DOCSLIB.ORG

Fluid Mechanics and Wind Engineering Program

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Fluid Mechanics and Wind Engineering Program PUBLICATIONS Papers - Reports - Theses - Dissertations Fluid Mechanics and Wind Engineering Program Compiled by E. J. Jones J. L. Steinhoff Publications listed herein may be obtained by writing to: J.E. Cermak, Professor-in-Charge Fluid Mechanics & Wind Engineering Program and Director, Fluid Dynamics & Diffusion Laboratory Department of Civil Engineering Colorado State University Fort Collins, Colorado 80523 CER82-83JEC-EJJ-JLS27 1/3/83 FLUID MECHANICS AND WIND ENGINEERING PROGRAM Department of Civil Engineering College of Engineering Colorado State University Fort Collins, Colorado 80523 PAPERS - REPORTS - THESES - DISSERTATIONS 1. Peterson, D. F., Jr. and J. E. Cermak, Discussions of ASCE Paper No. 2437, ELASTIC RESTRAINT EQUATIONS FOR SEMI-RIGID CONNECTIONS by J. E. Lothers, Trans. ASCE, Vol. 116, 1951. 2. Yih, C. S. and J. E. Cermak, LAMINAR HEAT CONVECTION IN PIPES AND DUCTS, Technical Report, Contract No. N9 ONR-82401, Report No. 5, September 1951, CER47-52CSY8. 3. Cermak, J. E., R. K. Thomas and M. L. Albertson, DETERMINATION OF WIND CHILL ON A LIFE-SIZED CLOTHED COPPER MAN, Final Report, Contract No. DA44-109-qm-584, June 1952, CER47-52JEC49. 4. Cermak, J.E., APPLICATION OF MODEL TECHNIQUES TO MASS TRANSFER AND EVAPORATION STUDIES, Paper Presentation, Centennial of Engineering, Chicago, Illinois, September 1952, CER53JEC2. 5. Yih, C. S., J. E. Cermak and R. T. Shen, TEMPERATURE DISTRIBUTION IN THE BOUNDARY LAYER OF AN AIRPLANE WING WITH A LINE SOURCE OF HEAT AT · THE STAGNATION EDGE, PART I, SYMMETRIC WING IN SYMMETRIC FLOW, Technial Report, Contract No. Nonr544(00), October 1952, CER53CSY5, AD-9-799. 6. Cermak, J.E. and H.J. Koloseus, LAKE HEFNER MODEL STUDIES OF WIND STRUCTURE AND EVAPORATION, Technical Report, Contract No. NObsr-5 7053, Part I, November 1953, CER54JEC20 and Part II, July 1954, CER54JEC22, AD-105-493. 7. Cermak, J. E. and H. J. Koloseus, DEVELOPMENT OF A MINIATURE AIR VELOCITY INDICATOR, Technical Report to Directing Agency, Special Activities, Signal Corps, Engineering Laboratories, Fort Monmouth, New Jersey, August 1954, CER54JEC23. 8. Sadar, D. J. , PRELIMINARY STUDY OF SEDIMENT SAMPLING EFFICIENCY, M.S. Thesis, November 1954. 9. Cermak, J. E. and P. N. Lin, VAPOR TRANSFER BY FORCED CONVECTION FROM A SMOOTH PLANE BOUNDARY, Technical Report, Contract No. N90NR 82401, Nr063-071/1-19-49, Fort Collins, Colorado, January 1955, CER55JEC1, AD-59-945. 