DOCSLIB.ORG

Improving the Yeast Two-Hybrid System with Permutated Fusion Proteins: the Varicella Zoster Virus Protein Interaction Network

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Improving the Yeast Two-Hybrid System with Permutated Fusion Proteins: the Varicella Zoster Virus Protein Interaction Network Improving the Yeast two-hybrid system with permutated fusion proteins: The Varicella zoster virus protein interaction network Zur Erlangung des akademischen Grades eines DOKTORS DER NATURWISSENSCHAFTEN (Dr. rer. nat.) Fakultät für Chemie und Biowissenschaften Karlsruher Institut für Technologie (KIT) - Universitätsbereich vorgelegte DISSERTATION von Diplom-Biologe Thorsten Stellberger aus Rauenberg Dekan: Prof. Dr. Stefan Bräse Referent: Prof. Dr. Jonathan Sleeman Korreferent: Prof. Dr. Jörg Kämper Tag der mündlichen Prüfung: 20.10.2010 Die vorliegende Arbeit wurde in der Zeit von Januar 2007 bis September 2010 in der Arbeitsgruppe von PD Dr. Peter Uetz im Institut für Toxikologie und Genetik des Karlsruher Instituts für Technologie (KIT), Campus Nord, angefertigt. Zusammenfassung Die vorliegende Studie beschreibt den ersten Versuch zur Erstellung eines vergleichenden Protein-Protein Interaktionsnetzwerks mit dem Yeast two-hybrid (Y2H) System. Viele Studien bestätigen, dass Interaktionsnetzwerke aus proteomweiten Screens unvollständig sind. Dies stützt sich auf die Beobachtung, dass Interaktionsdaten, die mit unterschiedlichen Methoden erhoben wurden, nur geringe Überlappungen zeigen. Dies betrifft auch unterschiedliche Systeme innerhalb einer Methode, wie verschiedene Y2H-Systeme. Dadurch wurde die Frage aufgeworfen, welche Rolle strukturelle Unterschiede, insbesondere sterische Bedingungen im Testsystem spielen, verursacht durch die Orientierung der verwendeten Fusionsdomänen. In dieser Arbeit untersuche ich deren Einfluss auf die Detektierbarkeit von Protein-Protein Interaktionen. Zunächst habe ich ein Vektorsystem entwickelt, welches die Y2H-Testdomänen an den C-Terminus und nicht an den N-terminus fusioniert, wie es traditionell gemacht wird. Die Ausgangsvektoren pGBKT7g und pGADT7g habe ich zunächst entsprechend umgebaut und wieder für die Hochdurchsatz-Klonierung kompatibel gemacht (Gateway-Klonierung, Invitrogen, Karlsruhe). Nach der Konversion konnten beide Vektorsysteme kombiniert werden, wodurch vier verschiedene Bait- Prey Kombinationen getestet werden können, mit N-N-, N-C-, C-N- und C-C- terminalen Testdomänen. Eine Bibliothek aus Gateway® Eingangsvektoren von Varizella Zoster Virus (VZV) wurde in beide Vektorsysteme hineinrekombiniert und zusätzlich zur NN-Topologie auf binäre Proteininteraktionen getestet. Dadurch konnten etwa doppelt so viele Interaktionen identifiziert und die Rate an falsch-negativen Interaktionen gesenkt werden. Ähnliche Ergebnisse wurden bei der Validierung mittels eines humanen Referenz-Sets erzielt. Deshalb empfehle ich, dieses System in zukünftigen Studien routinemäßig anzuwenden. Zusätzlich zum VZV-Interaktom habe ich ein Subnetzwerk von DNA-Enkapsidations Proteinen analysiert und eine besonders interessante Interaktion näher charakterisiert. Das essentielle, vom offenen Leserahmen Nummer 25 (ORF25) codierte Protein zeigt viele Interaktionen mit DNA-Verpackungsproteinen wie auch mit den meisten anderen viralen Proteinen. I Mithilfe von Peptid-Arrays konnte ich drei Sequenzbereiche Identifizieren, welche die Selbstinteraktion des Proteins vermitteln. Diese Erkenntnisse können in Kombination mit 3-D Strukturen und neuen Methoden des virtuellen drug-design bei der Entwicklung antiviraler Therapeutika verwendet werden. II Summary The study at hand is the first comprehensive attempt to perform a high-throughput protein-protein interaction network with the Yeast two-hybrid (Y2H) system. Reports of incompleteness and low overlaps between protein-protein interaction datasets derived by different methods and variants of the Yeast two-hybrid system, raised the question about the impact of sterical circumstances caused by the fusion tags added to the proteins in order to detect a possible interaction. First, I developed a Y2H vector system with the fusion tags C-terminally fused to the test-constructs. Additionally, the vectors had to be suitable for high-throughput cloning of test libraries. As parental vectors I have used the pGBKT7g bait and pGADT7g prey vector, derivatives of the Clontech MatchMaker Y2H system that were previously modified for high-throughput cloning by the Gateway® recombination cloning technology. After the conversion, both vector systems, the