DOCSLIB.ORG

Supplementary File 1. Identity-‐By-‐Descent Allele

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary File 1. Identity-‐By-‐Descent Allele Supplementary File 1. Identity-by-descent allele-sharing analysis of 12q23 region in families with HELLP: microsatellite markers Legends Identity-by-descent (IBD) allele-sharing analysis in families with HELLP was performed with 26 microsatellite markers covering the 23.6 Mb region on 12q23 between D12S309 and D12S395. Non-parametric multipoint linkage (Allegro 2) complemented by pedigree analysis was performed in 7 HELLP families with affected sisters (families 1-7), 4 families with affected cousins (families 8-11) and 1 family with discordant monozygotic twin sisters (family 12). A total of 57 individuals with 36 affected females was analyzed. Supplementary File 1A: Multipoint linkage analysis using Smnallele indicates the 4 marker region between PAH and D12S1647 with LOD and NPL scores >3 (box). Supplementary files 1B-D: Pedigree analysis indicates the same region with the presence of two minimal critial regions (I: D12S1607-PAH, II: D12S338-D123S317) in affected sister-pairs (1B), affected cousin pairs (1C) and discordant monozytic twin sisters (1D). Note the informative situation in family 11 (HELLP_93113) (1C) where two sisters from one family married two brothers from an unrelated family. In the affected cousins (93113/89, 93113/90) born from these couples, both alleles need to be shared in the region with linkage, as if these cousins were sisters. In the affected cousins (93113/89, 93113/90), both regions are supported. In their affected mothers (93113/12, 93113/8), maximal allele sharing is limited to the first region near D12S1030. Supplementary File 1A: Multipoint linkage analysis of families with HELLP Locationa LODb Dhatc NPLd Zlre Nplexactpf Infog Markerh 0.000 1.5181 1.0073 2.2686 2.6440 0.011835 0.7366 D12S1030 1.310 3.1605 1.9446 3.1727 3.8150 6.33e-04 0.6797 PAH 2.370 3.0472 1.7177 3.1866 3.7461 6.32e-04 0.7353 D12S360 3.510 3.1617 1.7433 3.2279 3.8158 5.99e-04 0.7518 D12S338 5.230 3.1711 2.1601 3.0243 3.8215 0.001445 0.6280 D12S1647 6.370 2.7642 1.9023 2.8938 3.5679 0.001939 0.6059 D12S317 8.090 2.5003 1.4707 2.8614 3.3933 0.002271 0.7158 D12S1597 8.100 2.4982 1.4677 2.8610 3.3919 0.002271 0.7170 D12S1683 8.650 2.6017 1.6258 2.8584 3.4614 0.002389 0.6648 D12S1605 Abbreviations: a. Relative location in cM, b. Allele sharing logarithm of the odds score, c. Maximum likelihood estimator of δ (difference), d. Non-parametric linkage score, e. Zlr: normalized likelihood ratio statistic for linkage, f. p value for NPL, g. Informativity (maximum 1.0), h. Microsatellite marker. For clarity, only the outcome for 9 of the 26 markers is shown. Supplementary File 1B: Affected sister-pairs 1 2 3 4 5 6 7 HELLP_8503 HELLP_9265 HELLP_9401 HELLP_9508 HELLP_9515 HELLP_9536 HELLP_94104 8 9 8 9 8 9 8 9 8 9 8 9 8 9 # Marker Position PIH PIH PIH PIH 1 D12S309 94989229 136 144 140 146 146 146 136 146 136 136 136 136 136 148 2 D12S1716 95469203 201 205 207 209 203 205 205 205 203 207 205 207 203 203 3 D12S1300 97025042 119 123 119 127 123 119 119 119 123 119 119 119 119 119 119 119 123 119 119 123 127 123 123 119 4 D12S1063 97223531 211 215 219 220 207 211 215 220 220 220 207 219 5 D12S306 99116489 198 222 218 224 218 224 214 222 204 218 6 D12S1041 99982385 140 149 146 149 140 149 140 146 140 140 140 149 7 D12S1727 100225071 173 179 173 175 171 173 171 173 8 D12S1607 100782813 137 151 137 155 151 153 155 155 137 155 151 155 151 151 9 D12S1030 101448930 251 251 251 255 255 271 251 255 251 255 247 255 10 PAH 101789858 245 241 233 253 233 245 253 241 245 233 237 229 233 245 245 241 237 245 257 241 11 D12S360 102603188 213 213 217 213 211 219 213 213 217 213 213 213 217 213 