Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus

Home , CEP70, CLDN18, COPB2, DBR1, FOXC2, MFGE8

LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus

Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD

Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary culture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all conditions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127

IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem. Genetic components to glaucoma are dants of a single founder, so GLC1C mu- suggested by high concordance for POAG tations may be found in multiple current among older monozygotic twins2 as well glaucoma genetics study populations. as mapping of a large number of glau- Here we describe expression data for 41 coma risk factor loci3,4 plus 12 POAG loci, genes within the GLC1C genetic inclu- called GLC1 loci.5-14 No unifying cellular sion interval and 7 high-priority candi- or biochemical themes have emerged from date genes selected based on overall or dif- the identification of the first 3 GLC1 genes: ferential expression. These data should Author Affiliations: myocilin (MYOC; Online Mendelian In- help to inform the work of many groups Departments of Ophthalmology heritance in Man [OMIM] 601652) at the in the field who are looking for genes that and Visual Sciences (Drs Rozsa, GLC1A locus,15,16 optineurin (OPTN; cause glaucoma. Pawar, and Richards and OMIM 602432) at the GLC1E locus,17 and Ms Scott) and Epidemiology WD-repeat36 (WDR36)atGLC1G11; these METHODS (Dr Richards), University of Michigan, Ann Arbor; and genes do not account for most of the fa- Department of Ophthalmology, milial cases of POAG. CELL LINES Oregon Health and Science The GLC1C locus is of special interest University, Portland because the gene itself has not been found For this institutional review board–approved (Drs Samples and Wirtz). but the locus has been confirmed through study, eyes were obtained from the Midwest

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 117

Genomic cDNA Gene Forward Primer Reverse Primer Size, bp Size, bp GLC1C-Region Genes Not on the U133A GeneChip, 5؅ to 3؅ ACPL2 GTGCATGTGTTCATTCGCCAC TCAGCAGCTGACCGTTCTGCA 12 894 271 DZIP1L CAGCTAGAAGCTCCAGCAAAG GCAGCCTCTTCTGTTGAAGTG 1991 341 FAM62C ATCAGAGTGCACTTGCTGGAG GTGGCCACATTGTGCACAAAG 5777 654 FNDC6 CCCTGTTTGCCTTTGTTGGCT TGTCCCCTCATGGTTTCCATG 14 852 296 GRK7 GTTGCTGGACGAACACCATTC GGTTCAATTAGGCCAGCTTCC 9048 254 KY ATGACATTGCAGCTGCTCAGG ACTTGAGCGTGTACTCCAGCA 15 001 708 MGC40579 TTCTCTAGCTGGCCTTGCTGT TCCCTGAGCTTCATCTCATCTG 4796 242 NMNAT3 GCAAACTGCTCAGATCTCCAC AAGGCTCGCCTGATGTATGTG 12 427 322 RBP2 AAGGGACCAGAATGGAACCTG CTTAACATGCCGGTTATCCAG 14 343 247 SPSB4 ATGAGGGCACACTCAGCTTCA GCTCACTGGTACTGCAGATAG 80 617 274 TRIM42 AGCAACACTGACAAGAAGGCC CTGAGGTTGTTTCCTGCTCTG 12 694 574 TXNDC6 TCAGAGAGGACCTGTACCTTG CAACCTTGGCTGTGTACTGGA 43 915 489 XRN1 CTGGGAAGCCCTTCCATCATA TGGCTAGTCTGAACTGGAGTG 965 181 Non-GLC1C Genes for Normalization and Regression, 5؅ to 3؅ ACTA2 ATGGAGTCTGCTGGCATCCAT CCGGCTTCATCGTATTCCTGT 2987 293 FST GGGATTTCAAGGTTGGGAGAG GGAAAGCTGTAGTCCTGGTCT 961 238 G1P2 GCAGCGAACTCATCTTTGCCA CAGAGGTTCGTCGCATTTGTC 718 311 GAPDH AAGGTGAAGGTCGGAGTCAAC CCTGGAAGATGGTGATGGGAT 1955 229 GREM2 AGACCAAACTTAGACCCCGCT TGCCATCTCTCCGAGTTGTTG 118 656 249 HGF GGGAAGGTGACTCTGAATGAG GTGGGTGCTTCAGACACACTT 2906 274 KLF4 CACCCACACTTGTGATTACGC GACTCAGTTGGGAACTTGACC 1493 392 LIF ACGCCACCCATGTCACAACAA TGGGGTTGAGGATCTTCTGGT 971 278 MFGE8 AAACGCGGTGCATGTCAACCT CGTTGAAGTTGCCCTGCTTGT 4287 266 MYOC TATCTCAGGAGTGGAGAGGGA CTGGCTGATGAGGTCATACTC 2103 216 PTGS1 CAGGAACATGGACCACCACAT TCCGGAGAACAGATGGGATTC 2161 318 SULF1 TGGAGCTCAGAAGCTGTCAAG CATAGTGACTCTTCAGCAGTG 19 907 295 TNFAIP6 AGGAGTGTGGTGGCGTCTTTA CCAGCTGTCACTGAAGCATCA 9390 316

Abbreviations: bp, base pairs; cDNA, complementary DNA.

Eye Banks (Ann Arbor, Mich), which obtained informed con- test, with PϽ.005 considered statistically significant. Scatter- sent and confirmed that no donors had been diagnosed with plots were drawn using Spotfire DecisionSite 8.2 software (Spot- glaucoma. Fifth-passage primary cultures of human trabecu- fire, Inc, Cambridge, Mass). lar meshwork (TM) cells used in age experiments came from Of the genes in the GLC1C interval between D3S3637 and 12- and 60-year-old females and 16- and 74-year-old males. D3S3694 obtained from the University of California, Santa Cruz, Cells were grown to confluence and maintained for 1 week Genome Browser (http://genome.ucsc.edu),18 28 were assayed before isolating RNA as previously described.21 In dexametha- by the U133A GeneChip and 13 were assayed by quantitative sone studies, fifth-passage TM cells were derived from young polymerase chain reaction (qPCR) using primers (Table 1) donors aged 12 and 16 years (as described in this article ear- in iQ SYBR Green Supermix reactions (BioRad Laboratories, lier) and a 17-year-old girl. The TM cells were grown with and Hercules, Calif) as previously described.21 We did not per- without a 21-day course of 100nM dexamethasone as previ- form qPCR confirmation of all of the GeneChip values be- ously described.21 cause results from previous experiments show GeneChip data to be adequate in the signal range being evaluated here. MICROARRAY ANALYSIS QUANTITATIVE PCR Labeling, hybridization to Affymetrix U133A GeneChips (Af- fymetrix, Santa Clara, Calif), and data extraction were done as Data from qPCR were assigned an estimated Affymetrix signal 21 previously described. The RNA was prepared from 2 sepa- value (EASV) using linear regression. The log2 values of Af- rate flasks for each culture, and conditions and data from bio- fymetrix signals from 9 control genes (Table 1) were plotted logical replicates were compared as previously described.21 against their corresponding qPCR threshold values normal- Image analysis was performed using Affymetrix Microar- ized to glyceraldehyde-3-phosphate dehydrogenase (Figure 1). ray Analysis Suite version 5.1 with samples scaled to 1500. Sig- These data are from the same RNA and GeneChips used for nals below 300 were considered absent and signals between 300 the other aspects of this study. The plot had an R2 value of and 750 were considered marginal. Values above 750 were con- 0.7459, and imputed values were calculated using the equa- ϫ ϩ [(C t −0.3866) 21.517] sidered present. tion EASV=2 , where Ct is the threshold value Fold change for each probe was calculated by dividing the for qPCR. The validity of the regression was examined by com- mean “treated” signal by the mean “untreated” signal in the dex- paring the actual and imputed signal values using qPCR data amethasone experiments and the mean “old” signal by the mean from 3 genes that were not used to construct the curve (Table 2). “young” signal in the age experiments. The inverse function When comparing data for the 3 control genes under 4 condi- was applied to values below 1 to indicate decreased expres- tions, we found that 8 of 12 data points showed less than a 2.5- sion. The significance of fold change was evaluated using the t fold difference between the imputed and actual Affymetrix val-

