DOCSLIB.ORG

Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary cul- ture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all condi- tions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127 IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem. Genetic components to glaucoma are dants of a single founder, so GLC1C mu- suggested by high concordance for POAG tations may be found in multiple current among older monozygotic twins2 as well glaucoma genetics study populations. as mapping of a large number of glau- Here we describe expression data for 41 coma risk factor loci3,4 plus 12 POAG loci, genes within the GLC1C genetic inclu- called GLC1 loci.5-14 No unifying cellular sion interval and 7 high-priority candi- or biochemical themes have emerged from date genes selected based on overall or dif- the identification of the first 3 GLC1 genes: ferential expression. These data should Author Affiliations: myocilin (MYOC; Online Mendelian In- help to inform the work of many groups Departments of Ophthalmology heritance in Man [OMIM] 601652) at the in the field who are looking for genes that and Visual Sciences (Drs Rozsa, GLC1A locus,15,16 optineurin (OPTN; cause glaucoma. Pawar, and Richards and OMIM 602432) at the GLC1E locus,17 and Ms Scott) and Epidemiology WD-repeat36 (WDR36)atGLC1G11; these METHODS (Dr Richards), University of Michigan, Ann Arbor; and genes do not account for most of the fa- Department of Ophthalmology, milial cases of POAG. CELL LINES Oregon Health and Science The GLC1C locus is of special interest University, Portland because the gene itself has not been found For this institutional review board–approved (Drs Samples and Wirtz). but the locus has been confirmed through study, eyes were obtained from the Midwest (REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 117 ©2007 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/27/2021 Table 1. Primers Used in Quantitative Polymerase Chain Reaction Genomic cDNA Gene Forward Primer Reverse Primer Size, bp Size, bp GLC1C-Region Genes Not on the U133A GeneChip, 5؅ to 3؅ ACPL2 GTGCATGTGTTCATTCGCCAC TCAGCAGCTGACCGTTCTGCA 12 894 271 DZIP1L CAGCTAGAAGCTCCAGCAAAG GCAGCCTCTTCTGTTGAAGTG 1991 341 FAM62C ATCAGAGTGCACTTGCTGGAG GTGGCCACATTGTGCACAAAG 5777 654 FNDC6 CCCTGTTTGCCTTTGTTGGCT TGTCCCCTCATGGTTTCCATG 14 852 296 GRK7 GTTGCTGGACGAACACCATTC GGTTCAATTAGGCCAGCTTCC 9048 254 KY ATGACATTGCAGCTGCTCAGG ACTTGAGCGTGTACTCCAGCA 15 001 708 MGC40579 TTCTCTAGCTGGCCTTGCTGT TCCCTGAGCTTCATCTCATCTG 4796 242 NMNAT3 GCAAACTGCTCAGATCTCCAC AAGGCTCGCCTGATGTATGTG 12 427 322 RBP2 AAGGGACCAGAATGGAACCTG CTTAACATGCCGGTTATCCAG 14 343 247 SPSB4 ATGAGGGCACACTCAGCTTCA GCTCACTGGTACTGCAGATAG 80 617 274 TRIM42 AGCAACACTGACAAGAAGGCC CTGAGGTTGTTTCCTGCTCTG 12 694 574 TXNDC6 TCAGAGAGGACCTGTACCTTG CAACCTTGGCTGTGTACTGGA 43 915 489 XRN1 CTGGGAAGCCCTTCCATCATA TGGCTAGTCTGAACTGGAGTG 965 181 Non-GLC1C Genes for Normalization and Regression, 5؅ to 3؅ ACTA2 ATGGAGTCTGCTGGCATCCAT CCGGCTTCATCGTATTCCTGT 2987 293 FST GGGATTTCAAGGTTGGGAGAG GGAAAGCTGTAGTCCTGGTCT 961 238 G1P2 GCAGCGAACTCATCTTTGCCA CAGAGGTTCGTCGCATTTGTC 718 311 GAPDH AAGGTGAAGGTCGGAGTCAAC CCTGGAAGATGGTGATGGGAT 1955 229 GREM2 AGACCAAACTTAGACCCCGCT TGCCATCTCTCCGAGTTGTTG 118 656 249 HGF GGGAAGGTGACTCTGAATGAG GTGGGTGCTTCAGACACACTT 2906 274 KLF4 CACCCACACTTGTGATTACGC GACTCAGTTGGGAACTTGACC 1493 392 LIF ACGCCACCCATGTCACAACAA TGGGGTTGAGGATCTTCTGGT 971 278 MFGE8 AAACGCGGTGCATGTCAACCT CGTTGAAGTTGCCCTGCTTGT 4287 266 MYOC TATCTCAGGAGTGGAGAGGGA CTGGCTGATGAGGTCATACTC 2103 216 PTGS1 CAGGAACATGGACCACCACAT TCCGGAGAACAGATGGGATTC 2161 318 SULF1 TGGAGCTCAGAAGCTGTCAAG CATAGTGACTCTTCAGCAGTG 19 907 295 TNFAIP6 AGGAGTGTGGTGGCGTCTTTA CCAGCTGTCACTGAAGCATCA 9390 316 Abbreviations: bp, base pairs; cDNA, complementary DNA. Eye Banks (Ann Arbor, Mich), which obtained informed con- test, with PϽ.005 considered statistically significant. Scatter- sent and confirmed that no donors had been diagnosed with plots were drawn using Spotfire DecisionSite 8.2 software (Spot- glaucoma. Fifth-passage primary cultures of human trabecu- fire, Inc, Cambridge, Mass). lar meshwork (TM) cells used in age experiments came from Of the genes in the GLC1C interval between D3S3637 and 12- and 60-year-old females and 16- and 74-year-old males. D3S3694 obtained from the University of California, Santa Cruz, Cells were grown to confluence and maintained for 1 week Genome Browser (http://genome.ucsc.edu),18 28 were assayed before isolating RNA as previously described.21 In dexametha- by the U133A GeneChip and 13 were assayed