Metabolic Responses of Aspergillus Terreus Under Low Dissolved Oxygen and Ph Levels

Annals of Microbiology (2018) 68:195–205 https://doi.org/10.1007/s13213-018-1330-6

ORIGINAL ARTICLE

Metabolic responses of Aspergillus terreus under low dissolved oxygen and pH levels

Pajareeya Songserm1 & Aphichart Karnchanatat2 & Sitanan Thitiprasert2 & Somboon Tanasupawat3 & Suttichai Assabumrungrat4 & Shang-Tian Yang5 & Nuttha Thongchul2

Received: 21 November 2017 /Accepted: 22 February 2018 /Published online: 7 March 2018 # Springer-Verlag GmbH Germany, part of Springer Nature and the University of Milan 2018

Abstract The metabolic responses of Aspergillus terreus NRRL1960 to stress conditions (low dissolved oxygen and pH with limited nitrogen and phosphate) in the two-phase fermentation were investigated in this study. The fermentation kinetics suggested that itaconate production was suppressed under low dissolved oxygen (DO) concentrations. A slight change in pH caused a signif- icant change in itaconate production. The transcriptomic data revealed that under low DO concentration, the glycolytic pathway was uncoupled from the oxidative phosphorylation, resulting in the activation of substrate-level phosphorylation as an alternative route for ATP regeneration. The downregulation of pdh genes, the genes encoding ATP synthase and succinate dehydrogenase, confirmed the observation of the uncoupling of the oxidative TCA cycle from glycolysis. It was found that the upregulation of pyc resulted in a large pool of oxaloacetate in the cytosol. This induced the conversion of oxaloacetate to malate. The upregulation of the gene encoding fumarate hydratase with the subsequent formation of fumarate was found to be responsible for the regeneration of NADPH and ATP under the condition of a low dissolved oxygen level. The large pool of oxaloacetate drove itaconic acid production also via the oxidative TCA cycle. Nevertheless, the downregulation of ATP synthase genes resulted in the deficiency of the proton-pumping H+ ATPase and the subsequent stress due to the failure to maintain the physiological pH. This resulted in itaconate production at a low titer. The fermentation kinetics and the transcriptomic data provided in this study can be used for further process optimization and control to improve itaconate production performance.

Keywords A. terreus . Central metabolic pathway . Gene expression . Metabolite production . Fermentation

Introduction

Electronic supplementary material The online version of this article Aspergillus sp. has gained much commercial interest as the (https://doi.org/10.1007/s13213-018-1330-6) contains supplementary filamentous fungi in this genus have been reported as the material, which is available to authorized users. industrial producers of enzymes and metabolites. Besides Aspergillus niger and Aspergillus oryzae, Aspergillus terreus * Nuttha Thongchul has been used extensively in the commercial production of [email protected] enzymes (cellulase and xylanase), organic acid (itaconic acid), pharmaceutical product (lovastatin), and several secondary 1 Program in Biotechnology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand metabolites (geodin, cyclosporin A, questrin, citrinin, and aspulvinone) (Schimmel 1998;Hajjajetal.2001; Nazir et al. 2 Institute of Biotechnology and Genetic Engineering, Chulalongkorn University, Bangkok 10330, Thailand 2010; Klement and Buchs 2013; Kocabas et al. 2014; Boruta and Bizukojc 2016). Due to its ability to produce several me- 3 Department of Biochemistry and Microbiology, Faculty of Pharmaceutical Sciences, Chulalongkorn University, tabolites, many researchers have attempted to identify and to Bangkok 10330, Thailand reconstruct the genomic sequences of A. terreus for better 4 Department of Chemical Engineering, Faculty of Engineering, understanding and for controlling its metabolic network Chulalongkorn University, Bangkok 10330, Thailand (Birren et al. 2005; Liu et al. 2013). The reconstructed 5 William G. Lowrie Department of Chemical and Biomolecular genome-scale metabolic model based on genome annotation Engineering, The Ohio State University, Columbus, OH 43210, USA and literature mining accurately predicted the physiological 196 Ann Microbiol (2018) 68:195–205 responses to the environmental conditions (Liu et al. 2013). by medium B to enhance metabolite production with the lim- The bottleneck reactions in the metabolic pathway could be ited cell growth (Pimtong et al. 2017). The compositions of also elucidated. In bioprocess development, the model that medium B were (per liter) 100 g glucose, 2.36 g (NH4)2SO4, explained the function of the metabolic network is necessary 0.11 g KH2PO4,2.08gMgSO4·7H2O, 0.13 g CaCl2·2H2O, for fermentation process optimization as it reflects the titer, 0.074 g NaCl, 0.2 mg CuSO4·5H2O, 5.5 mg FeSO4·7H2O, yield, and production rate of the desirable product. A suitable 0.7 mg MnCl2·4H2O, and 1.3 g ZnSO4·7H2O. The pH of manipulation of A. terreus metabolism to reduce the formation medium B was adjusted to 2.0. of byproducts (e.g., geodin in lovastatin production and cell biomass in itaconate production) is required. Itaconate pro- Cultivation of A. terreus in a 7-L stirred fermentor duction by A. terreus has long been studied; however, the synthetic pathway has not been clearly elucidated (Liu et al. The cultivation was performed in the 7-L stirred fermentor 2013). The rate-limiting reaction in itaconate production is (Sartorius Biostat® B) with a filled medium volume of 3 L. still unclear and the metabolic evolution proposed to improve Before the cultivation, the fermentor was autoclaved at 121 °C the production performance seems insufficient. To overcome and 15 psig, for 30 min. After sterilization, the fermentor was the problems addressed previously, a comprehensive under- cooled down before starting the control system. A dissolved standing of the physiology of A. terreus is important. oxygen (DO) sensor (Mettler Toledo InPro®6820) was cali-