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 118

©2007 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 ues. In a separate experiment in which data from a different RESULTS RNA sample tested on the Affymetrix U133Av2 version 2 chips were examined for the 6 experimental genes for which we need to impute values, we found that 5 of 6 measured data points The 7 879 854–base pair GLC1C interval between fell within 2.5-fold of the imputed values. D3S3637 and D3S3694 contains 41 genes (Table 3). We The EASV gives us an approximate value for comparing data evaluated gene expression under 4 conditions: TM cells derived from GeneChips with qPCR data for genes not on the cultured from 2 young donors, TM cells cultured from GeneChip, but only approximate and qualitative conclusions 2 older donors, and 3 young TM cell cultures treated with can be drawn. We have not compared variability across pro- and without dexamethasone. Although some genes can tocols, and we recommend that linear regression be performed using data in which the known and unknown Affyme- show substantial individual variation in responses to dex- trix and qPCR assays are carried out by the same person on the amethasone between individuals, the largest difference same instruments. Use of a larger number of replicate values in fold change between individuals for any gene in this is expected to improve the accuracy of the EASV. We consider region was only 0.46. the EASV in this case to be approximately accurate and not valid for making subtle distinctions between similar signal levels. Fu- GLC1C-REGION GENE EXPRESSION ture development of this method, including compensation for IN PRIMARY HUMAN TM CULTURES factors such as PCR product size and guanine-cytosine con- tent, may allow for increased precision but will not allow for extension of this approach to genes expressed at levels above Adenosine triphosphatase, sodium-potassium– the saturation point of the Affymetrix GeneChip. Imputed val- transporting, ␤3 polypeptide (ATP1B3) has the highest ues are used for display purposes, but primary conclusions are mean signal level across all 4 conditions tested (range, drawn from qPCR where available. 16 000-26 000), which is 6.6- to 10.8-fold higher than the average signal of 2400 for all probes and all conditions on 27 GeneChips. Coatomer protein complex, subunit 16.0 ␤2(␤ prime) (COPB2) has the second highest signal (range, 6000-11 000). Two other genes, transmem- 15.0 brane protein 22 (TMEM22) and solute carrier family 25, member 36 (SLC25A36), reach signal levels above 5000 14.0 y = – 0.3866x + 21.517 for at least 1 of the 4 conditions, and 15 other genes show R 2 = 0.7459 13.0 signals above 1000 for at least 1 condition (Table 4). Signals for 16 of the 41 genes in the GLC1C region are 12.0 considered present under all 4 conditions (Figure 2). Eleven genes with Affymetrix signals below 750 in all 11.0

(Mean Affymetrix Signal) 4 conditions were considered marginally expressed. Sig- 2

Log 10.0 nals for 3 of these genes were considered absent in 1 or more conditions (Table 4). Probes corresponding to 4 9.0 genes, forkhead box L2 (FOXL2), armadillo repeat- containing 8 (ARMC8), sex-determining region Y–box 14 8.0 15.0 17.0 19.0 21.0 23.0 25.0 27.0 29.0 31.0 33.0 35.0 (SOX14), and calsyntenin 2 (CLSTN2), showed absent Normalized qPRC Threshold Cycle signals in all 4 experimental conditions (Table 4 and Figure 2). Figure 1. Regression of Affymetrix signal values vs normalized quantitative For 13 genes not on the U133A GeneChip, surrogate polymerase chain reaction (qPCR) threshold values. The log2 of the Affymetrix microarray signals imputed from the qPCR Affymetrix signal value from 9 genes (ACTA2, FST, HGF, KLF4, LIF, MYOC, PTGS1, SULF1, and TNFAIP6) is plotted against qPCR threshold values cycle threshold (see the “Quantitative PCR” subsection normalized to glyceraldehyde-3-phosphate dehydrogenase. The equation of of the “Methods” section) allowed for a qualitative com- the regression line and R 2 value are shown. parison of signal levels for all GLC1C-interval genes on

Table 2. Actual and Imputed Mean Affymetrix Signal Levels of Control Genes

Signal Level, Mean

Untreated Dexamethasone-Treated Samples From Samples From Control Genes Samples Samples Younger Individuals Older Individuals G1P2 Actual 8017 1943 9644 3426 Imputed* 4127 959 2301 2525 GREM2 Actual 21 961 7866 13 328 921 Imputed* 11 524 3802 8643 3706 MFGE8 Actual 1716 5826 1884 11 507 Imputed* 8984 12 849 8644 19 565

*Imputed values are derived from the regression line shown in Figure 1.

