DOCSLIB.ORG

High-Throughput Bioinformatics Approaches to Understand Gene Expression Regulation in Head and Neck Tumors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
High-Throughput Bioinformatics Approaches to Understand Gene Expression Regulation in Head and Neck Tumors High-throughput bioinformatics approaches to understand gene expression regulation in head and neck tumors by Yanxiao Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Bioinformatics) in The University of Michigan 2016 Doctoral Committee: Associate Professor Maureen A. Sartor, Chair Professor Thomas E. Carey Assistant Professor Hui Jiang Professor Ronald J. Koenig Associate Professor Laura M. Rozek Professor Kerby A. Shedden c Yanxiao Zhang 2016 All Rights Reserved I dedicate this thesis to my family. For their unfailing love, understanding and support. ii ACKNOWLEDGEMENTS I would like to express my gratitude to Dr. Maureen Sartor for her guidance in my research and career development. She is a great mentor. She patiently taught me when I started new in this field, granted me freedom to explore and helped me out when I got lost. Her dedication to work, enthusiasm in teaching, mentoring and communicating science have inspired me to feel the excite- ment of research beyond novel scientific discoveries. I’m also grateful to have an interdisciplinary committee. Their feedback on my research progress and presentation skills is very valuable. In particular, I would like to thank Dr. Thomas Carey and Dr. Laura Rozek for insightful discussions on the biology of head and neck cancers and human papillomavirus, Dr. Ronald Koenig for expert knowledge on thyroid cancers, Dr. Hui Jiang and Dr. Kerby Shedden for feedback on the statistics part of my thesis. I would like to thank all the past and current members of Sartor lab for making the lab such a lovely place to stay and work in. And for enormous help I received from them for my projects. In particular, I’d like to thank Yu-Hsuan Lin for developing the prototype pipeline for PePr, Lada Koneva, Shama Virani and Pelle Hall for identifying viral integration and RNA-seq mutation in the head and neck cancer project, and Chee Lee for the pathway analysis in the thyroid cancer project. I would also like to thank all of my friends here at University of Michigan for their company, support and inspirations. Ann Arbor is like my second hometown with a lot of cherishable memories. Finally, I’m very grateful to my parents for encouraging and supporting me to chase my own dreams, to become who I am today. And to my dear Yuqi, who has always been a truthful friend and a loving company. Thank you so much for always having faith in me. iii TABLE OF CONTENTS DEDICATION ::::::::::::::::::::::::::::::::::::::: ii ACKNOWLEDGEMENTS :::::::::::::::::::::::::::::::: iii LIST OF FIGURES :::::::::::::::::::::::::::::::::::: vii LIST OF TABLES ::::::::::::::::::::::::::::::::::::: ix LIST OF ABBREVIATIONS ::::::::::::::::::::::::::::::: x ABSTRACT ::::::::::::::::::::::::::::::::::::::::: xii CHAPTER I. Introduction .....................................1 1.1 Introduction.................................1 1.2 Background.................................3 1.2.1 High-throughput technologies..................3 1.2.2 Genomic aberrations and instability in cancer..........5 1.2.3 Epigenetic dysregulation in cancer: DNA methylation and his- tone modifications.........................8 1.2.4 Discovery of molecular cancer subtypes: distinct etiology and prognosis..............................9 1.2.5 The biology of head and neck tumors.............. 10 1.3 Dissertation overview............................ 12 II. PePr: a peak-calling prioritization pipeline to identify consistent or differen- tial peaks from replicated ChIP-Seq data ..................... 24 2.1 Introduction................................. 24 2.2 Methods................................... 27 2.2.1 Datasets.............................. 27 2.2.2 PePr algorithm.......................... 28 2.2.3 Motif analysis.......................... 35 2.2.4 Unique peak analysis....................... 35 2.3 Results.................................... 35 iv 2.3.1 Overview of the PePr method.................. 35 2.3.2 Comparison to other methods.................. 36 2.4 Discussion.................................. 42 III. Subtypes of HPV-positive head and neck cancers are associated with HPV characteristics, copy number alterations, PIK3CA mutation, and pathway signatures ...................................... 