10. McFarland, W. W., EFFECT OF RIM HEIGHT ON THE RATE OF EVAPORATION FROM PANS, M.S. Thesis, November 1955. 2 11. Cermak, J.E. and A. C. Spengos, HEAT TRANSFER BY FORCED CONVECTION FROM A HORIZONTAL FLAT PLATE INTO A TURBULENT BOUNDARY LAYER, Proceedings Heat Transfer and Fluid Mechanics Institute, Stanford University, June 1956, CER56JEC21. 12. Cermak, J. E. and A. C. Spengos, TURBULENT DIFFUSION OF MOMENTUM AND HEAT FROM A SMOOTH PLANE BOUNDARY WITH ZERO PRESSURE GRADIENT, Technical Report, Contract AF19(604)-421, Part I, August 1956, CER56ACS12 and Part II, December 1956, CER56JEC22. 13 . Ne 1 son, D. F . , THE EFFECT OF SHAPE OF A PLANE , SMOOTH SATURATED SURFACE ON THE EVAPORATION RATE, M.S. Thesis, August 1957. 14. Cermak, J.E. and M. L. Albertson, USE OF WIND TUNNELS IN THE STUDY OF ATMOSPHERIC PHENOMENON, Paper Presentation, Air Pollution Control Association's Annual Meeting, Paper No, 58-32, Philadelphia, Pennsylvania, May 1958, CER58JEC18. 15. Cermak, J. E. , WIND TUNNEL FOR THE STUDY OF TURBULENCE IN THE ATMOSPHERIC SURFACE LAYER, Final Report, Contract AF19(604)-1706, November 1958, CER58JEC42. 16. Chanda, B. , TURBULENT BOUNDARY LAYER OVER HEATED AND UNHEATED, PLANE, ROUGH SURFACES, Ph.D. Dissertation, May 1958, CED58BC1, also Scientific Report No. 1, Department of Civil Engineering, CER58BC21. 17. Cermak, J. E. , THE TURBULENT BOUNDARY LAYER AT THE LOW REYNOLDS NUMBERS WITH UNSTABLE DENSITY STRATIFICATION PRODUCED BY HEATING, Ph.D. Dissertation, Cornell University, Ithaca, New York, March 1959, CED59JEC1. 18. Nelson, R. W., THE MEASUREMENT OF PERMEABILITY IN NON-HOMOGENEOUS MEDIA THROUGH AN ANALYSIS OF THE STEADY POTENTIAL DISTRIBU- TION, M.S. Thesis, May 1959. 19. Poreh, M., FLOW CHARACTERISTICS OF A CIRCULAR SUBMERGED JET IMPINGING NORMALLY ON A SMOOTH BOUNDARY, M.S. Thesis, February 1959, CET59MP2. (Poreh, M. and J. E. Cermak, Proceedings 6th Midwestern Mechanics Conference, University of Texas, Austin, Texas, September 1959, CER59MP-JEC67). 20. Sandborn, V. A., MEASUREMENTS OF INTERMITTENCY OF TURBULENT MOTION IN A BOUNDARY LAYER, Journal of Fluid Mechanics, §_, 1959, CEP58VAS1. 21. Earle, E. N., MEAN VELOCITY PROFILES FOR FLOW OVER A PLANE, SMOOTH, HEATED BOUNDARY, M.S. Thesis, May 1960. 22. Cermak, J. E., A STUDY OF SHEAR STRESS AT A FLUID-SOLID INTERFACE BY MEASUREMENT OF THE ELECTROKINETIC POTENTIAL, Technical Report, Research Corporation, New York, New York, 1 March 1960, CER60JEC15. 3 23. Binder, G., ELECTROKINETIC-POTENTIAL FLUCTUATIONS PRODUCED BY TURBULENCE AT A SOLID-LIQUID INTERFACE, Ph.D. Dissertation, Colorado State University, 1960. 