In this study, the metabolic responses of A. terreus and its brated with sterile pure nitrogen and air. A dissolved CO2 end product formation were investigated during the cultiva- sensor (Mettler Toledo InPro®50,009(i)) was calibrated with tion under low dissolved oxygen concentrations and pH. The CO2 gas before the cultivation. The fermentation was initiated fermentation kinetics and the transcriptomic data analysis by inoculating the fermentor with the spore suspension. were employed to explain the physiological responses of For the typical one-phase fermentation cultivation, after the A. terreus to the changes in the environmental conditions, inoculation, the fermentor was controlled at 30 °C, 350 rpm, especially under stress conditions (low dissolved oxygen con- and 20% DO, with an initial pH of 3.1. The cultivation was centration and pH). The results obtained in this study could be carried out for 132 h (Krull et al. 2017). deposited in the literature mining as the database for manipu- For the two-phase fermentation process, the cultivation lating A. terreus cultivation to achieve a high production per- started with the inoculation of the fermentor that was filled with formance of the desirable end products. medium A. The fermentor was operated at 30 °C, 100 rpm, and 0.5 vvm air, for 48 h. During the growth phase, spores were germinated, and the hyphal growth was initiated until a suffi- Materials and methods ciently high cell concentration was obtained. At the end of the growth phase, medium A was aseptically discharged using the Microorganisms, inoculum preparation, and medium peristaltic pump and the fermentor was filled with the sterile compositions medium B. The culture was incubated at the same temperature but with varied pH and DO levels to induce the production of A. terreus NRRL1960 was kindly provided by the fermentation metabolites. During the production phase, the pH Agricultural Research Service Culture Collection, US was automatically controlled by the addition of 5 M KOH. The

Department of Agriculture, Peoria, IL, USA. For the inoculum DO profile and the CO2 concentration were monitored during preparation, the culture was maintained on Czapek Dox agar the cultivation in the production phase. and was incubated at 30 °C for 7 days. The spores were har- Broth samples were collected from the fermentor every vested with sterile deionized water. The spore concentration 12 h throughout the cultivation for analyses of the remaining was adjusted to 106 spores/mL by dilution with sterile deion- glucose and ammonium and for the presence of fermentation ized water. A total of 10 mL of the spore suspension was used metabolites. The cell biomass was collected for dry weight to inoculate the bioreactor. (DW) and transcriptomic analyses. All the experiments were The medium composition of the one-phase fermentation conducted in duplicate for each condition. All the datasets consisted of (per liter) 180 g glucose, 0.1 g KH2PO4,3g presented for this study are the average values obtained from NH4NO3,1gMgSO4·7H2O, 5 g CaCl2·2H2O, 1.67 mg the duplication. FeCl3·6H2O, 8 mg ZnSO4·7H2O, and 15 mg CuSO4·5H2O. The pH of the medium was adjusted to 3.1 with 0.5 M H2SO4 Complementary DNA library preparation (Krull et al. 2017). and transcriptomic sequencing and analysis In the two-phase fermentation, medium A containing (per liter) 30 g glucose and 5 g yeast extract was used initially for To understand better the metabolic changes of A. terreus inducing spore germination and initial cell growth. The pH of NRRL1960 upon the manipulation of the process conditions medium A was adjusted to 3.0. Later, medium A was replaced during the two-phase fermentation, the fermentation sample at Ann Microbiol (2018) 68:195–205 197 the end of the first phase and those samples during the second the ratio of the product formed to the amount of glucose con- phase were collected for RNA extraction, subsequent tran- sumed. The volumetric productivity was defined as the total scriptome sequencing, and differential expression analysis. amount of the product formed per unit volume per unit time. Barcoded RNA libraries were prepared using Lexogen’s The cell biomass concentration was determined from Quant-Seq 3′ mRNA seq kit from Ion Torrent (Lexogen, the cell dry weight. The collected fermentation sample Vienna, Austria). This approach generated libraries of the se- was filtered through Whatman filter paper no.4 to harvest quences close to the 3′ end of the polyadenylated RNAs, and the cell biomass. The cell biomass was rinsed thoroughly only one fragment was produced per transcript. The RNA input with deionized water and dried at 80 °C until a constant was quantified by spectrophotometry and by fluorometry. dry weight was obtained. The cell concentration (in g/L) Approximately 300–500 ng of the RNA input was required for was calculated. library generation. The modified Quant-Seq protocol was per- High-performance liquid chromatography (HPLC) was formed as suggested for this low input, partially degraded RNA. used to analyze the remaining glucose and the presence of The External RNA Controls Consortium (ERCC) obtained from fermentation metabolites. The fermentation broth was centri- Life Technologies (Carlsbad, CA, USA) was spiked into each of fuged at 10000 g for 7 min. The supernatant was collected for the prepared library reactions at the manufacturer’s recommend- the HPLC sample preparation. The sample was diluted and ed concentration. The library quantification and quality control was filtered through a hydrophilic PTFE membrane. The were performed using the high sensitivity DNA kit and the particle-free sample (15 μL) was injected automatically Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA). (Shimadzu DGU-20A 5R, Shimadzu SIL-20A HT) into an The DNA templates for sequencing were prepared using the organic acid column (Biorad, Aminex HPX-87H ion exclu- 200 bp v3 OT2 kit and the Ion One Touch 2 platform (Life sion organic acid column; 300 mm × 7.8 mm) maintained at Technologies). Sequencing was performed on the Ion Proton, 40 °C in a column oven (Shimadzu, CTO-20A). A solution of with signal processing and base calling performed by the Ion 0.005 M H2SO4 was used as the mobile phase at the flowrate Torrent Suite v5.0.4 (Life Technologies). The raw sequences of 0.6 mL/min (Shimadzu, LC-20AD). The refractive index from each sample were uploaded to Partex Flow. The adapter detector (Shimadzu RID-20A) was used to detect the remain- sequences were trimmed. The bases were then trimmed accord- ing glucose while the organic compounds, e.g., glucose, ing to the visual representation and the quality score to a size itaconic acid, citric acid, cis-aconitic acid, succinic acid, oxa- below 170 bp. The resulting reads were then aligned to A. terreus loacetic acid, L-malic acid, pyruvic acid, fumaric acid, and NIH2624 genome references downloaded from http://fungi. ethanol, present in the sample were detected by the UV detec- ensembl.org/info/website/ftp/index.html using Star 2.4.1d tor at 210 nm (Shimadzu SPD-20A). The standards containing (UniProtKB) (Protein Knowledgebase (UniProt KB) 2017). 0–2 g/L of each compound mentioned previously were The transcript quantification was performed using the Partex E/ injected as the references to determine the concentration of M method available in Partek Flow. each compound in the sample. The chromatogram peak area The trimming of the adapters including TGGAATTC was selected for comparison basis. TCGGGTG, CACCCGAGAATTCCA, AATCTCGT The residual ammoniacal nitrogen was determined by the ATGCCGTCTTCTGCTTGC, AGATCGGAAGAGCT indophenol blue method (Tzollas et al. 2010). Before the as- CGTATGCCGTCTTCTGCTTG, AGATC GGAAGAGC say, the following reagents were prepared accordingly: (1) GTCGTCTAGGGAAAGAGTGT, and AGATCGGA phenol-alcohol solution was prepared by dissolving 10 g phe- AGAGCGGTTCAGCAGGAATGCCGAG was performed. nol (reagent grade) into 100 mL ethanol (95% v/v); (2) 0.5% The sequence alignment with the A. terreus NIH2624 (assem- sodium nitroprusside was prepared by dissolving 1 g sodium bly ASM14961v1) genome was performed using STAR nitroprusside into 200 mL water; (3) alkaline solution was v2.4.2a. Samtools v0.1.19-96b5f2294a was used with the de- preparedbydissolving100gtrisodiumcitrateand5gsodium fault setting to generate the bam index files. The quantification hydroxide into 500 mL water; (4) sodium hypochlorite solu- of gene expression was performed by Htseq v0.6.0 with–f tion was prepared from commercial hypochlorite (Chlorox); and–s options indicating bam inputs and un-stranded reads, and (5) oxidizing solution was prepared on the same day be- respectively. Cuffdiff v2.1.1 was used to estimate the tran- fore use from a mixture of 100 mL sodium citrate solution and script abundance with the –no-diff and default options to gen- 25 mL hypochlorite solution. The reaction assay was started erate the differential analysis files for each of the described by adding a 500 μL sample into the mixture of phenol solution comparisons. (20 μL), sodium nitroprusside solution (50 μL), and oxidizing solution (125 μL). The reaction was developed for 1 h in Sample analyses darkness. The optical purity of the mixture was measured at the wavelength of 640 nm (Thermo Scientific Multiskan GO), The cell growth and product formation during the fermenta- and the ammonia concentration in the sample was calculated tion were determined. The product yield was calculated from from the standard curve. 198 Ann Microbiol (2018) 68:195–205