traditional N-terminally- and the new C-terminally tagging vector system could be combined to screen four different tag-topologies of bait- and prey-fusion tags. A Gateway® entry-vector library of Varicella zoster virus (VZV), which was recently screened with the progenitor Y2H vectors, was recombinated into both vector systems and additional Y2H screens were performed to gain a complete "combinatorial" network of VZV (A screen repeated with four bait-prey combinations N-N, N-C, C-N and C-C bait-prey fusion tag orientation, respectively). The permutations of N- and C-terminal Y2H vectors achieved an extensive increase of the coverage of this interactome screen, and thus significantly reduce the rate of undetected interactions. Similar results were determined by screening a human reference set. Accordingly, I recommend that future interaction screening projects should use such vector combinations on a routine basis. In the second part of this study I generated a sub-network of VZV DNA-packaging proteins. Thereupon, I synthesized peptide-arrays to characterize the self-interaction of one of those proteins, encoded by the essential VZV open reading frame number 25 (ORF25). I could identify three interacting peptides within the 156 amino acid protein, which contribute to its self-interaction. These findings provide a basis for modern drug-design in order to identify and develop new antiviral compounds. III IV Contents Zusammenfassung............................................................................................. I Summary............................................................................................................ III Contents............................................................................................................. V List of Abbreviations ........................................................................................... VIII List of Figures..................................................................................................... XI List of Tables...................................................................................................... XIV 1 Introduction .................................................................................................. 1 1.1 Protein-Protein Interactions........................................................... 1 1.2 From single interactions to the interactome................................... 1 1.2.1 The Yeast two-hybrid system.................................................... 2 1.2.2 Protein-interactome studies performed with the Y2H system.... 3 1.2.3 Biological databases ................................................................. 4 1.2.4 Y2H screening methods............................................................ 5 1.2.5 Limitations of the Yeast two-hybrid system............................... 7 1.2.6 Experimental strategy for matrix-based Y2H-screens............... 9 1.3 Varicella zoster virus as model for combinatorial Y2H-screening.. 12 1.3.1 VZV - clinical aspects................................................................ 12 1.3.2 General introduction into the Herpesviridae family.................... 12 1.3.3 Herpesviridae - subfamilies and phylogeny............................... 13 1.3.4 Virion structure and genetic organization.................................. 14 1.3.5 Herpesviral life-cycle................................................................. 16 1.3.6 Latency ..................................................................................... 20 1.4 Drug discovery .............................................................................. 20 1.5 Mapping of interaction epitopes using peptide arrays ................... 21 1.5.1 Spot synthesis........................................................................... 21 1.6 Aims .............................................................................................. 25 1.6.1 Combinatorial Y2H-screening with permutated fusion tags....... 25 1.6.2 Mapping of the homomerization domain of VZV ORF25........... 