24. Plate, E. J. and J.E. Cermak, A STUDY OF DESIGN AND OPERATION OF A LOW SPEED PRECISION WIND INSTRUMENT TEST FACILITY, Technical Report, Contract DA29-040-0RD-2346, November 1960, CER60EJPS8. 25. Baldwin, L.V., V. A. Sandborn , and J. C. Laurence, HEAT TRANSFER FROM YAWED CYLINDERS IN RAREFIED AIRFLOW, ASME paper, No. 50-HT-S, 1960, CEP60VAS-LVB14. 26. Sandborn, V. A., L. V. Baldwin and J. C. Laurence, HEAT TRANSFER FROM TRANSVERSE AND YAWED CYCLINDER IN CONTINUUM, SLIP AND FREE MOLECULE AIR FLOW, Paper in ASME Transactions Journal of Heat Transfer, Series C, Vol. 82, 1960, CEP60VAS-LVB13. 2 7. Sandborn, V. A. and R. J. Wisneiwski, HOT-WIRE EXPLORATION OF TRANSITION OF CONES IN SUPERSONIC FLOW, Paper in the Proceed- ings of the 1960 Heat Transfer and Fluid Mechanics Institute, Stanford University Press, 1960, CEP60VAS3. 28. Cermak, J. E. and E. J. Plate, SPECIFICATIONS FOR THE TEMPERATURE AND HUMIDIFICATION CONTROL UNITS OF THE MICROMETEOROLOGICAL WIND TUNNEL AT COLORADO STATE UNIVERSITY, Technical Report, White Sands Missile Range, New Mexico, Contract No. DA-36-039-SC-80371, June 1961, CER61EJP36. 29. Nagabhushanaiah, H. S., SEPARATION FLOW DOWNSTREAM OF A PLATE SET NORMAL TO A PLANE BOUNDARY, Ph.D. Dissertation, October 1961. 30. Baldwin, L. V. and V. A. Sandborn, THEORY AND APPLICATION OF HOT- WIRE CALORIMETER FOR MEASUREMENT OF ION BEAM POWER, Paper in Progress in Aeronautics and Rocketry, Vol. 5, Electrostatic Propulsion, Academic Press, New York, 1961, CEP61VAS-LVB13. 31. Sandborn, V. A. and S. J. Kline, FLOW MODELS IN BOUNDARY-LAYER STALL INCEPTION, Journal of Basic Engineering, Trans. ASME Ser. D., Vol. 83, 1961, CEP61VAS3. 32. Sandborn, V. A. and J. C. Laurence, HEAT TRANSFER FROM CYLINDERS, Paper at the ASME Symposium on Measurement in Unsteady Flow, 1962, CEP62VAS16. 33. Sandborn, V. A. , APPL I CATION OF THE HOT-WIRE, RESISTANCE- TEMPERATURE TRANSDUCER TO THE MEASUREMENT OF TRANSIENT FLOW QUANTITIES, Paper at the ASME Symposium on Measurement in Unsteady Flow, 1962, CEP62VAS4. 34. Chuang, H., ELECTROKINETIC-POTENTIAL FLUCTUATIONS PRODUCED BY TURBULENCE IN FULLY DEVELOPED PIPE FLOW, Ph.D. Dissertation, Colorado State University, 1962, CED62HC13. 35. Duckstein, L., ELECTROKINETIC-POTENTIAL FLUCTUATIONS GENERATED BY JET IMPINGEMENT AT A SOLID-LIQUID INTERFACE, Ph.D. Disserta- tion, Colorado State University, 1962, CED62LD2. 4 36. Tsuei, Y. G., AXISYMMETRIC BOUNDARY-LAYER OF A JET IMPINGING ON A SMOOTH PLATE, Ph.D. Dissertation, August 1962, CED62YT11. 