217 213 213 227 221 12 D12S338 103065489 261 265 265 267 261 265 267 265 265 265 265 265 267 265 265 265 261 267 265 275 261 267 13 D12S1647 103613187 193 193 191 191 191 193 187 191 191 189 191 195 193 191 193 191 193 187 191 191 191 14 D12S317 104120682 268 250 252 252 252 252 252 250 270 250 268 250 250 268 252 250 252 15 D12S1597 104275626 221 207 205 215 217 207 223 221 221 223 205 201 215 205 221 207 205 207 205 209 215 217 16 D12S1683 104709609 230 234 234 230 230 230 230 230 242 234 230 230 228 230 242 234 230 234 230 248 17 D12S1605 107227970 201 201 203 197 201 197 201 201 201 203 201 197 199 201 201 201 203 201 18 D12S84 107546196 199 215 213 215 213 219 199 201 19 D12S105 107799269 143 147 143 143 145 143 151 145 143 137 143 143 145 136 145 143 143 147 151 143 143 20 D12S1583 108309051 239 247 225 221 225 239 225 221 243 223 221 225 237 225 235 225 225 221 221 21 D12S1344 110809745 235 235 235 241 239 227 235 239 235 229 239 235 235 235 239 235 241 22 D12S1616 111778551 219 217 215 215 217 219 215 215 219 219 215 217 219 215 215 217 23 D12S354 113611973 197 187 187 191 199 187 197 191 191 187 187 197 187 187 191 197 24 D12S1665 114557056 225 227 225 225 225 225 225 225 225 25 D12S366 117056989 187 195 189 195 189 189 187 193 26 D12S395 118672843 240 240 224 236 240 240 244 228 240 236 240 240 224 236 248 248 240 240 236 0 1 0 1 0 1 0 2 0 1 0 1 0 1 HELLP HELLP HELLP PE + HELLP HELLP HELLP HELLP HELLP HELLP HELLP HELLP PE + HELLP HELLP HELLP + E # Marker Position 75 76 79 80 81 82 83 84 85 86 87 88 94 95 1 D12S309 94989229 136 144 136 144 140 146 140 146 146 146 146 146 136 146 136 146 136 136 136 136 136 136 136 136 136 148 136 148 2 D12S1716 95469203 201 205 201 205 207 209 207 209 203 205 203 205 205 205 205 205 203 203 203 207 205 207 205 207 203 203 203 203 3 D12S1300 97025042 119 119 119 119 127 119 127 119 119 119 119 119 119 119 119 119 119 119 119 123 119 123 119 123 127 119 127 119 4 D12S1063 97223531 211 215 211 215 219 220 219 220 207 211 207 211 215 220 215 220 220 207 220 215 220 220 220 220 207 219 207 219 5 D12S306 99116489 198 222 198 222 218 224 218 224 218 224 218 224 214 222 214 222 214 220 214 204 218 216 224 218 204 218 204 218 6 D12S1041 99982385 140 149 140 149 146 149 146 149 140 149 140 149 140 146 140 146 149 149 149 140 140 140 140 140 140 149 140 149 7 D12S1727 100225071 173 179 173 179 173 175 173 175 171 173 171 173 171 173 171 171 179 167 179 173 175 175 171 171 171 173 171 173 8 D12S1607 100782813 137 151 137 151 137 155 137 155 151 153 151 153 155 155 155 155 137 155 137 155 151 155 151 151 151 151 151 151 9 D12S1030 101448930 251 251 251 251 251 255 251 255 255 271 255 271 251 255 251 255 251 255 251 255 247 255 247 255 247 247 251 251 10 PAH 101807288 245 233 245 233 253 253 253 253 241 245 241 245 233 237 233 237 229 245 229 245 245 245 245 241 237 241 237 241 11 D12S360 102603188 213 217 213 217 213 213 213 213 213 213 213 213 213 217 213 217 213 217 213 217 213 219 213 213 213 221 213 221 12 D12S338 103065489 261 265 261 265 267 267 267 267 265 265 265 265 265 267 265 267 265 265 265 265 261 267 261 267 265 267 265 267 13 D12S1647 103613187 193 191 193 191 191 187 191 187 191 189 191 189 191 193 191 193 191 193 191 193 191 193 191 193 187 191 187 191 14 D12S317 104120682 268 252 268 252 252 252 252 252 250 270 250 270 250 268 250 268 250 250 250 250 276 250 276 252 268 252 268 252 15 D12S1597 104275626 221 205 221 205 215 223 215 223 221 223 221 223 205 215 205 215 205 207 205 207 205 205 205 207 205 217 205 217 16 D12S1683 104709609 230 234 230 234 230 230 230 230 230 234 230 234 230 228 230 228 230 234 230 234 242 230 242 234 230 248 234 248 17 D12S1605 107227970 201 203 201 203 197 197 197 197 201 201 201 201 203 197 203 197 199 201 199 201 201 199 201 201 201 201 201 201 