DOCSLIB.ORG

Centriolar Satellites Prevent Uncontrolled Degradation of Centrosome Proteins: a Speculative Review

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Centriolar Satellites Prevent Uncontrolled Degradation of Centrosome Proteins: a Speculative Review Viewpoint www.cell-stress.com Centriolar satellites prevent uncontrolled degradation of centrosome proteins: a speculative review Nicolas Lecland1 and Andreas Merdes1,* 1 Centre de Biologie du Développement, Université Paul Sabatier/CNRS, 31062 Toulouse, France. * Corresponding Author: Andreas Merdes, Centre de Biologie du Développement, Université Paul Sabatier/CNRS, 31062 Toulouse, France; E-mail: [email protected] ABSTRACT Centriolar satellites are small electron-dense structures in the cy- toplasm, mostly surrounding the pericentriolar material. Initially viewed as Received originally: 22.11.2017; shuttles for the transport of centrosomal proteins, they have been implicated in revised form: 16.01.2018, Accepted 22.01.2018. in the assembly of the pericentriolar material and in ciliogenesis. Although Published 24.01.2018. numerous proteins have been identified as components of centriolar satel- lites, their molecular function remains unclear. In this review article, we dis- cuss recent findings that characterize centriolar satellites as regulators of pro- Keywords: centriolar satellites, tein degradation pathways: by sequestering E3 ligase MIB1, deacetylase centrosome, ciliogenesis, protein HDAC6, and proteins of the autophagy pathway, centriolar satellites may reg- degradation, chaperone. ulate the turnover of centrosomal and ciliary components, protecting them from removal via proteasomal degradation, autophagy, and aggresomes. Abbreviations: BBS – Bardet-Biedl Syndrome, LIR – LC3-interacting region. INTRODUCTION ery of centrioles, but also near the basal bodies in ciliated Centrosomes are cytoplasmic structures that serve as pri- cells [4]. Satellite-like structures that don’t contain PCM-1 mary microtubule organizing centers in a large variety of have also been reported for various centrosome proteins, animal cells. They consist of a pair of cylindrically shaped visible by immunofluorescence as small cytoplasmic foci in centrioles, surrounded by pericentriolar material. Since the the neighborhood of the centrosome [5]. Because the mo- 1950s, an impressive amount of light and electron micro- lecular composition of centriolar satellites has been re- graphs have been published that document the structure viewed extensively in previous publications [6, 7, 8], this and molecular composition of centrosomes. Early on, sci- article focuses on satellites containing the marker protein entists noted the existence of small electron-dense gran- PCM-1, and on the potential molecular functions of PCM-1 ules in the cytoplasm surrounding the centrosome, within and its binding partners within these structures. a radius of several microns from the centriolar cylinders. Because of their size, structure, and localization, these CENTRIOLAR SATELLITES AS SHUTTLES FOR THE granules were occasionally named “satellites”, or “pericen- TRANSPORT OF CENTROSOMAL PROTEINS triolar dense bodies”, since the term “satellites” was also Early studies showed that PCM-1 satellites move along used to describe subdistal appendages of centrioles [1, 2]. microtubules, towards and away from centrioles [4]. It was The functional characterization of these granules was shown that the dynein/dynactin motor complex is involved fueled by the discovery of their first molecular marker, in the centripetal movement of the satellites, and that part PCM-1 (originally named after “pericentriolar material 1”). of the PCM-1 satellites co-localize with cytoplasmic foci of Immunofluorescence showed that PCM-1 localizes to the various centrosome proteins [4, 5, 9]. Since siRNA- pericentriolar material in interphase, and to small puncta mediated depletion of PCM-1 led to reduced accumulation in the surrounding cytoplasm [3]. In mitosis, the pericentri- of centrin, pericentrin, and ninein at the pericentriolar ma- olar accumulation of PCM-1 is temporarily lost. Immunoe- terial, PCM-1-containing satellites were viewed as shuttles lectron microscopy revealed that PCM-1-containing centri- that transport centrosome components from the cyto- olar satellites are non-membranous