37. Malhotra, R. C. and J. E. Cermak, WIND-TUNNEL MODELING OF ATMOSPHERIC DIFFUSION, Journal of Geophysical Research, Vol. 68, No. 8, pp. 2181-2184, April 15, 1963, also Paper Presenta- tion, Third Air Pollution Research Seminar, New Orleans, Louisiana, March 1960, CEP62RCM-JEC9. 38. Malhotra, R. C., DIFFUSION FROM A POINT SOURCE IN A TURBULENT BOUNDARY WITH UNSTABLE DENSITY STRATIFICATION, Ph.D. Disserta- tion, March 1962, CED62RCM7. 39. Plate, E. J. and J. E. Cermak, MICROMETEOROLOGICAL WIND TUNNEL FACILITY, DESCRIPTION AND CHARACTERISTICS, Final Report, Contract No. DA36-039-SC-80371 with U.S. Army Electronic Research and Development Activity, Fort Huachuca, Arizona, February 1963, CER63EJP-JEC9. 40. Cermak, J.E., R. C. Malhotra and E. J. Plate, INVESTIGATION OF THE CANDLESTICK PARK WIND PROBLEM, Vol. II: WIND-TUNNEL MODEL STUDY, Tech. Rept., Metronics Associates, Inc., Palo Alto, California, July 1963, CER63JEC-RCM-EJP27. 41. Cermak, J. E. and E. J. Plate, INVESTIGATIONS TO DEVELOP WIND TUNNEL TECHNIQUES FOR MEASURING ATMOSPHERIC GASEOUS DIFFUSION IN MODEL VEGETATIVE SURFACE, Tech. Rept., U.S. Dept. of Agri- culture, ARS, Contract No. 12-13-100-4546(41), July 1963, CER63EJP-JEC28. 42. Binder, G. J. and J. E. Cermak, STREAMING-POTENTIAL FLUCTUATIONS PRODUCED BY TURBULENCE, Physics of Fluids, Vol. 6, No. 8, pp. 1192-1193, August 1963, CEP63GJB-JEC11. 43. Cermak, J. E. and W. A. Perkins, INVESTIGATION OF THE CANDLESTICK PARK WIND PROBLEM, Vol. III: CONCLUSIONS, RECOMMENDATIONS AND SUMMARY OF INVESTIGATION, Tech. Rept., No. 102, Aerosol Labor- atory, Metronics Associates, Inc., Palo Alto, California, August 1963, CER63JEC41. 44. Plate, E. J., THE DRAG ON A SMOOTH FLAT PLATE WITH A FENCE IMMERSED IN ITS TURBULENT BOUNDARY LAYER, Presented at the Fluids Engineering Conference, Philadelphia, Pa. , May 18-21, 1964, ASME Paper No. 64-FE-17, pp. 1-12, CER63EJP-66. 45. Cermak, J. E., LAGRANGIAN SIMILARITY HYPOTHESIS APPLIED TO DIFFUSION IN TURBULENT SHEAR FLOW, Journal of Fluid Mechanics, Vol. 15, Part I, pp. 49-64, 1963, CEP63JEC13. 46. Sandborn, V. A., H. Weisblatt and R. F. Flagg, TEST TIME IN A 1.5 INCH DIAMETER HIGH STAGNATION ENTHALPY SHOCK TUBE, Journal of the AIAA, Vol. 1, 1963, CEP63VAS6. 47. Sandborn, V. A. and A. Todisco, SHOCK TUBE MEASUREMENTS OF THE THERMAL CONDUCTIVITY, RELAXIZATION AND IONIZATION OF AIR AND ABLATION GASES, 1963, AVCO-RAD-RM. 5 48. Davar, K. S., DIFFUSION FROM A POINT SOURCE WITHIN A TURBULENT BOUNDARY LAYER, Ph.D. Dissertation, July 1961, CED61KSD3. 49. Davar, K. S. and J. E. Cermak, CHARACTERISTICS OF DIFFUSION PLUMES FOR A POINT SOURCE WITHIN A TURBULENT BOUNDARY LAYER, Int.