18 D12S84 107546196 199 215 199 215 213 215 213 215 213 219 213 219 199 201 199 201 199 215 199 205 201 219 201 217 19 D12S105 107799269 143 143 143 143 143 151 143 151 145 137 145 137 143 143 145 136 145 136 145 143 143 143 143 151 143 147 143 20 D12S1583 108309051 239 225 239 225 221 225 221 225 221 223 221 223 221 237 221 237 225 235 225 235 225 225 225 231 225 221 225 221 21 D12S1344 110809745 235 235 235 235 235 227 235 227 235 239 235 239 235 239 235 239 235 235 235 235 235 241 235 235 235 241 239 241 22 D12S1616 111778551 219 215 219 215 215 215 215 215 215 219 215 219 219 217 219 217 219 215 219 215 217 217 217 215 217 215 217 217 23 D12S354 113611973 197 187 187 187 191 197 191 197 191 187 191 187 187 197 187 197 187 187 187 187 191 187 197 187 197 191 197 195 24 D12S1665 114557056 225 225 225 225 225 225 225 225 227 225 225 225 225 225 225 223 227 225 233 221 233 225 25 D12S366 117056989 191 195 187 195 187 195 189 195 189 195 193 195 189 189 189 189 193 189 193 191 187 193 187 193 26 D12S395 118672843 240 224 240 224 236 244 236 244 228 236 240 224 236 248 236 248 240 244 240 240 248 236 Supplementary File 1C: Affected cousin-pairs 8 9 10 11 HELLP_9147 HELLP_93130 HELLP_94126 HELLP_93113 8 9 12 13 12 13 8 9 8 9 12 13 14 15 12 8 9 13 / # Marker Position PIH PIH PIH PE PIH PIH PIH + IUGR 1 D12S309 94989229 146 146 136 136 136 146 146 146 140 140 140 136 2 D12S1716 95469203 203 203 207 209 207 205 203 205 205 205 207 205 3 D12S1300 97025042 119 127 119 127 123 119 119 123 123 127 119 119 4 D12S1063 97223531 224 211 207 207 211 207 207 211 211 207 5 D12S306 99116489 218 204 216 218 222 224 6 D12S1041 99982385 146 155 143 149 140 149 146 146 146 149 7 D12S1727 100225071 171 173 173 171 179 171 171 173 179 171 8 D12S1607 100782813 137 155 155 137 151 151 137 137 137 137 137 137 139 139 137 137 161 137 151 137 139 151 151 139 151 139 151 151 151 155 9 D12S1030 101448930 251 251 255 255 259 259 255 255 251 251 251 251 247 251 251 10 PAH 101789858 245 245 245 245 241 241 245 245 245 237 241 245 11 D12S360 102603188 213 217 209 213 213 217 213 213 213 213 219 213 221 213 213 209 213 213 215 213 213 217 213 217 213 217 213 215 213 221 12 D12S338
Load more

Recommended publications
  • The Basal Bodies of Chlamydomonas Reinhardtii Susan K
    Dutcher and O’Toole Cilia (2016) 5:18 DOI 10.1186/s13630-016-0039-z Cilia REVIEW Open Access The basal bodies of Chlamydomonas reinhardtii Susan K. Dutcher1* and Eileen T. O’Toole2 Abstract The unicellular green alga, Chlamydomonas reinhardtii, is a biflagellated cell that can swim or glide. C. reinhardtii cells are amenable to genetic, biochemical, proteomic, and microscopic analysis of its basal bodies. The basal bodies contain triplet microtubules and a well-ordered transition zone. Both the mother and daughter basal bodies assemble flagella. Many of the proteins found in other basal body-containing organisms are present in the Chlamydomonas genome, and mutants in these genes affect the assembly of basal bodies. Electron microscopic analysis shows that basal body duplication is site-specific and this may be important for the proper duplication and spatial organization of these organelles. Chlamydomonas is an excellent model for the study of basal bodies as well as the transition zone. Keywords: Site-specific basal body duplication, Cartwheel, Transition zone, Centrin fibers Phylogeny and conservation of proteins Centrin, SPD2/CEP192, Asterless/CEP152; CEP70, The green lineage or Viridiplantae consists of the green delta-tubulin, and epsilon-tubulin. Chlamydomonas has algae, which include Chlamydomonas, the angiosperms homologs of all of these based on sequence conservation (the land plants), and the gymnosperms (conifers, cycads, except PLK4, CEP152, and CEP192. Several lines of evi- ginkgos). They are grouped together because they have dence suggests that CEP152, CEP192, and PLK4 interact chlorophyll a and b and lack phycobiliproteins. The green [20, 52] and their concomitant absence in several organ- algae together with the cycads and ginkgos have basal isms suggests that other mechanisms exist that allow for bodies and cilia, while the angiosperms and conifers have control of duplication [4].