68 3.1 Introduction................................. 68 3.2 Methods................................... 71 3.2.1 Tumor tissue acquisition, DNA and RNA extraction....... 71 3.2.2 RNA-seq and SNP-array protocol................ 71 3.2.3 RNA-seq analysis of the host gene expression.......... 72 3.2.4 Measuring HPV gene expression, and detection of HPV sub- types and genic integration.................... 72 3.2.5 Computing full-length E6 percentages.............. 73 3.2.6 Finding unique pathways in each HPV(+) cluster........ 74 3.2.7 Unsupervised clustering of gene expression values....... 74 3.2.8 Pathway scores.......................... 75 3.2.9 RNA-seq mutation calling.................... 75 3.2.10 TCGA RNA-seq analysis..................... 76 3.2.11 CNA analysis........................... 76 3.3 Results.................................... 76 3.3.1 Overview of differential expression results from HPV(+) and HPV(-) tumors.......................... 76 3.3.2 Unsupervised clustering revealed two HPV(+) subgroups.... 77 3.3.3 Differentially regulated genes and pathways between HPV(+) subgroups............................. 78 3.3.4 HPV(+) subgroups correlate with HPV integration, E2/E4/E5 expression levels, full-length E6 percent and E6 activity..... 79 3.3.5 Correlation of subgroups with copy number alterations and PIK3CA mutation............................. 80 3.3.6 Characteristics associated with HPV(+) subgroups and patient survival.............................. 82 3.4 Discussion.................................. 83 IV. Genomic binding and regulation of gene expression by the thyroid carcinoma- associated PAX8-PPARG fusion protein ...................... 106 4.1 Introduction................................. 106 4.2 Materials and methods............................ 108 4.2.1 Cell culture............................ 108 4.2.2 Antibodies............................ 108 4.2.3 Flow cytometry.......................... 108 v 4.2.4 ChIP-seq assay.......................... 109 4.2.5 RNA-seq assay.......................... 109 4.2.6 ChIP-seq data analysis...................... 110 4.2.7 RNA-seq data analysis...................... 111 4.2.8 Gene set enrichment testing................... 111 4.3 Results.................................... 112 4.3.1 Overview of genes regulated by PPFP in the absence and pres- ence of pioglitazone....................... 112 4.3.2 PPFP regulates processes related to oncogenesis........ 112 4.3.3 PPFP can induce or repress PAX8-regulated genes....... 113 4.3.4 Overview of the PPFP cistrome................. 114 4.3.5 Overview of genes and gene sets containing PPFP peaks.... 116 4.3.6 Why is pioglitazone adipogenic in PPFP-expressing cells?... 117 4.3.7 Why is pioglitazone therapeutic in the mouse model of PPFP thyroid carcinoma?........................ 118 4.3.8 Similarity of gene regulation by PPFP in PCCL3 cells and hu- man thyroid carcinomas..................... 119 4.4 Discussion.................................. 120 V. Conclusions and future directions ......................... 143 5.1 Conclusions................................. 143 5.2 Future directions............................... 145 5.2.1 Chapter II............................. 145 5.2.2 Chapter III............................ 146 5.2.3 Chapter IV............................ 147 APPENDIX ::::::::::::::::::::::::::::::::::::::::: 149 vi LIST OF FIGURES Figure 2.1 Motif logos for all TFs used in our comparisons.................. 46 2.2 Workflow of PePr.................................. 47 2.3 Extra-variance beyond that of the Poisson distribution is observed in ChIP-seq data 48 2.4 H3K27me3 data show a high autocorrelation of the dispersion parameters esti- mated for nearby windows............................. 49 2.5 Comparison of PePr to other approaches on NRSF data.............. 50 2.6 Comparison of PePr to ZINBA-CR (A) ZINBA-SA (B) and edgeR-basic (C) on NRSF data...................................... 51 2.7 Rank comparisons between PePr and the alternative approaches on NRSF data.. 52 2.8 Rank comparisons between PePr and the alternative approaches on ATF4 data.. 53 2.9 Comparison of PePr to other approaches on ATF4 data.............. 54 2.10 Comparison of PePr to ZINBA-CR (A), ZINBA-SA (B) and edgeR-basic (C) on ATF4 data...................................... 55 2.11 Example of an H3K27me3 enriched region showing high variation of ChIP-seq signals across samples................................ 