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 119

Gene Start, GenBank OMIM Entrez UniGene Affymetrix Symbol Aliases bp* No. No. No. No. Identification No. D3S3637 GLC1C interval boundary 135 793 868 ...... KY . . . 135 804 814 NM_178554 . . . 339855 224421 1564254_at† EPHB1 EPHT2, Hek6 135 996 950 NM_004441 600600 2047 116092 210753_s_at PPP2R3A PPP2R3 137 167 257 NM_002718 604944 5523 518155 209633_at MSL2L1 RNF184, FLJ10546, KIAA1585, 137 350 450 NM_018133 . . . 55167 18631 218733_at msl-2 PCCB . . . 137 451 838 NM_000532 232050 5096 63788 212694_s_at STAG1 SA-1 137 538 689 NM_005862 604358 10274 412586 202294_at TMEM22 MGC3295, DKFZp564K2464 138 020 670 NM_025246 . . . 80723 477692 219569_s_at NCK1 NCK, NCKalpha 138 063 763 NM_006153 600508 4690 477693 211063_s_at FNDC6 MGC34923 138 159 397 NM_144717 . . . 152028 61232 228575_at† SOX14 SOX28 138 966 269 NM_004189 604747 8403 248184 208574_at CLDN18 . . . 139 200 348 NM_016369 609210 51208 240182 214135_at DZIP1L FLJ32844 139 263 524 NM_173543 . . . 199221 351403 239785_at† A4GNT alpha4GnT 139 325 757 NM_016161 . . . 51146 278960 221131_at DBR1 . . . 139 362 543 NM_016216 607024 51163 477700 219149_x_at ARMC8 HSPC056, DKFZP434A043 139 388 838 NM_015396 . . . 25852 555925 219094_at TXNDC6 TXL-2 139 462 969 NM_178130 . . . 347736 266826 1562619_at† MRAS M-RAs, R-RAS3, RRAS3 139 574 397 NM_012219 608435 22808 527021 206538_at FAM62C CHR3SYT 139 636 118 NM_031913 . . . 83850 477711 1554912_at† CEP70 BITE, FLJ13036 139 695 879 NM_024491 . . . 80321 531962 219036_at FAIM FLJ10582, FAIM1 139 810 609 NM_018147 . . . 55179 173438 220643_s_at PIK3CB PIK3C1 139 856 923 NM_006219 602925 5291 239818 212688_at FOXL2 BPES, BPES1 140 145 757 NM_023067 605597 668 289292 220102_at MRPS22 MRP-S22, GK002, C3orf5, GIBT 140 545 551 NM_020191 605810 56945 555965 213500_at COPB2 beta’-COP, betaprime-COP 140 559 125 NM_004766 606990 9276 75724 201098_at RBP2 CRBP2, RBPC2 140 654 417 NM_004164 180280 5948 182313 231734_at† RBP1 CRABP-I 140 718 974 NM_002899 180260 5947 529571 203423_at NMNAT3 PNAT3 140 761 731 NM_178177 608702 349565 208673 243738_at† CLSTN2 CSTN2, CS2 141 136 897 NM_022131 . . . 64084 158529 219414_at TRIM42 FLJ40097 141 879 571 NM_152616 . . . 287015 343487 1553620_at† SLC25A36 . . . 142 143 378 NM_018155 . . . 55186 144130 201919_at SPSB4 SSB-4 142 253 433 NM_080862 . . . 92369 518300 229929_at† ACPL2 FLJ23751 142 433 372 NM_152282 . . . 92370 255491 226925_at† ZBTB38 FLJ22332, FLJ31131, FLJ35036 142 525 745 NM_024724 . . . 253461 518301 219221_at RASA2 GAP1M 142 688 616 NM_006506 601589 5922 98445 206636_at RNF7 SAG, ROC2 142 939 741 NM_014245 603863 9616 134623 218286_s_at GRK7 GPRK7 142 979 733 NM_139209 606987 131890 102513 1552929_at† ATP1B3 FLJ29027, CD298 143 078 160 NM_001679 601867 483 477789 208836_at TFDP2 Dp-2 143 153 034 NM_006286 602160 7029 379018 203588_s_at MGC40579 FLJ33582, FLJ45739 143 365 104 NM_152776 . . . 256356 589531 238121_at† XRN1 1-Sep 143 508 143 NM_019001 607994 54464 435103 225814_at† ATR FRP1, SCKL, SCKL1, MEC1 143 650 770 NM_001184 601215 545 271791 209902_at D3S3694 GLC1C interval boundary 143 673 722 ......

Abbreviations: bp, base pairs; OMIM, Online Mendelian Inheritance in Man; ellipses, not applicable. *National Center for Biotechnology Information Build 36.1 was produced by the International Human Genome Sequencing Consortium (http://www.ncbi.nlm.nih .gov). †Affymetrix U133v2 Plus probes.

the same plot (Table 4 and Figure 2). Three genes en- ALTERED EXPRESSION UNDER coding acid phosphatase–like 2 (ACPL2), hypothetical GLAUCOMA RISK CONDITIONS protein MGC40579 (MGC40579), and 5Ј-to-3Ј exoribonuclease 1 (XRN1) were considered present in all 4 con- The 1 significant change large enough to seem biologi- ditions but did not show large fold change values asso- cally interesting is the 5.3-fold decrease with age for ciated with age or dexamethasone treatment (Table 5). TMEM22 (Figure 2A and Table 4). Four genes responded Signals for the remaining genes missing from the U133A to dexamethasone exposure with statistically significant de- GeneChip were considered marginal or absent because creases (propionyl coenzyme A carboxylase, ␤ polypep- of failure to produce either a qPCR or GeneChip signal tide [PCCB] and TMEM22) and increases (SLC25A36 and for all of the conditions (Table 4). Data on these same zinc finger and BTB domain containing 38 [ZBTB38]) genes from a very limited number of Affymetrix U133 (Figure 2B and Table 4). A decrease in TMEM22 was the Plus 2.0 chips confirm absent expression (data not only statistically significant expression differential in both shown). experiments (Figure 2 and Figure 3).

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 120

Affymetrix Signal, Affymetrix Signal, Affymetrix Signal, Affymetrix Signal, Fold Change Gene* Mean† Range†‡ Mean† Range†‡ (P Value) Age Experiments Cell Cultures From Younger Individuals Cell Cultures From Older Individuals KY § Absent Absent Absent Absent Absent EPHB1 Absent, 105 49-161 Absent, 65 36-93 Absent PPP2R3A 1023 773-1273 1693 1562-1824 1.65 (.02) MSL2L1 447 373-520 433 413-452 −1.03 (.92) PCCB 2291 2059-2523 2460 2081-2839 1.07 (.60) STAG1 1585 1497-1672 1479 1302-1656 −1.07 (.54) TMEM22 4535 3279-5791 855 824-887 −5.30 (.003) NCK1 1631 1556-1706 1583 1456-1710 −1.03 (.68) FNDC6§ 309 266-353 928 385-1471 3.00 SOX14 Absent, 21 17-26 Absent, 27 22-32 Absent CLDN18 303 184-422 365 333-396 1.20 (.47) DZIP1L§ 660 546-774 1172 1109-1234 1.78 A4GNT 391 347-436 Absent, 296 257-334 −1.32 (.14) DBR1 332 323-341 460 393-528 1.39 (.09) ARMC8 Absent, 164 141-187 Absent, 155 151-160 Absent TXNDC6§ Absent Absent Absent Absent Absent MRAS 488 446-530 571 468-674 1.17 (.43) FAM62C § Absent Absent Absent Absent Absent CEP70 409 354-464 415 336-493 1.02 (.92) FAIM 321 295-347 542 432-652 1.69 (.04) PIK3CB 1088 946-1229 1162 1099-1225 1.07 (.64) FOXL2 Absent, 182 153-212 Absent, 116 73-160 Absent MRPS22 1544 1129-1958 1283 699-1867 −1.20 (.57) COPB2 10 676 10 525-10 827 10693 10 520-10 866 1.00 (.97) RBP2 § Absent Absent Absent Absent Absent RBP1 Absent, 206 80-332 316 313-320 1.54 (.19) NMNAT3§ 447 298-595 1074 700-1448 2.41 CLSTN2 Absent, 125 102-149 Absent, 175 158-192 Absent TRIM42 § Absent Absent Absent Absent Absent SLC25A36 3814 3784-3844 4080 3964-4196 1.07 (.30) SPSB4§ Absent Absent Absent Absent Absent ACPL2 § 1772 1752-1793 2969 2900-3038 1.68 ZBTB38 3096 2880-3313 2603 2564-2643 −1.19 (.06) RASA2 391 360-423 506 482-530 1.29 (.04) RNF7 2217 2177-2256 2268 2241-2294 1.02 (.78) GRK7 § Absent Absent Absent Absent Absent ATP1B3 26 673 22 954-30393 16 217 12 287-20 148 −1.64 (.02) TFDP2 1057 985-1129 1511 1315-1707 1.43 (.02) MGC40579 § 1646 1400-1892 2216 1943-2489 1.35 XRN1§ 3269 2899-3639 4878 4689-5066 1.49 ATR 711 665-757 639 499-780 −1.11 (.67)

