USOO8829264B2

(12) United States Patent (10) Patent No.: US 8,829.264 B2 Hannon et al. (45) Date of Patent: *Sep. 9, 2014

(54) METHODS AND COMPOSITIONS FOR RNA 2004/0229266 A1 11/2004 TuSchlet al. INTERFERENCE 2005, 016421.0 A1 7/2005 Mittal et al. 2005/O1973 15 A1 9, 2005 Taira et al. (75) Inventors: Gregory J. Hannon, Huntington, NY (US); Patrick Paddison, Seattle, WA FOREIGN PATENT DOCUMENTS (US); Emily Bernstein, New York, NY CA 2470903 T 2003 (US); Amy Caudy, Toronto (CA); EP 1462525 9, 2004 Douglas Conklin, Niskayuna, NY (US); WO WO-94/O1550 1, 1994 WO WO-99/32619 7, 1999 Scott Hammond, Pittsboro, NC (US) WO WO-99/49029 9, 1999 WO WO-0001846 1, 2000 (73) Assignee: Cold Spring Harbor Laboratory, Cold WO WO-OOf 44895 8, 2000 Spring Harbor, NY (US) WO WO-0044914 8, 2000 WO WO-0063364 10, 2000 (*) Notice: Subject to any disclaimer, the term of this WO WO-01/29058 4/2001 WO WO-01 (36646 5, 2001 patent is extended or adjusted under 35 WO WO-01 (481.83 T 2001 U.S.C. 154(b) by 67 days. WO WO-01 (498.44 T 2001 WO WO-01 68836 9, 2001 This patent is Subject to a terminal dis WO WO-O 1/75164 10, 2001 claimer. WO WO-02/44321 6, 2002 WO WO-O2/O59300 8, 2002 (21) Appl. No.: 13/526,335 WO WO-O2/O6863.5 9, 2002 WO WO-03/01018O 2, 2003 (22) Filed: Jun. 18, 2012 WO WO-03/020931 3, 2003 WO WO-2004/O292.19 4/2004 Prior Publication Data (65) OTHER PUBLICATIONS US 2013/0276.158A1 Oct. 17, 2013 Agrawal, S. et al., “Antisense Therapeutics: Is It AS Simple as Related U.S. Application Data Complementary Base Recognition?.” Molecular Medicine Today, 61:72-81 (2000). (63) Continuation of application No. 10/997,086, filed on Ambros V. Dicing Up RNAs, Science 293:811-813 (2001). Nov. 23, 2004, now Pat. No. 8,202,846, which is a Bass, B.L., Double-Stranded RNAAs a Template for Gene Silencing, continuation-in-part of application No. 10/055,797, Cell 101, 235-238 (2000). filed on Jan. 22, 2002, now abandoned. Baulcombe, D.C., Gene Silencing: RNA Makes RNA Makes No Protein, Curr. Biol. 9, R599-R601 (1999). (51) Int. Cl. Baulcombe, D.C., RNA as a Target and an Initiator of Post-Transcrip CI2N IS/II3 (2010.01) tional Gene Silencing in Transgenic Plants, Plant Mol. Biol. 32. (52) U.S. Cl. 79-88 (1996). USPC ...... 800/18: 536/24.5; 800/21 Bernstein E. et al., Dicer Is Essential For Mouse Development, Nat. Genet. 35(3):215-7 (2003); Epub Oct. 5, 2003. (58) Field of Classification Search Bernstein E. et al., Role For a Bidentate Ribonuclease in the Initiation CPC ...... C12N 15/111 Step of RNA Interference, Nature 4.09(6818):363-6 (2001). See application file for complete search history. Bernstein E. et al., The Rest Is Silence, RNA 7(11): 1509-21 (2001). Bohmert, K. et al., AGOl Defines a Novel Locus of Arabidopsis (56) References Cited Controlling Leaf Development, EMBO J. 17, 170-180 (1998). Bosher et al., “RNA interference can target pre-mRNA: conse U.S. PATENT DOCUMENTS quences for gene expression in a Caenorhabditis elegans operon.” 5,246,921 A 9/1993 Reddy et al. Genetics, vol. 153, No. 3, p. 1245-1256 (Nov. 1999). 5,624,803 A 4/1997 Noonberg et al. 5,814,500 A 9, 1998 Dietz (Continued) 5.998,148 A 12/1999 Bennett et al. 6,107,027 A 8/2000 Kay et al. Primary Examiner — Kimberly Chong 6,130,092 A 10, 2000 Lieber et al. 6,326, 193 B1 12/2001 Liu et al. (74) Attorney, Agent, or Firm — Wilmer Cutler Pickering 6,506,559 B1 1/2003 Fire et al. Hale and Dorr LLP 6,541,248 B1 4/2003 Kingsman et al. 6,573,099 B2 6, 2003 Graham et al. 6,605,429 B1 8, 2003 Barber et al. (57) ABSTRACT 7,691.995 B2 4/2010 Zamore et al. 2002fO086356 A1 7/2002 TuSchlet al. The present invention provides methods for attenuating gene 2002fO114784 A1 8, 2002 Li et al. expression in a cell, especially in a mammalian cell, using 2002/0160393 A1 10/2002 Symonds et al. gene-targeted double stranded RNA (dsRNA), such as a hair 2003/0051263 A1 3/2003 Fire et al. 2003/0055020 A1 3/2003 Fire et al. pin RNA. The dsRNA contains a nucleotide sequence that 2003/0056235 A1 3/2003 Fire et al. hybridizes under physiologic conditions of the cell to the 2003, OO84471 A1 5, 2003 Beach et al. nucleotide sequence of at least a portion of the gene to be 2004/0001811 A1 1/2004 Kreutzer et al. inhibited (the “target' gene). 2004, OO18999 A1 1/2004 Beach et al. 2004/0086884 A1 5, 2004 Beach et al. 2004.0102408 A1 5, 2004 Kreutzer et al. 10 Claims, 68 Drawing Sheets US 8,829.264 B2 Page 2