27 V 2 Materials and Methods .................................................................................28 2.1 Materials ........................................................................................28 2.1.1 Instruments................................................................................28 2.1.2 Consumable Materials...............................................................29 2.1.3 General Chemicals....................................................................29 2.1.4 Kits ............................................................................................31 2.1.5 Compounds of Bacteria- and Yeast Media ................................31 2.1.6 Chemicals for Peptide Synthesis...............................................32 2.1.7 DNA and Protein Ladders..........................................................33 2.1.8 Enzymes....................................................................................33 2.1.9 Media for Bacterial Culture ........................................................33 2.1.10 Media for Yeast Culture.............................................................34 2.1.11 General Buffers and Solutions...................................................36
Load more

Recommended publications
  • The Title of the Article
    Mechanism-Anchored Profiling Derived from Epigenetic Networks Predicts Outcome in Acute Lymphoblastic Leukemia Xinan Yang, PhD1, Yong Huang, MD1, James L Chen, MD1, Jianming Xie, MSc2, Xiao Sun, PhD2, Yves A Lussier, MD1,3,4§ 1Center for Biomedical Informatics and Section of Genetic Medicine, Department of Medicine, The University of Chicago, Chicago, IL 60637 USA 2State Key Laboratory of Bioelectronics, Southeast University, 210096 Nanjing, P.R.China 3The University of Chicago Cancer Research Center, and The Ludwig Center for Metastasis Research, The University of Chicago, Chicago, IL 60637 USA 4The Institute for Genomics and Systems Biology, and the Computational Institute, The University of Chicago, Chicago, IL 60637 USA §Corresponding author Email addresses: XY: [email protected] YH: [email protected] JC: [email protected] JX: [email protected] XS: [email protected] YL: [email protected] - 1 - Abstract Background Current outcome predictors based on “molecular profiling” rely on gene lists selected without consideration for their molecular mechanisms. This study was designed to demonstrate that we could learn about genes related to a specific mechanism and further use this knowledge to predict outcome in patients – a paradigm shift towards accurate “mechanism-anchored profiling”. We propose a novel algorithm, PGnet, which predicts a tripartite mechanism-anchored network associated to epigenetic regulation consisting of phenotypes, genes and mechanisms. Genes termed as GEMs in this network meet all of the following criteria: (i) they are co-expressed with genes known to be involved in the biological mechanism of interest, (ii) they are also differentially expressed between distinct phenotypes relevant to the study, and (iii) as a biomodule, genes correlate with both the mechanism and the phenotype.
    [Show full text]
  • Identification and Diagnostic Performance of a Small RNA Within the PCA3 and BMCC1 Gene Locus That Potentially Targets Mrna
    Published OnlineFirst November 12, 2014; DOI: 10.1158/1055-9965.EPI-14-0377 Research Article Cancer Epidemiology, Biomarkers Identification and Diagnostic Performance of a & Prevention Small RNA within the PCA3 and BMCC1 Gene Locus That Potentially Targets mRNA Ross M. Drayton1, Ishtiaq Rehman1, Raymond Clarke2, Zhongming Zhao3,4, Karl Pang1, Saiful Miah1, Robert Stoehr5, Arndt Hartmann5, Sheila Blizard1, Martin Lavin2, Helen E. Bryant1, Elena S. Martens-Uzunova6, Guido Jenster6, Freddie C. Hamdy7, Robert A. Gardiner2, and James W.F. Catto1 Abstract Background: PCA3 is a long noncoding RNA (lncRNA) with malignant prostatic tissues, exfoliated urinary cells from men unknown function, upregulated in prostate cancer. LncRNAs may with prostate cancer (13–273 fold change; t test P < 0.003), and be processed into smaller active species. We hypothesized this for closely correlated to PCA3 expression (r ¼ 0.84–0.93; P < 0.001). PCA3. Urinary PCA3-shRNA2 (C-index, 0.75–0.81) and PCA3 (C-index, Methods: We computed feasible RNA hairpins within the 0.78) could predict the presence of cancer in most men. PCA3- BMCC1 gene (encompassing PCA3) and searched a prostate shRNA2 knockup altered the expression of predicted target transcriptome for these. We measured expression using qRT- mRNAs, including COPS2, SOX11, WDR48, TEAD1, and Noggin. PCR in three cohorts of prostate cancer tissues (n ¼ 60), PCA3-shRNA2 expression was negatively correlated with COPS2 exfoliated urinary cells (n ¼ 484 with cancer and n ¼ 166 in patient samples (r ¼0.32; P < 0.001). controls), and in cell lines (n ¼ 22). We used in silico predictions Conclusion: We identified a short RNA within PCA3, whose and RNA knockup to identify potential mRNA targets of short expression is correlated to PCA3, which may target mRNAs transcribed RNAs.