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Information Proximity Interactions Among Centrosome
    Current Biology, Volume 24 Supplemental Information Proximity Interactions among Centrosome Components Identify Regulators of Centriole Duplication Elif Nur Firat-Karalar, Navin Rauniyar, John R. Yates III, and Tim Stearns Figure S1 A Myc Streptavidin -tubulin Merge Myc Streptavidin -tubulin Merge BirA*-PLK4 BirA*-CEP63 BirA*- CEP192 BirA*- CEP152 - BirA*-CCDC67 BirA* CEP152 CPAP BirA*- B C Streptavidin PCM1 Merge Myc-BirA* -CEP63 PCM1 -tubulin Merge BirA*- CEP63 DMSO - BirA* CEP63 nocodazole BirA*- CCDC67 Figure S2 A GFP – + – + GFP-CEP152 + – + – Myc-CDK5RAP2 + + + + (225 kDa) Myc-CDK5RAP2 (216 kDa) GFP-CEP152 (27 kDa) GFP Input (5%) IP: GFP B GFP-CEP152 truncation proteins Inputs (5%) IP: GFP kDa 1-7481-10441-1290218-1654749-16541045-16541-7481-10441-1290218-1654749-16541045-1654 250- Myc-CDK5RAP2 150- 150- 100- 75- GFP-CEP152 Figure S3 A B CEP63 – – + – – + GFP CCDC14 KIAA0753 Centrosome + – – + – – GFP-CCDC14 CEP152 binding binding binding targeting – + – – + – GFP-KIAA0753 GFP-KIAA0753 (140 kDa) 1-496 N M C 150- 100- GFP-CCDC14 (115 kDa) 1-424 N M – 136-496 M C – 50- CEP63 (63 kDa) 1-135 N – 37- GFP (27 kDa) 136-424 M – kDa 425-496 C – – Inputs (2%) IP: GFP C GFP-CEP63 truncation proteins D GFP-CEP63 truncation proteins Inputs (5%) IP: GFP Inputs (5%) IP: GFP kDa kDa 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl Myc- 150- Myc- 100- CCDC14 KIAA0753 100- 100- 75- 75- GFP- GFP- 50- CEP63 50- CEP63 37- 37- Figure S4 A siCtl
    [Show full text]
  • Downloaded from Bioscientifica.Com at 10/04/2021 03:09:50PM Via Free Access
    242 S-M Ho et al. Regulation of centrosome 24:2 83–96 Research duplication by BPA analogues Bisphenol A and its analogues disrupt centrosome cycle and microtubule dynamics in prostate cancer Shuk-Mei Ho1,2,3,4, Rahul Rao1, Sarah To1,5,6, Emma Schoch1 and Pheruza Tarapore1,2,3 1Department of Environmental Health, University of Cincinnati Medical Center, Cincinnati, Ohio, USA 2Center for Environmental Genetics, University of Cincinnati Medical Center, Cincinnati, Ohio, USA Correspondence 3Cincinnati Cancer Center, Cincinnati, Ohio, USA should be addressed 4Cincinnati Veteran Affairs Hospital Medical Center, Cincinnati, Ohio, USA to S-M Ho or P Tarapore 5Center for Cancer Research, Hudson Institute of Medical Research, Clayton, Victoria, Australia Email 6Monash University, Clayton, Victoria, Australia [email protected] or [email protected] Abstract Humans are increasingly exposed to structural analogues of bisphenol A (BPA), as Key Words BPA is being replaced by these compounds in BPA-free consumer products. We have f endocrine-disrupting previously shown that chronic and developmental exposure to BPA is associated with chemicals increased prostate cancer (PCa) risk in human and animal models. Here, we examine f bisphenol A analogues whether exposure of PCa cells (LNCaP, C4-2) to low-dose BPA and its structural analogues f BPA (BPS, BPF, BPAF, TBBPA, DMBPA and TMBPA) affects centrosome amplification (CA), f BPS a hallmark of cancer initiation and progression. We found that exposure to BPA, BPS, f BPF DMBPA and TBBPA, in descending order, increased the number of cells with CA, in a non- f TBBPA Endocrine-Related Cancer Endocrine-Related monotonic dose–response manner.