(continued)

GENE EXPRESSION OUTSIDE OF THE TM The remaining genes showed comparable expression for the retina and the TM (data not shown). In silico data show that most GLC1C-region genes expressed in the TM are also expressed in many tissues outside the eye.22 TMEM22 (expressed in the brain, COMMENT heart, pancreas, kidney, and lung) and ZBTB38 (negli- gible expression in several tissues that were assayed) Because elevated intraocular pressure is characteristic of show a more restricted range of expression than most of GLC1C glaucoma, prioritization of genes based on func- the GLC1C-region genes (http://www.genecards.org/cgi-bin tional information from primary cultured TM cells is po- /carddisp.pl?gene=TMEM22&search=tmem22 and http: tentially relevant. The original GLC1C family had a mean //www.genecards.org/cgi-bin/carddisp.pl?gene maximum known intraocular pressure of 23.3 mm Hg =ZBTB38). TMEM22, COPB2, and ATP1B3 are expressed (range, 14-36 mm Hg), and elevated intraocular pres- in the retina at more than 5 times the TM level whereas sure has been observed in subsequent GLC1C families mitochondrial ribosomal protein S22 (MRPS22), phos- as well.7,18,20 Thus, while a GLC1C mutation might also phoinositide-3-kinase, catalytic, ␤ polypeptide (PIK3CB), affect retinal ganglion cells or the optic disc, the role of and Fas apoptotic inhibitory molecule (FAIM) all show the TM in regulation of intraocular pressure makes it rel- lower levels of expression in the TM than in the retina. evant to the study of the GLC1C gene.

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 121

Affymetrix Signal, Affymetrix Signal, Affymetrix Signal, Affymetrix Signal, Fold Change Gene* Mean† Range†‡ Mean† Range†‡ (P Value) Dexamethasone Experiments Untreated Cell Cultures Cell Cultures Treated With Dexamethasone KY § Absent Absent Absent Absent Absent EPHB1 317 248-380 Absent, 282 230-352 −1.12 (.52) PPP2R3A 756 749-762 850 755-999 1.12 (.21) MSL2L1 561 472-630 503 421-595 −1.12 (.23) PCCB 2011 1914-2067 1593 1400-1885 −1.26 (Ͻ.001) STAG1 1356 1341-1368 1253 1184-1298 −1.08 (.34) TMEM22 6458 5896-6809 4146 3774-4576 −1.56 (Ͻ.001) NCK1 1765 1697-1881 1604 1523-1667 −1.10 (.08) FNDC6§ 355 308-408 303 244-366 −1.17 SOX14 Absent, 39 28-50 Absent, 42 23-58 Absent CLDN18 438 380-497 388 353-427 −1.13 (.41) DZIP1L§ 711 626-837 484 405-567 −1.47 A4GNT 441 385-511 393 379-404 −1.12 (.29) DBR1 464 437-516 498 468-523 1.07 (.36) ARMC8 Absent, 123 60-174 Absent, 169 123-231 Absent TXNDC6 § Absent Absent Absent Absent Absent MRAS Absent, 200 112-249 Absent, 125 93-174 Absent FAM62C § Absent Absent Absent Absent Absent CEP70 519 487-573 446 432-462 −1.16 (.11) FAIM 323 279-359 334 318-363 1.03 (.72) PIK3CB 950 683-1133 929 799-1107 −1.02 (.74) FOXL2 Absent, 72 46-118 Absent, 87 67-101 Absent MRPS22 1543 1048-2019 1726 1428-2244 1.12 (.52) COPB2 6844 6434-7364 6414 6087-7003 −1.07 (.30) RBP2§ Absent Absent Absent Absent Absent RBP1 318 233-434 Absent, 246 141-322 −1.29 (.23) NMNAT3§ 608 576-654 406 333-445 −1.50 CLSTN2 Absent, 85 55-111 Absent, 78 40-100 Absent TRIM42§ Absent Absent Absent Absent Absent SLC25A36 4639 4471-4895 5312 5131-5560 1.15 (.003) SPSB4§ Absent Absent Absent Absent Absent ACPL2§ 1582 1407-1717 1872 1584-2155 1.18 ZBTB38 2151 1406-2945 3543 2732-4869 1.65 (.004) RASA2 435 402-466 455 394-499 1.05 (.495) RNF7 3315 2831-3889 3572 3217-3830 1.08 (.42) GRK7 § Absent Absent Absent Absent Absent ATP1B3 20 830 18 633-22 394 21 094 19 699-23 647 1.01 (.93) TFDP2 1068 947-1143 1092 1022-1131 1.02 (.71) MGC40579 § 1307 959-1945 1284 929-1503 −1.02 XRN1§ 2196 1621-3075 1947 1586-2485 −1.13 ATR 620 533-677 546 524-570 −1.14 (.13)

*Genes are listed in order of the chromosomal position in the GLC1C interval. †An Affymetrix signal below 300 is considered absent, and an Affymetrix signal below 750 is considered marginal. ‡Data ranges are the minimum and maximum values of Affymetrix signals for 2 cell lines in the age experiments or 3 cell lines in the dexamethasone experiments. §The signal values are based on imputed data from quantitative polymerase chain reaction and have no associated P value.

POSITIONAL DIFFERENTIAL EXPRESSION gene product or activity level that can result from mu- PROFILE MODEL FOR CANDIDATE tations. GENE PRIORITIZATION TMEM22 is the only gene in the GLC1C interval that fits the positional differential expression profile model MYOC offers us an intriguing example of a type of infor- (Table 6). TMEM22 has a statistically significant de- mation that can be used in prioritizing candidate genes: crease in response to both aging and dexamethasone ex- differential expression. MYOC can initiate familial POAG posure (5.3- and 1.6-fold, respectively) (Table 4 and when mutated15 or can play a role through changes in Figure 3) and the third-highest expression in young (signal expression in response to the environment (dexametha- level=4535) and untreated (signal level=6458) donors. sone exposure) or development (aging). Our positional Expression of TMEM22 outside of the eye is much more differential expression profile model calls for mutation restricted than expression of most of the genes in this in- screening in positional candidate genes showing altered terval (GeneCards, http://www.genecards.org); further, gene expression that potentially mimics changes in the our microarray data (F.W.R., unpublished data, June

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 122

©2007 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 A 105 Absent on Microarray Mixed Status on Microarray Present, Nonsignificant Change Present, Significant Change Imputed From qPCR ATP1B3 PCCB COPB2 4 ACPL2 10 MGC40579 XRN1 PPP2R3A PIK3CB TFDP2 DZIP1L SLC25A36 ZBTB38 NMNAT3 RNF7 FNDC6 NCK1, STAG1 103 FAIM TMEM22 DBR1 MRPS22 RBP1 ATR MRAS ARMC8 RASA2 MSL2L1 CLSTN2 CEP70 102 FOXL2 A4GNT CLDN18 EPHB1