The residual phosphate was determined by the malachite been occasionally reported in the previous literature; never- green method (Baykov et al. 1988). The dye solution was theless, the finding in this study was confirmed by the HPLC prepared before the assay by adding 60 mL concentrated sul- chromatograms of the fermentation samples compared with furic acid into 300 mL water. The solution was allowed to cool those of the standards (data not shown) (Jimenez-Quero down to room temperature before 0.44-g malachite green was et al. 2016). supplemented. The orange solution was then prepared on the The two-phase fermentation was introduced in the cultiva- same day before use by mixing 2.5 mL ammonium molybdate tion of A. terreus to investigate the production of fermentation (7.5%) and 0.2 mL Tween 20 (11%) into 10 mL dye solution. metabolites under different environmental conditions. In the For the reaction assay, a 100 μL sample was mixed with a two-phase fermentation, spore germination and fungal growth 400 μL orange solution. The absorbance at 630 nm (Thermo were initiated during the first phase; whereas in the second Scientific Multiskan GO) was read within 10 min after phase, the growth was limited, allowing the fungi to convert mixing. The phosphate concentration of the sample was cal- the substrates to other fermentation metabolites (Thitiprasert culated from the standard curve. et al. 2016; Pimtong et al. 2017). By this approach, it can be seen clearly that cell biomass concentration remained relatively constant during the second phase (Fig. 2). Itaconic acid was Results and discussion found to be produced as the major product during the second

phase. Fumaric acid and CO2 production were observed with Metabolite production profiles by A. terreus the trace amount of other metabolites in the TCA cycle (data NRRL1960 from two cultivation approaches not shown); however, the concentration was relatively low in comparison to those observed in the typical two-phase culti- The fermentation kinetics during the 1-phase fermentation vation. From the findings in the two-phase fermentation, fur- cultivation of A. terreus NRRL1960 were observed (Fig. 1). ther experimental observation was conducted under varied Growth started immediately after inoculation; however, the environmental conditions for a better understanding of the production of the metabolites was observed after 48 h. This metabolic response of A. terreus NRRL1960 to the process resulted in the low overall volumetric productivity of the me- conditions, especially under stress conditions. tabolites. From the fermentation profiles, it was found that glucose was mainly consumed by A. terreus NRRL1960 for Dissolved oxygen and pH regulated metabolite cell biomass production (45.1 g/L). Fumaric acid was the ma- production in the 2-phase fermentation jor metabolite found in the 1-phase fermentation at the concentration of 41.6 g/L. Succinic acid was found as the second Table 1 represents the fermentation kinetics data of A. terreus major end product at a concentration lower than 10 g/L. Other NRRL1960 during the second phase in the two-phase fermen- intermediates in the TCA cycle, e.g., citric acid and cis- tation cultivated at low DO levels (10, 15, and 20%). Itaconic aconitic acid were present in trace amounts while no malic acid and fumaric acid were observed in the fermentation broth acid and itaconic acid were observed. The evidence of fuma- during the second phase in all of the conditions studied. From rate formation from the 1-phase fermentation by A. terreus has the kinetics profiles (data not shown), ethanol was observed