(56) References Cited Declaration of Dr. Vladimir Drozdoff (executed Aug. 5, 2008). Declaration of Mr. John Maroney (executed Aug. 5, 2008). OTHER PUBLICATIONS Declaration of Professor Gregory Hannon (executed Aug. 5, 2008). Bosher, J.M. & Labouesse, M., RNA Interference: Genetic Wand and Denli AM et al., RNAi: An Ever-Growing Puzzle, Trends Biochem Genetic Watchdog, Nat. Cell Biol. 2, E31-36 (2000). Sci. 28(4): 196-201 (2003). Bosher, J.M. et al., RNA Interference Can Target Pre-mRNA: Con Denliet al., “Processing of primary microRNAs by the Microproces sequences for Gene Expression in a Caenorhabditis elegans Operon, sor complex.” Nature, vol. 432(7014), pp. 231-235 (2004); Epub Genetics 153, 1245-1256 (Nov. 1999). Nov. 7, 2004. Brummelkamp et al., “A system for stable expression of short inter Di Nocera, P.P. & Dawid, I.B., Transient Expression of Genes Intro fering RNAs in mammalian cells.” Science, vol. 296, pp. 550-553 duced Into Cultured Cells of Drosophila, PNAS 80, 7095-7098 (Apr. 2002). (1983). Brummelkamp et al., "Stable Suppression of tumorigenicity by virus Elbashir et al., “Functional anatomy of siRNAs for mediating effi mediated RNA interference.” Cancer cell, vol. 2, pp. 243-247 (2002). cient RNAi in Drosophila melanogaster embryolysate.” The EMBO Buchholz et al., “Enzymatically prepared RNAi libraries.” Nature Journal, vol. 20023): pp. 6877-688 (2001). Mathods, vol. 3, No. 9, pp. 696-700 (Sep. 2006). Elbashir et al., “Duplexes of 21-nucleotide RNAs mediate RNA Caplen et al., “Rescue of polyglutamine-mediated cytotoxicity by Interference in cultured mammalian cells.” Nature vol. 411, pp. 494 double-stranded RNA-mediated RNA interference.’ Human 498 (May 2001). Molecular Genetics, vol. 11, pp. 175-184 (2002). Elbashir et al., “RNA interference is mediated by 21- and Caplen et al., “Specific inhibition of gene expression by Small 22-nucleotida RNAs.” Gene and Development, vol. 15, pp. 188-200 double-stranded RNAs in invertebrate and vertebrate systems.” (2001). PNAS vol. 98, pp. 9742-9747 (Aug. 2001). Ecket al. "Gene based therapy,” Goodman & Gilman's, the Pharma Caplen, N.J. et al., “dsRNA-Mediated Gene Silencing in Cultured cological Basis of Therapeutics, 9th Edition.; 5: 77-101 (1996). Drosophila Cells: A Tissue Culture odel for the analysis of RNA European Search Report for European Patent Application No. Interference.” Gene, 252:95-105 (2000). 05857008.6, mailed May 8, 2008. Caplen, N.J. et al., “RNAi As a Gene Therapy Approach.” Expert European Search report for European Patent application No. Opin. Biol. Ther., 3(4):575-586 (2003). 03732052.0, mailed May 23, 2008. Carmell MA et al., Germline Transmission of RNAi in Mice, Nat European Search Result mailed on Feb. 17, 2010, for European Struct Biol. 10(2):91-2 (2003). Carmell MA et al., RNase III Enzymes and the Initiation of Gene Application No. EP 03732052 filed Jan. 22, 2003. Silencing, Nat Struct Mol Biol. 11(3):214-8 (2004). European SearchResult mailed on Sep. 22, 2009 for European Appli Carmell MAetal. The Argonaute Family: Tentacles That Reach Into cation No. EP 03732052 filed Jan. 22, 2003. RNAi, Developmental Control, Stem Cell Maintenance, and Fagard, M., et al., AG01, QDE-2, and RDE-1 Are Related Proteins Tumorigenesis, Genes Dev. 16(21):2733-42 (2002). Required for Posttranscriptional Gene Silencing in Plants, Quelling Catalanotto, C. et al., Gene Silencing in Worms and Fungi, Nature in Fungi, and RNA Interference in Animals, PNAS97, 11650-1 1654 404, 245 (2000). (Oct. 10, 2000). Caudy AA et al., A Micrococcal Nuclease Homologue in RNAi Final office action mailed on Apr. 17, 2007, for U.S. Appl. No. Effector Complexes, Nature 425(6956):411-4 (2003). 10/055,797, filed Jan. 22, 2002. Caudy AA et al., Fragile X-Related Protein and VIG Associate With Final office action mailed on Jan. 27, 2010, for U.S. Appl. No. the RNA Interference Machinery, Genes Dev. 16(19):2491-6 (2002). 1 1/894,676, filed Aug. 20, 2007. Caudy AA et al., Induction and Biochemical Purification of RNA Final Office Action mailed on Jul. 2, 2010, for U.S. Appl. No. Induced Silencing Complex From Drosophila S2 Cells, Methods 10/997,086, filed Nov. 23, 2004; 13 pages. Mol Biol. 265:59-72 (2004. Final Office Action mailed on Mar. 18, 2011 for U.S. Appl. No. Changet al., “Lessons from Nature: microRNA-based ShRNA librar 12/152,837, filed May 16, 2008. ies.” Nature Methods, vol. 3, No. 9, pp. 707-714 (Sep. 2006). Final Office Action mailed on May 12, 2009, for U.S. Appl. No. Check, E., “RNA to the Rescue? Disease Therapies Based on a 10/997,086, filed Nov. 23, 2004; 17 pages. Technique for Gene Silencing Called RNA Interference Are Racing Fire, A., et al., Potent and Specific Genetic Interference by Double Towards the Clinic, Erika Check Investigates Molecular Medicine's Stranded RNA in Caenorhabditis elegans, Nature 391, 806-811 Next Big Thing.” Nature, 425:10-12 (2003). (1998). Cleary MA et al., Production of complex Nucleic Acid Libraries Fire, A., RNA-Triggered Gene Silencing, Trends Genet. 15,358-363 Using Highly Parallel In Situ Oligonucleotide Synthesis, Nat Meth (1999). ods, 1(3):241-8 (2004); Epub Nov. 18, 2004. Fortier, E. & Belote, J.M., Temperature-Dependent Gene Silencing Cogoni et al., “Post-transcriptional gene silencing across kingdoms.” by an Expressed Inverted Repeatin Drosophila, Genesis 26, 240-244 Current opinion in Genetics and Development, vol. 10, pp. 638-643 (2000). (2000). Fraser A., “Human Genes hit the big screen.” Nature 428:375-378 Cogoni, C. & Macino, G., Gene Silencing in Neurospora crassa (2004). Requires a Protein Homologous to RNA-Dependent RNA Gil et al., “Induction of apoptosis by the DskNA-dependent protein Polymerase, Nature 399, 166-169 (1999). Kinase (PKR): mechanism of Action.” Apopsosis, vol. 5, pp. 107-114 Cogoni, C. & Macino, G., Posttranscriptional Gene Silencing in (2000). Neurospora by a RecQ DNA Helicase, Science 286, 2342-2344 Gillespie, D.E. & Berg, C.A., Homeless is Required for RNA Local (1999). ization in Drosophila Oogenesis and Encodes a New Member of the Connelly, J.C. & Leach. D.R., the sbcC and sbcD genes of DE-H Family of RNA-Dependent ATPases, Genes Dev. 9, 2495 Escherichia coli Encode a Nuclease Involved in Palindrome invi 2508 (1995). ability and Genetic Recombination, Genes Cell 1, 285-291 (1996). Good et al., “Expression of small, therapeutic RNA's in human cell Crooke, ST, Basic Principles of Antisense Therapeutics, Antisense nuclei.” Gene Therapy, vol. 4, pp. 45-54, Stockton Press (1997). Research and Application (1998), Chapter 1, Springer-Verlag, New Grosshans et al., “Micro-RNAS: Small is plentiful.” The Journal of York. Cell Biology, vol. 156, pp. 17-21 (2002). Cullen, “Enhancing and confirming the specificity of RNAi experi Guo, S. & Kemphues, K.J., Par-1, A Gene Required for Establishing ments.” Nature Methods, vol. 3, pp. 677-681 (Sep. 2006). Polarity in C. elegans Embryos, Encodes a Putative Ser/Thr Kinase Dalmay, T., et al. An RNA-Dependent RNA Polymerase Gene in That is Asymmetrically Distributed, Cell 81, 611-620 (1995). Arabidopsis is Required for Posttranscriptional Gene Silencing Gupta et al., Inducible, reversible, and stable RNA interference in Mediated by a Transgene But Not by a Virus, Cell 101, 543-553 mammalian cells, Proc. Natl Acd. Sci. USA 101(7): 1927-32 (2004); (2000). Epub Feb. 4, 2004. US 8,829.264 B2 Page 3

(56) References Cited Kramer, E.R. et al., Activation of the Human Anaphase-Promoting complex by Proteins of the CDC20. Fizzy Family, Curr. Biol. 8, OTHER PUBLICATIONS 1207-1210 (1998). Lam, G. & Thummel, C.S., Inducible Expression of Double Hamilton, J.A. & Baulcombe, D.C., A Species of Small Antisense Stranded RNA Directs Specific Genetic Interference in Drosophila, RNA in Posttranscriptional Gene Silencing in Plants, Science 286, Curr. Biol. 10,957-963 (2000). 950-952 (1999). Lee et al., Distinct Roles for Drosophila Dicer-1 and Dicer-2 in the Hammond et al., “Post-Transcriptional Gene Silencing by Double SiRNA miRNA silencing Pathways, Cell 117, 69-81 (Apr. 2, 2004). Stranded RNA'. Nature Rev. Genetics 2(2): 110-9 (2001). Letter of Apr. 22, 2008 from Douglass N. Ellis, Jr. of Ropes & Gray Hammond, S. et al., “Argonaute2. A Link Between Genetic and LLP to John Maroney, Esq. of Cold Spring Harbor Laboratory. Biochemical Analyses RNAi.” Science, 293:5532, 1146-1150 (2001). Letter of Apr. 28, 2008 from John Maroney of Cold Spring Harbor Hammond, S.M. et al., An RNA-Directed Nuclease Mediates Post Laboratory to Douglass N. Ellis, Jr. of Ropes & Gray LLP Transcriptional Gene Silencing in Drosophila Cells, Nature 404. Letter of Apr. 29, 2008 from Douglass N. Ellis, Jr. from Ropes & Gray 293-296 (2000). LLP to John Maroney, Esq. of Cold Spring Harbor Laboratory. Hannon et al., “RNA interference by short Hairpin RNAs expreseed Letter of Jun. 13, 2008 from John Maroney, Esq. of Cold Spring in vertebrate cells.” Methods Mol Biol 257:255-66 (2004). Harbor Laboratory to James Haley, Esq. of Ropes & Gray LLP. Hannon Get al., “Unlocking the potential of the human genome with Letter of Jun. 4, 2008 from Eric R. Hubbard of Ropes & Gray LLP to RNA interference.” Nature, 431(7006):371-8 (2004). John Maroney, Esq. of Cold Spring Harbor Laboratory. Hannon GJ, “RNA Interference.” Nature 418(6894): 244-51 (2002). Letter of May 9, 2008 to Eric R. Hubbard, Esq. of Ropes & Gray LLP Harui et al., “Frequency and Stability of Chromosomal Integration of from John Maroney, Esq. of Cold Spring Harbor Laboratory. Adenovirus Vectors,” Journal of Virology, vol. 73(7), pp. 6141-6146 Lingeletal. "Nucleic acid 3'-end recognition by the Argonaute2PAZ (Jul 1999). domain.” Nat. Struct & Mol. Biol, vol. 1 1(6):576-577 (2004). Hasuwa et al., “Small interfering RNA and gene silencing in Lipardi et al., “RNAi as randon Degradative PCR.: SiRNA Primers transgenic mice and rats.” FEBS Letters, Elsevier, Amsterdam, NL, Convert mRNA into dsRNAs that are degrated to generate new vol. 532, pp. 227-230 (Dec. 2002). siRNAs.” Cell, vol. 107, pp. 297-307 (2001). He et al., “A microRNA polycistron as a potential human oncogene.” Liu et al., “MicroRNA-dependent localization of targeted mRNAS to Nature 435(7043):828-33 (2005). mammalian P-bodies.” Nat cell Biol. 7(7):719-23 (2005): Epub Jun. He et al., MicroRNAS: Small RNAs with a big role in gene regulation, 5, 2005. Nat Rev. Genet. 5(7):522-31 (2004). Liu et al., “Argonaute 2 is the catalytic engine of mammalian RNAI. Hemann et al., “An epi-allelic seried of p53 hypomorphs created by Science 305(5689): 1437-41 (2004); Epub Jul. 29, 2004. stable RNAi produces distinct tumor phenotypes in vivo.” Nat Genet. Lohmann, J.U. et al., Silencing of Developmental Genes in Hydra, 33(3):396–400 (2003); Epub Feb. 3, 2003. Dev. Biol. 214, 211-214 (1999). Hunter, C., Genetics: A Touch of Elegance with RNAi, Curr. Biol. 9, Lundet al., “Nuclear Export of MicroRNA Precursors.” Science 303, R440-R442 (1999). 95-98 (Jan. 2, 2004). Hutvagner et al., A Cellular Function for the RNA-Interference Manche et al., “Interactions between double-stranded RNA regula Enzyme Dicer i the maturation of the let-7 Small Temporal RNA, tors and the proteinkinase Dai.” Molecular and cellular Biology, Science, vol. 293, pp. 834-838 (Aug. 2001). Amercian Society for Microbiology, Washington, US, vol. 12, pp. Ilves et al., “Retroviral vectors designated for targeted expression of 5238-5248 (Nov. 1992). RNA polymerase III-driven transcripts: a comparative study,' Gene, U.S. Appl. No. 60/243,097, filed Oct. 24, 2000. vol. 171; pp. 203-208 (1996). The U.S. Appl. No. 09/866,557, filed May 24, 2001. Jackson et al., “Expression profiling reveals off-target gene regula Marshall E. "Gene Therapy's growing pains,” Science 269, 1050 tion by RNAi.” Nature Biotechnology 21(6), 635-638 (Jun. 2003). 1055 (1995). Jacobsen, S.E. et al., Disruption of an RNA helicase?RNAse III Gene Matsuda, S. et al., Molecular Cloning and Characterization of a in Arabidopsis Causes Unregulated Cell Division in Floral Novel Human Gene (HERNA) Which Encodes a Putative RNA Meristems, Development 126, 5231-5243 (1999). Helicase, Biochim. Biophys. Acta 1490, 163-169 (2000). Jen, K.Y. et al., “Suppression of Gene Expression by Targeted Dis MCCaffrey et al., “RNA inference in adult mice.” Nature ruption of Messenger RNA: Available Options and Current Strate 418(6893):38-9 (2002). gies.” StemCells, 18:307-319 (2000). McManus et al., “Gene Silencing in mammals by Small interfering Jones, A.L.. et al., DeNovo Methylation and Co-Suppression Induced RNA’s.” Nature Reviews, vol. 3, pp. 737-747 (Oct. 2002). by a Cytoplannically Replicating Plant RNA Virus, EMBO J. 17. McManus et al., “Gene silencing using micro-RNA designed hair 6385-6393 (1998). pins.” RNA, vol. 8, pp. 842-850 (2002). Jones, L., et al., RNA-DNA Interactions and DNA Methylation in Medina et al., “Rina polymerase II-driven expression cassettes in Post-Transcriptional Gene Silencing, Plant Cell 11, 2291-2301 (Dec. human gene therapy. Current opinion in Molecular Therapeutics, 1999). vol. 1(5), pp. 580-594 (1999). Jorgensen et al., “An RNA-based information Superhighway in Mette et al., “Transcriptional silencing and promoter methylation Plants.” Science 279, pp. 1486-1487 (1998). triggered by double stranded RNA.” The EMBO Journal vol. 19(19): Kaleta, R.F. etal. An Integral Membrane Green Fluorescent Protein pp. 5194-5201 (2000). Marker, Us9-GFP. Is Quantitatively Retained in Cells During Miller et al., “Improved retroviral vectors for gene transfer and Propidium Iodide-Based Cell Cycle Analysis by Flow Cytometry, expression.” Biotechniques, vol. 7(9), pp.980-990 (1989). Exp. Cell. Res. 248, 322-328 (1999). Miller, "Retroviruses.” Edited by John M. Coffin, Stephen H. Hughes Kennerdell, J.R. & Carthew, R.W., Heritable Gene Silencing in and Harold E. Varmus, Cold Spring Harbor, NY: Cold Spring harbor Drosophila. Using Double-Stranded RNA, Nat. Biotechnol. 17,896 Laboratory Press; 1997; 6 pages. 898 (2000). Misquitta, L. & Paterson, B.M., Targeted Disruption of Gene Func Kennerdell, J.R. & Carthew, R.W., Use of dsRNA-Mediated Genetic tion in Drosophila by RNA Interference (RNA-i): A Role for Nautilus Interference to Demonstrate That Frizzled 2 Act in the Wingless in Embryonic Somatic muscle Formation, PNAS 96, 1451-1456 Pathway, Cell 95, 1017-1026 (1998). (Feb. 1999). Ketting et al., “Dicer functions in RNA interference and in synthesis Montgomery, M.K. & Fire, A Double-Stranded RNA as a Mediator in of Small RNA involved in developmental timing in C. elegans.” Sequence-Specific Genetic Silencing and Co-Suppression, Trends Genes Dev 15, 2654-2659 (Oct. 15, 2001). Genet. 14, 255-258 (1998). Ketting, R.F. et al., mut-7 of C. elegans, Required for Transposon Montgomery, M.K. et al., RNA as a Target of Double-Stranded Silencing and RNA Interference, Is a Homolog of Werner Syndrome RNA-Mediated Genetic Interference in Caenorhabditis elegans, Helicase and RNaseID, Cell 99, 133-141 (1999). PNAS95, 15502-15507 (Dec. 1998). US 8,829.264 B2 Page 4

