DOCSLIB.ORG

Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary cul- ture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all condi- tions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127 IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem. Genetic components to glaucoma are dants of a single founder, so GLC1C mu- suggested by high concordance for POAG tations may be found in multiple current among older monozygotic twins2 as well glaucoma genetics study populations. as mapping of a large number of glau- Here we describe expression data for 41 coma risk factor loci3,4 plus 12 POAG loci, genes within the GLC1C genetic inclu- called GLC1 loci.5-14 No unifying cellular sion interval and 7 high-priority candi- or biochemical themes have emerged from date genes selected based on overall or dif- the identification of the first 3 GLC1 genes: ferential expression. These data should Author Affiliations: myocilin (MYOC; Online Mendelian In- help to inform the work of many groups Departments of Ophthalmology heritance in Man [OMIM] 601652) at the in the field who are looking for genes that and Visual Sciences (Drs Rozsa, GLC1A locus,15,16 optineurin (OPTN; cause glaucoma. Pawar, and Richards and OMIM 602432) at the GLC1E locus,17 and Ms Scott) and Epidemiology WD-repeat36 (WDR36)atGLC1G11; these METHODS (Dr Richards), University of Michigan, Ann Arbor; and genes do not account for most of the fa- Department of Ophthalmology, milial cases of POAG. CELL LINES Oregon Health and Science The GLC1C locus is of special interest University, Portland because the gene itself has not been found For this institutional review board–approved (Drs Samples and Wirtz). but the locus has been confirmed through study, eyes were obtained from the Midwest (REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 117 ©2007 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 Table 1. Primers Used in Quantitative Polymerase Chain Reaction Genomic cDNA Gene Forward Primer Reverse Primer Size, bp Size, bp GLC1C-Region Genes Not on the U133A GeneChip, 5؅ to 3؅ ACPL2 GTGCATGTGTTCATTCGCCAC TCAGCAGCTGACCGTTCTGCA 12 894 271 DZIP1L CAGCTAGAAGCTCCAGCAAAG GCAGCCTCTTCTGTTGAAGTG 1991 341 FAM62C ATCAGAGTGCACTTGCTGGAG GTGGCCACATTGTGCACAAAG 5777 654 FNDC6 CCCTGTTTGCCTTTGTTGGCT TGTCCCCTCATGGTTTCCATG 14 852 296 GRK7 GTTGCTGGACGAACACCATTC GGTTCAATTAGGCCAGCTTCC 9048 254 KY ATGACATTGCAGCTGCTCAGG ACTTGAGCGTGTACTCCAGCA 15 001 708 MGC40579 TTCTCTAGCTGGCCTTGCTGT TCCCTGAGCTTCATCTCATCTG 4796 242 NMNAT3 GCAAACTGCTCAGATCTCCAC AAGGCTCGCCTGATGTATGTG 12 427 322 RBP2 AAGGGACCAGAATGGAACCTG CTTAACATGCCGGTTATCCAG 14 343 247 SPSB4 ATGAGGGCACACTCAGCTTCA GCTCACTGGTACTGCAGATAG 80 617 274 TRIM42 AGCAACACTGACAAGAAGGCC CTGAGGTTGTTTCCTGCTCTG 12 694 574 TXNDC6 TCAGAGAGGACCTGTACCTTG CAACCTTGGCTGTGTACTGGA 43 915 489 XRN1 CTGGGAAGCCCTTCCATCATA TGGCTAGTCTGAACTGGAGTG 965 181 Non-GLC1C Genes for Normalization and Regression, 5؅ to 3؅ ACTA2 ATGGAGTCTGCTGGCATCCAT CCGGCTTCATCGTATTCCTGT 2987 293 FST GGGATTTCAAGGTTGGGAGAG GGAAAGCTGTAGTCCTGGTCT 961 238 G1P2 GCAGCGAACTCATCTTTGCCA CAGAGGTTCGTCGCATTTGTC 718 311 GAPDH AAGGTGAAGGTCGGAGTCAAC CCTGGAAGATGGTGATGGGAT 1955 229 GREM2 AGACCAAACTTAGACCCCGCT TGCCATCTCTCCGAGTTGTTG 118 656 249 HGF GGGAAGGTGACTCTGAATGAG GTGGGTGCTTCAGACACACTT 2906 274 KLF4 CACCCACACTTGTGATTACGC GACTCAGTTGGGAACTTGACC 1493 392 LIF ACGCCACCCATGTCACAACAA TGGGGTTGAGGATCTTCTGGT 971 278 MFGE8 AAACGCGGTGCATGTCAACCT CGTTGAAGTTGCCCTGCTTGT 4287 266 MYOC TATCTCAGGAGTGGAGAGGGA CTGGCTGATGAGGTCATACTC 2103 216 PTGS1 CAGGAACATGGACCACCACAT TCCGGAGAACAGATGGGATTC 2161 318 SULF1 TGGAGCTCAGAAGCTGTCAAG CATAGTGACTCTTCAGCAGTG 19 907 295 TNFAIP6 AGGAGTGTGGTGGCGTCTTTA CCAGCTGTCACTGAAGCATCA 9390 316 Abbreviations: bp, base pairs; cDNA, complementary DNA. Eye Banks (Ann Arbor, Mich), which obtained informed