    [Show full text]
  • PP2A-B′ Holoenzyme Substrate Recognition, Regulation and Role in Cytokinesis
    OPEN Citation: Cell Discovery (2017) 3, 17027; doi:10.1038/celldisc.2017.27 ARTICLE www.nature.com/celldisc PP2A-B′ holoenzyme substrate recognition, regulation and role in cytokinesis Cheng-Guo Wu1,2,8, Hui Chen1,8, Feng Guo1,8,9, Vikash K Yadav3,8, Sean J Mcilwain4, Michael Rowse1, Alka Choudhary5, Ziqing Lin6, Yitong Li1, Tingjia Gu1, Aiping Zheng1,10, Qingge Xu6, Woojong Lee1, Eduard Resch7, Benjamin Johnson1, Jenny Day1, Ying Ge6, Irene M Ong4, Mark E Burkard5, Ylva Ivarsson3,*, Yongna Xing1,2,* 1McArdle Laboratory for Cancer Research, Department of Oncology, University of Wisconsin at Madison, School of Medicine and Public Health, Madison, WI, USA; 2Biophysics Program, University of Wisconsin at Madison, Madison, WI, USA; 3Department of Chemistry—BMC, Uppsala University, Uppsala, Sweden; 4Biostatistics and Medical Informatics, Wisconsin Institutes of Medical Research, University of Wisconsin at Madison, School of Medicine and Public Health, Madison, WI, USA; 5Department of Medicine, Hematology/Oncology, UW Carbone Cancer Center, University of Wisconsin at Madison, School of Medicine and Public Health, Madison, WI, USA; 6Department of Cell and Regenerative Biology, Human Proteomic Program, School of Medicine and Public Health, Madison, WI, USA; 7Fraunhofer Institute for Molecular Biology and Applied Ecology IME, Project Group Translational Medicine and Pharmacology TMP, Frankfurt am Main, Germany Protein phosphatase 2A (PP2A) is a major Ser/Thr phosphatase; it forms diverse heterotrimeric holoenzymes that counteract kinase actions. Using a peptidome that tiles the disordered regions of the human proteome, we identified proteins containing [LMFI]xx[ILV]xEx motifs that serve as interaction sites for B′-family PP2A regulatory subunits and holoenzymes.
    [Show full text]
  • Is Cep70, a Centrosomal Protein with New Roles in Breast Cancer Dissemination and Metastasis, a Facilitator of Epithelial-Mesenchymal Transition?