(56) References Cited Schneider, I., Cell Lines Derived from Late Embryonic Stages of Drosophila melanogaster, J. Embryol. Exp. Morpho. 27, 353–365 OTHER PUBLICATIONS (1972). Schramke et al., “RNA-interference-directed chromatin modification Moss, Eric G., “RNA Interference: It’s a Small RNA World. Current coupled to RNA polymerase II transcription.” Nature Biology, 11(19), R772-R775 (2001). 435(7046: 1275-9 (2005); Epub Jun. 19, 2005. Mourrain, P. et al., Arabidopsis SGS2 and SGS3 Genes Are Required Sen et al., “A brief history of RNAi: the silence of the genes.” FASEB for Posttranscriptional Gene Silencing and Natural Virus Resistance, J., vol. 20, pp. 1293-1299 (2006). Cell 101,533-542 (2000). Sharp, P.A., RNAi and Double-Strand RNA, Genes Dev. 13, 139-141 Murchison et al., “miRNAs on the move; miRNA biogenesis and the (1999). RNAi machinery,” Curr opinion Cell Biol. 16(3):223-9 (2004). Shi, H. et al., Genetic Interference in Tipanosoma bruceii by Heri Ngo, H. et al., Double-Stranded RNA Induces mRNA Degradation in table and Inducible Double-Stranded RNA, RNA 6, 1069-1076 Trypanosoma brucei, PNAS95, 14687-14692 (Dec. 1998). (2000). Non Final Office Action mailed on Aug. 26, 2009, for U.S. Appl. No. Shuttleworth, J. & Colman, A. Antisense Oligonucleotide-Directed 10/997,086, filed Nov. 23, 2004; 18 pages. Cleavage of mRNA in Xenopus Oocytes and Eggs, EMBO J. 7, Non final office action mailed on Aug. 30, 2010, for U.S. Appl. No. 427-434 (1988). 1 1/894,676, filed Aug. 20, 2007. Sijen, T. & Kooter, J.M., Post-Transcriptional Gene-Silencing: RNAs Non Final Office Action mailed on Feb. 12, 2007, for U.S. Appl. No. on the Attack or on the Defense? Bioessays 22, 520-531 (2000). 10/997,086, filed Nov. 23, 2004; 12 pages. Silva et al., Free energy lights the path toward more effective RNAI. Non final office action mailed on Feb. 9, 2005 for U.S. Appl. No. Nat Genet. 35:303-5 (2003). 10/055,797, filed Jan. 22, 2002. Silva et al., “RNA interference micro arrays: high-throughtput loss Non final office action mailed on Jul. 26, 2006, for U.S. Appl. No. of function genetics in mammaliancells.” Proc. NAtl Acad. Sci USA, 10/055,797, filed Jan. 22, 2002. 101 (17):6548-52 (2004); Epub Apr. 14, 2004. Non final office action mailed on Jun. 23, 2010, for U.S. Appl. No. Silva et al., “RNA interference: a promising appraoch to antiviral 12/152,837, filed Jan. 22, 2002. therapy?,” Trends Mol Med. 8(11): 505-8 (2002). Non final office action mailed on May 4, 2009, for U.S. Appl. No. Silva et al., “RNA-interfrence-based functional genomics in mam 1 1/894,676, filed Aug. 20, 2007. malian cells: reverse genetics coming of age. Oncogene Non final office action mailed on Nov. 8, 2005 for U.S. Appl. No. 23(51):8401-9 (2004). 10/055,797, filed Jan. 22, 2002. Silva Jose et al., “Second-generation shRNA libraries covering the Novina et al. The RNAI Revolution, Nature (2004), vol. 430:161 mouse and human genomes.” Nature genetics, vol. 37, No. 11, pp. 164, Nature Publishing Group. 1281-1288 (Nov. 2005). Opalinska et al., "Nucleic acid therapeutics: basic principals and Singh et al., “Inverted-Repeat DNA: A New Gene-Silencing Tool for recent applications.” Nature reviews: Drug Discovery, vol. 1, pp. Seed Lipid Modification', Biochem Soc. Trans. 28(6):925-927 (2000). 503-5 14 (2002). Siolas Despina et al. : Synthesis shRNAs as potent RNAi triggers, Paddison et al., “A resource for large-scale RNA-interference-based Nature Biotechnology, vol. 23, No. 2, pp. 227-231 (Feb. 2005). screens in mammals.” Nature 428(6981):427-31 (2004). Smardon, A. et al., EGO-1 is Related to RNA-Directed RNA Paddison et al., “Cloning of short hairpin RNAs for gene knockdown Polymerase and Functions in Germ-Line Development and RNA in mammalian cells.” Nature Meth., vol. 1(2): 163-167 (2004). Interference in C. elegans, Curr. Biol. 10, 169-178 (2000). Paddison et al., “RNA interference: the new somatic cell genetics?.” Smith, N.A. et al., Total Silencing by Intron-Spliced Hairpin RNAS, Cancer cell. 2(1): 17-23 (2002). Nature 407, 319-320 (2000). Paddison et al., “Short hairpin activated gene silencing in mammalian Snove Jr et al., “Expressing short Hairpin RNAs in vivo.” Nature cells.” Methods Mol Biol. 265: 85-100 (2004). Methods, vol. 3 No. 9, pp. 689-695 (Sep. 2006). Paddison et al., “Short hairpin RNAs (shRNAs) induce sequence Song et al., “Crystal structure of Argonaute and its applications for specific silencing in mammalian cells. Genes & Development RISC slicer activity.” Science 305(5689): 1434-7 (2004) Epub Jul. 29, 16:948-958 (2002). 2004. Paddison et al., "Stable suppression of gene expression by RNAI in Song et al., “The Crystal structure of the Argonaute 2PAZ domai mammalian cells.”99(3) 1443-1448 (2002). reveals a RNA binding motifin RNAi effector complexes.” Nat Struct Paddison et alm, “SiRNAs and ShRNAS. skeletonkeys to the human Biol. 10(12): 1026-32 (2003); Epub Nov. 16, 2003. genome.” Curr Opinion Mil Ther. 5(3):217-24 (2003). Sorensen et al., “Gene Silencing by systemic delivery of Synthetic Paroo et al., Challenges for RNAi InVivo, Trends in Biotechnology siRNAs in adult Mice.” J. Mol. Biol., vol. 327, pp. 761-766 (2003). (2004), vol. 22(8), 390-394, Elsevier. Sui et al., “A DNA vector-based RNAI technology to suppress gene Pei et al., “On the art of identifying effective and specific siRNAs.” expression in mammaliancells.” PNAS, vol.99, pp. 5515-5520 (Apr. Nature Methods, vol. 3, No. 9, pp. 670-676 (Sep. 2006). 16, 2002). Pham et al., “A Dicer-2-Dependent 80S complex cleaves targeted Svoboda et al., “RNAI in mouse Oocytes and Preimplantation mRNAs during RNAI in Drosophilia.” Cell 117, 83-94 (Apr. 2, Embryos: effectiveness of Hairpin dsRNA.” Biochem. Biophys. Res. 2004). Commum. vol. 287, pp. 1099-1 104 (2001). Piccin et al., “Efficient and Heritable Functional Knock-Out of an Svoboda et al., “RNAi expression of retrotransposons MuERV-L and Adult Phenotype in Drosophila. Using a GAL4-Driven Hairpin RNA IAP in preimplantation mouse embryos.” Dev biol 269(1):276-85 Incorporating a Heterologous Spacer. Nuc. Acid Res., (2004). 29(12):E55: 1-5 (2001). Tabara et al., “The DskNA binding Protein RDE-4 interacts with U.S. Appl. No. 60/305,185, filed Jul. 12, 2001. RDE-1, DCR-1, and a DExH-Box Helicase to direct RNAi in C. Qi et al., Biochemical Specialization within Arabidopsis RNA elegans.” Cell 109,861-871 (Jun. 28, 2002). Silencing Pathways, Mol Cell. 19(3): 421-8 (2005). Tabara, H. et al., RNAi in C. elegans: Soaking in the Genome Ratcliff, F. et al., A Similarity Between Viral Defense and Gene Sequence, Science 282, 430-432 (1998). Silencing in Plants, Science 276, 1558-1560 (1997). Tabara, H. etal. Therde-1 Gene, RNA Interference, and Transposon Rivas et al., Purified Argonaute and an sIRNA form recombinant Silencing in C. elegans, Cell 99, 123-132 (1999). human RISC, Nat Struct Mol Biol, 12(4):340-9 (2005); Epub Mar. Tavernarakis, N. et al., Heritable and Inducible Genetic Interference 30, 2005. by Double-Stranded RNA Encoded by Transgenes, Nat. Genet. 24. Sanchez Alvarado, A. & Newmark, P.A., Double-Stranded RNA 180-183 (2000). Specifically Disrupts Gene Expression During Planarian Regenera Timmons, L. & Fire, A. Specific Interference by Ingested dsRNA, tion, PNAS 96, 5049-5054 (Apr. 1999). Nature 395,854 (1998). US 8,829.264 B2 Page 5