con- test, with PϽ.005 considered statistically significant. Scatter- sent and confirmed that no donors had been diagnosed with plots were drawn using Spotfire DecisionSite 8.2 software (Spot- glaucoma. Fifth-passage primary cultures of human trabecu- fire, Inc, Cambridge, Mass). lar meshwork (TM) cells used in age experiments came from Of the genes in the GLC1C interval between D3S3637 and 12- and 60-year-old females and 16- and 74-year-old males. D3S3694 obtained from the University of California, Santa Cruz, Cells were grown to confluence and maintained for 1 week Genome Browser (http://genome.ucsc.edu),18 28 were assayed before isolating RNA as previously described.21 In dexametha- by the U133A GeneChip and 13 were assayed by quantitative sone studies, fifth-passage TM cells were derived from young polymerase chain reaction (qPCR) using primers (Table 1) donors aged 12 and 16 years (as described in this article ear- in iQ SYBR Green Supermix reactions (BioRad Laboratories, lier) and a 17-year-old girl. The TM cells were grown with and Hercules, Calif) as previously described.21 We did not per- without a 21-day course of 100nM dexamethasone as previ- form qPCR confirmation of all of the GeneChip values be- ously described.21 cause results from previous experiments show GeneChip data to be adequate in the signal range being evaluated here. MICROARRAY ANALYSIS QUANTITATIVE PCR Labeling, hybridization to Affymetrix U133A GeneChips (Af- fymetrix, Santa Clara, Calif), and data extraction were done as Data from qPCR were assigned an estimated Affymetrix signal 21 previously described. The RNA was prepared from 2 sepa- value (EASV) using linear regression. The log2 values of Af- rate flasks for each culture, and conditions and data from bio- fymetrix signals from 9 control genes (Table 1) were plotted logical replicates were compared as previously described.21 against their corresponding qPCR threshold values normal- Image analysis was performed using Affymetrix Microar- ized to glyceraldehyde-3-phosphate dehydrogenase (Figure 1). ray Analysis Suite version 5.1 with samples scaled to 1500. Sig- These data are from the same RNA and GeneChips used for nals below 300 were considered absent and signals between 300 the other aspects of this study. The plot had an R2 value of and 750 were considered marginal. Values above 750 were con- 0.7459, and imputed values were calculated using the equa- ϫ ϩ [(C t −0.3866) 21.517] sidered present. tion EASV=2 , where Ct is the threshold value Fold change for each probe was calculated by dividing the for qPCR. The validity of the regression was examined by com- mean “treated” signal by the mean “untreated” signal in the dex- paring the actual and imputed signal values using qPCR data amethasone experiments and the mean “old” signal by the mean from 3 genes that were not used to construct the curve (Table 2). “young” signal in the age experiments. The inverse function When comparing data for the 3 control genes under 4 condi- was applied to values below 1 to indicate decreased expres- tions, we found that 8 of 12 data points showed less than a 2.5- sion. The significance of fold change was evaluated using the t fold difference between the imputed and actual Affymetrix val- (REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 118 ©2007 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 ues. In a separate experiment in which data from a different RESULTS RNA sample tested on the Affymetrix U133Av2 version 2 chips were examined for the 6 experimental genes for which we need to impute values, we found that 5 of 6 measured data points The 7 879 854–base pair GLC1C interval between fell within 2.5-fold of the imputed values. D3S3637 and D3S3694 contains 41 genes (Table 3). We The EASV gives us an approximate value for comparing data evaluated gene expression under