Load more

Recommended publications
  • Synergistic Genetic Interactions Between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models
    BASIC RESEARCH www.jasn.org Synergistic Genetic Interactions between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models Rory J. Olson,1 Katharina Hopp ,2 Harrison Wells,3 Jessica M. Smith,3 Jessica Furtado,1,4 Megan M. Constans,3 Diana L. Escobar,3 Aron M. Geurts,5 Vicente E. Torres,3 and Peter C. Harris 1,3 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background Autosomal recessive polycystic kidney disease (ARPKD) and autosomal dominant polycystic kidney disease (ADPKD) are genetically distinct, with ADPKD usually caused by the genes PKD1 or PKD2 (encoding polycystin-1 and polycystin-2, respectively) and ARPKD caused by PKHD1 (encoding fibrocys- tin/polyductin [FPC]). Primary cilia have been considered central to PKD pathogenesis due to protein localization and common cystic phenotypes in syndromic ciliopathies, but their relevance is questioned in the simple PKDs. ARPKD’s mild phenotype in murine models versus in humans has hampered investi- gating its pathogenesis. Methods To study the interaction between Pkhd1 and Pkd1, including dosage effects on the phenotype, we generated digenic mouse and rat models and characterized and compared digenic, monogenic, and wild-type phenotypes. Results The genetic interaction was synergistic in both species, with digenic animals exhibiting pheno- types of rapidly progressive PKD and early lethality resembling classic ARPKD. Genetic interaction be- tween Pkhd1 and Pkd1 depended on dosage in the digenic murine models, with no significant enhancement of the monogenic phenotype until a threshold of reduced expression at the second locus was breached.
    [Show full text]
  • The Basal Bodies of Chlamydomonas Reinhardtii Susan K
    Dutcher and O’Toole Cilia (2016) 5:18 DOI 10.1186/s13630-016-0039-z Cilia REVIEW Open Access The basal bodies of Chlamydomonas reinhardtii Susan K. Dutcher1* and Eileen T. O’Toole2 Abstract The unicellular green alga, Chlamydomonas reinhardtii, is a biflagellated cell that can swim or glide. C. reinhardtii cells are amenable to genetic, biochemical, proteomic, and microscopic analysis of its basal bodies. The basal bodies contain triplet microtubules and a well-ordered transition zone. Both the mother and daughter basal bodies assemble flagella. Many of the proteins found in other basal body-containing organisms are present in the Chlamydomonas genome, and mutants in these genes affect the assembly of basal bodies. Electron microscopic analysis shows that basal body duplication is site-specific and this may be important for the proper duplication and spatial organization of these organelles. Chlamydomonas is an excellent model for the study of basal bodies as well as the transition zone. Keywords: Site-specific basal body duplication, Cartwheel, Transition zone, Centrin fibers Phylogeny and conservation of proteins Centrin, SPD2/CEP192, Asterless/CEP152; CEP70, The green lineage or Viridiplantae consists of the green delta-tubulin, and epsilon-tubulin. Chlamydomonas has algae, which include Chlamydomonas, the angiosperms homologs of all of these based on sequence conservation (the land plants), and the gymnosperms (conifers, cycads, except PLK4, CEP152, and CEP192. Several lines of evi- ginkgos). They are grouped together because they have dence suggests that CEP152, CEP192, and PLK4 interact chlorophyll a and b and lack phycobiliproteins. The green [20, 52] and their concomitant absence in several organ- algae together with the cycads and ginkgos have basal isms suggests that other mechanisms exist that allow for bodies and cilia, while the angiosperms and conifers have control of duplication [4].