    Is Cep70, a centrosomal protein with new roles in breast cancer dissemination and metastasis, a facilitator of epithelial-mesenchymal transition? Pedro A. Lazo 1,2 1 Experimental Therapeutics and Translational Oncology Program, Instituto de Biología Molecular y Celular del Cáncer, Consejo Superior de Investigaciones Científicas (CSIC), Universidad de Salamanca, Salamanca, Spain 2 Instituto de Investigación Biomédica de Salamanca (IBSAL), Hospital Universitario de Salamanca, Salamanca, Spain Running title: Cep70 and EMT Disclosures: None declared. Contact address: [email protected] 1 Introduction Microtubules are driving mechanisms of chromosomes, intracellular organelle movement, and cell shape and motility. Microtubules are organized on centrosomes, which are assembled in microtubule-organizing centers (MTOC). In mitosis there is no nuclear envelope and centromeres associated to microtubules are mainly involved in chromosome redistribution into daughter cells. In differentiated cells the microtubule- organizing centers are dispersed in the cytoplasm (non centrosomal (ncMTOC)) and interact with the minus end of microtubules through γ-tubulin. 1 However, it is not known if the microtubule contribution to tumor biology is only by facilitating tumor aneuploidy. During tumor dissemination, a process not linked to cell division, important changes take place in cell shape and motility. Microtubules are very dynamic because of their inherent structural instability, and this plasticity facilitates their reorganization during the epithelial-mesenchymal
    [Show full text]
  • Integrative Clinical Sequencing in the Management of Refractory Or
    Supplementary Online Content Mody RJ, Wu Y-M, Lonigro RJ, et al. Integrative Clinical Sequencing in the Management of Children and Young Adults With Refractory or Relapsed CancerJAMA. doi:10.1001/jama.2015.10080. eAppendix. Supplementary appendix This supplementary material has been provided by the authors to give readers additional information about their work. © 2015 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 SUPPLEMENTARY APPENDIX Use of Integrative Clinical Sequencing in the Management of Pediatric Cancer Patients *#Rajen J. Mody, M.B.B.S, M.S., *Yi-Mi Wu, Ph.D., Robert J. Lonigro, M.S., Xuhong Cao, M.S., Sameek Roychowdhury, M.D., Ph.D., Pankaj Vats, M.S., Kevin M. Frank, M.S., John R. Prensner, M.D., Ph.D., Irfan Asangani, Ph.D., Nallasivam Palanisamy Ph.D. , Raja M. Rabah, M.D., Jonathan R. Dillman, M.D., Laxmi Priya Kunju, M.D., Jessica Everett, M.S., Victoria M. Raymond, M.S., Yu Ning, M.S., Fengyun Su, Ph.D., Rui Wang, M.S., Elena M. Stoffel, M.D., Jeffrey W. Innis, M.D., Ph.D., J. Scott Roberts, Ph.D., Patricia L. Robertson, M.D., Gregory Yanik, M.D., Aghiad Chamdin, M.D., James A. Connelly, M.D., Sung Choi, M.D., Andrew C. Harris, M.D., Carrie Kitko, M.D., Rama Jasty Rao, M.D., John E. Levine, M.D., Valerie P. Castle, M.D., Raymond J. Hutchinson, M.D., Moshe Talpaz, M.D., ^Dan R. Robinson, Ph.D., and ^#Arul M. Chinnaiyan, M.D., Ph.D. CORRESPONDING AUTHOR (S): # Arul M.
    [Show full text]
  • S41467-019-10037-Y.Pdf
    ARTICLE https://doi.org/10.1038/s41467-019-10037-y OPEN Feedback inhibition of cAMP effector signaling by a chaperone-assisted ubiquitin system Laura Rinaldi1, Rossella Delle Donne1, Bruno Catalanotti 2, Omar Torres-Quesada3, Florian Enzler3, Federica Moraca 4, Robert Nisticò5, Francesco Chiuso1, Sonia Piccinin5, Verena Bachmann3, Herbert H Lindner6, Corrado Garbi1, Antonella Scorziello7, Nicola Antonino Russo8, Matthis Synofzik9, Ulrich Stelzl 10, Lucio Annunziato11, Eduard Stefan 3 & Antonio Feliciello1 1234567890():,; Activation of G-protein coupled receptors elevates cAMP levels promoting dissociation of protein kinase A (PKA) holoenzymes and release of catalytic subunits (PKAc). This results in PKAc-mediated phosphorylation of compartmentalized substrates that control central aspects of cell physiology. The mechanism of PKAc activation and signaling have been largely characterized. However, the modes of PKAc inactivation by regulated proteolysis were unknown. Here, we identify a regulatory mechanism that precisely tunes PKAc stability and downstream signaling. Following agonist stimulation, the recruitment of the chaperone- bound E3 ligase CHIP promotes ubiquitylation and proteolysis of PKAc, thus attenuating cAMP signaling. Genetic inactivation of CHIP or pharmacological inhibition of HSP70 enhances PKAc signaling and sustains hippocampal long-term potentiation. Interestingly, primary fibroblasts from autosomal recessive spinocerebellar ataxia 16 (SCAR16) patients carrying germline inactivating mutations of CHIP show a dramatic dysregulation of PKA signaling. This suggests the existence of a negative feedback mechanism for restricting hormonally controlled PKA activities. 1 Department of Molecular Medicine and Medical Biotechnologies, University Federico II, 80131 Naples, Italy. 2 Department of Pharmacy, University Federico II, 80131 Naples, Italy. 3 Institute of Biochemistry and Center for Molecular Biosciences, University of Innsbruck, A-6020 Innsbruck, Austria.
