: 3 Tyr Met Glu Ser Lieu. His Met Glin Gly Glu Ile Glu Asn Glin Ile 1. 5 1O 15

<210s, SEQ ID NO 4 &211s LENGTH: 2O 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: N-Ror1-KNG recognition site <4 OOs, SEQUENCE: 4 Cys Gln Pro Trp Asn Ser Glin Tyr Pro His Thr His Thr Phe Thr Ala 1. 5 1O 15 Lieu. Arg Phe Pro 2O

<210s, SEQ ID NO 5 &211s LENGTH: 15 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: N-Ror1-904 recognition site

<4 OOs, SEQUENCE: 5 US 2014/0004156 A1 Jan. 2, 2014 18

- Continued

Asn Llys Ser Glin Llys Pro Tyr Lys Ile Asp Ser Lys Glin Ala Ser 1. 5 1O 15

<210s, SEQ ID NO 6 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ROR1 siRNA target sequence <4 OOs, SEQUENCE: 6 atgaac caat gaataa catc

<210s, SEQ ID NO 7 &211s LENGTH: 21 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ROR1 siRNA sequence <4 OO > SEQUENCE: 7 aaugaaccala ugaauaiacau, C 21

<210s, SEQ ID NO 8 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ROR2 siRNA target sequence

<4 OOs, SEQUENCE: 8 aaaaatctat aaaggc catc t 21

<210s, SEQ ID NO 9 &211s LENGTH: 21 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ROR2 siRNA sequence <4 OOs, SEQUENCE: 9 aaaaauculau aaaggc caucu. 21

<210s, SEQ ID NO 10 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ROR3 siRNA target sequence

<4 OOs, SEQUENCE: 10 acatgtcaat tccaaatcat

<210s, SEQ ID NO 11 &211s LENGTH: 21 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ROR3 siRNA sequence <4 OOs, SEQUENCE: 11 aacaugucaa uuccaaauca u 21 US 2014/0004156 A1 Jan. 2, 2014 19

- Continued <210s, SEQ ID NO 12 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: t-Ror1 sense primer <4 OOs, SEQUENCE: 12 ccalaaggacc ttctgcagtg gaa 23

<210s, SEQ ID NO 13 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: t-Ror1 antisense primer <4 OOs, SEQUENCE: 13 t ct cattcca gcactctgtc atgagg 26

<210s, SEQ ID NO 14 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Ror1 RT-PCR sense primer <4 OOs, SEQUENCE: 14 Ctgctg.ccca agaaacagag 2O

<210s, SEQ ID NO 15 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Ror1 RT-PCR antisense primer <4 OOs, SEQUENCE: 15 Catagtgaag gcagotgtga t ct 23

<210s, SEQ ID NO 16 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: B-actin RT-PCR sense primer <4 OOs, SEQUENCE: 16 attaaggaga agctgtgcta C9tc 24

<210s, SEQ ID NO 17 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: B-actin RT-PCR antisense primer <4 OOs, SEQUENCE: 17 atgatggagt talagg tagt titcg 24

<210s, SEQ ID NO 18 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 2014/0004156 A1 Jan. 2, 2014 20

- Continued <223> OTHER INFORMATION: Ror1 RT-QPCR sense primer <4 OOs, SEQUENCE: 18 aaagagctac ct ctittctgc tigtacg 26

<210s, SEQ ID NO 19 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Ror1 RT-QPCR antisense primer <4 OOs, SEQUENCE: 19 cittcttgttgaaattic cqtc cattg 25

<210s, SEQ ID NO 2 O &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Ror1 RT-QPCR probe <4 OOs, SEQUENCE: 2O catgct cago toggttgctat caaga cc 27

<210s, SEQ ID NO 21 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: B-actin RT-QPCR sense primer <4 OOs, SEQUENCE: 21 cgacaggatg Cagaaggaga 2O

<210s, SEQ ID NO 22 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: B-actin RT-QPCR antisense primer <4 OOs, SEQUENCE: 22 cgt.cat actic ctdcttgctg 2O

<210s, SEQ ID NO 23 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: B-actin RT-QPCR probe <4 OOs, SEQUENCE: 23 aagat caaga t cattgct co toctdag 27