by quantitative sone studies, fifth-passage TM cells were derived from young polymerase chain reaction (qPCR) using primers (Table 1) donors aged 12 and 16 years (as described in this article ear- in iQ SYBR Green Supermix reactions (BioRad Laboratories, lier) and a 17-year-old girl. The TM cells were grown with and Hercules, Calif) as previously described.21 We did not per- without a 21-day course of 100nM dexamethasone as previ- form qPCR confirmation of all of the GeneChip values be- ously described.21 cause results from previous experiments show GeneChip data to be adequate in the signal range being evaluated here. MICROARRAY ANALYSIS QUANTITATIVE PCR Labeling, hybridization to Affymetrix U133A GeneChips (Af- fymetrix, Santa Clara, Calif), and data extraction were done as Data from qPCR were assigned an estimated Affymetrix signal 21 previously described. The RNA was prepared from 2 sepa- value (EASV) using linear regression. The log2 values of Af- rate flasks for each culture, and conditions and data from bio- fymetrix signals from 9 control genes (Table 1) were plotted logical replicates were compared as previously described.21 against their corresponding qPCR threshold values normal- Image analysis was performed using Affymetrix Microar- ized to glyceraldehyde-3-phosphate dehydrogenase (Figure 1). ray Analysis Suite version 5.1 with samples scaled to 1500. Sig- These data are from the same RNA and GeneChips used for nals below 300 were considered absent and signals between 300 the other aspects of this study. The plot had an R2 value of and 750 were considered marginal. Values above 750 were con- 0.7459, and imputed values were calculated using the equa- ϫ ϩ [(C t −0.3866) 21.517] sidered present. tion EASV=2 , where Ct is the threshold value Fold change for each probe was calculated by dividing the for qPCR. The validity of the regression was examined by com- mean “treated” signal by the mean “untreated” signal in the dex- paring the actual and imputed signal values using qPCR data amethasone experiments and the mean “old” signal by the mean from 3 genes that were not used to construct the curve (Table 2). “young” signal in the age experiments. The inverse function When comparing data for the 3 control genes under 4 condi- was applied to values below 1 to indicate decreased expres- tions, we found that 8 of 12 data points showed less than a 2.5- sion. The significance of fold change was evaluated using the t fold difference between the imputed and actual Affymetrix val- (REPRINTED) ARCH OPHTHALMOL / VOL 125, JAN 2007 WWW.ARCHOPHTHALMOL.COM 118 ©2007 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/27/2021 ues. In a separate experiment in which data from a different RESULTS RNA sample tested on the Affymetrix U133Av2 version 2 chips were examined for the 6 experimental genes for which we need to impute values, we found that 5 of 6 measured data points The 7 879 854–base pair GLC1C interval between fell within 2.5-fold of the imputed values. D3S3637 and D3S3694 contains 41 genes (Table 3). We The EASV gives us an approximate value for comparing data evaluated gene expression under
Load more

Recommended publications
  • High-Throughput, Pooled Sequencing Identifies Mutations in NUBPL And
    ARTICLES High-throughput, pooled sequencing identifies mutations in NUBPL and FOXRED1 in human complex I deficiency Sarah E Calvo1–3,10, Elena J Tucker4,5,10, Alison G Compton4,10, Denise M Kirby4, Gabriel Crawford3, Noel P Burtt3, Manuel Rivas1,3, Candace Guiducci3, Damien L Bruno4, Olga A Goldberger1,2, Michelle C Redman3, Esko Wiltshire6,7, Callum J Wilson8, David Altshuler1,3,9, Stacey B Gabriel3, Mark J Daly1,3, David R Thorburn4,5 & Vamsi K Mootha1–3 Discovering the molecular basis of mitochondrial respiratory chain disease is challenging given the large number of both mitochondrial and nuclear genes that are involved. We report a strategy of focused candidate gene prediction, high-throughput sequencing and experimental validation to uncover the molecular basis of mitochondrial complex I disorders. We created seven pools of DNA from a cohort of 103 cases and 42 healthy controls and then performed deep sequencing of 103 candidate genes to identify 151 rare variants that were predicted to affect protein function. We established genetic diagnoses in 13 of 60 previously unsolved cases using confirmatory experiments, including cDNA complementation to show that mutations in NUBPL and FOXRED1 can cause complex I deficiency. Our study illustrates how large-scale sequencing, coupled with functional prediction and experimental validation, can be used to identify causal mutations in individual cases. Complex I of the mitochondrial respiratory chain is a large ~1-MDa ­assembly factors are probably required, as suggested by the 20 factors macromolecular machine composed of 45 protein subunits encoded necessary for assembly of the smaller complex IV9 and by cohort by both the nuclear and mitochondrial (mtDNA) genomes.