Fig. 1 Metabolite production 210 70 profiles in 1-phase fermentation by A. terreus cultivated at 30 °C, 180 60 350 rpm, 20% DO, and initial pH 3.1 150 50

Glucose Biomass /L) g 120 Itaconate Fumarate 40 Cis-aconitate Succinate

90 Citrate Malate 30 Glucose (g/L)

60 20 Cell, Metabolites (

30 10

0 0 0 12 24 36 48 60 72 84 96 108 120 132 Time (h) Ann Microbiol (2018) 68:195–205 199

Fig. 2 Metabolite production 120 60 profiles of A. terreus during the production phase in two-phase fermentation. The fermentor was 100 50 controlled at 30 °C, 100 rpm, 10% DO, and pH 2.0. The C/N weight 80 40 ratio of the production medium was 100/2.36 60 30 Glucose Cell

Glucose (g/L) Itaconate Fumarate 40 20 CO2

20 10 Cell, Metabolites (g/L),(%)CO2

0 0 48 72 96 120 144 168 192 216 240 Time (h)

later in some operating conditions at the end of the fermenta- cultivation (Kuenz et al. 2012). It should be noted that itaconic tion (Table 1). The formation of ethanol revealed the evidence acid fermentation by A. terreus is an incomplete oxidation of oxygen limitation during the cultivation. The final cell con- process involving decarboxylation of cis-aconitic acid by centration and yield fluctuated because of morphological cis-aconitate decarboxylase, which interrupts the TCA cycle changes occurring during the production phase, which caused (Gyamerah 1995a). On the other hand, in the two-phase cul- difficulties in sampling and quantitative measurement. The tivation, it was found that the metabolite production (both results show that increasing the DO level and pH rather itaconic acid and fumaric acid) followed non-growth- lowered the production of the end metabolites (itaconic acid associated product-formation kinetics. This phenomenon and fumaric acid). Nevertheless, the metabolite production could be explained by oxidative phosphorylation being was still limited as observed from the low yield and produc- uncoupled from glycolysis under the low DO level with lim- tivity when compared with the fermentation study operated at ited ammonium concentration (Fig. 3) (Gyamerah 1995b; the high DO level (Kuenz et al. 2012; Krull et al. 2017). Riscaldati et al. 2000; Karaffa et al. 2015). Consequently, The phenomenon of low cell biomass production during the glycolytic flux was enhanced rapidly for ATP regeneration the second phase in the two-phase fermentation can be ex- via substrate-level phosphorylation under this condition plained by the activation of the reductive pyruvate carboxyl- (Klement and Buchs 2013). With the limited nitrogen and ation together with the oxidation of pyruvate via TCA cycle oxygen, pyruvate flux was shifted toward the itaconic acid while the oxidative phosphorylation was uncoupled from the production route instead of completing the oxidative TCA glycolysis. It was reported that the TCA cycle was active cycle for biosynthesis. during fumaric acid production in case the reductive pyruvate The evidence of both nitrogen and phosphate limitation con- carboxylation was the sole pathway. As a result, ATP genera- firmed the non-growth-associated product-formation kinetics of tion for cell maintenance and metabolites transportation was end metabolite production during the second phase in the two- limited (Kenealy et al. 1986). With the CO2 fixation under the phase cultivation (Riscaldati et al. 2000;Papagiannietal.2005; aerobic condition, pyruvate carboxylase catalyzed the conver- Boer et al. 2010). Itaconic acid and fumaric acid were found sion of pyruvate to oxaloacetic acid and subsequently to from the fermentation after 96 h when the concentration of fumaric acid. Consequently, citric acid flux in the TCA cycle ammonium and phosphate became low at 0.29 and 13.0 mg/ was somewhat low during the first phase when growth was L, respectively (Fig. 3). This finding was consistent with our presumably promoted. However, the glucose metabolism and previous study indicating that itaconic acid was first observed

CO2 fixation could continue and could lead to the accumula- as the major end product in the fermentation broth when the tion of citric acid flux in the TCA cycle later when nitrogen growth was limited (Songserm et al. 2015). Klement and Buchs became limited which gradually decreased the cell biomass also reported that the overproduction of itaconic acid by production (Romano et al. 1967). A. terreus required nutrient limitation to uncouple glycolysis In the typical 1-phase fermentation cultivation, end product from oxidative phosphorylation (Klement and Buchs 2013). formation followed the growth-associated product-formation Riscaldati et al. reported that itaconic acid production was ob- kinetics model. Kuenz et al. reported that itaconic acid was served in the fermentation broth when the phosphate concen- produced simultaneously with the growth during the tration in the medium dropped to approximately 10 mg/L, with 200 Ann Microbiol (2018) 68:195–205

g/g) the continuously decreasing ammonium concentration from 20 mg/L to less than 1 mg/L, while the cell concentration was 0±0 0±0 0±0 0±0 0±0 0±0 0±0 0±0 slowly increasing from 3 to 10–11 g/L (Riscaldati et al. 2000). Hevekerl et al. claimed that, under the optimized operating conditions, itaconic acid was produced by the 1-day cultivation