<210s, SEQ ID NO 24 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Ror1 RT-PCR extracellular domain sense primer <4 OOs, SEQUENCE: 24 atgaataa.ca toaccacgtc. tctgggcc 28 US 2014/0004156 A1 Jan. 2, 2014 21

- Continued

<210s, SEQ ID NO 25 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Ror1 RT-PCR extracellular domain antisense prlmer

<4 OOs, SEQUENCE: 25 citcc ttggaa toctittgaat cqca 24

<210s, SEQ ID NO 26 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Ror1 RT-PCR kinase domain sense primer <4 OOs, SEQUENCE: 26 ttct tcattt gcgtctgtcg 2O

<210s, SEQ ID NO 27 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Ror1 RT-PCR kinase domain antisense primer <4 OOs, SEQUENCE: 27 Ctggct cqgg alacatgitaat 2O

<210s, SEQ ID NO 28 &211s LENGTH: 321 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: VL sequence for Anti-Ror1 Ig24 (clone 2A4) antibody

<4 OOs, SEQUENCE: 28 atggaaattg agat caccca gactic cagca ct catgtctg. Catct coagg ggaga aggt c 6 O accatgacct gcagtgc.cag Ctcaagtgta agitta catgt actgg tacca gcagaa.gc.ca 12 O agat cotc cc ccaaac cctd gattitatic to a catcca acc toggcttctgg agt ccct gct 18O cgct tcagtg gcagtgggtc. tdgacct ct tact Ctctica caatcagcag catggaggct 24 O gaagatgctg. C Cactt atta CtgcCaggag tigagtagta accc.gtacac gttcggaggg 3OO gggaccaggc tiggagctaala a 321

<210s, SEQ ID NO 29 &211s LENGTH: 107 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: VL sequence for Anti-Ror1 Ig24 (clone 2A4) antibody

<4 OOs, SEQUENCE: 29

Met Glu Ile Glu Ile Thr Glin Thr Pro Ala Lieu Met Ser Ala Ser Pro 1. 5 1O 15

Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr 2O 25 3O US 2014/0004156 A1 Jan. 2, 2014 22

- Continued

Met Tyr Trp Tyr Glin Glin Llys Pro Arg Ser Ser Pro Llys Pro Trp Ile 35 4 O 45 Tyr Lieu. Thir Ser Asn Lieu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly SO 55 6 O Ser Gly Ser Gly Thr Ser Tyr Ser Lieu. Thir Ile Ser Ser Met Glu Ala 65 70 7s 8O Glu Asp Ala Ala Thr Tyr Tyr Cys Glin Glin Trp Ser Ser Asn Pro Tyr 85 90 95 Thir Phe Gly Gly Gly Thr Arg Lieu. Glu Lieu Lys 1OO 105

<210s, SEQ ID NO 3 O &211s LENGTH: 342 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: VH sequence for Anti-Ror1 Ig24 (clone 2A4) antibody

<4 OOs, SEQUENCE: 30 gaggtoaa.gc tigcagoagtic aggacctgag Ctggtgaagc Ctggggctt C agtgaagata 6 O t cctgcaaga Cttctggata cacatt cact gaatacacca to actgggit galagcagagc 12 O Catggaaaga gccttgagtggattggaggt attaatccta acaatggtgg tactagotac 18O aaccagaagt t caagggcaa ggcca cattg actgtagaca agt cct C cag cacagcc tac 24 O atggagct Co gcagoctgac atctgaggat tctgcagt ct attactgtgc tict acagggg 3OO tittgct tact gggggcaagg gactic cactic acggit ct cot Ca 342

<210s, SEQ ID NO 31 &211s LENGTH: 114 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: VH sequence for Anti-Ror1 Ig24 (clone 2A4) antibody

<4 OOs, SEQUENCE: 31 Glu Val Lys Lieu. Glin Glin Ser Gly Pro Glu Lieu Val Llys Pro Gly Ala 1. 5 1O 15 Ser Val Lys Ile Ser Cys Llys Thr Ser Gly Tyr Thr Phe Thr Glu Tyr 2O 25 3O Thr Met His Trp Val Lys Glin Ser His Gly Lys Ser Lieu. Glu Trp Ile 35 4 O 45 Gly Gly Ile Asin Pro Asn Asn Gly Gly Thr Ser Tyr Asn Glin Llys Phe SO 55 6 O Lys Gly Lys Ala Thr Lieu. Thr Val Asp Llys Ser Ser Ser Thir Ala Tyr 65 70 7s 8O Met Glu Lieu. Arg Ser Lieu. Thir Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Leu Gln Gly Phe Ala Tyr Trp Gly Glin Gly Thr Pro Leu. Thr Val 1OO 105 11 O