    [Show full text]
  • Predicting Gene Ontology Biological Process from Temporal Gene Expression Patterns Astrid Lægreid,1,4 Torgeir R
    Methods Predicting Gene Ontology Biological Process From Temporal Gene Expression Patterns Astrid Lægreid,1,4 Torgeir R. Hvidsten,2 Herman Midelfart,2 Jan Komorowski,2,3,4 and Arne K. Sandvik1 1Department of Cancer Research and Molecular Medicine, Norwegian University of Science and Technology, N-7489 Trondheim, Norway; 2Department of Information and Computer Science, Norwegian University of Science and Technology, N-7491 Trondheim, Norway; 3The Linnaeus Centre for Bioinformatics, Uppsala University, SE-751 24 Uppsala, Sweden The aim of the present study was to generate hypotheses on the involvement of uncharacterized genes in biological processes. To this end,supervised learning was used to analyz e microarray-derived time-series gene expression data. Our method was objectively evaluated on known genes using cross-validation and provided high-precision Gene Ontology biological process classifications for 211 of the 213 uncharacterized genes in the data set used. In addition,new roles in biological process were hypothesi zed for known genes. Our method uses biological knowledge expressed by Gene Ontology and generates a rule model associating this knowledge with minimal characteristic features of temporal gene expression profiles. This model allows learning and classification of multiple biological process roles for each gene and can predict participation of genes in a biological process even though the genes of this class exhibit a wide variety of gene expression profiles including inverse coregulation. A considerable number of the hypothesized new roles for known genes were confirmed by literature search. In addition,many biological process roles hypothesi zed for uncharacterized genes were found to agree with assumptions based on homology information.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • A Yeast Phenomic Model for the Influence of Warburg Metabolism on Genetic Buffering of Doxorubicin Sean M
    Santos and Hartman Cancer & Metabolism (2019) 7:9 https://doi.org/10.1186/s40170-019-0201-3 RESEARCH Open Access A yeast phenomic model for the influence of Warburg metabolism on genetic buffering of doxorubicin Sean M. Santos and John L. Hartman IV* Abstract Background: The influence of the Warburg phenomenon on chemotherapy response is unknown. Saccharomyces cerevisiae mimics the Warburg effect, repressing respiration in the presence of adequate glucose. Yeast phenomic experiments were conducted to assess potential influences of Warburg metabolism on gene-drug interaction underlying the cellular response to doxorubicin. Homologous genes from yeast phenomic and cancer pharmacogenomics data were analyzed to infer evolutionary conservation of gene-drug interaction and predict therapeutic relevance. Methods: Cell proliferation phenotypes (CPPs) of the yeast gene knockout/knockdown library were measured by quantitative high-throughput cell array phenotyping (Q-HTCP), treating with escalating doxorubicin concentrations under conditions of respiratory or glycolytic metabolism. Doxorubicin-gene interaction was quantified by departure of CPPs observed for the doxorubicin-treated mutant strain from that expected based on an interaction model. Recursive expectation-maximization clustering (REMc) and Gene Ontology (GO)-based analyses of interactions identified functional biological modules that differentially buffer or promote doxorubicin cytotoxicity with respect to Warburg metabolism. Yeast phenomic and cancer pharmacogenomics data were integrated to predict differential gene expression causally influencing doxorubicin anti-tumor efficacy. Results: Yeast compromised for genes functioning in chromatin organization, and several other cellular processes are more resistant to doxorubicin under glycolytic conditions. Thus, the Warburg transition appears to alleviate requirements for cellular functions that buffer doxorubicin cytotoxicity in a respiratory context.