wo-phase fermentation when the phosphate concentration was decreased (Hevekerl et al. 2014a). It was reported that in the absence of oxygen, itaconic Ethanol acid production was immediately stopped in A. terreus NRRL1960 (Gyamerah 1995b). The production mechanism involving the protein synthesis was restored slowly only under the aerobic condition (Gyamerah 1995b). To be more specific, itaconic acid production stopped as ATP generation was inhibited (Kuenz et al. 2012;Klementand Buchs 2013). ATP was claimed to be responsible for maintaining a proper physiological pH inside the cells conc. (g/L) Yield (g/g) Final conc. (g/L) Yield ( (i.e., near neutral pH), counteracting the acid produced 5.84±0.25 0.10±0.01 0±0 6.09±0.28 0.09±0.01 0±0 4.34±0.17 0.07±0.00 0±0 8.00±0.90 0.13±0.01 0±0 3.18±0.11 0.07±0.00 0±0 Fumarate 9.42±0.70 0.17±0.02 0±0 8.70±0.71 0.12±0.01 0±0 5.43±0.37 0.08±0.01 0±0 6.30±0.14 0.12±0.01 1.95±0.01 0.04±0.01 4.70±0.23 0.08±0.00 1.95±0.00 0.03±0.00 2.22±0.17 0.05±0.00 3.14±0.01 0.07±0.01 4.16±0.31 0.07±0.01in 6.44±0.01 the fermentation 0.11±0.01 process and the low external pH (Riscaldatietal.2000; Hevekerl et al. 2014b;Krull et al. 2017). When the extracellular pH was decreased, the permeability of the cell membrane was decreased. The transport of acid metabolites and proton across the 96 132 120 132 108 132 108 120 108 132 132 120 membrane only occurred when the sufficient ATP was present (Corte-Real and Leao 1990). In the yeast cultivation, it was stated that the diffusion rate of undissociated acids across the membrane was increased with the decreasing extracellular pH. The same phenomenon was found during the second phase in the two-phase cultiva- 05±0.00 06±0.01 .16±0.02 .19±0.03 tion of A. terreus in this study. The different extracellular

NRRL1960 cultivated in medium B at 30 °C and 100 rpm during the second phase in the t concentration of itaconic acid was observed from the cultivation with the small change in pH. This can be ex- .03 0.26±0.02 .05 0.20±0.03 plained by the different acid dissociation degree at the

A. terreus different cultivation pH which resulted in the different concentration ratio of the undissociated acid and its salt. A detailed explanation on the synthesis of end metabolites in A. terreus and the transport across the membrane can be found below. Itaconic acid was appeared as the major end metabolite pro-

Itaconate duced in the second phase of the two-phase fermentation. It

was produced in an undissociated form (H2IA) in the cytosol. The degree of dissociation shifted from H2IA to the single- dissociated form (HIA−) and the double-dissociated form (IA2 −) based on the intracellular pH, causing the release of protons and the acidification of the cytosol, which led to stress or growth inhibition of the cells. The dissociated forms (HIA−) and (IA2−) were not able to pass across the cytoplasmic mem-

a brane, while the acid form (H2IA) could diffuse through the membrane freely via the major facilitator superfamily (Mfs) Final conc. (g/L) Yield (g/g) Final conc. (g/L) Yield (g/g) Productivity (g/L h) Produced at (h) Final protein transporters, using the energy from electrochemical gra- dients across the membrane. The transport of itaconic acid Effect of dissolved oxygen and pH on the metabolic responses of 2.30 54.70±1.51 0.35±0.04 8.14±3.26 0.25±0.06 0. 2.30 60.20±3.88 0.42±0.09 15.86±0.94 0.38±0.01 0.13±0.03 2.15 46.60±2.09 0.16±0.05 22.39±2.22 0.48±0.03 0.15±0.05 2.15 60.50±3.74 0.25±0.06 8.37±1.21 0.23±0.06 0.06±0.01 2.00 50.00±0.92 0.15±0.02 35.65±0.89 0.52±0 2.00 54.00±3.56 0.20±0.03 22.85±3.08 0.40±0 2.00 52.00±2.10 0.22±0.03 12.19±1.42 0.28±0.01 0.08±0.02 2.15 62.40±0.44 0.34±0.05 4.58±2.22 0.19±0.04 0.04±0.00 2.30 54.00±1.83 0.04±0.02across 7.99±1.01 the cytoplasmic 0.19±0.01 0. membrane also involved the proton- pumping H+ ATPase, which required ATP to drive the transport Total cell biomass production from the beginning to the end of fermentation %DO pH Cell Table 1 a 10 1.85 64.40±3.31 0.51±0.02 22.37±4.48 0.49±0.04 0 15 1.85 44.60±0.09 0.31±0.07 23.28±5.81 0.47±0.01 0 20 1.85 43.00±1.17 0.15±0.04 14.73±1.75of protons 0.33±0.04 across 0.07±0.01 the membrane (Krull et al. 2017). Ann Microbiol (2018) 68:195–205 201

Fig. 3 The fermentation kinetics 100 60 of A. terreus under the limited nitrogen and phosphate during the 50 production phase. The fermentor 80 was controlled at 30 °C, 100 rpm, 20% DO, and pH 2.0. The C/N weight ratio of the production 40 medium was 100/2.36 60 30

40 Glucose Phosphate Cell Itaconate 20 Fumarate Nitrogen

Glucose (g/L), Phosphate (mg/L) Phosphate (g/L), Glucose 20 Cell, Metabolites, Nitrogen(g/L) 10

0 0 48 72 96 120 144 168 192 216 240 Time (h)

In case of fumaric acid production at low extracellular pH, From the previous explanation, it can be summarized that a it was reported that the undissociated form could passively low pH is necessary in the cultivation of A. terreus diffuse back through the cytoplasmic membrane decreasing NRRL1960 for the end metabolite production in order to pro- the intracellular pH. Nonetheless, the transport mechanism vide the sufficient amount of proton in exchange with the acid of fumaric acid in fungi has not been clearly understood. It metabolite transport. In addition, ethanol formation and low is believed that increasing the activity of the dicarboxylic acid extracellular concentration of itaconate and fumarate con- transporters could lower the intracellular fumarate concentra- firmed the evidence of oxygen limitation and insufficient tion in the cytosol and, therefore, could provide the positive ATP regeneration in the two-phase fermentation system. For effect on the fermentation process performance (Roa Engel further improvement in production performance, the fermen- et al. 2008, 2011;Xuetal.2012). tation under high DO level is necessary.