structures of 70 to plasm to the surface of the centrosome [5]. Other proteins 100 nm diameter that accumulate not only at the periph- whose centrosomal accumulation is facilitated by PCM-1 OPEN ACCESS | www.cell-stress.com 1 Cell Stress | in press N. Lecland and A. Merdes (2018) Centriolar satellites and protein degradation include gamma-tubulin, Nek2, and C-Nap1 [9, 10, 11]. CENTRIOLAR SATELLITES AND AUTOPHAGY However, the simple concept of PCM-1 satellites as shut- Indeed, data published in recent years suggest that PCM-1- tles for centrosomal protein transport falls short to explain containing centriolar satellites may be at the crossroad why only part of the cytoplasmic foci of centrosomal pro- between proteasomal and autophagic degradation path- teins co-localize with PCM-1 satellites, and why loss of ways. Proteomic analyses and localization studies revealed shuttle activity isn’t compensated by simple diffusion, since that PCM-1 forms a multiprotein complex with proteins such as centrin are 90% soluble in the cytoplasm Azi1/Cep131 and the E3 ubiquitin ligases MIB1 and WWP2, [12]. and associates with numerous other centrosomal proteins, often in a transient manner [6, 7, 8, 21, 22, 23]. Moreover, CENTRIOL SATELLITES AND CILIOGENESIS PCM-1 interacts with multiple proteins involved in autoph- Because PCM-1-containing satellites were seen highly en- agy, such as LC3, GATE16, and GABARAP [24]. The latter riched near basal bodies in ciliated cells, a role of PCM-1 in are proteins of the Atg8 family that recruit cargoes to au- ciliogenesis had been suspected [4]. Further research indi- tophagosomes for subsequent lysosomal degradation. One cated that PCM-1 satellites interact with proteins of the cargo that has been characterized in the context of ciliary BBSome, a complex of seven conserved proteins that are function is Ofd1, a negative regulator of ciliogenesis that encoded by susceptibility genes of the “Bardet-Biedl Syn- binds to the centrosome and to basal bodies [25]. To ena- drome” (BBS) and that are involved in membrane traffick- ble the formation of a new primary cilium, Ofd1 needs to ing to the primary cilium [13, 14]. Silencing of PCM-1 dislo- be eliminated. This is accomplished by an interaction of cated two interacting proteins, Cep72 and Cep290, from Ofd1 with PCM-1 at centriolar satellites, from where Ofd1 the satellites to the pericentriolar material, and various is degraded by the autophagosome-lysosome pathway [24, silencing experiments indicated that PCM-1, Cep72, and 26]. In this process, centriolar satellites may regulate Ofd1 Cep290 are needed for the targeting of the small GTPase removal by controlling the levels of Atg8 proteins, such as Rab8 and of BBS proteins to the primary cilium [15, 16]. GABARAP. This occurs in two ways: 1) GABARAP accumu- Finally, these experiments showed the need of intact cen- lates at the pericentriolar material, where its abundance is triolar satellites for efficient ciliogenesis. Although an in- limited by MIB1-dependent polyubiquitylation, followed by volvement of centriolar satellites in the transport and de- proteasomal degradation [27]. PCM-1-dependent seques- livery of ciliary components could not be excluded, the tration of MIB1 to satellites suppresses this polyubiquityla- molecular function of PCM-1 in this process remained un- tion [27], and may therefore help with fine-tuning the pro- clear. To shed light on this, we are reviewing a variety of tein levels of GABARAP. 2) At the same time, PCM-1 can observations that indicate less known mechanisms by bind to GABARAP and other proteins of the Atg8 family which satellites may regulate ciliogenesis and centrosomal (LC3, GATE16, and others) by an LIR (LC3-interacting re- function. gion) sequence motif near the PCM-1 carboxy-terminus. Several years ago, a novel perspective on the function With the help of the LIR motif, PCM-1 mediates both the of PCM-1 emerged from a phylogenetic analysis of centro- association of GABARAP with centriolar satellites, and its somal proteins in 45 organisms, representing a wide evolu- delivery to the pericentriolar material. The pool of pericen- tionary spread across the major groups of eukaryotes. A triolar GABARAP is in an equilibrium with GABARAP bound phylogenetic profile demonstrated a correlation between to satellites, and satellite-bound