    [Show full text]
  • Tese Roberto Molina.Pdf
    Universidade de São Paulo FACULDADE DE MEDICINA DE RIBEIRÃO PRETO Roberto Augusto Silva Molina Tese de Doutorado a ser apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para a obtenção do Título de Doutor em Ciências: Biologia Celular e Molecular. Orientadora: Prof.ª Dr.ª Enilza Maria Espreafico RIBEIRÃO PRETO 2014 Ficha Catalográfica Molina, Roberto Augusto Silva "EMC1 contribui para a malignidade em células de câncer de mama", Ribeirão Preto, 2014. 107p.: il.; 30cm Tese de Doutorado, apresentada à Faculdade de Medicina de Ribeirão Preto/USP. Área de Concentração: Biologia Celular e Molecular. Orientadora: Espreafico, Enilza Maria. 1 - EMC1; 2 - KIAA0090; 3 - câncer de mama; 4 - invasão; 5 - EROs FOLHA DE APROVAÇÃO Roberto Augusto Silva Molina "EMC1 contribui para a malignidade em células de câncer de mama" Tese de doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para a obtenção do título de Doutor. Área de Concentração: Biologia Celular e Molecular. Aprovado em: / / Banca Examinadora Professora Dra. Maria Aparecida Nagai Instituição: Assinatura: ________________________________________________________ Professora Dra. Mariana Kiomy Osako Instituição: Assinatura: ________________________________________________________ Professor Dr. Guido Lenz Instituição: Assinatura: ________________________________________________________ Professor Dr. Wilson Araujo da Silva Júnior Instituição: Assinatura: ________________________________________________________ Professora Dra. Enilza Maria Espreafico Instituição: Faculdade de Medicina de Ribeirão Preto/USP Assinatura: ________________________________________________________ i Agradecimentos... Primeiramente a Deus, que me concedeu o dom da vida, por iluminar meu caminho sempre me dando forças para lutar sem perder o ânimo. À Profa. Dra. Enilza Maria Espreafico, por me receber de portas abertas em seu laboratório, pela confiança depositada, por todo ensinamento e pela sua empolgação contagiante pela ciência.