(56) References Cited Wesley et al., "Construct design for efficient, effective and high throughput gene silencing in plants.” The plant Journal, vol. 27(6), OTHER PUBLICATIONS pp. 581-590 (2001). Wianny, F. & Zernicka-Goetz, M., Specific Interference With Gene Tomari et al., “RISC Assembly Defects in the Drosophila RNAi Function by Double-Stranded RNA in Early Mouse Development, Mutant armitage.” Cell 116,831-841 (Mar. 19, 2004). Nature Cell Biol. 2, 70-75 (2000). Tuschl, T. et al., Targeted mRNA Degradation by Double-Stranded Wolf, D.A. & Jackson, P.K., Cell Cycle: Oiling the Gears of RNA in Vitro, Genes Dev. 13,3191-3197 (1999). Anaphase, Curr. Biol. 8, R636-R639 (1998). Ui-Tei et al., Sensitive Assay of RNA Interference in Drosphilia and Wurtele et al., “Illegitimate DNA integration in mammalian cells.” Chinese Hamster Cultured Cells Using Firefly Luciferase Gene as Gene Therapy, vol. 10, pp. 1791-1799 (2003). Target, FEBS Letters (2000), 479:79-82, Elsevier. Yu et al., “RNA interference by expression of short-interfering U.S. Appl. No. 60/307,411, filed Jul. 23, 2001, 32 pages. RNA's and hairpin RNAs in mammalian cells.” PNAS, vol. 99, pp. Vaucheret, H. et al., Transgene-Induced Gene Silencing in Plants, 6047-6052 (Apr. 30, 2002). Plant J. 16, 651-659 (1998). Zamore, P.D. et al., RNAi: Double-Stranded RNA Directs the ATP Vermeulen et al., “the contributions of DsRNA structure to Dicer Dependent Cleavage of mRNA at 21 to 23 Nucleotide Intervals, Cell specificity and efficiency.” RNA. vol. 11, pp. 674-682 (2005). 101, 25-33 (2000). Wadhwa, R. et al., “Know-How of RNA Interference and Its Appli Zhang et al., “Human Dicer preferentially cleaves dsRNAs at their cations in Research and Therapy.” Mutation Research, 567:71-84 termini withour a requirment for ATP.” The Embo Journal 21:58.75 (2004). 5885 (Nov. 1, 2002). Wassenegger, M. & Pelissier, T., A Model for RNA-Mediated Gene Zhanget al., “Single Processing Center Models for Human Dicer and Silencing in Higher Plants, Plant Mol. Biol. 37, 349-362 (1998). Bacterial RNase III.” Cell Vo. 118:57-68 (2004). Waterhouse, PM. et al., Virus Resistance and Gene Silencing in Zhang et al., “Targeted gene silencing by Small interfering RNA Plants Can Be Induced by Simultaneous Expression of Sense and based knock-down technology.” Curr PharmaBiotech, vol. 5, pp. 1-7 Antisense RNA, PNAS95, 13959-13964 (Nov. 1998). (2004). U.S. Patent Sep. 9, 2014 Sheet 1 of 68 US 8,829.264 B2

dsRNA 5N

cyclin E fizzy cyclin A U.S. Patent Sep. 9, 2014 Sheet 2 of 68 US 8,829.264 B2

mRNA cycE fac fac cycE O-Ge 8 - SO (- - & & 8 s 8

cycin E extract i8CX extract Fig. 2A

U.S. Patent Sep. 9, 2014 Sheet 3 of 68 US 8,829.264 B2

U.S. Patent Sep. 9, 2014 Sheet 4 of 68 US 8,829.264 B2

s s g ge geesy risis

Substrate cyclin F lacz Fig. 3

w

as U.S. Patent Sep. 9, 2014 Sheet 5 of 68 US 8,829.264 B2

S2 CES EMBRYO

SO SOO SO SOO

Fig. 5C U.S. Patent Sep. 9, 2014 Sheet 6 of 68 US 8,829.264 B2

Fig.6A Fig. 6C

Helicose ZAP R. C. Rib disrm

R. C. R1b dSrm

Helicose Homeless Fig. 6B U.S. Patent Sep. 9, 2014 Sheet 7 of 68 US 8,829.264 B2

DS?P;

Fig. 6D Fig. 6E Fig. 6F U.S. Patent Sep. 9, 2014 Sheet 8 of 68 US 8,829.264 B2

Fig. 7A Fig. 7B

Z GFP ds + Controlds d49)9NISSER|dXBSTTEO% N GFP ds + dicer ds

Exp. Exp. 2 Exp. 3 Fig. 7C U.S. Patent Sep. 9, 2014 Sheet 9 of 68 US 8,829.264 B2

helicase

helicose AP Rig REbdSIT

D.m. Dicer = :==E, EE 5. 606 1099 246 2 helicase C.e. Dicer EE 498 759 95 325

helicase ZAP R9 E.

ZAP Rugen le U.S. Patent Sep. 9, 2014 Sheet 10 of 68 US 8,829.264 B2

CELL FREE EXTRACT | 2OOKSPN RBOSOME PELET

HIGH SALT EXTRACTION

RBOSOME ASSOCATED PROTEINS

OWSAT PRECIPITATION

PELET SUPERNATANT RNAi ACTIVITY RESOUBLIZE HIGH s

CHROWATOGRAPHY SUPEROSE 6 MONOS MONO CR HYDROXYAPATTE Fig. 9 U.S. Patent Sep. 9, 2014 Sheet 11 of 68 US 8,829.264 B2

...„•,ºwº

U.S. Patent Sep. 9, 2014 Sheet 13 of 68 US 8,829.264 B2

Z||-61 U.S. Patent Sep. 9, 2014 Sheet 14 of 68 US 8,829.264 B2

!&', U.S. Patent Sep. 9, 2014 Sheet 15 of 68 US 8,829.264 B2

Al-Orgonaute-l HS-ef2C Nc-qde-2 Ce-rde Dm-piwi Dm-sting Dm-argonaute Dm-argonaute-2 U.S. Patent Sep. 9, 2014 Sheet 16 of 68 US 8,829.264 B2

Fig. 15 U.S. Patent Sep. 9, 2014 Sheet 17 of 68 US 8,829.264 B2

S2 cells Embryo is --> --> U.S. Patent Sep. 9, 2014 Sheet 18 of 68 US 8,829.264 B2

SO SOO SO SOO -a-ra- - - -er r-e-

Uc cyclin E

mRNA degradation Fig.17 dsRNA processing U.S. Patent Sep. 9, 2014 Sheet 19 of 68 US 8,829.264 B2

3

3

O C lf C 2. 8 is: %O CN

CO y W O) LL

C Cd f .

k

. . . . 4-5 U.S. Patent Sep. 9, 2014 Sheet 20 of 68 US 8,829.264 B2

U.S. Patent Sep. 9, 2014 Sheet 21 of 68 US 8,829.264 B2

SZ As C

E

Fig.20C Helicose ZAP RO Rib dsrm

RO RIIIb disrm

Drosho

Homeless C U.S. Patent Sep. 9, 2014 Sheet 22 of 68 US 8,829.264 B2

Fig. 21 U.S. Patent Sep. 9, 2014 Sheet 23 of 68 US 8,829.264 B2

Fig. 22A U.S. Patent Sep. 9, 2014 Sheet 24 of 68 US 8,829.264 B2

ha C) .9 C) w

U.S. Patent Sep. 9, 2014 Sheet 26 of 68 US 8,829.264 B2

PREDICTED INTRON REPEATS

Fig. 25 U.S. Patent Sep. 9, 2014 Sheet 27 of 68 US 8,829.264 B2

"O CD as 9 Gd V / C O r s CD 2 () --

U.S. Patent Sep. 9, 2014 Sheet 28 of 68 US 8,829.264 B2

STRATEGY FORSTABLE EXPRESSION OF dsRNAIN CULTURED MAMMALIANCELS

CRE RECOMBINASE

NVVO EXPRESSION OF RNA HARPN

PRODUCTION OF dsDNA HOMOLOGOUS TO TARGET mRNA

Fig. 27 U.S. Patent Sep. 9, 2014 Sheet 29 of 68 US 8,829.264 B2

U.S. Patent Sep. 9, 2014 Sheet 30 of 68 US 8,829.264 B2

25 ng dsRNA 4.