    [Show full text]
  • Supplementary Material for “Characterization of the Opossum Immune Genome Provides Insights Into the Evolution of the Mammalian Immune System”
    Supplementary material for “Characterization of the opossum immune genome provides insights into the evolution of the mammalian immune system” Katherine Belov1*, Claire E. Sanderson1, Janine E. Deakin2, Emily S.W. Wong1, Daniel Assange3, Kaighin A. McColl3, Alex Gout3,4, Bernard de Bono5, Terence P. Speed3, John Trowsdale5, Anthony T. Papenfuss3 1. Faculty of Veterinary Science, University of Sydney, Sydney, Australia 2. ARC Centre for Kangaroo Genomics, Research School of Biological Sciences, The Australian National University, Canberra, Australia 3. Bioinformatics Division, The Walter and Eliza Hall Institute of Medical Research, Parkville, Australia 4. Department of Medical Biology, The University of Melbourne, Parkville, Australia 5. Immunology Division, University of Cambridge, Cambridge, UK *Corresponding author: K. Belov, Faculty of Veterinary Science, University of Sydney, NSW 2006, Australia ph 61 2 9351 3454, fx 61 2 9351 3957, email [email protected] MHC paralogous regions Only 36 of the 114 genes in the opossum MHC have paralogs in one of the three paralogous regions (Supplementary Table 1). Genes represented in at least three of the four paralogous regions (13 genes) were used to compare gene order, revealing rearrangements between the four regions in opossum. Table 1: MHC genes with paralogs on opossum chromosomes 1, 2 and 3, corresponding to MHC paralogous regions on human chromosomes 9, 1 and 19 respectively. MHC Chromosome 1 Chromosome 2 Chromosome 3 (Human Chr 9) (Human Chr 1) (Human Chr 19) AGPAT1 AGPAT2 AIF1 C9orf58 ATP6V1G2 ATP6V1G1 ATP6V1G3 B3GALT4 B3GALT2 BAT1 DDX39 BAT2 KIAA0515 BAT2D1 BRD2 BRD3 BRDT BRD4 C4 C5 C3 SLC44A4 SLC44A5 SLC44A2 CLIC1 CLIC3 CLIC4 COL11A2 COL5A1 COL11A1 COL5A3 CREBL1 ATF6 DDAH2 DDAH1 DDR1 DDR2 EGFL8 EGFL7 EHMT2 EHMT1 GPX5 GPX4 MHC Class I CD1 HSPA1A HSPA5 MDC1 PRG4 NOTCH4 NOTCH1 NOTCH2 NOTCH3 PBX2 PBX3 PBX1 PBX4 PHF1 MTF2 PRSS16 DPP7 PSMB9 PSMB7 RGL2 RALGDS RGL1 RGL3 RING1 RNF2 RXRB RXRA RXRG SYNGAP1 RASAL2 TAP ABCA2 TNF/LTA/LTB TNFSF8/TNFSF15 TNFSF4 CD70/TNFSF9/ TNFSF14/ TNXB TNC TNR Table 2.
    [Show full text]
  • High-Throughput, Pooled Sequencing Identifies Mutations in NUBPL And
    ARTICLES High-throughput, pooled sequencing identifies mutations in NUBPL and FOXRED1 in human complex I deficiency Sarah E Calvo1–3,10, Elena J Tucker4,5,10, Alison G Compton4,10, Denise M Kirby4, Gabriel Crawford3, Noel P Burtt3, Manuel Rivas1,3, Candace Guiducci3, Damien L Bruno4, Olga A Goldberger1,2, Michelle C Redman3, Esko Wiltshire6,7, Callum J Wilson8, David Altshuler1,3,9, Stacey B Gabriel3, Mark J Daly1,3, David R Thorburn4,5 & Vamsi K Mootha1–3 Discovering the molecular basis of mitochondrial respiratory chain disease is challenging given the large number of both mitochondrial and nuclear genes that are involved. We report a strategy of focused candidate gene prediction, high-throughput sequencing and experimental validation to uncover the molecular basis of mitochondrial complex I disorders. We created seven pools of DNA from a cohort of 103 cases and 42 healthy controls and then performed deep sequencing of 103 candidate genes to identify 151 rare variants that were predicted to affect protein function. We established genetic diagnoses in 13 of 60 previously unsolved cases using confirmatory experiments, including cDNA complementation to show that mutations in NUBPL and FOXRED1 can cause complex I deficiency. Our study illustrates how large-scale sequencing, coupled with functional prediction and experimental validation, can be used to identify causal mutations in individual cases. Complex I of the mitochondrial respiratory chain is a large ~1-MDa ­assembly factors are probably required, as suggested by the 20 factors macromolecular machine composed of 45 protein subunits encoded necessary for assembly of the smaller complex IV9 and by cohort by both the nuclear and mitochondrial (mtDNA) genomes.
    [Show full text]
  • Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus
    LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary cul- ture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all condi- tions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127 IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem.