GABARAP is believed to be the evolution of ciliary photoreceptor cells in the eye and in an inactive state [27]. The presence of the LIR motif in the presence of BBSome components and of PCM-1 [17]. PCM-1 is directly responsible for the maintenance of regu- Photoreceptor cells in the eye of vertebrates contain light- lar GABARAP protein levels [27], suggesting that binding to sensitive outer segments that represent modified cilia, PCM-1 protects GABARAP. Upon serum starvation, satel- with stacked membrane disks involved in phototransduc- lites that contain PCM-1 and Atg8 proteins associate with tion. These photoreceptor cells are not renewed during early autophagosomes and transfer the ciliogenesis inhibi- lifetime, but internal protein turnover assures their viabil- tor Ofd1 together with the Atg8 protein into these orga- ity. This turnover involves autophagy and massive nelles (Figure 1). The autophagic removal of Ofd1 activates transport of outer‐segment material through the connect- ciliogenesis. PCM-1 is thus involved in the flux of compo- ing cilium [18]. Since autophagy protects photoreceptor nents and cargoes towards
Load more

Recommended publications
  • The Basal Bodies of Chlamydomonas Reinhardtii Susan K
    Dutcher and O’Toole Cilia (2016) 5:18 DOI 10.1186/s13630-016-0039-z Cilia REVIEW Open Access The basal bodies of Chlamydomonas reinhardtii Susan K. Dutcher1* and Eileen T. O’Toole2 Abstract The unicellular green alga, Chlamydomonas reinhardtii, is a biflagellated cell that can swim or glide. C. reinhardtii cells are amenable to genetic, biochemical, proteomic, and microscopic analysis of its basal bodies. The basal bodies contain triplet microtubules and a well-ordered transition zone. Both the mother and daughter basal bodies assemble flagella. Many of the proteins found in other basal body-containing organisms are present in the Chlamydomonas genome, and mutants in these genes affect the assembly of basal bodies. Electron microscopic analysis shows that basal body duplication is site-specific and this may be important for the proper duplication and spatial organization of these organelles. Chlamydomonas is an excellent model for the study of basal bodies as well as the transition zone. Keywords: Site-specific basal body duplication, Cartwheel, Transition zone, Centrin fibers Phylogeny and conservation of proteins Centrin, SPD2/CEP192, Asterless/CEP152; CEP70, The green lineage or Viridiplantae consists of the green delta-tubulin, and epsilon-tubulin. Chlamydomonas has algae, which include Chlamydomonas, the angiosperms homologs of all of these based on sequence conservation (the land plants), and the gymnosperms (conifers, cycads, except PLK4, CEP152, and CEP192. Several lines of evi- ginkgos). They are grouped together because they have dence suggests that CEP152, CEP192, and PLK4 interact chlorophyll a and b and lack phycobiliproteins. The green [20, 52] and their concomitant absence in several organ- algae together with the cycads and ginkgos have basal isms suggests that other mechanisms exist that allow for bodies and cilia, while the angiosperms and conifers have control of duplication [4].
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Information Proximity Interactions Among Centrosome
    Current Biology, Volume 24 Supplemental Information Proximity Interactions among Centrosome Components Identify Regulators of Centriole Duplication Elif Nur Firat-Karalar, Navin Rauniyar, John R. Yates III, and Tim Stearns Figure S1 A Myc Streptavidin -tubulin Merge Myc Streptavidin -tubulin Merge BirA*-PLK4 BirA*-CEP63 BirA*- CEP192 BirA*- CEP152 - BirA*-CCDC67 BirA* CEP152 CPAP BirA*- B C Streptavidin PCM1 Merge Myc-BirA* -CEP63 PCM1 -tubulin Merge BirA*- CEP63 DMSO - BirA* CEP63 nocodazole BirA*- CCDC67 Figure S2 A GFP – + – + GFP-CEP152 + – + – Myc-CDK5RAP2 + + + + (225 kDa) Myc-CDK5RAP2 (216 kDa) GFP-CEP152 (27 kDa) GFP Input (5%) IP: GFP B GFP-CEP152 truncation proteins Inputs (5%) IP: GFP kDa 1-7481-10441-1290218-1654749-16541045-16541-7481-10441-1290218-1654749-16541045-1654 250- Myc-CDK5RAP2 150- 150- 100- 75- GFP-CEP152 Figure S3 A B CEP63 – – + – – + GFP CCDC14 KIAA0753 Centrosome + – – + – – GFP-CCDC14 CEP152 binding binding binding targeting – + – – + – GFP-KIAA0753 GFP-KIAA0753 (140 kDa) 1-496 N M C 150- 100- GFP-CCDC14 (115 kDa) 1-424 N M – 136-496 M C – 50- CEP63 (63 kDa) 1-135 N – 37- GFP (27 kDa) 136-424 M – kDa 425-496 C – – Inputs (2%) IP: GFP C GFP-CEP63 truncation proteins D GFP-CEP63 truncation proteins Inputs (5%) IP: GFP Inputs (5%) IP: GFP kDa kDa 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl Myc- 150- Myc- 100- CCDC14 KIAA0753 100- 100- 75- 75- GFP- GFP- 50- CEP63 50- CEP63 37- 37- Figure S4 A siCtl