1.2

0.8 dSFF 0.6 dSGFP O.4 O.2 2 HOURS 24 HOURS 50 HOURS Fig. 29A

2 250 ng dsRNA

0.8 0.6 d dSFF a disCFP 0.4 0.2 O-- zz, 2 HOURS 24 HOURS 50 HOURS Fig. 29B 1.6 4. . .2

0.8 0.6 0.4 0.2 disfit issFF SFF dis GFP ssGFP ascFP

22 dsRENSSREN OSRENds GFPSSGFP CSGFP Fig. 29D

U.S. Patent Sep. 9, 2014 Sheet 32 of 68 US 8,829.264 B2

. 2

O. 8

O. 6

0. 4.

O. 2

FFds.500 Rends500 GFP dis500 Fig. 31 U.S. Patent Sep. 9, 2014 Sheet 33 of 68 US 8,829.264 B2

P ds 500 Fig. 32A

RENLA FIREFLY

Fig. 32B

N

Fig. 32C U.S. Patent US 8,829.264 B2

DUAL LUCIFERASE ASSAY 2 HRS POST-TRANSFECTION (.4Ug dsRNA) % []

ocC>-osco~soun

T Cl) o ? º?g) I• ),CO Ll CO U.S. Patent Sep. 9, 2014 Sheet 35 of 68 US 8,829.264 B2

Cre

transcription in vivo

Fig. 34B U.S. Patent Sep. 9, 2014 Sheet 36 of 68 US 8,829.264 B2

pGFP pGFP pGFP - -- --

no dsRNA 500ng dsRNA 1000ng dsRNA

dSFF

dSDCER

P9 GFP HARPEN CLONE NUMBER #10 48 HRS POST-TRANSFECTION FLUORESCENT MICROSCOPYSUPERMPOSED WITH BRIGHT FIELD Fig. 34C

siRNAS -- 28

in Vitro in vivo Fig. 34D U.S. Patent Sep. 9, 2014 Sheet 37 of 68 US 8,829.264 B2

.4

2

O CN

O 0 ug Olug ..l Lug ug dsRNAADDED TO EXTRACT Fig. 35 U.S. Patent Sep. 9, 2014 Sheet 38 of 68 US 8,829.264 B2

SLENCING IS SPECIFIC AND REQUIRES dsRNA

6

6

l l n Z CY O H. C 4. U.S. Patent Sep. 9, 2014 Sheet 39 of 68 US 8,829.264 B2

P9 CELLSSOAKED WITH IN dsRNA FOR 12 HRS IN 2m GROWTH MEDIUM (ALPHA MEM, l0% FBS) dsUC dSGFP

Z

O 6

5 2O 40 MCROGRAMS OF dsRNA Fig. 37 U.S. Patent Sep. 9, 2014 Sheet 40 of 68 US 8,829.264 B2

INVITROSYNTHESIS OF siRNAs by T7 RNA POLYMERASE T7 T7 e b ne

TRANSCRIBE/ANNEAL

TREAT CELS

ASSAYPHENOTYPE

DNASYNTHESIS/RNA TRANSCRIPTION -S16/siRNAVERSUS-$400/siRNA FORCHEMICAL SYNTHESIS BRINGS LARGE-SCALE PROJECTS WITHIN REASONABLE BUDGETRANGE

Fig. 38 U.S. Patent Sep. 9, 2014 Sheet 41 of 68 US 8,829.264 B2

siRNA UCGAAGUACUCAGCGUAAGUG AAAGCUUCAUGAGUCGCAUUC

c shiff U CAUCGACUGAAAUCCCUGGUAAUCCGUUG U GUAGCUGACUUUAGGGACCAUUAGGCAAC A A.

CshFf-L7 w as a are as or as wrw U CAUCGACUGAAAUCCCUGGUAAUCCGUUU GGGGC V GUAGCUGAUUUUAGGGACUAUUAGGUAAA UCCCG C UAGGGUAUCG U

c shRf-L7m GCC ------U CAUCGACUGAAAUCCC GUAAUCCGUUU GGGGC \ GUAGCUGAUUUUAGGG UAUUAGGUAAA UCCCG C AC- UAGGGUAUCG U Fig. 39A

LU s

- - - - - + - + EXTRACT ONG INPUT hp INPU

5 ----2 is -22nt C E1. ll U C U U.S. Patent Sep. 9, 2014 Sheet 42 of 68 US 8,829.264 B2

293T He O

d49

Fig. 40

U.S. Patent Sep. 9, 2014 Sheet 44 of 68 US 8,829.264 B2

Fig . 42A

5 - - - GAA GGAUUCCAAUUCAGCGGGAGCCACCUGAU G CCUAAGGUUGAGUCGCUCUCGGUGGGCUA C

Fig. 42B

293 He O

Fig. 42C U.S. Patent Sep. 9, 2014 Sheet 45 of 68 US 8,829.264 B2

1.2

ocºG

-- DICERSiRNA U.S. Patent Sep. 9, 2014 Sheet 46 of 68 US 8,829.264 B2

"SENSE"STRAND

GAA GGUCUAAGUGGAGCCCUUCGAGUGUUA G CCGGGUUCACUUCGGGAGGCUCACAGU C UU GUU "ANTI-SENSE"STRAND

Fig. 44A

ROSV2 MEF

U.S. Patent Sep. 9, 2014 Sheet 47 of 68 US 8,829.264 B2

SMULTANEOUS INTRODUCTION OF MULTIPLE HARPNS DOES NOT PRODUCE SYNERGY E SERIES

O

5 3: :3& is: 53E 5. SE control CONTROL SiRNA HP HP #2 MX Fig. 45 U.S. Patent Sep. 9, 2014 Sheet 48 of 68 US 8,829.264 B2

ENCODED SHORTHAIRPINS FUNCTION If VI VO

PLASMD

EldWISDf^T Fig. 46

U.S. Patent Sep. 9, 2014 Sheet 50 of 68 US 8,829.264 B2

STABLESUPPRESSIONBY SHORT dsRNAS - CLONING STRATEGY

PCR- -- PCR-2

AUTOMATICSUBCLONING INTO VECTOR OF CHOICE

U.S. Patent Sep. 9, 2014 Sheet 51 of 68 US 8,829.264 B2

STABLE SUPPRESSION BY EXPRESSED RNA

Fig. 49 U.S. Patent Sep. 9, 2014 Sheet 52 of 68 US 8,829.264 B2

EARLY PASSAGE PKR-/- MEFs: DUALLUCIFERASE ASSAY WITH LONG dsRNA (-500nt) 1.4

2

dsGFP CSREN

HOURS-POST TRANSFECTION Fig. 50

MOUSETYROSNASE PROMOTER Enhancer. -1404 to -1007 L-1003 to -506 505 to -85.

- - ---ee- 74------a- --- -a-r Fig. 51

U.S. Patent Sep. 9, 2014 Sheet 54 of 68 US 8,829,264 B2

Luciferose Unrelated Untreated SiRNA SiRNA 3000

2500

2000

500

1000

500

OO

80

60

40

20 U.S. Patent Sep. 9, 2014 Sheet 55 of 68 US 8,829.264 B2

UNTREATED pShh. Ff pShh. Ffrew 3000

2500

2000

500

1000

500 Fig. 54A

TOÀNINOOOBIVENIN?n% CONO

ShrNA-NEGATIVE ShrNA-POSITIVE MCE MCE

- Neil

- B-actin

SPLEEN Fig. 55B Fig. 55C U.S. Patent Sep. 9, 2014 Sheet 57 of 68 US 8,829.264 B2

ShrNA-NEGATIVE ShrNA-POSTIVE MICE MCE

as over gr is ess - Neil

as up in Qi se ept) - PCNA Fig. 56A

shRNA-NEGATIVE ShrNA-POSITIVE MICE WICE

U.S. Patent Sep. 9, 2014 Sheet 63 of 68 US 8,829.264 B2

lexieu C GC WNSU WNS u WNSu Z. WNS u Za exileu COZ ofW "WNuS Ju 66 ONA u! obv 'WNS Ju 60 ONA ul Co6w "WNuS Ju 60 ONA ul Co6W 'WNUS Ju 60 ONA u! Je)Jeu C (a WNuSU 6a O.A U. WNUS u 62 O}A U Jesueu q (, Auo Jeuld