SOX14 Microarray Signal of Older Human TM Donors, Mean ge 101

(+) 3-Fold Chan

No Change

(–) 3-Fold Change

100 101 102 103 104 105 Microarray Signal of Younger Human TM Donors, Mean B 105

SLC25A36 ATP1B3 RNF7 COPB2 ZBTB38 104 MRPS22 ACPL2 MGC40579 TMEM22 PPP2R3A TFDP2 XRN1 NCK1 DBR1 PCCB 3 RASA2 10 STAG1 CLDN18, A4GNT ATR PIK3CB FAIM DZIP1L EPHB1 MSL2L1, CEP70 ARMC8 NMNAT3

102 FOXL2 MRAS FNDC6 RBP1 CLSTN2

SOX14

ge 101

(+) 3-Fold Chan Microarray Signal of Dexamethasone-Treated Human TM Cell Cultures, Mean Microarray Signal of Dexamethasone-Treated

No Change hange

(–) 3-Fold C

100 101 102 103 104 105 Microarray Signal of Untreated Human TM Cell Cultures, Mean

Figure 2. Scatterplot of Affymetrix U133A GeneChip (Affymetrix, Santa Clara, Calif ) data for GLC1C-region genes in response to aging (A) and dexamethasone exposure (B). A, The mean signal intensity of 2 human trabecular meshwork (TM) samples from older individuals (aged 60 and 74 years) is plotted against the mean from 2 TM samples from younger individuals (aged 12 and 16 years). B, The mean signal from 3 dexamethasone-treated TM cell lines is plotted against the mean signal of the untreated cell lines. Black diagonal lines indicate boundaries of no change; red diagonal lines, boundaries of 3-fold change; qPCR, quantitative polymerase chain reaction.

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 123

©2007 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 Table 5. Fold Change Determined From Quantitative Polymerase Chain Reaction or Imputed Affymetrix Signal Levels

Fold Change in Dexamethasone Fold Change in Age Experiments Experiments

Gene qPCR Imputed qPCR Imputed ACPL2 2.73 1.68 1.38 1.18 DZIP1L 1.92 1.78 −1.58 −1.47 FNDC6 4.17 3.00 1.20 −1.17 MGC40579 1.52 1.35 −1.04 −1.02 NMNAT3 3.58 2.41 −1.62 −1.50 XRN1 2.22 1.49 −1.33 −1.13

Abbreviation: qPCR, quantitative polymerase chain reaction.

of DUF6 domains within a region of homology to the bac-

Age Dexamethasone terial l-rhamnose symport transporter protein encoded Treatment by the RhaT gene,23 TMEM22 may be a member of the Significant Change drug metabolite transporter superfamily of permeases, Nonsignificant Change Marginal Expression some members of which are involved in the transport and Absent metabolism of carbohydrates, amino acids, toxins, or Gene Chromosome 3 drugs.24-26 If TMEM22 were the GLC1C gene, functional Position, bp KY ∗ 135 804 814 studies of its transport functions could point to key me- EPHB1 135 996 950 tabolites and pathways for further study. PPP2R3A 137 167 257 MSL2L1 137 350 450 PCCB (P < .001) 137 451 838 STAG1 137 538 689 PRIORITIZATION BASED ON TMEM22 138 020 670 (P = .002) (P < .001) OVERALL SIGNAL LEVELS NCK1 138 063 763 FNDC6 ∗ 138 159 397 SOX14 138 966 269 Two genes, ATP1B3 and COPB2, show signal levels in ex- CLDN18 139 200 348 DZIP1L ∗ 139 263 524 cess of 10 000, a signal level seen for only 4.7% of the probes A4GNT 139 325 757 on the U133A GeneChip. ATP1B3 shows the highest ex- DBR1 139 362 543 ARMC8 139 388 838 pression level (signal range, 16 217-26 673) (Table 4) but TXNDC6 ∗ 139 462 969 MRAS 139 574 397 no significant differential expression. This signal level can FAM62C ∗ 139 636 118 be compared with the higher average MYOC signal CEP70 139 695 879 FAIM 139 810 609 level of 78 368 in response to dexamethasone exposure. PIK3CB 139 856 923 ␤ FOXL2 140 145 757 There is evidence of multiple different -chain isoforms MRPS22 140 545 551 and substantial alternative splicing of this isoform COPB2 140 559 125 RBP2 ∗ 140 654 417 (http://www.genecards.org/cgi-bin/carddisp.pl?gene RBP1 140 718 974 ␤ NMNAT3 ∗ 140 761 731 =ATP1B3). ATP1B3 encodes the 3 subunit of the inte- CLSTN2 141 136 897 gral membrane sodium-potassium adenosine tri- TRIM42 ∗ 141 879 571 SLC25A36 142 143 378 phosphatase responsible for transport of sodium and po- ∗ (P = .003) SPSB4 142 253 433 27 ACPL2 ∗ 142 433 372 tassium ions across the plasma membrane (Table 6). The ZBTB38 (P = .004) 142 525 745 ability of several transporters to alter the effects of ion trans- RASA2 142 688 616 RNF7 142 939 741 port on cell volume fluid flow in glaucomatous eyes has ∗ GRK7 142 979 733 28-30 ATP1B3 143 078 160 recently been ruled out. It remains to be seen whether TFDP2 143 153 034 ATP1B3 is playing a role in the regulation of cellular or ex- MGC40579 ∗ 143 365 104 XRN1 ∗ 143 508 143 tracellular volume. ATR 143 650 770 COPB2, the second most highly expressed gene in the 6 5 432123 46 5 GLC1C interval (signal range, 6414-10 693), shows no Fold Change Decreasing Increasing significant differential expression (Table 4). COPB2 is widely expressed throughout the body, and there appear to be at least 5 different splice variants (http://www Figure 3. Fold change values for genes in the GLC1C interval. Fold change .genecards.org/cgi-bin/carddisp.pl?gene=COPB2&search values are included for each gene examined by age and by dexamethasone =COPB2copb2&suff=txt). COPB2 encodes coatomer com- treatment status. Each gene in the GLC1C interval is shown on the left with ␤ the corresponding position on chromosome 3 on the right. *Expression plex subunit 2, 1 of the 7 proteins that make up the ap- quantified using quantitative polymerase chain reaction. Significant changes proximately 700-kd Golgi coatomer complex that coats and the associated P values are shown for PCCB, TMEM22, SLC25A36, and non–clathrin-coated vesicles31 (Table 6). The COPB1 ZBTB38. bp indicates base pairs. coatomer complex selectively recruits proteins from the Golgi apparatus into budding vesicles that are trans- 2006) show absent expression in the retina. Limited in- ported back to the endoplasmic reticulum, a process that formation suggests that the TMEM22 gene product might might be expected to affect a variety of proteins important be involved in transport functions (Table 6). With a pair to glaucoma, perhaps even myocilin.