Load more

Recommended publications
  • View of the Literature
    Roles of Adipose Tissue-Derived Factors in Adipose Tissue Development and Lipid Metabolism Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Jinsoo Ahn, M.S. Graduate Program in Ohio State University Nutrition The Ohio State University 2015 Dissertation Committee: Kichoon Lee, Ph.D., Advisor Earl H. Harrison, Ph.D. Ramesh Selvaraj, Ph.D. Ouliana Ziouzenkova, Ph.D. Copyright by Jinsoo Ahn 2015 Abstract Obesity is a global trend and major risk factor for serious diseases including type 2 diabetes, heart disease, and hypertension. Obesity is characterized by excess fat accumulation, especially in the visceral area. The pathogenic effects related to common obesity are largely attributed to dysregulated secretion of adipokines followed by insulin resistance in peripheral tissues when adipose tissue mass is altered. White adipose tissue serves as a dynamic endocrine organ as well as a major energy reservoir for whole-body energy homeostasis. Adipokines influence various metabolic processes in the body including adipocyte differentiation; however, precise physiological roles of adipokines need to be further investigated. In addition, a large proportion of adipokines still needs to be identified. Information from the gene expression omnibus (GEO) profile, a public repository for microarray data, combined with confirmatory studies on mRNA and protein expression were used to identify a novel adipose tissue-specific gene, chordin-like 1 (Chrdl1). Further analysis showed that Chrdl1 encodes a putative secreted protein which is a new adipokine. Chrdl1 expression increases during 3T3-L1 adipocyte development in vitro and mouse adipose tissue development in vivo.
    [Show full text]
  • Genome-Wide Analysis of 5-Hmc in the Peripheral Blood of Systemic Lupus Erythematosus Patients Using an Hmedip-Chip
    INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 35: 1467-1479, 2015 Genome-wide analysis of 5-hmC in the peripheral blood of systemic lupus erythematosus patients using an hMeDIP-chip WEIGUO SUI1*, QIUPEI TAN1*, MING YANG1, QIANG YAN1, HUA LIN1, MINGLIN OU1, WEN XUE1, JIEJING CHEN1, TONGXIANG ZOU1, HUANYUN JING1, LI GUO1, CUIHUI CAO1, YUFENG SUN1, ZHENZHEN CUI1 and YONG DAI2 1Guangxi Key Laboratory of Metabolic Diseases Research, Central Laboratory of Guilin 181st Hospital, Guilin, Guangxi 541002; 2Clinical Medical Research Center, the Second Clinical Medical College of Jinan University (Shenzhen People's Hospital), Shenzhen, Guangdong 518020, P.R. China Received July 9, 2014; Accepted February 27, 2015 DOI: 10.3892/ijmm.2015.2149 Abstract. Systemic lupus erythematosus (SLE) is a chronic, Introduction potentially fatal systemic autoimmune disease characterized by the production of autoantibodies against a wide range Systemic lupus erythematosus (SLE) is a typical systemic auto- of self-antigens. To investigate the role of the 5-hmC DNA immune disease, involving diffuse connective tissues (1) and modification with regard to the onset of SLE, we compared is characterized by immune inflammation. SLE has a complex the levels 5-hmC between SLE patients and normal controls. pathogenesis (2), involving genetic, immunologic and envi- Whole blood was obtained from patients, and genomic DNA ronmental factors. Thus, it may result in damage to multiple was extracted. Using the hMeDIP-chip analysis and valida- tissues and organs, especially the kidneys (3). SLE arises from tion by quantitative RT-PCR (RT-qPCR), we identified the a combination of heritable and environmental influences. differentially hydroxymethylated regions that are associated Epigenetics, the study of changes in gene expression with SLE.