Ser Ser

<210s, SEQ ID NO 32 &211s LENGTH: 324 &212s. TYPE: DNA US 2014/0004156 A1 Jan. 2, 2014 23

- Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: VL sequence for Anti-Ror1 CRD16 (clone 1C11 antibody

<4 OOs, SEQUENCE: 32 atggaagttctgat caccca gactic catcc ticcittatctg. cct citctggg agaaagagtic 6 O agtict cactt gtcgggcaag ticaggacatt gg tagtagot taalactggct t cagcaggaa 12 O ccagatggaa ct attaaacg cct gatctac gocacatcca gtttagattic tdgtgtc.ccc 18O aaaaggttca gtggcagtag gtctgggit ca gattatt citc. tcaccat cag cagccttgag 24 O tctgaagatt ttgtag acta t tactgtcta caatatgcta gttct cogta cacgttcgga 3OO ggggggacca aactggagct caaa 324

<210s, SEQ ID NO 33 &211s LENGTH: 108 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: VL sequence for Anti-Ror1 CRD16 (clone 1C11 antibody

<4 OOs, SEQUENCE: 33

Met Glu Wall Lieu. Ile Thr Glin Thr Pro Ser Ser Leu Ser Ala Ser Lieu. 1. 5 1O 15 Gly Glu Arg Val Ser Lieu. Thr Cys Arg Ala Ser Glin Asp Ile Gly Ser 2O 25 3O Ser Lieu. Asn Trp Lieu. Glin Glin Glu Pro Asp Gly. Thir Ile Lys Arg Lieu. 35 4 O 45 Ile Tyr Ala Thr Ser Ser Lieu. Asp Ser Gly Val Pro Lys Arg Phe Ser SO 55 6 O Gly Ser Arg Ser Gly Ser Asp Tyr Ser Lieu. Thir Ile Ser Ser Leu Glu 65 70 7s 8O Ser Glu Asp Phe Val Asp Tyr Tyr Cys Leu Gln Tyr Ala Ser Ser Pro 85 90 95 Tyr Thr Phe Gly Gly Gly. Thir Lys Lieu. Glu Lieu Lys 1OO 105

<210s, SEQ ID NO 34 &211s LENGTH: 357 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: VH sequence for Anti-Ror1 CRD16 (clone 1C11 antibody

<4 OOs, SEQUENCE: 34 gaggtoaa.gc tigcaggagtic tigagctgaa citggcaagac Ctggggcct C agtgaagatg 6 O t cctgcaagg Cttctggcta Cacct ttact agctacacga tigcactgggit aaaacagagg 12 O Cctgga Cagg gtctggaatggattggatac attaatccta gcagtggata tactgagtac 18O aatcagaagt toaaggacaa gaccacattg actgcagaca aatcc to cag cacagcc tac 24 O atgcaactga gcagoctgac atctggggac totgcggtct attactgtgc aagaagggta 3OO

Ctatggittac gacgcggaga C tactggggc Caaggcacta tact cacggit Ctc.cgca 357

<210s, SEQ ID NO 35 &211s LENGTH: 119 US 2014/0004156 A1 Jan. 2, 2014 24

- Continued

212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: VH sequence for Anti-Ror1 CRD16 (clone 1C11 antibody

<4 OOs, SEQUENCE: 35 Glu Val Lys Lieu. Glin Glu Ser Gly Ala Glu Lieu Ala Arg Pro Gly Ala 1. 5 1O 15 Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 2O 25 3O Thr Met His Trp Val Lys Glin Arg Pro Gly Glin Gly Lieu. Glu Trp Ile 35 4 O 45 Gly Tyr Ile Asin Pro Ser Ser Gly Tyr Thr Glu Tyr Asn Glin Llys Phe SO 55 6 O Lys Asp Llys Thir Thr Lieu. Thir Ala Asp Llys Ser Ser Ser Thir Ala Tyr 65 70 7s 8O Met Glin Leu Ser Ser Lieu. Thir Ser Gly Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg Val Lieu. Trp Lieu. Arg Arg Gly Asp Tyr Trp Gly Glin Gly 1OO 105 11 O