    [Show full text]
  • Human Genome Center Laboratory of Genome Database Laboratory of Sequence Analysis ゲノムデータベース分野 シークエンスデータ情報処理分野
    116 Human Genome Center Laboratory of Genome Database Laboratory of Sequence Analysis ゲノムデータベース分野 シークエンスデータ情報処理分野 Professor Minoru Kanehisa, Ph.D. 教授（委嘱） 理学博士 金 久 實 Assistant Professor Toshiaki Katayama, M.Sc. 助 教 理学修士 片山俊明 Assistant Professor Shuichi Kawashima, M.Sc. 助 教 理学修士 川島秀一 Lecturer Tetsuo Shibuya, Ph.D. 講 師 理学博士 渋谷哲朗 Assistant Professor Michihiro Araki, Ph.D. 助 教 薬学博士 荒木通啓 Since the completion of the Human Genome Project, high-throughput experimental projects have been initiated for uncovering genomic information in an extended sense, including transcriptomics, proteomics metabolomics, glycomics, and chemi- cal genomics. We are developing a new generation of databases and computa- tional technologies, beyond the traditional genome databases and sequence analy- sis tools, for making full use of these divergent and ever-increasing amounts of data, especially for medical and pharmaceutical applications. 1. KEGG DRUG and KEGG DISEASE natural product information in the context of plant and other genomes. We also develop Minoru Kanehisa KEGG DISEASE (http://www.genome.jp/kegg/ disease/), a new resource for understanding KEGG is a database of biological systems that molecular mechanisms of human diseases, integrates genomic, chemical, and systemic func- where molecular networks involving disease tional information. It is widely used as a refer- genes are represented as KEGG pathway maps ence knowledge base for understanding higher- or, when such details are not known, simply by order functions and utilities of the cell or the or- a list of diseases genes and other lists of mole- ganism from genomic information. Although the cules including environmental factors. basic components of the KEGG resource are de- veloped in Kyoto University, this Laboratory in 2.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • Improving the Yeast Two-Hybrid System with Permutated Fusion Proteins: the Varicella Zoster Virus Protein Interaction Network
    Improving the Yeast two-hybrid system with permutated fusion proteins: The Varicella zoster virus protein interaction network Zur Erlangung des akademischen Grades eines DOKTORS DER NATURWISSENSCHAFTEN (Dr. rer. nat.) Fakultät für Chemie und Biowissenschaften Karlsruher Institut für Technologie (KIT) - Universitätsbereich vorgelegte DISSERTATION von Diplom-Biologe Thorsten Stellberger aus Rauenberg Dekan: Prof. Dr. Stefan Bräse Referent: Prof. Dr. Jonathan Sleeman Korreferent: Prof. Dr. Jörg Kämper Tag der mündlichen Prüfung: 20.10.2010 Die vorliegende Arbeit wurde in der Zeit von Januar 2007 bis September 2010 in der Arbeitsgruppe von PD Dr. Peter Uetz im Institut für Toxikologie und Genetik des Karlsruher Instituts für Technologie (KIT), Campus Nord, angefertigt. Zusammenfassung Die vorliegende Studie beschreibt den ersten Versuch zur Erstellung eines vergleichenden Protein-Protein Interaktionsnetzwerks mit dem Yeast two-hybrid (Y2H) System. Viele Studien bestätigen, dass Interaktionsnetzwerke aus proteomweiten Screens unvollständig sind. Dies stützt sich auf die Beobachtung, dass Interaktionsdaten, die mit unterschiedlichen Methoden erhoben wurden, nur geringe Überlappungen zeigen. Dies betrifft auch unterschiedliche Systeme innerhalb einer Methode, wie verschiedene Y2H-Systeme. Dadurch wurde die Frage aufgeworfen, welche Rolle strukturelle Unterschiede, insbesondere sterische Bedingungen im Testsystem spielen, verursacht durch die Orientierung der verwendeten Fusionsdomänen. In dieser Arbeit untersuche ich deren Einfluss auf die Detektierbarkeit
    [Show full text]
  • Human Untagged Clone – SC316202 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC316202 SLC35G2 (NM_001097599) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: SLC35G2 (NM_001097599) Human Untagged Clone Tag: Tag Free Symbol: SLC35G2 Synonyms: TMEM22 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001097599, the custom clone sequence may differ by one or more nucleotides ATGGATACTTCTCCCTCCAGAAAATATCCAGTTAAAAAACGGGTGAAAATACATCCCAACACAGTGATGG TGAAATATACTTCTCATTATCCCCAGCCTGGCGATGATGGATATGAAGAAATCAATGAAGGCTATGGAAA TTTTATGGAGGAAAATCCAAAGAAAGGTCTGCTGAGTGAAATGAAAAAAAAAGGGAGAGCTTTCTTTGGA ACCATGGATACCCTACCTCCACCAACAGAAGACCCAATGATCAATGAGATTGGACAATTCCAGAGCTTTG CAGAAAAAAACATTTTTCAATCCCGAAAAATGTGGATAGTGCTGTTTGGATCTGCTTTGGCTCATGGATG TGTAGCTCTTATCACTAGGCTTGTTTCTGATCGGTCTAAAGTTCCATCTCTAGAACTGATTTTTATCCGT TCTGTTTTTCAGGTCTTATCTGTGTTAGTTGTGTGTTACTATCAGGAGGCCCCCTTTGGACCCAGTGGAT ACAGATTACGACTCTTCTTTTATGGTGTATGCAATGTCATTTCTATCACTTGTGCTTATACATCATTTTC AATAGTTCCTCCCAGCAATGGGACCACTATGTGGAGAGCCACAACTACAGTCTTCAGTGCCATTTTGGCT TTTTTACTCGTAGATGAGAAAATGGCTTATGTTGACATGGCTACAGTTGTTTGCAGCATCTTAGGTGTTT GTCTTGTCATGATCCCAAACATTGTTGATGAAGACAATTCTTTGTTAAATGCCTGGAAAGAAGCCTTTGG GTACACCATGACTGTGATGGCTGGACTGACCACTGCTCTCTCAATGATAGTATACAGATCCATCAAGGAG AAGATCAGCATGTGGACTGCACTGTTTACTTTTGGTTGGACTGGGACAATTTGGGGAATATCTACTATGT TTATTCTTCAAGAACCCATCATCCCATTAGATGGAGAAACCTGGAGTTATCTCATTGCTATATGTGTCTG
    [Show full text]
  • Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus
    LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary cul- ture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all condi- tions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127 IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem.