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Cep78 Is a New Centriolar Protein Involved in Plk4-Induced Centriole
    © 2016. Published by The Company of Biologists Ltd | Journal of Cell Science (2016) 129, 2713-2718 doi:10.1242/jcs.184093 SHORT REPORT Cep78 is a new centriolar protein involved in Plk4-induced centriole overduplication Kathrin Brunk1,§, Mei Zhu1,*,§, Felix Bärenz1, Anne-Sophie Kratz1, Uta Haselmann-Weiss2, Claude Antony2,‡ and Ingrid Hoffmann1,¶ ABSTRACT 2006; Brito et al., 2012). Major components of the pathway in Centrioles are core components of centrosomes, the major human cells are the serine/threonine polo-like kinase 4 (Plk4), microtubule-organizing centers of animal cells, and act as basal Cep192, Cep152, Sas-6, STIL and CPAP (also known as CENPJ) bodies for cilia formation. Control of centriole number is therefore (Brito et al., 2012). In human cells, Plk4, Sas-6 and STIL localize to crucial for genome stability and embryogenesis. Centriole duplication the sites of procentriole formation and collaborate to induce requires the serine/threonine protein kinase Plk4. Here, we identify cartwheel assembly during daughter centriole formation. Plk4 is a Cep78 as a human centrosomal protein and a new interaction partner structurally divergent polo-like kinase family member as it harbors – of Plk4. Cep78 is mainly a centriolar protein that localizes to the three polo-boxes (PB1 PB3) whereas Plk1, Plk2 and Plk3 only centriolar wall. Furthermore, we find that Plk4 binds to Cep78 through have two polo-boxes, PB1 and PB2 (Slevin et al., 2012). its N-terminal domain but that Cep78 is not an in vitro Plk4 substrate. Few substrates of Plk4 have been described to date, including Cep78 colocalizes with Plk4 at centrioles and is required for STIL (Ohta et al., 2014; Dzhindzhev et al., 2014; Kratz et al., 2015; Plk4-induced centriole overduplication.
    [Show full text]
  • Is Cep70, a Centrosomal Protein with New Roles in Breast Cancer Dissemination and Metastasis, a Facilitator of Epithelial-Mesenchymal Transition?
    Is Cep70, a centrosomal protein with new roles in breast cancer dissemination and metastasis, a facilitator of epithelial-mesenchymal transition? Pedro A. Lazo 1,2 1 Experimental Therapeutics and Translational Oncology Program, Instituto de Biología Molecular y Celular del Cáncer, Consejo Superior de Investigaciones Científicas (CSIC), Universidad de Salamanca, Salamanca, Spain 2 Instituto de Investigación Biomédica de Salamanca (IBSAL), Hospital Universitario de Salamanca, Salamanca, Spain Running title: Cep70 and EMT Disclosures: None declared. Contact address: [email protected] 1 Introduction Microtubules are driving mechanisms of chromosomes, intracellular organelle movement, and cell shape and motility. Microtubules are organized on centrosomes, which are assembled in microtubule-organizing centers (MTOC). In mitosis there is no nuclear envelope and centromeres associated to microtubules are mainly involved in chromosome redistribution into daughter cells. In differentiated cells the microtubule- organizing centers are dispersed in the cytoplasm (non centrosomal (ncMTOC)) and interact with the minus end of microtubules through γ-tubulin. 1 However, it is not known if the microtubule contribution to tumor biology is only by facilitating tumor aneuploidy. During tumor dissemination, a process not linked to cell division, important changes take place in cell shape and motility. Microtubules are very dynamic because of their inherent structural instability, and this plasticity facilitates their reorganization during the epithelial-mesenchymal
    [Show full text]
  • The Transformation of the Centrosome Into the Basal Body: Similarities and Dissimilarities Between Somatic and Male Germ Cells and Their Relevance for Male Fertility
    cells Review The Transformation of the Centrosome into the Basal Body: Similarities and Dissimilarities between Somatic and Male Germ Cells and Their Relevance for Male Fertility Constanza Tapia Contreras and Sigrid Hoyer-Fender * Göttingen Center of Molecular Biosciences, Johann-Friedrich-Blumenbach Institute for Zoology and Anthropology-Developmental Biology, Faculty of Biology and Psychology, Georg-August University of Göttingen, 37077 Göttingen, Germany; [email protected] * Correspondence: [email protected] Abstract: The sperm flagellum is essential for the transport of the genetic material toward the oocyte and thus the transmission of the genetic information to the next generation. During the haploid phase of spermatogenesis, i.e., spermiogenesis, a morphological and molecular restructuring of the male germ cell, the round spermatid, takes place that includes the silencing and compaction of the nucleus, the formation of the acrosomal vesicle from the Golgi apparatus, the formation of the sperm tail, and, finally, the shedding of excessive cytoplasm. Sperm tail formation starts in the round spermatid stage when the pair of centrioles moves toward the posterior pole of the nucleus. The sperm tail, eventually, becomes located opposed to the acrosomal vesicle, which develops at the anterior pole of the nucleus. The centriole pair tightly attaches to the nucleus, forming a nuclear membrane indentation. An Citation: Tapia Contreras, C.; articular structure is formed around the centriole pair known as the connecting piece, situated in the Hoyer-Fender, S. The Transformation neck region and linking the sperm head to the tail, also named the head-to-tail coupling apparatus or, of the Centrosome into the Basal in short, HTCA.