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 124

©2007 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 Table 6. Gene Ontology Classification of GLC1C-Interval Genes Expressed in Trabecular Meshwork Cells

Priority Prioritization Basis Symbol Gene Name Gene Ontology 1 Shared differential expression TMEM22*† Transmembrane protein 22 Member of the drug metabolite transporter superfamily of (dexamethasone and age permeases* experiments), expression Ͼ5000, permease function 2 Differential expression (dexamethasone SLC25A36† Solute carrier family 25, member Transport, mitochondrial transport, binding experiments), expression Ͼ5000, 36 solute carrier function 2 Differential expression (dexamethasone ZBTB38† Zinc finger and BTB domain Transcription factor activity, metal ion binding, DNA experiments), expression Ͼ2000, containing 38 binding transcription factor function 2 Differential expression (age PCCB† Propionyl coenzyme A Fatty acid catabolism, propionyl–coenzyme A carboxylase experiments), expression Ͼ2000 carboxylase, ␤ polypeptide activity, ligase activity 2 Differential expression (age FNDC6 Fibronectin type III domain Hematopoietin–interferon-class (D200-domain) cytokine experiments), some expression containing 6 receptor activity Ͼ1000, fibronectin-like domain 3 Expression Ͼ30 000 ATP1B3† Adenosine triphosphatase, Sodium-potassium–exchanging adenosine triphosphatase sodium-potassium activity transporting, ␤3 polypeptide 3 Expression Ͼ10 000, Golgi transport COPB2† Coatomer protein complex, Intracellular protein transport, endoplasmic function subunit ␤2 reticulum–to-Golgi transport, retrograde transport, Golgi-to–endoplasmic reticulum transport, intra-Golgi transport, transport, protein transport, protein transporter activity 4 Marginal differential expression (age TFDP2 Transcription factor Dp-2 Transcription factor complex, transcription cofactor experiments), expression Ͼ1000 activity, DNA binding 4 Expression Ͼ3000 ACPL2 Acid phosphatase–like 2 Acid phosphatase activity 4 Expression Ͼ2000 MGC40579 Hypothetical protein MGC40579 Carbohydrate metabolism 4 Expression Ͼ2000 MRPS22 Mitochondrial ribosomal protein Intracellular protein transport, endoplasmic S22 reticulum–to-Golgi transport, retrograde transport, Golgi-to–endoplasmic reticulum transport, intra-Golgi transport, protein transport 4 Expression Ͼ2000 RNF7 Ring finger protein 7 Antiapoptosis, metal ion binding 4 Expression Ͼ2000 XRN1 5Ј To 3Ј exoribonuclease 1 Nucleic acid binding, nuclease activity, cell cycle 4 Expression Ͼ1000 NCK1 NCK adaptor protein 1 Signal complex formation, intracellular signaling cascade, positive regulation of actin filament polymerization, positive regulation of T-cell proliferation, T-cell activation, cytoskeletal adaptor activity, complex scaffold activity, receptor binding, receptor signaling 4 Expression Ͼ1000 STAG1 Stromal antigen 1 Chromosome segregation, cell cycle, mitosis, binding 5 Some expression Ͼ1000 PPP2R3A Protein phosphatase 2, Phosphoprotein phosphatase activity, calcium ion binding, regulatory subunit B, ␣ protein binding, protein phosphatase type 2A regulator activity, hydrolase activity 5 Some expression Ͼ1000 PIK3CB Phosphoinositide-3-kinase, Inositol or phosphatidylinositol kinase activity, catalytic, ␤ polypeptide phosphatidylinositol-3-kinase activity, transferase activity, phosphatidylinositol-4,5–bisphosphate 3–kinase activity, phosphotransferase activity, alcohol group as acceptor, nucleotide binding, cell cycle 5 Some expression Ͼ1000 DZIP1L DAZ-interacting protein 1–like Nucleic acid binding, DNA binding, zinc ion binding, metal ion binding 5 Some expression Ͼ1000 NMNAT3 Nicotinamide nucleotide Nicotinamide adenine dinucleotide biosynthesis, pyridine adenylyltransferase 3 nucleotide biosynthesis, nicotinamide-nucleotide adenylyltransferase activity, nucleotidyltransferase activity 6 Marginal expression ATR Ataxia telangiectasia and DNA binding, DNA repair, protein serine-threonine kinase Rad3–related activity, cell cycle 6 Marginal expression CEP70 Centrosomal protein 70 kd Binding 6 Marginal expression CLDN18 Claudin 18 Calcium-independent cell-cell adhesion, structural molecule activity, protein self-binding, protein binding, tight junction 6 Marginal expression DBR1 Debranching enzyme homolog 1 Messenger RNA processing, hydrolase activity, acting on ester bonds 6 Marginal expression FAIM Fas apoptotic inhibitory molecule Negative regulation of apoptosis 6 Marginal expression MSL2L1 Male-specific lethal 2–like 1 Protein ubiquitination, protein transporter activity, ubiquitin-protein ligase activity, zinc ion binding, metal ion binding 6 Marginal expression RASA2 RAS p21 protein activator 2 Intracellular signaling cascade, signal transduction

*Data from the Pfam database rather than the Gene Ontology database. †Genes found by this study to be of greatest interest.