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • Examination of the Role of the Hu Proteins, Hur and Hud, in Prostate Cancer Cells
    Examination of the Role of the Hu Proteins, HuR and HuD, in Prostate Cancer Cells. Christin Florence Down This thesis is presented for the degree of Doctor of Philosophy to the School of Medicine and Pharmacology, University of Western Australia. January 2007 i Declaration. This thesis contains published work and/or work prepared for publication, some of which has been co-authored . The bibliographic details of the works and where they appear in the thesis are set out below. (The candidate must attach to this declaration a statement detailing the percentage contribution of each author to the work. This must been signed by all authors. Where this is not possible, the statement detailing the percentage contribution of authors should be signed by the candidate’s Coordinating Supervisor). This thesis contains experimental data from the following co-authored work: Hu Proteins are Expressed and Regulate Androgen Receptor Expression and Cell Proliferation in Prostate Cancer. Christin F Down , Dianne J Beveridge, Michael R Epis, Ricky Lareu, Lisa M Stuart, Britt Granath, Dominic C Voon, Henry Furneaux, Cecily Metcalf, Jacqueline Bentel and Peter J Leedman. Submitted to Cancer Research . The relative contribution of authors is as follows: Christin Down (the Candidate): 55% Dianne J Beveridge 6 % Michael R Epis 6 % Ricky Lareu 3 % Lisa M Stuart 3 % Britt Granath 3 % Dominic Voon 3 % Henry Furneaux 3 % Cecily Metcalf 3 % Jacqueline Bentel 5 % Peter J Leedman 10 % Data from the manuscript described above are presented in this thesis in the following figures, and were performed by the investigator indicated: Figure 3.1A : Dr Cecily Metcalfe, Department of Pathology, Royal Perth Hospital.
    [Show full text]
  • Tese Roberto Molina.Pdf
    Universidade de São Paulo FACULDADE DE MEDICINA DE RIBEIRÃO PRETO Roberto Augusto Silva Molina Tese de Doutorado a ser apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para a obtenção do Título de Doutor em Ciências: Biologia Celular e Molecular. Orientadora: Prof.ª Dr.ª Enilza Maria Espreafico RIBEIRÃO PRETO 2014 Ficha Catalográfica Molina, Roberto Augusto Silva "EMC1 contribui para a malignidade em células de câncer de mama", Ribeirão Preto, 2014. 107p.: il.; 30cm Tese de Doutorado, apresentada à Faculdade de Medicina de Ribeirão Preto/USP. Área de Concentração: Biologia Celular e Molecular. Orientadora: Espreafico, Enilza Maria. 1 - EMC1; 2 - KIAA0090; 3 - câncer de mama; 4 - invasão; 5 - EROs FOLHA DE APROVAÇÃO Roberto Augusto Silva Molina "EMC1 contribui para a malignidade em células de câncer de mama" Tese de doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para a obtenção do título de Doutor. Área de Concentração: Biologia Celular e Molecular. Aprovado em: / / Banca Examinadora Professora Dra. Maria Aparecida Nagai Instituição: Assinatura: ________________________________________________________ Professora Dra. Mariana Kiomy Osako Instituição: Assinatura: ________________________________________________________ Professor Dr. Guido Lenz Instituição: Assinatura: ________________________________________________________ Professor Dr. Wilson Araujo da Silva Júnior Instituição: Assinatura: ________________________________________________________ Professora Dra. Enilza Maria Espreafico Instituição: Faculdade de Medicina de Ribeirão Preto/USP Assinatura: ________________________________________________________ i Agradecimentos... Primeiramente a Deus, que me concedeu o dom da vida, por iluminar meu caminho sempre me dando forças para lutar sem perder o ânimo. À Profa. Dra. Enilza Maria Espreafico, por me receber de portas abertas em seu laboratório, pela confiança depositada, por todo ensinamento e pela sua empolgação contagiante pela ciência.