Extracellular fluid

Glucose F-1,6-bisphosphate Cytosol pfk

Pyruvate Pyruvate pdh pyc Acetyl CoA cs

OAA OAA Citrate mdh fh Fumarate Malate Malate Mitochondria Cis-aconitate Fumaric acid mttA

Fumarate Isocitrate Cis-aconitate Succinate sdh cadA Succinate 2-oxoglutarate

Succinyl Itaconate CoA

H+ Pump mfsA

H+ Itaconic acid Fig. 4 Metabolic pathway of A. terreus and the key genes responsible in boxes were downregulated. The genes in the gray boxes were found to be glycolysis and TCA cycle. The key genes in the green boxes were expressed at certain levels overexpressed during the production phase, while the genes in the red 202 Ann Microbiol (2018) 68:195–205

Gene expression explained metabolic responses citrate synthase (cs) gene was the consequence of the down- of A. terreus regulated pdh genes, while the expression of the gene encoding aconitase fluctuated (Fig. 5b) (Patel et al. 2014). To better understand the fermentation kinetics and the metabol- The upregulation of pyc at 144 h resulted in a large pool of ic response of A. terreus NRRL1960 and, thus, to improve the oxaloacetate in the cytosol. This induced the conversion of fermentation performance for desirable end product further, we oxaloacetate to malate, to be transported into the mitochon- observed gene expression during the second phase in the two- dria, while cis-aconitate was transported across the mitochon- phase fermentation where the end metabolite production was drial TCA transporter. As a result, the major glucose con- enhanced. From the selection of one fermentation condition as sumption went to itaconic acid synthesis. This phenomenon the representative of the fermentation operation under stress was confirmed by the upregulation of the genes encoding condition (low DO and pH) to conduct transcriptomic analysis, mitochondrial TCA transporter (mttA), cis-aconitate decar- we attempted to correlate the fermentation kinetics results with boxylase (cadA), and Mfs transporter (mfsA) responsible for the regulation of the genes of interest under the specified pro- secreting itaconic acid across the cytoplasmic membrane to cess conditions. Figure 4 shows the central metabolic pathway the fermentation broth (Fig. 5c) (Hossain et al. 2016). It was of A. terreus. Glucose was converted to the key intermediate also found that the gene encoding fumarate hydratase was pyruvate. The key responsible enzyme in this route was phos- slightly upregulated (Fig. 5d). The time course data explaining phofructokinase. Pyruvate was either converted to acetyl CoA the upregulation of the genes in itaconic acid cluster was con- by the pyruvate dehydrogenase complex or was carboxylated to sistent with the fermentation kinetics data describing the pro- oxaloacetate by pyruvate carboxylase. The formation of duction of itaconic acid after 96 h cultivation. itaconic acid involved the shuttle of intermediate metabolites The low production rate of itaconic acid could be explained between the cytosol and the mitochondria and the formation by the downregulation of four ATP synthase genes (for the utilized the different enzymes present in both of the cell com- ATP synthase subunits d, 4, 5, and 9) (Fig. 5e). As a result, partments. Cis-aconitate was transported into the cytosol via the the proton-pumping H+ ATPase which requires ATP to drive mitochondrial TCA transporter. Cis-aconitate was then convert- the transport of proton across the membrane in exchange for ed to itaconic acid by cis-aconitate decarboxylase. Later, undis- intracellular H2IA was shunted (Krull et al. 2017). Together sociated form of itaconic acid was secreted from the cytosol with the upregulated genes of the itaconic acid cluster, this across the cytoplasmic membrane in exchange for protons via would result in the accumulation of H2IA and eventually intra- the Mfs transporter (Krull et al. 2017). Fumaric acid synthesis cellular metabolic stress. In addition to the downregulation of pathway started with the carboxylation of pyruvate by pyruvate ATP synthase genes, the downregulation of the succinate decarboxylase to oxaloacetate with the presence of ATP and CO2. hydrogenase gene confirmed that glycolysis was uncoupled Later, oxaloacetate was converted to malic acid by malate de- from oxidative phosphorylation under the condition of limited hydrogenase and then to fumaric acid by fumarase or fumarate nitrogen, phosphate, and dissolved oxygen (Fig. 5d). Succinate hydratase (Xu et al. 2012). The transport mechanism of fumaric dehydrogenase was the only enzyme that participated in both acid in filamentous fungi has not been studied extensively; the TCA cycle and the electron transport chain; therefore, the however, the transport mechanism in yeast has been studied downregulation of this gene resulted in an incomplete TCA thoroughly. This was presumably applied for the transport of cycle (Hartman et al. 2014; Jimenez-Quero et al. 2016). This fumarate in the filamentous fungi (Roa Engel et al. 2008). finding confirmed that glycolysis and oxidative phosphoryla- Figure 5 describes the transcriptional levels of genes tion were uncoupled, resulting in limitation of ATP availability encoding key enzymes involved in glycolysis, TCA cycle, and reduction of power regeneration (in the form of NADH oxidative phosphorylation, and biosynthesis of acid metabo- and FADH) (Jimenez-Quero et al. 2016). Substrate-level phos- lites (itaconic acid and fumaric acid) during the second phase phorylation was initiated to allow ATP regeneration, where in the two-phase fermentation. The fermentation process was fumaric acid was the electron acceptor, confirmed by the slight controlled at 30 °C, 100 rpm, 10% DO, and pH 2.0 (see upregulation of the fumarate hydratase gene (Fig. 5d). Supplementation Material Online, Table S1). The expression of phosphofructokinase (pfk) genes of glycolysis was changed slightly during the production phase (Fig. 5a). The evidence of Conclusion the downregulation of pyruvate dehydrogenase (pdhB, pdhC, pdhA,andpdhX) genes with the upregulation of the pyruvate The central metabolic pathway of A. terreus involves both the carboxylase (pyc) gene from the heat maps indicated that more biosynthesis and the transport of metabolites across cell com- pyruvate was carboxylated to oxaloacetate as the fermentation partments. In this study, two-phase fermentation was conduct- proceeded (Fig. 5a). It was suggested that the limited nitrogen ed to study the metabolic responses of A. terreus during cul- and phosphate and the low DO level were responsible for this tivation under low DO and pH levels. The transcriptomic data metabolic shift (Wynn et al. 2001). The downregulation of the analysis was employed to correlate the gene expression level Ann Microbiol (2018) 68:195–205 203