    [Show full text]
  • Suppl. Table 1
    Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA
    [Show full text]
  • Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus
    LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary cul- ture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all condi- tions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127 IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Supplementary Fig. S1. LD Mice Used in This Study Accumulate Polyglucosan Inclusions (Lafora Bodies) in the Brain
    1 SUPPLEMENTARY MATERIAL Supplementary Fig. S1. LD mice used in this study accumulate polyglucosan inclusions (Lafora bodies) in the brain. Samples from the hippocampus of five months old control, Epm2a-/- (lacking laforin) and Epm2b-/- mice (lacking malin) were stained with periodic acid Schiff reagent (PAS staining), which colors polysaccharide granules in red. Bar: 50 m. Supplementary Fig. S2. Principal component analysis (PCA) representing the first two components with the biggest level of phenotypic variability. Samples 1_S1 to 4_S4 corresponded to control, 5_S5, 6_S6 and 8_S8 to Epm2a-/- and 9_S9 to 12_S12 to Epm2b- /- samples, of animals of 16 months of age respectively. Supplementary Table S1. Primers used in this work to validate the expression of the corresponding genes by RT-qPCR. Supplementary Table S2: Genes downregulated more than 0.5 fold in Epm2a-/- and Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. Supplementary Table S3: Genes upregulated more than 1.5 fold in Epm2a-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. Supplementary Table S4: Genes upregulated more than 1.5 fold in Epm2b-/- mice of 16 months of age. The gene name, false discovery rate (FDR), fold change (FC), description and MGI Id (mouse genome informatics) are indicated. Genes are arranged according to FC. 2 Supplementary Table S5: Genes upregulated in both Epm2a-/- and Epm2b-/- mice of 16 months of age.
    [Show full text]
  • PPP1R35 Is a Novel Centrosomal Protein That Regulates
    RESEARCH ARTICLE PPP1R35 is a novel centrosomal protein that regulates centriole length in concert with the microcephaly protein RTTN Andrew Michael Sydor1, Etienne Coyaud2, Cristina Rovelli1, Estelle Laurent2, Helen Liu1, Brian Raught2,3, Vito Mennella1,4* 1Cell Biology Program, The Hospital for Sick Children, Toronto, Canada; 2Princess Margaret Cancer Centre, University Health Network, Toronto, Canada; 3Department of Medical Biophysics, University of Toronto, Ontario, Canada; 4Department of Biochemistry, University of Toronto, Ontario, Canada Abstract Centrosome structure, function, and number are finely regulated at the cellular level to ensure normal mammalian development. Here, we characterize PPP1R35 as a novel bona fide centrosomal protein and demonstrate that it is critical for centriole elongation. Using quantitative super-resolution microscopy mapping and live-cell imaging we show that PPP1R35 is a resident centrosomal protein located in the proximal lumen above the cartwheel, a region of the centriole that has eluded detailed characterization. Loss of PPP1R35 function results in decreased centrosome number and shortened centrioles that lack centriolar distal and microtubule wall associated proteins required for centriole elongation. We further demonstrate that PPP1R35 acts downstream of, and forms a complex with, RTTN, a microcephaly protein required for distal centriole elongation. Altogether, our study identifies a novel step in the centriole elongation pathway centered on PPP1R35 and elucidates downstream partners of the microcephaly protein RTTN. DOI: https://doi.org/10.7554/eLife.37846.001 *For correspondence: [email protected] Introduction Competing interests: The The centrosome is a membrane-less organelle whose major role is to organize, orient, and regulate authors declare that no competing interests exist. the site of microtubule formation.
    [Show full text]