    [Show full text]
  • Supplemental Figure S1 Differentially Methylated Regions (Dmrs
    Supplemental Figure S1 '$$#0#,2'**7+#2&7*2#"0#%'-,11 #25##,"'1#1#122#1 '!2-0'*"#.'!2'-,-$122&#20,1'2'-,$0-+2- !"Q !"2-$%," $ 31',% 25-$-*" !&,%# ," ' 0RTRW 1 !32V-$$ !0'2#0'T - #.0#1#,22'-, -$ "'$$#0#,2'**7+#2&7*2#"%#,#11',.0#,2&#1#1,"2&#'0 #&4'-022&#20,1'2'-, #25##,"'$$#0#,2"'1#1#122#1T-*!)00-51',"'!2#&7.#0+#2&7*2#"%#,#1Q%0700-51 &7.-+#2&7*2#"%#,#1Q31',%25-$-*"!&,%#,"'0RTRW1!32V-$$!0'2#0'T-%#,#1 +#22&# -4#!0'2#0'22&#20,1'2'-,$0-+$%2-$Q5#2&#0#$-0#*1-',!*3"#" %#,#15'2&V4*3#0RTRWT$$#!2#"%#,10#&'%&*'%&2#" 712#0'1)1#T Supplemental Figure S2 Validation of results from the HELP assay using Epityper MassarrayT #13*21 $0-+ 2&# 1$ 117 5#0# !-00#*2#" 5'2& /3,2'22'4# +#2&7*2'-, ,*78#" 7 '13*$'2#11007$-04V-,"6U-%#,#.0-+-2#00#%'-,1T11007 51.#0$-0+#"31',%**4'* *#1+.*#1T S Supplemental Fig. S1 A unique hypermethylated genes (methylation sites) 454 (481) 5693 (6747) 120 (122) NLMGUS NEWMM REL 2963 (3207) 1338 (1560) 5 (5) unique hypomethylated genes (methylation sites) B NEWMM 0 (0) MGUS 454 (481) 0 (0) NEWMM REL NL 3* (2) 2472 (3066) NEWMM 2963 REL (3207) 2* (2) MGUS 0 (0) REL 2 (2) NEWMM 0 (0) REL Supplemental Fig. S2 A B ARID4B DNMT3A Methylation by MassArray Methylation by MassArray 0 0.2 0.4 0.6 0.8 1 1.2 0.5 0.6 0.7 0.8 0.9 1 2 0 NL PC MGUS 1.5 -0.5 NEW MM 1 REL MM -1 0.5 -1.5 0 -2 -0.5 -1 -2.5 -1.5 -3 Methylation by HELP Assay Methylation by HELP Methylation by HELP Assay Methylation by HELP -2 -3.5 -2.5 -4 Supplemental tables "3..*#+#,2*6 *#"SS 9*','!*!&0!2#0'12'!1-$.2'#,21+.*#1 DZ_STAGE Age Gender Ethnicity MM isotype PCLI Cytogenetics
    [Show full text]
  • Human Genome Center Laboratory of Genome Database Laboratory of Sequence Analysis ゲノムデータベース分野 シークエンスデータ情報処理分野
    116 Human Genome Center Laboratory of Genome Database Laboratory of Sequence Analysis ゲノムデータベース分野 シークエンスデータ情報処理分野 Professor Minoru Kanehisa, Ph.D. 教授（委嘱） 理学博士 金 久 實 Assistant Professor Toshiaki Katayama, M.Sc. 助 教 理学修士 片山俊明 Assistant Professor Shuichi Kawashima, M.Sc. 助 教 理学修士 川島秀一 Lecturer Tetsuo Shibuya, Ph.D. 講 師 理学博士 渋谷哲朗 Assistant Professor Michihiro Araki, Ph.D. 助 教 薬学博士 荒木通啓 Since the completion of the Human Genome Project, high-throughput experimental projects have been initiated for uncovering genomic information in an extended sense, including transcriptomics, proteomics metabolomics, glycomics, and chemi- cal genomics. We are developing a new generation of databases and computa- tional technologies, beyond the traditional genome databases and sequence analy- sis tools, for making full use of these divergent and ever-increasing amounts of data, especially for medical and pharmaceutical applications. 1. KEGG DRUG and KEGG DISEASE natural product information in the context of plant and other genomes. We also develop Minoru Kanehisa KEGG DISEASE (http://www.genome.jp/kegg/ disease/), a new resource for understanding KEGG is a database of biological systems that molecular mechanisms of human diseases, integrates genomic, chemical, and systemic func- where molecular networks involving disease tional information. It is widely used as a refer- genes are represented as KEGG pathway maps ence knowledge base for understanding higher- or, when such details are not known, simply by order functions and utilities of the cell or the or- a list of diseases genes and other lists of mole- ganism from genomic information. Although the cules including environmental factors. basic components of the KEGG resource are de- veloped in Kyoto University, this Laboratory in 2.