56 2.12 A scaling FDR analysis of the H3k27me3 dataset shows PePr was most robust to differences in read coverage level.......................... 57 2.13 Comparison of PePr to other approaches for H3K27me3 data............ 58 3.1 Identification of two HPV(+) subgroups and pathway differences between them. 88 3.2 HPV(+) subgroups correlate with several HPV characteristics........... 89 3.3 HPV(+) subgroups differ by copy number alterations............... 90 3.4 The HPV-KRT subgroup had more PIK3CA mutations and amplifications..... 91 3.5 Summary of characteristics that differ by HPV(+) subgroup, and prognosis.... 91 3.6 Focal amplification of chr11q13 and chr11q22 in HPV(-) tumors and far-end deletion of chr11q in HPV(+) tumors........................ 92 3.7 ConsensusCluster Plus output for (A) UM and (B) UM+TCGA HPV(+) samples. 93 3.8 Correlation
Load more

Recommended publications
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Environmental Influences on Endothelial Gene Expression
    ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • CCNL1 (NM 020307) Human Untagged Clone – SC113160 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC113160 CCNL1 (NM_020307) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCNL1 (NM_020307) Human Untagged Clone Tag: Tag Free Symbol: CCNL1 Synonyms: ania-6a; ANIA6A; BM-001; PRO1073 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_020307, the custom clone sequence may differ by one or more nucleotides ATGGCGTCCGGGCCTCATTCGACAGCTACTGCTGCCGCAGCCGCCTCATCGGCCGCCCCAAGCGCGGGCG GCTCCAGCTCCGGGACGACGACCACGACGACGACCACGACGGGAGGGATCCTGATCGGCGATCGCCTGTA CTCGGAAGTTTCACTTACCATCGACCACTCTCTGATTCCGGAGGAGAGGCTCTCGCCCACCCCATCCATG CAGGATGGGCTCGACCTGCCCAGTGAGACGGACTTACGCATCCTGGGCTGCGAGCTCATCCAGGCCGCCG GCATTCTCCTCCGGCTGCCGCAGGTGGCGATGGCAACGGGGCAGGTGTTGTTTCATCGTTTTTTCTACTC CAAATCTTTCGTCAAACACAGTTTCGAGATTGTTGCTATGGCTTGTATTAATCTTGCATCAAAAATCGAA GAAGCACCTAGAAGAATAAGAGATGTGATTAATGTATTCCACCACCTCCGCCAGTTAAGAGGAAAAAGGA CTCCAAGCCCCCTGATCCTTGATCAGAACTACATTAACACCAAAAATCAAGTTATCAAAGCAGAGAGGAG GGTGCTAAAGGAGTTGGGATTTTGTGTTCATGTCAAGCATCCTCATAAGATCATTGTTATGTATTTACAA GTCTTAGAATGTGAACGTAATCAAACCCTGGTTCAAACTGCCTGGAATTACATGAATGACAGTCTTCGAA CCAATGTGTTTGTTCGATTTCAACCAGAGACTATAGCATGTGCTTGCATCTACCTTGCAGCTAGAGCACT TCAGATTCCGTTGCCAACTCGTCCCCATTGGTTTCTTCTTTTTGGTACTACAGAAGAGGAAATCCAGGAA ATCTGCATAGAAACACTTAGGCTTTATACCAGAAAAAAGCCAAACTATGAATTACTGGAAAAAGAAGTAG AAAAAAGAAAAGTAGCCTTACAAGAAGCCAAATTAAAAGCAAAGGGATTGAATCCGGATGGAACTCCAGC
    [Show full text]
  • Epigenome-Wide Study Identified Methylation Sites Associated With
    nutrients Article Epigenome-Wide Study Identified Methylation Sites Associated with the Risk of Obesity Majid Nikpay 1,*, Sepehr Ravati 2, Robert Dent 3 and Ruth McPherson 1,4,* 1 Ruddy Canadian Cardiovascular Genetics Centre, University of Ottawa Heart Institute, 40 Ruskin St–H4208, Ottawa, ON K1Y 4W7, Canada 2 Plastenor Technologies Company, Montreal, QC H2P 2G4, Canada; [email protected] 3 Department of Medicine, Division of Endocrinology, University of Ottawa, the Ottawa Hospital, Ottawa, ON K1Y 4E9, Canada; [email protected] 4 Atherogenomics Laboratory, University of Ottawa Heart Institute, Ottawa, ON K1Y 4W7, Canada * Correspondence: [email protected] (M.N.); [email protected] (R.M.) Abstract: Here, we performed a genome-wide search for methylation sites that contribute to the risk of obesity. We integrated methylation quantitative trait locus (mQTL) data with BMI GWAS information through a SNP-based multiomics approach to identify genomic regions where mQTLs for a methylation site co-localize with obesity risk SNPs. We then tested whether the identified site contributed to BMI through Mendelian randomization. We identified multiple methylation sites causally contributing to the risk of obesity. We validated these findings through a replication stage. By integrating expression quantitative trait locus (eQTL) data, we noted that lower methylation at cg21178254 site upstream of CCNL1 contributes to obesity by increasing the expression of this gene. Higher methylation at cg02814054 increases the risk of obesity by lowering the expression of MAST3, whereas lower methylation at cg06028605 contributes to obesity by decreasing the expression of SLC5A11. Finally, we noted that rare variants within 2p23.3 impact obesity by making the cg01884057 Citation: Nikpay, M.; Ravati, S.; Dent, R.; McPherson, R.