    [Show full text]
  • Suppl. Table 1
    Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA
    [Show full text]
  • Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus
    LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary cul- ture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all condi- tions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127 IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem.
    [Show full text]
  • Supplementary File 1. Identity-‐By-‐Descent Allele
    Supplementary File 1. Identity-by-descent allele-sharing analysis of 12q23 region in families with HELLP: microsatellite markers Legends Identity-by-descent (IBD) allele-sharing analysis in families with HELLP was performed with 26 microsatellite markers covering the 23.6 Mb region on 12q23 between D12S309 and D12S395. Non-parametric multipoint linkage (Allegro 2) complemented by pedigree analysis was performed in 7 HELLP families with affected sisters (families 1-7), 4 families with affected cousins (families 8-11) and 1 family with discordant monozygotic twin sisters (family 12). A total of 57 individuals with 36 affected females was analyzed. Supplementary File 1A: Multipoint linkage analysis using Smnallele indicates the 4 marker region between PAH and D12S1647 with LOD and NPL scores >3 (box). Supplementary files 1B-D: Pedigree analysis indicates the same region with the presence of two minimal critial regions (I: D12S1607-PAH, II: D12S338-D123S317) in affected sister-pairs (1B), affected cousin pairs (1C) and discordant monozytic twin sisters (1D). Note the informative situation in family 11 (HELLP_93113) (1C) where two sisters from one family married two brothers from an unrelated family. In the affected cousins (93113/89, 93113/90) born from these couples, both alleles need to be shared in the region with linkage, as if these cousins were sisters. In the affected cousins (93113/89, 93113/90), both regions are supported. In their affected mothers (93113/12, 93113/8), maximal allele sharing is limited to the first region near D12S1030.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Supplementary Fig. S1. LD Mice Used in This Study Accumulate Polyglucosan Inclusions (Lafora Bodies) in the Brain
    1 SUPPLEMENTARY MATERIAL Supplementary Fig. S1. LD mice used in this study accumulate polyglucosan inclusions (Lafora bodies) in the brain. Samples from the hippocampus of five months old control, Epm2a-/- (lacking laforin) and Epm2b-/- mice (lacking malin) were stained with periodic acid Schiff reagent (PAS staining), which colors polysaccharide granules in red. Bar: 50 m. Supplementary Fig. S2. Principal component analysis (PCA) representing the first two components with the biggest level of phenotypic variability. Samples 1_S1 to 4_S4 corresponded to control, 5_S5, 6_S6 and 8_S8 to Epm2a-/- and 9_S9 to 12_S12 to Epm2b- /- samples, of animals of 16 months of age respectively. Supplementary Table S1. Primers used in this work to validate the expression of the corresponding genes by RT-qPCR. Supplementary Table S2: Genes downregulated more than 0.5 fold in Epm2a-/- and Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. Supplementary Table S3: Genes upregulated more than 1.5 fold in Epm2a-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. Supplementary Table S4: Genes upregulated more than 1.5 fold in Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. 2 Supplementary Table S5: Genes upregulated in both Epm2a-/- and Epm2b-/- mice of 16 months of age.