U.S. Patent US 8,829.264 B2

? O O O) l

WNAS U.S. Patent Sep. 9, 2014 Sheet 66 of 68 US 8,829.264 B2

| 00|| 09 09 07 0Z 0

00|| 08 09 07 OZ U.S. Patent US 8,829.264 B2

\/09·61

U.S. Patent US 8,829.264 B2

US 8,829,264 B2 1. 2 METHODS AND COMPOSITIONS FOR RNA The potency of RNAi inspired Timmons and Fire (Nature INTERFERENCE 395: 854, 1998) to do a simple experiment that produced an astonishing result. They fed to nematodes bacteria that had RELATED APPLICATIONS been engineered to express double-stranded RNA corre sponding to the C. elegans unc-22 gene. Amazingly, these This application is a continuation of U.S. application Ser. nematodes developed a phenotype similar to that of unc-22 No. 10/997,086, filed on Nov. 23, 2004, which is a continu mutants that was dependent on their food source. The ability ation-in-part of abandoned U.S. application Ser. No. 10/055, to conditionally expose large numbers of nematodes to gene 797, filed on Jan. 22, 2002. The aforementioned applications specific double-stranded RNA formed the basis for a very are incorporated herein by reference. 10 powerful screen to select for RNAi-defective C. elegans mutants and then to identify the corresponding genes. GOVERNMENT SUPPORT Double-stranded RNAs (dsRNAs) can provoke gene silencing in numerous invitro contexts including Drosophila, Work described herein was supported by National Insti Caenorhabditis elegans, planaria, hydra, trypanosomes, tutes of Health Grant RO1-GM62534. The United States Gov 15 fungi and plants. However, the ability to recapitulate this ernment may have certain rights in the invention. phenomenon in higher eukaryotes, particularly mammalian cells, has not been accomplished in the art. Nor has the prior SEQUENCE LISTING art demonstrated that this phenomena can be observed in cultured eukaryotic cells. Additionally, the rules established The instant application contains a Sequence Listing which by the prior art have taught that RNAi requires exon has been submitted electronically in ASCII format and is sequences, and thus constructs consisting of intronic or pro hereby incorporated by reference in its entirety. Said ASCII moter sequences were not believed to be effective reagents in copy, created on Jan. 16, 2014, is named mediating RNAi. The present invention aims to address each 287000. 130US4 SL.txt and is 138,550 bytes in size. 25 of these deficiencies in the prior art and provides evidence both that RNAi can be observed in cultured eukaryotic cells BACKGROUND OF THE INVENTION and that RNAi constructs consisting of non-exon sequences can effectively repress gene expression. “RNA interference”, “post-transcriptional gene silencing, “quelling these different names describe similar effects 30 SUMMARY OF THE INVENTION that result from the overexpression or misexpression of trans genes, or from the deliberate introduction of double-stranded One aspect of the present invention provides a method for RNA into cells (reviewed in Fire, Trends Genet 15:358-363, attenuating expression of a target gene in cultured cells, com 1999: Sharp, Genes Dev 13: 139-141, 1999: Hunter, Curr prising introducing double stranded RNA (dsRNA) into the Biol 9: R440-R442, 1999: Baulcombe, Curr Biol 9: R599 35 cells in an amount Sufficient to attenuate expression of the R601, 1999; Vaucheret et al., Plant J 16: 651-659, 1998). The target gene, wherein the dsRNA comprises a nucleotide injection of double-stranded RNA into the nematode Cae sequence that hybridizes under Stringent conditions to a norhabditis elegans, for example, acts systemically to cause nucleotide sequence of the target gene. the post-transcriptional depletion of the homologous endog Another aspect of the present invention provides a method enous RNA (Fire et al., Nature 391: 806-811, 1998; and 40 for attenuating expression of a target gene in a mammalian Montgomery et al., PNAS 95: 15502-15507, 1998). RNA cell, comprising: (i) activating one or both of a Dicer activity interference, commonly referred to as RNAi offers a way of oran Argonaut activity in the cell, and (ii) introducing into the specifically and potently inactivating a cloned gene, and is cell a double stranded RNA (dsRNA) in an amount sufficient proving a powerful tool for investigating gene function. to attenuate expression of the target gene, wherein the dsRNA Although the phenomenon is interesting in its own right; the 45 comprises a nucleotide sequence that hybridizes under Strin mechanism has been rather mysterious, but recent research— gent conditions to a nucleotide sequence of the target gene. for example that recently reported by Smardon et al., Curr In certain embodiments, the cell is Suspended in culture; Biol 10: 169-178, 2000 is beginning to shed light on the while in other embodiments the cell is in a whole animal, such nature and evolution of the biological processes that underlie as a non-human mammal. RNAi. 50 In certain preferred embodiments, the cell is engineered RNAi was discovered when researchers attempting to use with (i) a recombinant gene encoding a Dicer activity, (ii) a the antisense RNA approach to inactivate a C. elegans gene recombinant gene encoding an Argonaut activity, or (iii) both. found that injection of sense-strand RNA was actually as For instance, the recombinant gene may encode, for a effective as the antisense RNA at inhibiting gene function example, a protein which includes an amino acid sequence at (Guo et al., Cell 81: 611-620, 1995). Further investigation 55 least 50 percent identical to SEQID NO: 2 or 4; or be defined revealed that the active agent was modest amounts of double by a coding sequence which hybridizes under wash condi stranded RNA that contaminate in vitro RNA preparations. tions of 2xSSC at 22°C. to SEQ ID NO: 1 or 3. In certain Researchers quickly determined the rules and effects of embodiments, the recombinant gene may encode, for a RNAi which have become the paradigm for thinking about example, a protein which includes an amino acid sequence at the mechanism which mediates this affect. Exon sequences 60 least 50 percent identical to the Argonaut sequence shown in are required, whereas introns and promoter sequences, while FIG. 24. In certain embodiments, the recombinant gene may ineffective, do not appear to compromise RNAi (though there encode a protein which includes an amino acid sequence at may be gene-specific exceptions to this rule). RNAi acts least 60%, 70%, 80%, 85%, 90%, or 95% identical to SEQID systemically—injection into one tissue inhibits gene function NO: 2 or 4. In certain embodiments, the recombinant gene in cells throughout the animal. The results of a variety of 65 may be defined by a coding sequence which hybridizes under experiments, in C. elegans and other organisms, indicate that stringent conditions, including a wash step selected from RNAi acts to destabilize cellular RNA after RNA processing. 0.2-2.0xSSC at from 50° C.-65° C., to SEQID NO: 1 or 3. US 8,829,264 B2 3 4 In certain embodiments, rather than use a heterologous the sequence. In other embodiments, the vector includes two expression construct(s), an endogenous Dicer gene or Argo sequences which, respectively, give rise to the two comple naut gene can be activated, e.g., by gene activation technol mentary sequences which form the dsRNA when annealed. In ogy, expression of activated transcription factors or other still other embodiments, the vector includes a coding signal transduction protein(s), which induces expression of 5 sequence which forms a hairpin. In certain embodiments, the the gene, or by treatment with an endogenous factor which vectors are episomal, e.g., and transfection is transient. In upregulates the level of expression of the protein or inhibits other embodiments, the vectors are chromosomally inte the degradation of the protein. grated, e.g., to produce a stably transfected cell line. Preferred In certain preferred embodiments, the target gene is an vectors for forming such stable cell lines are described in U.S. endogenous gene of the cell. In other embodiments, the target 10 Pat. No. 6,025,192 and PCT publication WO 98/12339, gene is a heterologous gene relative to the genome of the cell, which are incorporated by reference herein. Such as a pathogen gene, e.g., a viral gene. Another aspect the present invention provides a double In certain embodiments, the cell is treated with an agent stranded (ds) RNA for inhibiting expression of a mammalian that inhibits protein kinase RNA-activated (PKR) apoptosis, gene. The dsRNA comprises a first nucleotide sequence that Such as by treatment with agents which inhibit expression of 15 hybridizes under stringent conditions, including a wash step PKR, cause its destruction, and/or inhibit the kinase activity of 0.2xSSC at 65°C., to a nucleotide sequence of at least one of PKR. mammalian gene and a second nucleotide sequence which is In certain preferred embodiments, the cell is a primate cell, complementary to the first nucleotide sequence. Such as a human cell. In one embodiment, the first nucleotide sequence of said In certain preferred embodiments, the length of the dsRNA double-stranded RNA is at least 20, 21, 22, 25, 50, 100, 200, is at least 20, 21 or 22 nucleotides in length, e.g., correspond 300, 400, 500, 800 nucleotides in length. ing in size to RNA products produced by Dicer-dependent In another embodiment, the first nucleotide sequence of cleavage. In certain embodiments, the dsRNA construct is at said double-stranded RNA is identical to at least one mam least 25, 50, 100, 200, 300 or 400 bases. In certain embodi malian gene. In another embodiment, the first nucleotide ments, the dsRNA construct is 400-800 bases in length. 25 sequence of said double-stranded RNA is identical to one In certain preferred embodiments, expression of the target mammalian gene. In yet another embodiment, the first nucle gene is attenuated by at least 5 fold, and more preferably at otide sequence of said double-stranded RNA hybridizes least 10, 20 or even 50 fold, e.g., relative to the untreated cell under stringent conditions to at least one human gene. In still or a cell treated with a dsRNA construct which does not another embodiment, the first nucleotide sequence of said correspond to the target gene. 30 double-stranded RNA is identical to at least one human gene. Yet another aspect of the present invention provides a In still another embodiment, the first nucleotide sequence of method for attenuating expression of a target gene in cultured said double-stranded RNA is identical to one human gene. cells, comprising introducing an expression vector having a The double-stranded RNA may be an siRNA or a hairpin, "coding sequence' which, when transcribed, produces and may be expressed transiently or stably. In one embodi double stranded RNA (dsRNA) in the cell in an amount 35 ment, the double-stranded RNA is a hairpin comprising a first Sufficient to attenuate expression of the target gene, wherein nucleotide sequence that hybridizes under stringent condi the dsRNA comprises a nucleotide sequence that hybridizes tions to a nucleotide sequence of at least one mammalian under Stringent conditions to a nucleotide sequence of the gene, and a second nucleotide sequence which is a comple target gene. In certain embodiments, the vector includes a mentary inverted repeat of said first nucleotide sequence and single coding sequence for the dsRNA which is operably 40 hybridizes to said first nucleotide sequence to form a hairpin linked to (two) transcriptional regulatory sequences which Structure. cause transcription in both directions to form complementary The first nucleotide sequence of said double-stranded RNA transcripts of the coding sequence. In other embodiments, the can hybridize to either coding or