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 125

©2007 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 OTHER GENES OF POTENTIAL INTEREST zinc finger domains46,49 (http://ca.expasy.org/uniprot BECAUSE OF SIGNAL LEVEL OR SIGNAL CHANGE /Q8NAP3 and http://www.genecards.org/cgi-bin/carddisp .pl?gene=ZBTB38&search=ZBTB38). ZBTB38 is the hu- Based on sequence homology, SLC25A36 encodes mem- man homolog of the rat Zenon gene that is hypothesized ber 36 of solute carrier family 25 (Table 6) and shows mod- to play a role in survival or phenotypic maintenance of post- erate expression (signal range, 3814-5312) and signifi- mitotic neurons,47 suggesting a possible role in the sur- cant expression change in response to dexamethasone vival of retinal ganglion cells. ZENON has also been shown exposure (P=.003) but not aging (P=.30) (Table 4). It is to regulate expression of tyrosine hydroxylase (TH), which expressed in many tissues, and 5 different splicing vari- participates in a pathway leading to levodopa produc- ants have been observed (http://www.genecards.org/cgi-bin tion,50 especially in neurons.51 Induction of ZBTB38 does /carddisp.pl?gene=SLC25A36&search=SLC25A36). Other not appear to lead to suppression of TH in our TM cul- members of this family of proteins are involved in the trans- tures, as TH is uniformly absent (signal range, 16-108). port of small molecules such as citrate, adenine nucle- Feeding levodopa to a mouse model of glaucoma during otide, ornithine, or malate.32-35 development ameliorates some aspects of the glaucoma phe- Although the fold change of PCCB in response to dex- notype,50 so we cannot rule out ZBTB38 effects on the for- amethasone exposure is statistically significant, the mag- mation of structures of the angle and outflow pathway, dif- nitude of the change is modest (Table 4, Figure 2, and ferent expression patterns of ZBTB38 and TH in native Figure 3). Mutations in this gene have caused propionic tissue, or a role for ZBTB38 in retinal ganglion cells and acidemia,36 a trait not known to occur in members of the the optic nerve of the adult. Thus, the connection be- known GLC1C families. This does not rule out PCCB as tween ZBTB38 and the animal model of Libby et al50 is in- a candidate, as mild cases might go undiagnosed and some triguing, but dexamethasone-induced changes in ZBTB38 genes can cause drastically different phenotypes involv- expression do not appear to invoke a direct response in TH ingcompletelydifferenttissuetypesandclinicalfeatures.37-39 expression in cultured adult TM cells. Even if ZBTB38 regu- We rank genes with substantial signal levels ahead of lates TH in neurons, its effects in the TM might operate the genes with absent expression or qPCR product through other downstream regulatory targets. If ZBTB38 (Figure 2 and Table 6). Changes observed for most of were the GLC1C gene, there would be questions about how these genes are too small to be significant indicators of to relate the beneficial effects of feeding levodopa in mice50 biologically important changes and are more likely an in- to the development of therapeutic strategies for GLC1C fami- dicator of experimental and interindividual variation. The lies with glaucoma. GLC1C gene could potentially be expressed in vivo but not in this cultured cell system. We cannot conclude that CONCLUSIONS expression levels in these cells from adolescents and adults indicate levels that occur during other stages of life, in- TMEM22 fits our positional differential expression profile cluding prenatal development. Thus, the nonexpressed model whereas other models recommend ATP1B3, COPB2, genes are assigned low priority but cannot be removed SLC25A36, PCCB, and transcription factor ZBTB38. from the list based on our experimental system. TMEM22 and other candidates are being screened. Some glaucoma mutations may have function-specific effects PRIORITIZATION OF TRANSCRIPTION FACTORS (Table 6) rather than acting through altered expression, as IN THE GLC1C REGION previously seen for night blindness or retinal degenera- tion resulting from certain rhodopsin mutations.52 We do One of the functional themes in a number of develop- not expect the positional differential expression profile mental glaucomas is that of transcription factors such as model to pinpoint every glaucoma gene; information on paired-like homeodomain transcription factor 2 (PITX2), the expression of GLC1C-region genes described here forkhead box C1 (FOXC1), and LIM homeobox tran- should be of interest to those engaged in the search for glau- ␤ 40-43 whose phenotypic range scription factor 1 (LMX1B), coma genes, even if some investigators use a different ba- includes POAG in some individuals.43,44 It is interesting sis for prioritization of GLC1C candidate genes. to note 3 transcription factors in the GLC1C region. Two of these, FOXL2 and SOX14, are not expressed at all in our cell culture system. Mutations in FOXL2 are already Submitted for Publication: June 30, 2006; final revision associated with blepharophimosis, ptosis, and epican- received September 18, 2006; accepted September 19, 2006. thus inversus,45 which do not occur in the GLC1C fami- Correspondence: Julia E. Richards, PhD, Department of lies, although this does not completely rule out involve- Ophthalmology and Visual Sciences, University of Michi- ment of this gene in more than 1 phenotype. gan, 1000 Wall St, Ann Arbor, MI 48105 (richj@umich ZBTB3846,47 is expressed at moderate levels (signal range, .edu). 2151-4543) and shows a 1.65-fold increase in response to Financial Disclosure: None reported. dexamethasone exposure (P=.004) but only a small, non- Funding/Support: This work was supported by grants significant decrease with age (1.19-fold decrease; P=.05) EY07003 (core grant, Kellogg Eye Center), EY010572 (Table 4). Given that haploinsufficiency or duplication of (core grant, Casey Eye Institute), EY011650 (Dr Wirtz), transcription factor genes can cause disease,43,45,48 a change and EY09580 (Dr Richards) from the National Insti- of 1.65-fold is potentially biologically important. The tutes of Health, Bethesda, Md, unrestricted grants to the ZBTB38 gene product is a Kaiso-like transcriptional re- Kellogg Eye Center and the Casey Eye Institute from Re- pressor containing a BTB (POZ) domain and multiple C2H2 search to Prevent Blindness, Inc, New York, NY, and the