Fig. 5 Heat maps summarizing the differential expression of the key the gene. The black box indicates a slight change in gene expression level genes responsible in glycolysis and TCA cycle during the production (log2(fold_change) less than 2). ND represents the fragments per kilobase phase of A. terreus. The number in the box indicates the differential per million reads (FPKM) at that time was zero (no expression). a gene expression level compared with that at the starting time that the Glycolytic cluster, b citrate isomer, c itaconic acid cluster, d glyoxylate/ gene was expressed (48 or 72 h). The green box represents the dicarboxylate metabolism, and e ATP synthase cluster upregulation of the gene. The red box represents the downregulation of

with the metabolite production kinetics. Under the stress con- reductive carboxylation and the oxidative TCA pathways. ditions with low DO level and limited nitrogen and phosphate, The transcriptomic data suggested that a high flux of itaconic A. terreus produced itaconic acid as the major end product. acid occurred due to the upregulation of pyc. As a result, Fumaric acid was found to the byproduct under these condi- pyruvate was subsequently converted to oxaloacetate and ma- tions. The production of both itaconic acid and fumaric acid late was generated. Malate entered the mitochondria, while indicated that oxaloacetate simultaneously entered both the cis-aconitate was transported to the cytosol at the mttA 204 Ann Microbiol (2018) 68:195–205 transporter resulting in the incomplete oxidative TCA cycle Boruta T, Bizukojc M (2016) Induction of secondary metabolism of and the uncoupled glycolysis and oxidative phosphorylation. Aspergillus terreus ATCC 20542 in the batch bioreactor cultures. Appl Microbiol Biotechnol 100:3009–3022 It was observed that the gene encoding fumarate hydratase in Corte-Real M, Leao C (1990) Transport of malic acid and other carbox- the reductive TCA cycle was slightly upregulated. Although ylic acids in the yeast Hansenula anomala. Appl Environ Microbiol the genes in the itaconic acid cluster including mfsA were 56:1109–1113 upregulated, the downregulation of ATP synthase caused a Gyamerah MH (1995a) Oxygen requirement and energy relations of itaconic acid fermentation by Aspergillus terreus NRRL1960. strong effect on itaconic acid production as it controlled the Appl Microbiol Biotechnol 44:20–26 transport of protons in exchange for itaconic acid across the Gyamerah MH (1995b) Factors affecting the growth form of Aspergillus cytoplasmic membrane. From the fermentation kinetics and terreus NRRL1960 in relation to itaconic acid fermentation. Appl the transcriptomic analysis obtained in this study, it can be Microbiol Biotechnol 44:356–361 suggested that low pH is necessary in the cultivation of Hajjaj H, Niederberger P, Duboc P (2001) Lovastatin biosynthesis by Aspergillus terreus in a chemically defined medium. Appl Environ A. terreus NRRL1960 for the end metabolite production in Microbiol 67:2596–2602 order to provide the sufficient amount of proton in exchange Hartman T, Weinrick B, Vilcheze C, Berney M, Tufariello J, Cook GM, with the acid metabolite transport. In addition, ethanol forma- Jacobs WR Jr (2014) Succinate dehydrogenase is the regulator of – tion and low extracellular concentration of itaconate and fu- respiration in Mycobacterium tuberculosis. PLoS Pathog 10:1 15 Hevekerl A, Kuenz A, Vorlop KD (2014a) Filamentous fungi in microti- marate confirmed the evidence of oxygen limitation and in- ter plates-an easy way to optimize itaconic acid production with sufficient ATP regeneration in the two-phase fermentation Aspergillus terreus. Appl Microbiol Biotechnol 98:6983–6989 system. For further improvement in production performance, Hevekerl A, Kuenz A, Vorlop KD (2014b) Influence of the pH on the the fermentation under high DO level is necessary. itaconic acid production with Aspergillus terreus.ApplMicrobiol Biotechnol 98:10005–10012 Hossain AH, Li A, Brickwedde A, Wilms L, Caspers M, Overkamp K, Acknowledgements The authors would like to thank Dr. Kaemwich Punt PJ (2016) Rewiring a secondary metabolite pathway toward Jantama for his fruitful discussion on transcriptomic analysis. The work itaconic acid production in Aspergillus niger.MicrobCellFactories in RNA-seq gene expression analysis performed by D. Ashley Hill and her 15:1–15 colleagues at ResourcePath, Sterlin, VA, USA are highly appreciated. The Jimenez-Quero A, Pollet E, Zhao M, Marchioni E, Averous L, Phalip V authors also thank Timothy Wesselman and Roshni Patel from OnRamp (2016) Itaconic and fumaric acid production from biomass hydroly- Bioinformatics, Inc. (San Diego, CA, USA) for their outstanding work on sates by Aspergillus strains. J Microbiol Biotechnol 26:1557–1565 analyzing the RNA-seq data and differential gene expression analysis. Karaffa L, Diaz R, Papp B, Fekete E, Sandor E, Kubicek CP (2015) A deficiency of manganese ions in the presence of high sugar concentra- Funding Information Partial support from the Grant for International tions is the critical parameter for achieving high yields of itaconic acid Research Integration: Research Pyramid, Ratchadapiseksomphot by Aspergillus terreus. Appl Microbiol Biotechnol 99:7937–7944 Endowment Fund (GCURP_58_01_33_01) and Thailand Research Fund via the Distinguished Research Professor Grant (DPG5880003) Kenealy W, Zaady E, Dupreez JC, Stieglitz B, Goldberg I (1986) Biochemical aspects of fumaric acid accumulation by Rhizopus are also acknowledged. The research facility support from the – Chulalongkorn Academic Advancement into its 2nd Century Project arrhizus. Appl Environ Microbiol 52:128 133 – (CUAASC) is highly appreciated. PS is the recipient of the Royal Klement T, Buchs J (2013) Itaconic acid a biotechnological process in – Jubilee Scholarship Program, Thailand Research Fund. change. Bioresour Technol 135:422 431 Kocabas A, Ogel ZB, Bakir U (2014) Xylanase and itaconic acid production by Aspergillus terreus NRRL 1960 within a biorefinery con- Compliance with ethical standards cept. Ann Microbiol 64:75–84 Krull S, Hevekerl A, Kuenz A, Prube U (2017) Process development of Conflict of interest The authors declare that they have no conflict of itaconic acid production by a natural wild type strain of Aspergillus interest. terreus to reach industrially relevant final titers. Appl Microbiol Biotechnol 101:4063–4072 Ethical approval This article does not contain any studies with human Kuenz A, Gallenmuller T, Willke T, Vorlop KD (2012) Microbial pro- participants or animals performed by any of the authors. duction of itaconic acid: developing a stable platform for high product concentrations. Appl Microbiol Biotechnol 96:1209–1216 Liu J, Gao Q, Xu N, Liu L (2013) Genome-scale reconstruction and in silico analysis of Aspergillus terreus metabolism. Mol BioSyst 9: References 1939–1948 Nazir A, Soni R, Saini HS, Kaur A, Chadha BS (2010) Profiling differential expression of cellulases and metabolite footprints in Baykov AA, Evtushenko OA, Avaeva SM (1988) A malachite green Aspergillus terreus. Appl Biochem Biotechnol 162:538–547 procedure for orthophosphate determination and its use in al- Papagianni M, Wayman F, Mattey M (2005) Fate and role of ammonium kaline phosphatase-based enzyme immunoassay. Anal Biochem ions during fermentation of citric acid by Aspergillus niger.Appl 171:266–270 Environ Microbiol 71:7178–7186 Birren BW, Lander ES, Galagan JE, et al (2005) Annotation of Patel MS, Nemeria NS, Furey W, Jordan F (2014) The pyruvate dehy- the Aspergillus terreus NIH264 genome. EMBL/GenBank/ drogenase complexes: structure-based function and regulation. J DDBJ databases Biol Chem 289:16615–16622 Boer VM, Crutchfield CA, Bradley PH, Botstein D, Rabinowitz JD Pimtong V, Ounaeb S, Thitiprasert S, Tolieng V, Sooksai S, (2010) Growth-limiting intracellular metabolites in yeast growing Boonsombat R, Tanasupawat S, Assabumrungrat S, Thongchul under diverse nutrient limitations. Mol Biol Cell 21:198–211 N (2017) Enhanced effectiveness of Rhizopus oryzae by Ann Microbiol (2018) 68:195–205 205