    [Show full text]
  • Human Untagged Clone – SC316202 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC316202 SLC35G2 (NM_001097599) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: SLC35G2 (NM_001097599) Human Untagged Clone Tag: Tag Free Symbol: SLC35G2 Synonyms: TMEM22 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001097599, the custom clone sequence may differ by one or more nucleotides ATGGATACTTCTCCCTCCAGAAAATATCCAGTTAAAAAACGGGTGAAAATACATCCCAACACAGTGATGG TGAAATATACTTCTCATTATCCCCAGCCTGGCGATGATGGATATGAAGAAATCAATGAAGGCTATGGAAA TTTTATGGAGGAAAATCCAAAGAAAGGTCTGCTGAGTGAAATGAAAAAAAAAGGGAGAGCTTTCTTTGGA ACCATGGATACCCTACCTCCACCAACAGAAGACCCAATGATCAATGAGATTGGACAATTCCAGAGCTTTG CAGAAAAAAACATTTTTCAATCCCGAAAAATGTGGATAGTGCTGTTTGGATCTGCTTTGGCTCATGGATG TGTAGCTCTTATCACTAGGCTTGTTTCTGATCGGTCTAAAGTTCCATCTCTAGAACTGATTTTTATCCGT TCTGTTTTTCAGGTCTTATCTGTGTTAGTTGTGTGTTACTATCAGGAGGCCCCCTTTGGACCCAGTGGAT ACAGATTACGACTCTTCTTTTATGGTGTATGCAATGTCATTTCTATCACTTGTGCTTATACATCATTTTC AATAGTTCCTCCCAGCAATGGGACCACTATGTGGAGAGCCACAACTACAGTCTTCAGTGCCATTTTGGCT TTTTTACTCGTAGATGAGAAAATGGCTTATGTTGACATGGCTACAGTTGTTTGCAGCATCTTAGGTGTTT GTCTTGTCATGATCCCAAACATTGTTGATGAAGACAATTCTTTGTTAAATGCCTGGAAAGAAGCCTTTGG GTACACCATGACTGTGATGGCTGGACTGACCACTGCTCTCTCAATGATAGTATACAGATCCATCAAGGAG AAGATCAGCATGTGGACTGCACTGTTTACTTTTGGTTGGACTGGGACAATTTGGGGAATATCTACTATGT TTATTCTTCAAGAACCCATCATCCCATTAGATGGAGAAACCTGGAGTTATCTCATTGCTATATGTGTCTG
    [Show full text]
  • Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders
    177 Arch Neuropsychitry 2020;57:177−191 RESEARCH ARTICLE https://doi.org/10.29399/npa.24890 Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders Hakan GÜRKAN1 , Emine İkbal ATLI1 , Engin ATLI1 , Leyla BOZATLI2 , Mengühan ARAZ ALTAY2 , Sinem YALÇINTEPE1 , Yasemin ÖZEN1 , Damla EKER1 , Çisem AKURUT1 , Selma DEMİR1 , Işık GÖRKER2 1Faculty of Medicine, Department of Medical Genetics, Edirne, Trakya University, Edirne, Turkey 2Faculty of Medicine, Department of Child and Adolescent Psychiatry, Trakya University, Edirne, Turkey ABSTRACT Introduction: Aneuploids, copy number variations (CNVs), and single in 39 (39/123=31.7%) patients. Twelve CNV variant of unknown nucleotide variants in specific genes are the main genetic causes of significance (VUS) (9.75%) patients and 7 CNV benign (5.69%) patients developmental delay (DD) and intellectual disability disorder (IDD). were reported. In 6 patients, one or more pathogenic CNVs were These genetic changes can be detected using chromosome analysis, determined. Therefore, the diagnostic efficiency of CMA was found to chromosomal microarray (CMA), and next-generation DNA sequencing be 31.7% (39/123). techniques. Therefore; In this study, we aimed to investigate the Conclusion: Today, genetic analysis is still not part of the routine in the importance of CMA in determining the genomic etiology of unexplained evaluation of IDD patients who present to psychiatry clinics. A genetic DD and IDD in 123 patients. diagnosis from CMA can eliminate genetic question marks and thus Method: For 123 patients, chromosome analysis, DNA fragment analysis alter the clinical management of patients. Approximately one-third and microarray were performed. Conventional G-band karyotype of the positive CMA findings are clinically intervenable.
    [Show full text]