non-coding sequence of at vector includes two coding sequences which, respectively, least one mammalian gene. In one embodiment, the first give rise to the two complementary sequences which form the 45 nucleotide sequence of said double-stranded RNA hybridizes dsRNA when annealed. In still other embodiments, the vector to a coding sequence of at least one mammalian gene. In includes a coding sequence which forms a hairpin. In certain another embodiment, the first nucleotide sequence of said embodiments, the vectors are episomal, e.g., and transfection double-stranded RNA hybridizes to a coding sequence of at is transient. In other embodiments, the vectors are chromo least one human gene. In another embodiment, the first nucle Somally integrated, e.g., to produce a stably transfected cell 50 otide sequence of said double-stranded RNA is identical to a line. Preferred vectors for forming such stable cell lines are coding sequence of at least one mammalian gene. In still described in U.S. Pat. No. 6,025,192 and PCT publication another embodiment, the first nucleotide sequence of said WO 98/12339, which are incorporated by reference herein. double-stranded RNA is identical to a coding sequence of at Another aspect of the present invention provides a method least one human gene. for attenuating expression of a target gene in cultured cells, 55 In another embodiment, the first nucleotide sequence of comprising introducing an expression vector having a “non said double-stranded RNA hybridizes to a non-coding coding sequence' which, when transcribed, produces double sequence of at least one mammalian gene. In another embodi stranded RNA (dsRNA) in the cell in an amount sufficient to ment, the first nucleotide sequence of said double-stranded attenuate expression of the target gene. The non-coding RNA hybridizes to a non-coding sequence of at least one sequence may include intronic or promoter sequence of the 60 human gene. In another embodiment, the first nucleotide target gene of interest, and the dsRNA comprises a nucleotide sequence of said double-stranded RNA is identical to a non sequence that hybridizes under Stringent conditions to a coding sequence of at least one mammalian gene. In still nucleotide sequence of the promoter or intron of the target another embodiment, the first nucleotide sequence of said gene. In certain embodiments, the vector includes a single double-stranded RNA is identical to a non-coding sequence sequence for the dsRNA which is operably linked to (two) 65 of at least one human gene. In any of the foregoing embodi transcriptional regulatory sequences which cause transcrip ments, the non-coding sequence may be a non-transcribed tion in both directions to form complementary transcripts of Sequence. US 8,829,264 B2 5 6 Still another aspect of the present invention provides an from such modified oocytes could not give rise to viable assay for identifying nucleic acid sequences, either coding or organisms. Non-limiting examples of Such modifications non-coding sequences, responsible for conferring a particular include those that decrease or eliminate expression of cell phenotype in a cell, comprising: (i) constructing a variegated Surface receptors (i.e., integrins) required for the recognition library of nucleic acid sequences from a cell in an orientation 5 between the blastocyst and the uterine wall, modifications relative to a promoter to produce double stranded DNA; (ii) that decrease or eliminate expression of proteases (i.e., col introducing the variegated dsRNA library into a culture of lagenase, Stromelysin, and plasminogen activator) required to target cells; (iii) identifying members of the library which digest matrix in the uterine lining and thus allow proper confer a particular phenotype on the cell, and identifying the implantation, and modifications that decrease or eliminate sequence from a cell which correspond, such as being iden 10 expression of proteases (i.e., trypsin) necessary for the blas tical or homologous, to the library member. tocyst to hatch from the Zona pellucida. Such hatching is Yet another aspect of the present invention provides a required for implantation. method of conducting a drug discovery business comprising: In another embodiment, embryonic stem cells, embryonic (i) identifying, by the Subject assay, a target gene which stem cells obtained from fertilization of modified oocytes, or provides a phenotypically desirable response when inhibited 15 the differentiated progeny thereof, can be modified or further by RNAi; (ii) identifying agents by their ability to inhibit modified with one or more dsRNAs. In a preferred embodi expression of the target gene or the activity of an expression ment, the modification decreases or eliminates MHC expres product of the target gene; (iii) conducting therapeutic pro sion. Cells modified in this way will be tolerated by the filing of agents identified in Step (b), or further analogs recipient, thus avoiding complications arising from graft thereof, for efficacy and toxicity in animals; and (iv) formu rejection. Such modified cells are suitable for transplantation lating a pharmaceutical preparation including one or more into a related or unrelated patient to treat a condition charac agents identified in step (iii) as having an acceptable thera terized by cell damage or cell loss. peutic profile. In another aspect of the invention, the undifferentiated The method may include an additional step of establishing stem cell is an adult stem cell. Exemplary adult stem cells a distribution system for distributing the pharmaceutical 25 include, but are not limited to, hematopoietic stem cells, preparation for sale, and may optionally include establishing mesenchymal stem cells, cardiac stem cells, pancreatic stem a sales group for marketing the pharmaceutical preparation. cells, and neural stem cells. Exemplary adult stem cells Another aspect of the present invention provides a method include any stem cell capable of forming differentiated ecto of conducting a target discovery business comprising: (i) dermal, mesodermal, or endodermal derivatives. Non-limit identifying, by the Subject assay, a target gene which provides 30 ing examples of differentiated cell types which arise from a phenotypically desirable response when inhibited by RNAi; adult stem cells include: blood, skeletal muscle, myocardium, (ii) (optionally) conducting therapeutic profiling of the target endocardium, pericardium, bone, cartilage, tendon, ligament, gene for efficacy and toxicity in animals; and (iii) licensing, to connective tissue, adipose tissue, liver, pancreas, skin, neural a third party, the rights for further drug development of inhibi tissue, lung, Small intestine, large intestine, gallbladder, rec tors of the target gene. 35 tum, anus, bladder, female or male reproductive tract, geni Another aspect of the invention provides a method for tals, and the linings of the body cavity. inhibiting RNAi by inhibiting the expression or activity of an In one embodiment, an undifferentiated adult stem cell, or RNAi enzyme. Thus, the subject method may include inhib the differentiated progeny thereof, is altered with one or more iting the activity of Dicer and/or the 22-mer RNA. dsRNAs to decrease or eliminate MHC expression. Cells Still another aspect relates to a method for altering the 40 modified in this way will be tolerated by the recipient, thus specificity of an RNAi by modifying the sequence of the RNA avoiding complications arising from graft rejection. Such component of the RNAi enzyme. modified cells are suitable for transplantation into a related or In another aspect, gene expression in an undifferentiated unrelated patient to treat a condition characterized by cell stem cell, or the differentiated progeny thereof, is altered by damage or cell loss. introducing dsRNA of the present invention. In one embodi 45 In another aspect of the invention, an embryonic stem cell, ment, the stem cells are embryonic stem cells. Preferably, the an undifferentiated adult stem cell, or the differentiated prog embryonic stem cells are derived from mammals, more pref eny of either an embryonic or adult stem cell is altered with erably from non-human primates, and most preferably from one or more dsRNA to decrease or eliminate expression of humans. genes required for HIV infection. In a preferred embodiment, The embryonic stem cells may be isolated by methods 50 the stem cell is one capable of giving rise to hematopoietic known to one of skill in the art from the inner cell mass (ICM) cells. Modified cells with hematopoietic potential can be of blastocyst stage embryos. In one embodiment the embry transplanted into a patient as a preventative therapy or treat onic stem cells are obtained from previously established cell ment for HIV or AIDS. lines. In a second embodiment, the embryonic stem cells are Another aspect of the invention relates to purified or semi derived de novo by standard methods. 55 purified preparations of the RNAi enzyme or components In another aspect, the embryonic stem cells are the result of thereof. In certain embodiments, the preparations are used for nuclear transfer. The donor nuclei are obtained from any identifying compounds, especially small organic molecules, adult, fetal, or embryonic tissue by methods well known in the which inhibit or potentiate the RNAi activity. Small molecule art. In one embodiment, the donor nuclei is transferred to a inhibitors, for example, can be used to inhibit dsRNA recipient oocyte which had previously been modified. In one 60 responses in cells which are purposefully being transfected embodiment, the oocyte is modified using one or more dsR with a virus which produces double stranded RNA. NAs. Exemplary modifications of the recipient oocyte The dsRNA construct may comprise one or more strands of include any changes in gene or protein expression that prevent polymerized ribonucleotide. It may include modifications to an embryo derived from said modified oocyte from Success either the phosphate-sugar backbone or the nucleoside. The fully implanting in the uterine wall. Since implantation in the 65 double-stranded structure may be formed by a single self uterine wall is essential for fertilized mammalian embryos to complementary RNA strand or two complementary RNA progress from beyond the blastocyst stage, embryos made strands. RNA duplex formation may be initiated either inside US 8,829,264 B2 7 8 or outside the cell. The dsRNA construct may be introduced (iii) reduces expression of said target gene in a manner depen in an amount which allows delivery of at least one copy per dent on the sequence of said complementary regions. Prefer cell. Higher doses of double-stranded material may yield ably, the shRNA comprises a 3' overhang of about 1-4 nucle more effective inhibition. Inhibition is sequence-specific in otides. that nucleotide sequences corresponding to the duplex region 5 Yet another related aspect of the invention provides a of the RNA are targeted for genetic inhibition. In certain method for attenuating expression of one or more target genes embodiments, dsRNA constructs containing a nucleotide in mammalian cells, comprising introducing into the mam sequences identical to a portion of the target gene are pre malian cells a variegated library of single-stranded hairpin ferred for inhibition. RNA sequences with insertions, dele ribonucleic acid (shRNA) species, each shRNA species com tions, and single point mutations relative to the target 10 prising self complementary sequences of 19 to 100 nucle sequence (i.e., RNA sequences similar to the target sequence) otides that form duplex regions and which hybridize under have also been found to be effective for inhibition. Thus, intracellular