    [Show full text]
  • Downloaded from Genomic Data Common Website (GDC at Accessed on 2019)
    G C A T T A C G G C A T genes Article Molecular Pathways Associated with Kallikrein 6 Overexpression in Colorectal Cancer Ritu Pandey 1,2,*, Muhan Zhou 3, Yuliang Chen 3, Dalila Darmoul 4 , Conner C. Kisiel 2, Valentine N. Nfonsam 5 and Natalia A. Ignatenko 1,2 1 Department of Cellular and Molecular Medicine, University of Arizona, Tucson, AZ 85721, USA; [email protected] 2 University of Arizona Cancer Center, University of Arizona, Tucson, AZ 85724, USA; [email protected] 3 Bioinformatics Shared Resource, University of Arizona Cancer Center, Tucson, AZ 85724, USA; [email protected] (M.Z.); [email protected] (Y.C.) 4 Institut National de la Santé et de la Recherche Médicale (INSERM), Université de Paris, Lariboisière Hospital, 75010 Paris, France; [email protected] 5 Department of Surgery, Section of Surgical Oncology, University of Arizona, Tucson, AZ 85724, USA; [email protected] * Correspondence: [email protected] Abstract: Colorectal cancer (CRC) remains one of the leading causes of cancer-related death world- wide. The high mortality of CRC is related to its ability to metastasize to distant organs. The kallikrein-related peptidase Kallikrein 6 (KLK6) is overexpressed in CRC and contributes to cancer cell invasion and metastasis. The goal of this study was to identify KLK6-associated markers for the CRC prognosis and treatment. Tumor Samples from the CRC patients with significantly elevated Citation: Pandey, R.; Zhou, M.; Chen, KLK6 transcript levels were identified in the RNA-Seq data from Cancer Genome Atlas (TCGA) Y.; Darmoul, D.; Kisiel, C.C.; and their expression profiles were evaluated using Gene Ontology (GO), Phenotype and Reactome Nfonsam, V.N.; Ignatenko, N.A.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Early Diagnosis of Colorectal Cancer Via Plasma Proteomic Analysis of CRC and Advanced Adenomatous Polyp
    Gastroenterology and Hepatology From Bed to Bench. ORIGINAL ARTICLE ©2019 RIGLD, Research Institute for Gastroenterology and Liver Diseases Early diagnosis of colorectal cancer via plasma proteomic analysis of CRC and advanced adenomatous polyp Setareh Fayazfar1, Hakimeh Zali2, Afsaneh Arefi Oskouie1, Hamid Asadzadeh Aghdaei3, Mostafa Rezaei Tavirani4, Ehsan Nazemalhosseini Mojarad5 1Faculty of Paramedical Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran 2School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran 3Basic and Molecular Epidemiology of Gastroenterology Disorders Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran 4Proteomics Research Center, Faculty of Paramedical Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran 5Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran ABSTRACT Aim: This paper aimed to identify new candidate biomarkers in blood for early diagnosis of CRC. Background: Colorectal cancer (CRC) is the third most widespread malignancies increasing globally. The high mortality rate associated with colorectal cancer is due to the delayed diagnosis in an advanced stage while the metastasis has occurred. For better clinical management and subsequently to reduce mortality of CRC, early detection biomarkers are in high demand.
    [Show full text]
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • Gene Mapping and Medical Genetics
    J Med Genet: first published as 10.1136/jmg.24.8.451 on 1 August 1987. Downloaded from Gene mapping and medical genetics Journal of Medical Genetics 1987, 24, 451-456 Molecular genetics of human chromosome 16 GRANT R SUTHERLAND*, STEPHEN REEDERSt, VALENTINE J HYLAND*, DAVID F CALLEN*, ANTONIO FRATINI*, AND JOHN C MULLEY* From *the Cytogenetics Unit, Adelaide Children's Hospital, North Adelaide, South Australia 5006; and tUniversity of Oxford, Nuffield Department of Clinical Medicine, John Radcliffe Hospital, Headington, Oxford OX3 9DU. SUMMARY The major diseases mapped to chromosome 16 are adult polycystic kidney disease and those resulting from mutations in the a globin complex. There are at least six other less important genetic diseases which map to this chromosome. The adenine phosphoribosyltransferase gene allows for selection of chromosome 16 in somatic cell hybrids and a hybrid panel is available which segments the chromosome into six regions to facilitate gene mapping. Genes which have been mapped to this chromosome or which have had their location redefined since HGM8 include APRT, TAT, MT, HBA, PKDI, CTRB, PGP, HAGH, HP, PKCB, and at least 19 cloned DNA sequences. There are RFLPs at 13 loci which have been regionally mapped and can be used for linkage studies. Chromosome 16 is not one of the more extensively have been cloned and mapped to this chromosome. mapped human autosomes. However, it has a Brief mention will be made of a hybrid cell panel http://jmg.bmj.com/ number of features which make it attractive to the which allows for an efficient regional localisation of gene mapper.
    [Show full text]