immobilization in a static bed fermentor for L-lactic acid produc- (2015) Regulating pyruvate carboxylase in the living culture tion. Process Biochem 52:44–52 of Aspergillus terreus NRRL1960 by L-aspartate for en- Protein knowledgebase (UniProtKB) of Aspergillus terreus NIH2624. hanced itaconic acid production. Appl Biochem Biotechnol Available from www.uniprot.org/uniprot/?query=A+terreus+ 177:595–609 &sort=score. Accessed March 13, 2017 Thitiprasert S, Pimtong V, Kodama K, Sooksai S, Tanasupawat S, Riscaldati E, Moresi M, Federici F, Petruccioli M (2000) Effect of pH and Assabumrungrat S, Tolieng V, Thongchul N (2016) Correlative stirring rate on itaconate production by Aspergillus terreus.J effect of dissolved oxygen and key enzyme inhibitors respon- Biotechnol 83:219–230 sible for L-lactate production by immobilized Rhizopus oryzae Roa Engel CA, Straathof AJJ, Zijlmans TW, van Gulik WM, van der NRRL395 cultivated in a static bed bioreactor. Process Wielen LAM (2008) Fumaric acid production by fermentation. Biochem 51:204–212 Appl Microbiol Biotechnol 78:379–389 Tzollas NM, Zachariadis GA, Anthemidis AN, Stratis JA (2010) A new Roa Engel CA, van Gulik WM, Marang L, van der Wielen LAM, approach to indophenol blue method for determination of ammoni- Straathof AJJ (2011) Development of a low pH fermentation strat- um in geothermal waters with high mineral content. Int J Environ egy for fumaric acid production by Rhizopus oryzae. Enzym Microb Anal Chem 90:115–126 Technol 48:39–47 Wynn JP, Hamid AA, Li Y, Ratledge C (2001) Biochemical events lead- Romano AH, Bright MM, Scott WE (1967) Mechanism of fumaric acid ing to the diversion of carbon into storage lipids in the oleaginous accumulation in Rhizopus nigricans. J Biotechnol 93:600–604 fungi Mucor circinelloides and Mortierella alpine. Microbiology Schimmel TG (1998) Effect of butyrolactone I on the producing fungus, 147:2857–2864 Aspergillus terreus. Appl Environ Microbiol 64:3707–3712 Xu Q, Li S, Huang H, Wen J (2012) Key technologies for the industrial Songserm P, Thitiprasert S, Tolieng V, Piluk J, Tanasupawat S, production of fumaric acid by fermentation. Biotechnol Adv 30: Assabumrungrat S, Yang ST, Karnchanatat A, Thongchul N 1685–1696