    [Show full text]
  • The P53/P73 - P21cip1 Tumor Suppressor Axis Guards Against Chromosomal Instability by Restraining CDK1 in Human Cancer Cells
    Oncogene (2021) 40:436–451 https://doi.org/10.1038/s41388-020-01524-4 ARTICLE The p53/p73 - p21CIP1 tumor suppressor axis guards against chromosomal instability by restraining CDK1 in human cancer cells 1 1 2 1 2 Ann-Kathrin Schmidt ● Karoline Pudelko ● Jan-Eric Boekenkamp ● Katharina Berger ● Maik Kschischo ● Holger Bastians 1 Received: 2 July 2020 / Revised: 2 October 2020 / Accepted: 13 October 2020 / Published online: 9 November 2020 © The Author(s) 2020. This article is published with open access Abstract Whole chromosome instability (W-CIN) is a hallmark of human cancer and contributes to the evolvement of aneuploidy. W-CIN can be induced by abnormally increased microtubule plus end assembly rates during mitosis leading to the generation of lagging chromosomes during anaphase as a major form of mitotic errors in human cancer cells. Here, we show that loss of the tumor suppressor genes TP53 and TP73 can trigger increased mitotic microtubule assembly rates, lagging chromosomes, and W-CIN. CDKN1A, encoding for the CDK inhibitor p21CIP1, represents a critical target gene of p53/p73. Loss of p21CIP1 unleashes CDK1 activity which causes W-CIN in otherwise chromosomally stable cancer cells. fi Vice versa 1234567890();,: 1234567890();,: Consequently, induction of CDK1 is suf cient to induce abnormal microtubule assembly rates and W-CIN. , partial inhibition of CDK1 activity in chromosomally unstable cancer cells corrects abnormal microtubule behavior and suppresses W-CIN. Thus, our study shows that the p53/p73 - p21CIP1 tumor suppressor axis, whose loss is associated with W-CIN in human cancer, safeguards against chromosome missegregation and aneuploidy by preventing abnormally increased CDK1 activity.
    [Show full text]
  • Cep57, a NEDD1-Binding Pericentriolar Material Component, Is Essential for Spindle Pole Integrity
    Cell Research (2012) :1-12. © 2012 IBCB, SIBS, CAS All rights reserved 1001-0602/12 $ 32.00 npg ORIGINAL ARTICLE www.nature.com/cr Cep57, a NEDD1-binding pericentriolar material component, is essential for spindle pole integrity Qixi Wu1, *, Runsheng He1, *, Haining Zhou1, Albert CH Yu2, Bo Zhang1, Junlin Teng1, Jianguo Chen1, 3 1The State Key Laboratory of Biomembrane and Membrane Bioengineering and The Key Laboratory of Cell Proliferation and Dif- ferentiation of Ministry of Education, College of Life Sciences, Peking University, Beijing 100871, China; 2Department of Neurobi- ology, Neuroscience Research Institute, School of Basic Medical Sciences, Peking University, Beijing 100191, China; 3The Center for Theoretical Biology, Peking University, Beijing 100871, China Formation of a bipolar spindle is indispensable for faithful chromosome segregation and cell division. Spindle in- tegrity is largely dependent on the centrosome and the microtubule network. Centrosome protein Cep57 can bundle microtubules in mammalian cells. Its related protein (Cep57R) in Xenopus was characterized as a stabilization factor for microtubule-kinetochore attachment. Here we show that Cep57 is a pericentriolar material (PCM) component. Its interaction with NEDD1 is necessary for the centrosome localization of Cep57. Depletion of Cep57 leads to unaligned chromosomes and a multipolar spindle, which is induced by PCM fragmentation. In the absence of Cep57, cen- trosome microtubule array assembly activity is weakened, and the spindle length and microtubule density decrease. As a spindle microtubule-binding protein, Cep57 is also responsible for the proper organization of the spindle micro- tubule and localization of spindle pole focusing proteins. Collectively, these results suggest that Cep57, as a NEDD1- binding centrosome component, could function as a spindle pole- and microtubule-stabilizing factor for establishing robust spindle architecture.