    [Show full text]
  • Rank Aggregation Via the Cross Entropy Algorithm
    Finding cancer genes through meta-analysis of of the individual microarray studies were hybridized with the A®ymetrix GeneChip Human Genome HG-U133A and record expression levels for 22,283 Probe IDs. To make our ¯nal results meaningful and comprehensive at the same time, we decided to focus on microarray experiments that study di®erent types of cancer in humans. The goal of our meta-analysis is to identify genetic factors which are common across di®erent types and stages of cancer. For that purpose, we have selected 20 di®erent cancer-related microarray experiments which are included in the contest meta-dataset and have explicit cell type groupings necessary for detecting di®erentially expressed genes. Here, we list the selected experiment IDs along with the number of samples in each experiment in the parenthesis: E-MEXP-72 (20), E-MEXP-83 (22), E-MEXP-76 (17), E-MEXP-97 (24), E-MEXP-121 (30), E-MEXP-149 (20), E-MEXP-231 (58), E-MEXP-353 (96), E-TABM-26 (57), E-MEXP-669 (24), GSE4475 (221), GSE1456 (159), GSE5090 (17), GSE1420 (24), GSE1577 (29), GSE1729 (43), GSE2485 (18), GSE2603 (21), GSE3585 (12), GSE4127 (29). The total number of selected arrays is 941 (about 1/6 of the overall number of samples in the meta-dataset). One can refer to ArrayExpress database which provides public access to the microarray data from these experiments (http://www.ebi.ac.uk/arrayexpress/ ). 3 Methodology The proposed meta-analysis approach to microarray data is a two-step procedure: 1. Individual Analysis. By analyzing each microarray dataset individually, a set of \interesting" genes (top-50 Probe IDs) that exhibit the largest di®erences in terms of expression values between the groups is obtained for each dataset.
    [Show full text]
  • Predicting Tissue-Specific Enhancers in the Human Genome
    Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Methods Predicting tissue-specific enhancers in the human genome Len A. Pennacchio,1,2 Gabriela G. Loots,3 Marcelo A. Nobrega,4 and Ivan Ovcharenko2,5,6 1Genomics Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720, USA; 2U.S. Department of Energy, Joint Genome Institute, Walnut Creek, California 94598, USA; 3Biosciences and Biotechnology Division, Lawrence Livermore National Laboratory, Livermore, California 94550, USA; 4Department of Human Genetics, University of Chicago, Chicago, Illinois 60637, USA; 5Computation Directorate, Lawrence Livermore National Laboratory, Livermore, California 94550, USA Determining how transcriptional regulatory signals are encoded in vertebrate genomes is essential for understanding the origins of multicellular complexity; yet the genetic code of vertebrate gene regulation remains poorly understood. In an attempt to elucidate this code, we synergistically combined genome-wide gene-expression profiling, vertebrate genome comparisons, and transcription factor binding-site analysis to define sequence signatures characteristic of candidate tissue-specific enhancers in the human genome. We applied this strategy to microarray-based gene expression profiles from 79 human tissues and identified 7187 candidate enhancers that defined their flanking gene expression, the majority of which were located outside of known promoters. We cross-validated this method for its ability to de novo predict tissue-specific gene expression and confirmed its reliability in 57 of the 79 available human tissues, with an average precision in enhancer recognition ranging from 32% to 63% and a sensitivity of 47%. We used the sequence signatures identified by this approach to successfully assign tissue-specific predictions to ∼328,000 human–mouse conserved noncoding elements in the human genome.
    [Show full text]