    [Show full text]
  • PPP1R35 Is a Novel Centrosomal Protein That Regulates
    RESEARCH ARTICLE PPP1R35 is a novel centrosomal protein that regulates centriole length in concert with the microcephaly protein RTTN Andrew Michael Sydor1, Etienne Coyaud2, Cristina Rovelli1, Estelle Laurent2, Helen Liu1, Brian Raught2,3, Vito Mennella1,4* 1Cell Biology Program, The Hospital for Sick Children, Toronto, Canada; 2Princess Margaret Cancer Centre, University Health Network, Toronto, Canada; 3Department of Medical Biophysics, University of Toronto, Ontario, Canada; 4Department of Biochemistry, University of Toronto, Ontario, Canada Abstract Centrosome structure, function, and number are finely regulated at the cellular level to ensure normal mammalian development. Here, we characterize PPP1R35 as a novel bona fide centrosomal protein and demonstrate that it is critical for centriole elongation. Using quantitative super-resolution microscopy mapping and live-cell imaging we show that PPP1R35 is a resident centrosomal protein located in the proximal lumen above the cartwheel, a region of the centriole that has eluded detailed characterization. Loss of PPP1R35 function results in decreased centrosome number and shortened centrioles that lack centriolar distal and microtubule wall associated proteins required for centriole elongation. We further demonstrate that PPP1R35 acts downstream of, and forms a complex with, RTTN, a microcephaly protein required for distal centriole elongation. Altogether, our study identifies a novel step in the centriole elongation pathway centered on PPP1R35 and elucidates downstream partners of the microcephaly protein RTTN. DOI: https://doi.org/10.7554/eLife.37846.001 *For correspondence: [email protected] Introduction Competing interests: The The centrosome is a membrane-less organelle whose major role is to organize, orient, and regulate authors declare that no competing interests exist. the site of microtubule formation.
    [Show full text]
  • Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets
    www.nature.com/scientificreports OPEN Assessment of a complete and classifed platelet proteome from genome‑wide transcripts of human platelets and megakaryocytes covering platelet functions Jingnan Huang1,2*, Frauke Swieringa1,2,9, Fiorella A. Solari2,9, Isabella Provenzale1, Luigi Grassi3, Ilaria De Simone1, Constance C. F. M. J. Baaten1,4, Rachel Cavill5, Albert Sickmann2,6,7,9, Mattia Frontini3,8,9 & Johan W. M. Heemskerk1,9* Novel platelet and megakaryocyte transcriptome analysis allows prediction of the full or theoretical proteome of a representative human platelet. Here, we integrated the established platelet proteomes from six cohorts of healthy subjects, encompassing 5.2 k proteins, with two novel genome‑wide transcriptomes (57.8 k mRNAs). For 14.8 k protein‑coding transcripts, we assigned the proteins to 21 UniProt‑based classes, based on their preferential intracellular localization and presumed function. This classifed transcriptome‑proteome profle of platelets revealed: (i) Absence of 37.2 k genome‑ wide transcripts. (ii) High quantitative similarity of platelet and megakaryocyte transcriptomes (R = 0.75) for 14.8 k protein‑coding genes, but not for 3.8 k RNA genes or 1.9 k pseudogenes (R = 0.43–0.54), suggesting redistribution of mRNAs upon platelet shedding from megakaryocytes. (iii) Copy numbers of 3.5 k proteins that were restricted in size by the corresponding transcript levels (iv) Near complete coverage of identifed proteins in the relevant transcriptome (log2fpkm > 0.20) except for plasma‑derived secretory proteins, pointing to adhesion and uptake of such proteins. (v) Underrepresentation in the identifed proteome of nuclear‑related, membrane and signaling proteins, as well proteins with low‑level transcripts.
    [Show full text]