Thir Ile Lieu. Thir Wal Ser Ala 115

<210s, SEQ ID NO 36 &211s LENGTH: 333 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: VL sequence for Anti-Ror1 KNG20 (clone 4C10 antibody

<4 OOs, SEQUENCE: 36 atggatgttg tdgtgactico agt ct cotgc titccttagot gitatic totgg ggcagagggc 6 O caccatctica tacagggcca gcaaaagtgt cagta catct ggctatagitt atatgcactg 12 O gaac caacag aaaccaggac agccacccag act cotcatc tat cittgtat cca acct aga 18O atctggggtc. cctgcc aggt t cagtggcag togt ctggg acagact tca CCCtcaiacat 24 O c catcCt9tg gaggaggagg atgctgcaac Ctatt actgt cagcacatta gggagcttac 3OO acgttcggag gggggaccag gctggagcta aaa. 333

<210s, SEQ ID NO 37 &211s LENGTH: 109 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: VL sequence for Anti-Ror1 KNG20 (clone 4C10 antibody

<4 OO > SEQUENCE: 37 Met Asp Val Val Val Thr Pro Val Ser Cys Phe Leu Ser Cys Ile Ser 1. 5 1O 15 Gly Ala Glu Gly His His Lieu. Ile Glin Gly Glin Glin Lys Cys Glin Tyr 2O 25 3O Ile Trp Lieu. Leu Tyr Ala Lieu. Glu Pro Thr Glu Thr Arg Thr Ala Thr 35 4 O 45 Gln Thr Pro His Leu Ser Cys Ile Glin Pro Arg Ile Trp Gly Pro Cys SO 55 6 O US 2014/0004156 A1 Jan. 2, 2014 25

- Continued

Glin Val Glin Trp Gln Trp Val Trp Asp Arg Lieu. His Pro Gln His Pro 65 70

Ser Cys Gly Gly Gly Gly Cys Cys Asn Lieu. Lieu Lleu Ser Ala His Gly 85 90 95

Ala Tyr Thr Phe Gly Gly Gly Thr Arg Lieu. Glu Lieu Lys 105

<210s, SEQ I D NO 38 &211s LENGT H: 360 212. TYPE : DNA ORGANISM: Artificial Sequence 22 Os. FEATU RE: OTHER INFORMATION: VH sequence for Anti-Ror1 KNG20 (clone 4C10) antib ody

<4 OOs, SEQUENCE: 38 gaggtoaaac to aggagtic tggacctgag Ctggtaaagc Ctggggctt C agtgaagatg 6 O t cctgcaagg cittctggata Cacattcact agctatotta tgcactgggt gaagcagaag 12 O

CCtgggCagg gcc ttgagtg gattggat at attaatcCtt acaatgatgg tactaagtac 18O aatgagaagt tcaaaggcaa. ggccacactg actitcagaca aatcct c cag cacagcc tac 24 O atggagctica gcagoctgac Ctctgaggac tctgcggtct attactgtgc aagatggaag 3OO atctac tatg gtaactacga ggact actgg ggc.ca aggca ctic ct cit cac tgtct cotca 360

<210s, SEQ I D NO 39 &211s LENGT H: 120 212. TYPE : PRT ORGANISM: Artificial Sequence 22 Os. FEATU RE: OTHER INFORMATION: VH sequence for Anti-Ror1 KNG20 (clone 4C10) antib ody

<4 OOs, SEQUENCE: 39

Glu Val Lys Lieu. Glin Glu Ser Gly Pro Glu Lieu Wall Pro Gly Ala 1. 1O 15

Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thir Phe Thir Ser Tyr 25

Wall Met His Trp Wall Lys Gln Lys Pro Gly Glin Gly Lell Glu Trp Ile 35 4 O 45

Gly Tyr Ile Asn Pro Tyr Asn Asp Gly Thr Lys Asn Glu Llys Phe SO 55 6 O

Gly Lys Ala Thir Lieu. Thir Ser Asp Llys Ser Ser Ser Thir Ala Tyr 65 70 7s 8O

Met Glu Lieu. Ser Ser Lieu. Thir Ser Glu Asp Ser Ala Wall 85 90 95

Ala Arg Trp Lys Ile Tyr Tyr Gly Asn Tyr Glu Asp Trp Gly Glin 105 11 O

Gly Thir Pro Lieu. Thir Wal Ser Ser 115 12 O US 2014/0004156 A1 Jan. 2, 2014 26

- Continued

<210s, SEQ ID NO 4 O &211s LENGTH: 21 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: ROR1 siRNA sequence <4 OOs, SEQUENCE: 4 O aaugaaccala agaauaiacau, C 21