    [Show full text]
  • Is Cep70, a Centrosomal Protein with New Roles in Breast Cancer Dissemination and Metastasis, a Facilitator of Epithelial-Mesenchymal Transition?
    Is Cep70, a centrosomal protein with new roles in breast cancer dissemination and metastasis, a facilitator of epithelial-mesenchymal transition? Pedro A. Lazo 1,2 1 Experimental Therapeutics and Translational Oncology Program, Instituto de Biología Molecular y Celular del Cáncer, Consejo Superior de Investigaciones Científicas (CSIC), Universidad de Salamanca, Salamanca, Spain 2 Instituto de Investigación Biomédica de Salamanca (IBSAL), Hospital Universitario de Salamanca, Salamanca, Spain Running title: Cep70 and EMT Disclosures: None declared. Contact address: [email protected] 1 Introduction Microtubules are driving mechanisms of chromosomes, intracellular organelle movement, and cell shape and motility. Microtubules are organized on centrosomes, which are assembled in microtubule-organizing centers (MTOC). In mitosis there is no nuclear envelope and centromeres associated to microtubules are mainly involved in chromosome redistribution into daughter cells. In differentiated cells the microtubule- organizing centers are dispersed in the cytoplasm (non centrosomal (ncMTOC)) and interact with the minus end of microtubules through γ-tubulin. 1 However, it is not known if the microtubule contribution to tumor biology is only by facilitating tumor aneuploidy. During tumor dissemination, a process not linked to cell division, important changes take place in cell shape and motility. Microtubules are very dynamic because of their inherent structural instability, and this plasticity facilitates their reorganization during the epithelial-mesenchymal
    [Show full text]
  • Integrated Analysis of the Critical Region 5P15.3–P15.2 Associated with Cri-Du-Chat Syndrome
    Genetics and Molecular Biology, 42, 1(suppl), 186-196 (2019) Copyright © 2019, Sociedade Brasileira de Genética. Printed in Brazil DOI: http://dx.doi.org/10.1590/1678-4685-GMB-2018-0173 Research Article Integrated analysis of the critical region 5p15.3–p15.2 associated with cri-du-chat syndrome Thiago Corrêa1, Bruno César Feltes2 and Mariluce Riegel1,3* 1Post-Graduate Program in Genetics and Molecular Biology, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil. 2Institute of Informatics, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil. 3Medical Genetics Service, Hospital de Clínicas de Porto Alegre, Porto Alegre, RS, Brazil. Abstract Cri-du-chat syndrome (CdCs) is one of the most common contiguous gene syndromes, with an incidence of 1:15,000 to 1:50,000 live births. To better understand the etiology of CdCs at the molecular level, we investigated theprotein–protein interaction (PPI) network within the critical chromosomal region 5p15.3–p15.2 associated with CdCs using systemsbiology. Data were extracted from cytogenomic findings from patients with CdCs. Based on clin- ical findings, molecular characterization of chromosomal rearrangements, and systems biology data, we explored possible genotype–phenotype correlations involving biological processes connected with CdCs candidate genes. We identified biological processes involving genes previously found to be associated with CdCs, such as TERT, SLC6A3, and CTDNND2, as well as novel candidate proteins with potential contributions to CdCs phenotypes, in- cluding CCT5, TPPP, MED10, ADCY2, MTRR, CEP72, NDUFS6, and MRPL36. Although further functional analy- ses of these proteins are required, we identified candidate proteins for the development of new multi-target genetic editing tools to study CdCs.
    [Show full text]
  • Microtubule Regulation in Cystic Fibrosis Pathophysiology
    MICROTUBULE REGULATION IN CYSTIC FIBROSIS PATHOPHYSIOLOGY By: SHARON MARIE RYMUT Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Dissertation Advisor: Dr. Thomas J Kelley Department of Pharmacology CASE WESTERN RESERVE UNIVERSITY August 2015 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/ dissertation of Sharon Marie Rymut candidate for the Doctor of Philosophy degree* Dissertation Advisor: Thomas J Kelley Committee Chair: Paul N MacDonald Committee Member: Ruth E Siegel Committee Member: Craig A Hodges Committee Member: Danny Manor Committee Member: Rebecca J Darrah Date of Defense: April 29, 2015 * We also certify that written approval has been obtained for any proprietary material contained therein. ii Dedication There are five chapters in this dissertation. To Mom, Dad, Joe, Marie and Susan, I dedicate one chapter to each of you. You can fight about which chapter you want later. iii Table of Contents Table of Contents................................................................................................................iv List of Tables .................................................................................................................... vii List of Figures .................................................................................................................. viii Acknowledgements ............................................................................................................. x List of Abbreviations .......................................................................................................