    [Show full text]
  • Id Proteins Promote a Cancer Stem Cell Phenotype in Triple Negative Breast
    bioRxiv preprint doi: https://doi.org/10.1101/497313; this version posted March 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Id proteins promote a cancer stem cell phenotype in triple negative 2 breast cancer via negative regulation of Robo1 3 Wee S. Teo1,2, Holly Holliday1,2#, Nitheesh Karthikeyan3#, Aurélie S. Cazet1,2, Daniel L. 4 Roden1,2, Kate Harvey1, Christina Valbirk Konrad1, Reshma Murali3, Binitha Anu Varghese3, 5 Archana P. T.3,4, Chia-Ling Chan1,2, Andrea McFarland1, Simon Junankar1,2, Sunny Ye1, 6 Jessica Yang1, Iva Nikolic1,2, Jaynish S. Shah5, Laura A. Baker1,2, Ewan K.A. Millar1,6,7,8, 7 Mathew J. Naylor1,2,10, Christopher J. Ormandy1,2, Sunil R. Lakhani11, Warren Kaplan1,12, 8 Albert S. Mellick13,14, Sandra A. O’Toole1,9, Alexander Swarbrick1,2*, Radhika Nair1,2,3* 9 Affiliations 10 1Garvan Institute of Medical Research, Darlinghurst, New South Wales, Australia 11 2St Vincent’s Clinical School, Faculty of Medicine, UNSW Sydney, New South Wales, 12 Australia 13 3 Cancer Research Program, Rajiv Gandhi Centre for Biotechnology, Kerala, India 14 4Manipal Academy of Higher Education, Manipal, Karnataka, India 15 5Centenary Institute, The University of Sydney, New South Wales, Australia 16 6 Department of Anatomical Pathology, NSW Health Pathology, St George Hospital, 17 Kogarah, NSW, Australia 18 7 School of Medical Sciences, UNSW Sydney, Kensington NSW, Australia.
    [Show full text]
  • Transcriptomic Analysis of the Aquaporin (AQP) Gene Family
    Pancreatology 19 (2019) 436e442 Contents lists available at ScienceDirect Pancreatology journal homepage: www.elsevier.com/locate/pan Transcriptomic analysis of the Aquaporin (AQP) gene family interactome identifies a molecular panel of four prognostic markers in patients with pancreatic ductal adenocarcinoma Dimitrios E. Magouliotis a, b, Vasiliki S. Tasiopoulou c, Konstantinos Dimas d, * Nikos Sakellaridis d, Konstantina A. Svokos e, Alexis A. Svokos f, Dimitris Zacharoulis b, a Division of Surgery and Interventional Science, Faculty of Medical Sciences, UCL, London, UK b Department of Surgery, University of Thessaly, Biopolis, Larissa, Greece c Faculty of Medicine, School of Health Sciences, University of Thessaly, Biopolis, Larissa, Greece d Department of Pharmacology, Faculty of Medicine, School of Health Sciences, University of Thessaly, Biopolis, Larissa, Greece e The Warren Alpert Medical School of Brown University, Providence, RI, USA f Riverside Regional Medical Center, Newport News, VA, USA article info abstract Article history: Background: This study aimed to assess the differential gene expression of aquaporin (AQP) gene family Received 14 October 2018 interactome in pancreatic ductal adenocarcinoma (PDAC) using data mining techniques to identify novel Received in revised form candidate genes intervening in the pathogenicity of PDAC. 29 January 2019 Method: Transcriptome data mining techniques were used in order to construct the interactome of the Accepted 9 February 2019 AQP gene family and to determine which genes members are differentially expressed in PDAC as Available online 11 February 2019 compared to controls. The same techniques were used in order to evaluate the potential prognostic role of the differentially expressed genes. Keywords: PDAC Results: Transcriptome microarray data of four GEO datasets were incorporated, including 142 primary Aquaporin tumor samples and 104 normal pancreatic tissue samples.