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 126

©2007 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 Van Arnam Glaucoma Research Fund of the Depart- 27. Malik N, Canfield V, Sanchez-Watts G, et al. Structural organization and chro- ment of Ophthalmology and Visual Sciences, University mosomal localization of the human Na,K-ATPase beta-3 subunit gene and pseudogene. Mamm Genome. 1998;9:136-143. of Michigan, Ann Arbor. 28. Putney LK, Vibat CR, O’Donnell ME. Intracellular Cl regulates Na-K-Cl cotransport activity in human trabecular meshwork cells. Am J Physiol. 1999;277:C373-C383. REFERENCES 29. Mitchell CH, Fleischhauer JC, Stamer WD, Peterson-Yantorno K, Civan MM. Human trabecular meshwork cell volume regulation. Am J Physiol Cell Physiol. 2002;283:C315-C326. 1. Quigley HA. Number of people with glaucoma worldwide. Br J Ophthalmol. 1996; 30. Gabelt BT, Wiederholt M, Clark AF, Kaufman PL. Anterior segment physiology 80:389-393. after bumetanide inhibition of Na-K-Cl cotransport. Invest Ophthalmol Vis Sci. 2. Gottfredsdottir MS, Sverrisson T, Musch DC, Stefansson E. Chronic open-angle 1997;38:1700-1707. glaucoma and associated ophthalmic findings in monozygotic twins and their 31. Duden R. ER-to-Golgi transport: COP I and COP II function. Mol Membr Biol. spouses in Iceland. J Glaucoma. 1999;8:134-139. 2003;20:197-207. 3. Wiggs JL, Allingham RR, Hossain A, et al. Genome-wide scan for adult onset 32. Kaplan RS, Mayor JA, Wood DO. The mitochondrial tricarboxylate transport pro- primary open angle glaucoma. Hum Mol Genet. 2000;9:1109-1117. tein: cDNA cloning, primary structure, and comparison with other mitochon- 4. Nemesure B, Jiao X, He Q, et al; Barbados Family Study Group. A genome-wide drial transport proteins. J Biol Chem. 1993;268:13682-13690. scan for primary open-angle glaucoma (POAG): the Barbados Family Study of 33. Ku D-H, Kagan J, Chen S-T, Chang C-D, Baserga R, Wurzel J. The human fibro- Open-Angle Glaucoma. Hum Genet. 2003;112:600-609. blast adenine nucleotide translocator gene: molecular cloning and sequence. 5. Sheffield VC, Stone EM, Alward WL, et al. Genetic linkage of familial open angle J Biol Chem. 1990;265:16060-16063. glaucoma to chromosome 1q21-q31. Nat Genet. 1993;4:47-50. 34. Camacho JA, Obie C, Biery B, et al. Hyperornithinaemia-hyperammonaemia- 6. Stoilova D, Child A, Trifan OC, Crick RP, Coakes RL, Sarfarazi M. Localization of homocitrullinuria syndrome is caused by mutations in a gene encoding a mito- a locus (GLC1B) for adult-onset primary open angle glaucoma to the 2cen-q13 chondrial ornithine transporter. Nat Genet. 1999;22:151-158. region. Genomics. 1996;36:142-150. 35. Iacobazzi V, Palmieri F, Runswick MJ, Walker JE. Sequences of the human and 7. Wirtz MK, Samples JR, Kramer PL, et al. Mapping a gene for adult-onset primary bovine genes for the mitochondrial 2-oxoglutarate carrier. DNA Seq. 1992; open-angle glaucoma to chromosome 3q. Am J Hum Genet. 1997;60:296-304. 3:79-88. 8. Trifan OC, Traboulsi EI, Stoilova D, et al. A third locus (GLC1D) for adult-onset 36. Tahara T, Kraus JP, Ohura T, Rosenberg LE, Fenton WA. Three independent mu- primary open-angle glaucoma maps to the 8q23 region. Am J Ophthalmol. 1998; tations in the same exon of the PCCB gene: differences between Caucasian and 126:17-28. Japanese propionic acidaemia. J Inherit Metab Dis. 1993;16:353-360. 9. Sarfarazi M, Child A, Stoilova D, et al. Localization of the fourth locus (GLC1E) 37. Brown TR, Lubahn DB, Wilson EM, Joseph DR, French FS, Migeon CJ. Deletion for adult-onset primary open-angle glaucoma to the 10p15-p14 region. Am J Hum of the steroid-binding domain of the human androgen receptor gene in one fam- Genet. 1998;62:641-652. ily with complete androgen insensitivity syndrome: evidence for further genetic 10. Wirtz MK, Samples JR, Rust K, et al. GLC1F, a new primary open-angle glau- heterogeneity in this syndrome. Proc Natl Acad Sci U S A. 1988;85:8151-8155. coma locus, maps to 7q35-q36. Arch Ophthalmol. 1999;117:237-241. 38. Newmark JR, Hardy DO, Tonb DC, et al. Androgen receptor gene mutations in 11. Monemi S, Spaeth G, DaSilva A, et al. Identification of a novel adult-onset pri- human prostate cancer. Proc Natl Acad Sci U S A. 1992;89:6319-6323. mary open-angle glaucoma (POAG) gene on 5q22.1. Hum Mol Genet. 2005; 39. La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH. Androgen re- 14:725-733. ceptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature. 12. Allingham RR, Wiggs JL, Hauser ER, et al. Early adult-onset POAG linked to 15q11-13 using ordered subset analysis. Invest Ophthalmol Vis Sci. 2005; 1991;352:77-79. 46:2002-2005. 40. Semina EV, Reiter R, Leysens NJ, et al. Cloning and characterization of a novel 13. Wiggs JL, Lynch S, Ynagi G, et al. A genomewide scan identifies novel early- bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger onset primary open-angle glaucoma loci on 9q22 and 20p12. Am J Hum Genet. syndrome. Nat Genet. 1996;14:392-399. 2004;74:1314-1320. 41. Nishimura DY, Swiderski RE, Alward WLM, et al. The forkhead transcription fac- 14. Baird PN, Foote SJ, Mackey DA, Craig J, Speed TP, Bureau A. Evidence for a novel tor gene FKHL7 is responsible for glaucoma phenotypes which map to 6p25. glaucoma locus at chromosome 3p21-22. Hum Genet. 2005;117:249-257. Nat Genet. 1998;19:140-147. 15. Stone EM, Fingert JH, Alward WL, et al. Identification of a gene that causes pri- 42. Mears AJ, Jordan T, Mirzayans F, et al. Mutations of the forkhead/winged-helix mary open angle glaucoma. Science. 1997;275:668-670. gene, FKHL7, in patients with Axenfeld-Rieger anomaly. Am J Hum Genet. 1998; 16. Nguyen TD, Chen P, Huang WD, Chen H, Johnson D, Polansky JR. Gene struc- 63:1316-1328. ture and properties of TIGR, an olfactomedin-related glycoprotein cloned from 43. Vollrath D, Jaramillo-Babb VL, Clough MV, et al. Loss-of-function mutations in glucocorticoid-induced trabecular meshwork cells. J Biol Chem. 1998;273: the LIM-homeodomain gene, LMX1B, in Nail-Patella Syndrome. Hum Mol Genet. 6341-6350. 1998;7:1091-1098. 17. Rezaie T, Child A, Hitchings R, et al. Adult-onset primary open-angle glaucoma 44. Lichter PR, Richards JE, Downs CA, Stringham HM, Boehnke M, Farley F. Co- caused by mutations in optineurin. Science. 2002;295:1077-1079. segregation of open-angle glaucoma and the nail-patella syndrome. Am J 18. Samples JR, Kitsos G, Economou-Petersen E, et al. Refining the primary open- Ophthalmol. 1997;124:506-515. angle glaucoma GLC1C region on chromosome 3 by haplotype analysis. Clin Genet. 45. Smith RS, Zabaleta A, Kume T, et al. Haploinsufficiency of the transcription fac- 2004;65:40-44. tors FOXC1 and FOXC2 results in aberrant ocular development Hum Mol Genet. 19. Petersen MB, Kitsos G, Samples JR, et al. A Large GLC1C Greek family with a 2000;9:1021-1032. myocilin T377M mutation: inheritance and phenotypic variability. Invest Oph- 46. Crisponi L, Deiana M, Loi A, et al. The putative forkhead transcription factor FOXL2 thalmol Vis Sci. 2006;47:620-625. is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome. Nat Genet. 20. Kitsos G, Eiberg H, Economou-Petersen E, et al. Genetic linkage of autosomal 2001;27:159-166. dominant primary open angle glaucoma to chromosome 3q in a Greek pedigree. 47. Kiefer H, Chatail-Hermitte F, Ravassard P, Bayard E, Brunet I, Mallet J. ZENON, Eur J Hum Genet. 2001;9:452-457. a novel POZ Kruppel-Like DNA binding protein associated with differentiation and/or 21. Rozsa FW, Reed DM, Scott KM, et al. Gene expression profile of human trabe- survival of late postmitotic neurons. Mol Cell Biol. 2005;25:1713-1729. cular meshwork cells in response to long-term dexamethasone exposure. Mol 48. Lehmann OJ, Ebenezer ND, Jordan T, et al. Chromosomal duplication involving Vis. 2006;12:125-141. the forkhead transcription factor gene FOXC1 causes iris hypoplasia and glaucoma. 22. Rebhan M, Chalifa-Caspi V, Prilusky J, Lancet D. GeneCards: encyclopedia for Am J Hum Genet. 2000;67:1129-1135. genes, proteins and diseases. http://www.genecards.org. Accessed June 2006. 49. Filion GJ, Zhenilo S, Salozhin S, Yamada D, Prokhortchouk E, Defossez PA. 23. Henderson PJ, Maiden MC. Homologous sugar transport proteins in Escheri- A family of human zinc finger proteins that bind methylated DNA and repress chia coli and their relatives in both prokaryotes and eukaryotes. Philos Trans R transcription. Mol Cell Biol. 2006;26:169-181. Soc Lond B Biol Sci. 1990;326:391-410. 50. Libby RT, Smith RS, Savinova OV, et al. Modification of ocular defects in mouse 24. Paulsen IT, Skurray RA, Tam R, et al. The SMR family: a novel family of multi- developmental glaucoma models by tyrosinase. Science. 2003;299:1578-1581. drug efflux proteins involved with the efflux of lipophilic drugs. Mol Microbiol. 51. Sasai N, Matsuda E, Sarashina E, Ishida Y, Kawaichi M. Identification of a novel 1996;19:1167-1175. BTB-zinc finger transcriptional repressor, CIBZ, that interacts with CtBP 25. Marchler-Bauer A, Bryant SH. CD-Search: protein domain annotations on the fly. corepressor. Genes Cells. 2005;10:871-885. Nucleic Acids Res. 2004;32:W327-W331. 52. Sieving PA, Richards JE, Naarendorp F, Bingham EL, Scott K, Alpern M. Dark- 26. Marchler-Bauer A, Anderson JB, Cherukuri PF, et al. CDD: a Conserved Domain light: model for nightblindness from the human rhodopsin Gly90→Asp mutation. Database for protein classification. Nucleic Acids Res. 2005;33:D192-D196. Proc Natl Acad Sci U S A. 1995;92:880-884.

(REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 127