    [Show full text]
  • The Transformation of the Centrosome Into the Basal Body: Similarities and Dissimilarities Between Somatic and Male Germ Cells and Their Relevance for Male Fertility
    cells Review The Transformation of the Centrosome into the Basal Body: Similarities and Dissimilarities between Somatic and Male Germ Cells and Their Relevance for Male Fertility Constanza Tapia Contreras and Sigrid Hoyer-Fender * Göttingen Center of Molecular Biosciences, Johann-Friedrich-Blumenbach Institute for Zoology and Anthropology-Developmental Biology, Faculty of Biology and Psychology, Georg-August University of Göttingen, 37077 Göttingen, Germany; [email protected] * Correspondence: [email protected] Abstract: The sperm flagellum is essential for the transport of the genetic material toward the oocyte and thus the transmission of the genetic information to the next generation. During the haploid phase of spermatogenesis, i.e., spermiogenesis, a morphological and molecular restructuring of the male germ cell, the round spermatid, takes place that includes the silencing and compaction of the nucleus, the formation of the acrosomal vesicle from the Golgi apparatus, the formation of the sperm tail, and, finally, the shedding of excessive cytoplasm. Sperm tail formation starts in the round spermatid stage when the pair of centrioles moves toward the posterior pole of the nucleus. The sperm tail, eventually, becomes located opposed to the acrosomal vesicle, which develops at the anterior pole of the nucleus. The centriole pair tightly attaches to the nucleus, forming a nuclear membrane indentation. An Citation: Tapia Contreras, C.; articular structure is formed around the centriole pair known as the connecting piece, situated in the Hoyer-Fender, S. The Transformation neck region and linking the sperm head to the tail, also named the head-to-tail coupling apparatus or, of the Centrosome into the Basal in short, HTCA.
    [Show full text]
  • Suppl. Table 1
    Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA
    [Show full text]
  • Anti-CEP72 Antibody
    D224513 Anti-CEP72 antibody Cat. No. D224513 Package 25 μl/100 μl/200 μl Storage -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Product overview Description A n ti-CEP72rabbit polyclonal antibody Applications ELISA, WB, IHC Immunogen Fusion protein of human CEP72 Reactivity Human, Mouse Content 0 .4 mg/ml Host species Rabbit Ig class Immunogen-specific rabbit IgG Purification Antigen affinity purification Target information Symbol CEP72 Full name centrosomal protein 72 Synonyms Swissprot Q9P209 Target Background Centrosomes are the major microtubule-organizing centers of mammalian cells. They are composed of a centriole pair and surrounding microtubule-nucleating material termed pericentriolar material (PCM). Bipolar mitotic spindle assembly relies on two intertwined processes: centriole duplication and centrosome maturation. Failure to properly orchestrate centrosome duplication and maturation is subsequently linked to spindle defects, which can result in aneuploidy and promote cancer progression. CEP72 (centrosomal protein 72kDa) is a 647 amino acid protein that localizes to the centrosome and centrosome-surrounding particles throughout the cell cycle. Involved in the recruitment of key centrosomal proteins to the centrosome, CEP72 provides centrosomal microtubule-nucleation activity on the © Tubulin ring complexes and has critical roles in forming a focused bipolar spindle, which is needed for proper tension generation between sister chrSomatids.angon CEP72 exists as two alternatively s plicBied isoformso. tech Applications Immunohistochemistry Predicted cell location: Cytoplasm Predicted cell location: Cytoplasm Positive control: Human esophagus cancer Positive control: Human liver cancer Recommended dilution: 30-150 Recommended dilution: 30-150 The image on the left is immunohistochemistry of paraffin-embedded The image on the left is immunohistochemistry of paraffin-embedded Human esophagus cancer tissue using D224513(CEP72 Antibody) Human liver cancer tissue using D224513(CEP72 Antibody) at at dilution 1/40, on the right is treated with fusion protein.
    [Show full text]
  • Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus
    LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary cul- ture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all condi- tions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127 IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem.
    [Show full text]