1. A biological inhibitor of ROR1 capable of inducing cell selected from AAUGAACCAAAGAAUAACAUC, death in a cell expressing ROR1. AAAAAUCUAUAAAGGCCAUCU or AACAUGUCAA 2. A biological inhibitor as claimed in claim 1 wherein the UUCCAAAUCAU. inhibitor binds specifically to either an extracellular domain 13. A nucleotide sequence encoding a biological inhibitor of ROR1, and intracellular domain or ROR1 or to a nucleotide as claimed in claim 1. sequence encoding ROR1. 14. An expression vector containing a nucleotide sequence as claimed in claim 13. 3. A biological inhibitor as claimed in claim 1 wherein the 15. A host cell comprising a nucleotide sequence as inhibitor is selected from an antibody, interfering nucleic acid claimed in claim 13. molecule, or a soluble receptor. 16. (canceled) 4. A biological inhibitor as claimed in claim 3 wherein the 17. A method of inducing cell death in one or more cells antibody is a complete antibody or a fragment thereof. comprising exposing a cell expressing ROR1 to a biological 5. A biological inhibitor as claimed in claim 1 wherein cell inhibitor of claim 1. death is induced on specific binding of the inhibitor to ROR1 18. (canceled) or the nucleotide sequence encoding ROR1. 19. (canceled) 6. A biological inhibitor as claimed in claim 1 wherein the 20. (canceled) extracellular domain to which the biological inhibitor binds 21. A method of treating a disease comprising the step of has the amino acid sequence WNISSELNKDSYLTL. administering to a Subject a biological inhibitor as claimed in 7. A biological inhibitor as claimed in claim 1 wherein the claim 1, wherein the disease is selected from Chronic Lym intracellular domain to which the biological inhibitor binds phocytic Leukemia, Acute lymphocytic leukemia, Acute has the amino acid sequence NKSQKPYKIDSKQAS. myeloid leukemia, non-Hodgkin lymphomas, chronic 8. A biological inhibitor as claimed in claim 5 wherein the myeloid, multiple myeloma, ovarian carcinoma, prostate can interfering nucleic acid molecule in an interfering RNA mol cer, breast cancer, melanoma, lung cancer, colorectal cancer, ecule selected from the group consisting of a siRNA, an glioblastoma, pancreatic cancer and hepatocellular cancer. antisense RNA and a dsRNA. 22. The method of claim 21 wherein the disease is progres 9. A biological inhibitor as claimed in claim 8 wherein the S1V. interfering nucleic molecule is complementary to the nucle 23. The method of claim 21 wherein the disease is Chronic otide sequence encoding ROR1 or fragments or variants Lymphocytic Leukemia. thereof. 24. A pharmaceutical composition comprising a biological 10. Abiological inhibitor as claimed in claim 9 wherein the inhibitor of claim 1 and a pharmaceutically acceptable excipi interfering nucleic acid is an antisense polynucleotide which ent, diluent or carrier. is capable of hybridizing to the nucleotide sequence encoding 25. A pharmaceutical composition as claimed in claim 24 ROR1 or fragments or variants thereof. which induces cell death in a cell expressing ROR1. 11. A biological inhibitor as claimed in claim 10 wherein 26. A kit of parts comprising: the interfering nucleic acid is complementary to either a (i) a biological inhibitor as claimed in claim 1: nucleotide sequence encoding an extracellular domain of (ii) apparatus for administering the biological inhibitor; ROR1 or a nucleotide sequence encoding an intracellular and domain of ROR1. (iii) instructions for use. 12. Abiological inhibitor as claimed in claim 5 wherein the 27-31. (canceled) interfering nucleic acid is an siRNA having a sequence