    [Show full text]
  • The Basal Bodies of Chlamydomonas Reinhardtii Susan K
    Dutcher and O’Toole Cilia (2016) 5:18 DOI 10.1186/s13630-016-0039-z Cilia REVIEW Open Access The basal bodies of Chlamydomonas reinhardtii Susan K. Dutcher1* and Eileen T. O’Toole2 Abstract The unicellular green alga, Chlamydomonas reinhardtii, is a biflagellated cell that can swim or glide. C. reinhardtii cells are amenable to genetic, biochemical, proteomic, and microscopic analysis of its basal bodies. The basal bodies contain triplet microtubules and a well-ordered transition zone. Both the mother and daughter basal bodies assemble flagella. Many of the proteins found in other basal body-containing organisms are present in the Chlamydomonas genome, and mutants in these genes affect the assembly of basal bodies. Electron microscopic analysis shows that basal body duplication is site-specific and this may be important for the proper duplication and spatial organization of these organelles. Chlamydomonas is an excellent model for the study of basal bodies as well as the transition zone. Keywords: Site-specific basal body duplication, Cartwheel, Transition zone, Centrin fibers Phylogeny and conservation of proteins Centrin, SPD2/CEP192, Asterless/CEP152; CEP70, The green lineage or Viridiplantae consists of the green delta-tubulin, and epsilon-tubulin. Chlamydomonas has algae, which include Chlamydomonas, the angiosperms homologs of all of these based on sequence conservation (the land plants), and the gymnosperms (conifers, cycads, except PLK4, CEP152, and CEP192. Several lines of evi- ginkgos). They are grouped together because they have dence suggests that CEP152, CEP192, and PLK4 interact chlorophyll a and b and lack phycobiliproteins. The green [20, 52] and their concomitant absence in several organ- algae together with the cycads and ginkgos have basal isms suggests that other mechanisms exist that allow for bodies and cilia, while the angiosperms and conifers have control of duplication [4].
    [Show full text]
  • Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus
    LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary cul- ture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all condi- tions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127 IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem.
    [Show full text]
  • RBP2 Belongs to a Family of Demethylases, Specific For
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector RBP2 Belongs to a Family of Demethylases, Specific for Tri- and Dimethylated Lysine 4 on Histone 3 Jesper Christensen,1,2,4 Karl Agger,1,2,4 Paul A.C. Cloos,1,2,4 Diego Pasini,1,2 Simon Rose,2 Lau Sennels,3 Juri Rappsilber,3 Klaus H. Hansen,1,2 Anna Elisabetta Salcini,2,* and Kristian Helin1,2,* 1 Centre for Epigenetics 2 Biotech Research and Innovation Centre (BRIC) University of Copenhagen, Ole Maaløes Vej 5, 2200 Copenhagen, Denmark 3 Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh, EH9 3JR, UK 4 These authors contributed equally to this work. *Correspondence: [email protected] (K.H.), [email protected] (A.E.S.) DOI 10.1016/j.cell.2007.02.003 SUMMARY activity (Strahl and Allis, 2000; Turner, 2000). Thus, some of these modifications appear to play important roles in Methylation of histones has been regarded as dividing the genome into transcriptionally active and a stable modification defining the epigenetic inactive areas. program of the cell, which regulates chromatin As an example of this, tri- and dimethylation of histone structure and transcription. However, the recent H3 at lysine 4 (H3K4me3/me2) is restricted to euchromatin discovery of histone demethylases has chal- and is generally associated with active transcription (Sims lenged the stable nature of histone methylation. and Reinberg, 2006). The H3K4 tri- and dimethylation marks may facilitate transcription by the recruitment of nu- Here we demonstrate that the JARID1 proteins cleosome remodeling complexes and histone-modifying RBP2, PLU1, and SMCX are histone demethy- enzymes or by preventing transcriptional repressors lases specific for di- and trimethylated histone from binding to chromatin.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
    [Show full text]