conditions to a target gene, wherein each of said sequence identity may be optimized by alignment algorithms hairpin RNA species: (i) is a substrate for cleavage by a known in the art and calculating the percent difference RNaseIII enzyme to produce a double-stranded RNA prod between the nucleotide sequences. Alternatively, the duplex 15 uct, (ii) does not produce a general sequence-independent region of the RNA may be defined functionally as a nucle killing of the mammalian cells, and (iii) if complementary to otide sequence that is capable of hybridizing with a portion of a target sequence, reduces expression of said target gene in a the target gene transcript. In another embodiment, dsRNA manner dependent on the sequence of said complementary constructs containing nucleotide sequences identical to a regions. Preferably, the shRNA comprises a 3' overhang of non-coding portion of the target gene are preferred for inhi about 1-4 nucleotides. bition. Exemplary non-coding regions include introns and the In one embodiment, the shRNA comprises a 3' overhang of promoter region. Sequences with insertions, deletions, and 2 nucleotides. single point mutations relative to the target non-coding In one embodiment, the shRNA comprises self-comple sequence may also be used. mentary sequences of 25 to 29 nucleotides that form duplex Yet another aspect of the invention pertains to transgenic 25 regions. non-human mammals which include a transgene encoding a In one embodiment, the self-complementary sequences are dsRNA construct, wherein the dsRNA is identical or similar 29 nucleotides in length. to either the coding or non-coding sequence of the target gene, In one embodiment, the shRNA is transfected or microin preferably which is stably integrated into the genome of cells jected into said mammalian cells. in which it occurs. The animals can be derived by oocyte 30 In one embodiment, the shRNA is a transcriptional product microinjection, for example, in which case all of the nucle that is transcribed from an expression construct introduced ated cells of the animal will include the transgene, or can be into said mammalian cells, which expression construct com derived using embryonic stem (ES) cells which have been prises a coding sequence for transcribing said shRNA, oper transfected with the transgene, in which case the animal is a ably linked to one or more transcriptional regulatory chimera and only a portion of its nucleated cells will include 35 sequences. The transcriptional regulatory sequences may the transgene. In certain instances, the sequence-independent include a promoter for an RNA polymerase, such as a cellular dsRNA response, e.g., the PKR response, is also inhibited in RNA polymerase. those cells including the transgene. In one embodiment, the promoter is a U6 promoter, a T7 In still other embodiments, dsRNA itself can be introduced promoter, a T3 promoter, or an SP6 promoter. into an ES cell in order to effect gene silencing, and that 40 In one embodiment, the transcriptional regulatory phenotype will be carried for at least several rounds of divi sequences includes an inducible promoter. Sion, e.g., into the progeny of that cell. In one embodiment, the mammalian cells are stably trans Another aspect of the invention provides a method for fected with said expression construct. attenuating expression of a target gene in mammalian cells, In one embodiment, the mammaliancells are primate cells, comprising introducing into the mammalian cells a single 45 Such as human cells. stranded hairpin ribonucleic acid (shRNA) comprising self In one embodiment, the shRNA is introduced into the complementary sequences of 19 to 100 nucleotides that form mammalian cells in cell culture or in an animal. a duplex region, which self complementary sequences In one embodiment, the expression of the target is attenu hybridize under intracellular conditions to a target gene, ated by at least 33 percent relative expression in cells not wherein said hairpin RNA: (i) is a substrate for cleavage by a 50 treated said hairpin RNA. RNaseIII enzyme to produce a double-stranded RNA prod In one embodiment, the target gene is an endogenous gene uct, (ii) does not produce a general sequence-independent or a heterologous gene relative to the genome of the mamma killing of the mammaliancells, and (iii) reduces expression of lian cell. said target gene in a manner dependent on the sequence of In one embodiment, the self complementary sequences said complementary regions. Preferably, the shRNA com 55 hybridize under intracellular conditions to a non-coding prises a 3' overhang of about 1-4 nucleotides. sequence of the target gene selected from a promoter A related aspect of the invention provides a method for sequence, an enhancer sequence, or an intronic sequence. attenuating expression of a target gene in mammalian cells, In one embodiment, the shRNA includes one or more comprising introducing into the mammalian cells a single modifications to phosphate-Sugar backbone or nucleosides stranded hairpin ribonucleic acid (shRNA) comprising self 60 residues. complementary sequences of 19 to 100 nucleotides that form In one embodiment, the variegated library of snRNA spe a duplex region, which self complementary sequences cies are arrayed a solid Substrate. hybridize under intracellular conditions to a target gene, In one embodiment, the method includes the further step of wherein said hairpin RNA: (i) is cleaved in the mammalian identifying shRNA species of said variegated library which cells to produce an RNA guide sequence that enters an Argo 65 produce a detected phenotype in said mammalian cells. naut-containing complex, (ii) does not produce a general In one embodiment, the shRNA is a chemically synthe sequence-independent killing of the mammalian cells, and sized product or an in vitro transcription product. US 8,829,264 B2 10 Another aspect of the invention provides a method of a transcript derived from the portion of the cyclin EcDNA not enhancing the potency/activity of an RNAi therapeutic for a contained within the transfected dsRNA. E-ds is identical to mammalian patient, said RNAi therapeutic comprising an the dsRNA that had been transfected into S2 cells. Time siRNA of 19-22 paired polynucleotides, the method compris points were 0 and 30 min. (c) Synthetic transcripts comple ing replacing said siRNA with a single-stranded hairpin RNA mentary to the complete cyclin EcDNA (Eas) or the final 600 (shRNA) of claim 1 or 2, wherein said duplex region com nucleotides (Eas600) or 300 nucleotides (Eas300) were incu prises the same 19-22 paired polynucleotides of said siRNA. bated in extract for 0 or 30 min. In one embodiment, the shRNA comprises a 3' overhang of FIG. 3: Substrate requirements of the RISC. Extracts were 2 nucleotides. prepared from cells transfected with cyclin E dsRNA. Ali In one embodiment, the half-maximum inhibition by said 10 quots were incubated for 30 min at 30°C. before the addition RNAi therapeutic is achieved by a concentration of said of either the cyclin E (E600) or lacZ (Z800) substrate. Indi shRNA at least about 20% lower than that of said siRNA. vidual 20Ll aliquots, as indicated, were pre-incubated with 1 In one embodiment, the half-maximum inhibition by said mM CaCl and 5 mMEGTA, 1 mM CaCl, 5 mM EGTA and RNAi therapeutic is achieved by a concentration of said 60 U of micrococcal nuclease, 1 mM CaCl and 60 U of shRNA at least about 100% lower than that of said siRNA. 15 micrococcal nuclease or 10 U of DNase I (Promega) and 5 In one embodiment, the end-point inhibition by said mM EGTA. After the 30 min pre-incubation, EGTA was shRNA is at least about 40% higher than that of said siRNA. added to those samples that lacked it. Yeast tRNA (1 lug) was In one embodiment, the end-point inhibition by said added to all samples. Time points were at 0 and 30 min. shRNA is at least about 2-6 fold higher than that of said FIG. 4: The RISC contains a potential guide RNA. (a) siRNA. Northern blots of RNA from either a crude lysate or the S100 Another aspect of the invention provides a method of fraction (containing the soluble nuclease activity, see Meth designing a short hairpin RNA (shRNA) construct for RNAi, ods) were hybridized to a riboprobe derived from the sense said shRNA comprising a 3' overhang of about 1-4 nucle strand of the cyclin E mRNA. (b) Soluble cyclin-E-specific otides, the method comprising selecting the nucleotide about nuclease activity was fractionated as described in Methods. 21 bases 5' to the most 3'-end nucleotide as the first paired 25 Fractions from the anion-exchange resin were incubated with nucleotide in a cognate doubled-stranded siRNA with the the lacz, control substrate (upper panel) or the cyclin E sub same 3' overhang. strate (centre panel). Lower panel, RNA from each fraction In one embodiment, the shRNA comprises 25-29 paired was analysed by northern blotting with a uniformly labeled polynucleotides. transcript derived from sense strand of the cyclin E. cDNA. In one embodiment, the shRNA, when cut by a Dicer 30 DNA oligonucleotides were used as size markers. enzyme, produces a product siRNA that is either identical to, FIG. 5: Generation of 22 mers and degradation of mRNA or differ by a single basepair immediately 5' to the 3' overhang are carried out by distinct enzymatic complexes. (a) Extracts from, said cognate siRNA. prepared either from 0-12 hour Drosophila embryos or In one embodiment, the Dicer enzyme is a human Dicer. Drosophila S2 cells (see Methods) were incubated for 0, 15, In one embodiment, the 3' overhang has 2 nucleotides. 35 30, or 60 minutes (left to right) with a uniformly-labeled In one embodiment, the shRNA is for RNAi in mammalian double-stranded RNA corresponding to the first 500 nucle cells. otides of the Drosophila cyclin E coding region. Mindicates All embodiments described above can be freely combined a marker prepared by in vitro transcription of a synthetic with one or more other embodiments whenever appropriate. template. The template was designed to yield a 22 nucleotide Such combination also includes embodiments described 40 transcript. The doublet most probably results from improper under different aspects of the invention. initiation at the +1 position. (b) Whole-cell extracts were prepared from S2 cells that had been transfected with a BRIEF DESCRIPTION OF THE DRAWINGS dsRNA corresponding to the first 500 nt. of the luciferase coding region. S10 extracts were spun at 30,000xg for 20 FIG. 1: RNAi in S2 cells. (a) Drosophila S2 cells were 45 minutes which represents our standard RISC extract. S100 transfected with a plasmid that directs lacZ expression from extracts were prepared by further. centrifugation of S10 the copia promoter in combination with dsRNAs correspond extracts for 60 minutes at 100,000xg. Assays for mRNA ing to either human CD8 or lacz, or with no dsRNA, as degradation were carried out as described previously for 0.30 indicated. (b) S2 cells were co-transfected with a plasmid that or 60 minutes (left to right in each set) with either a single directs expression of a GFP-US9 fusion protein and dsRNAs 50 stranded luciferase mRNA or a single-stranded cyclin E of either lacz or cyclin E, as indicated. Upper panels show mRNA, as indicated. (c) S10 or S100 extracts were incubated FACS profiles of the bulk population. Lower panels show with cyclin EdsRNAs for 0, 60 or 120 minutes (L to R). FACS profiles from GFP-positive cells. (c) Total RNA was FIG. 6: Production of 22 mers by recombinant CG4792/ extracted from cells transfected with lacZ, cyclin E, fizzy or Dicer. (a) Drosophila S2 cells were transfected with plasmids cyclin A dsRNAs, as indicated. Northern blots were hybrid 55 that direct the expression of T7-epitope tagged versions of ized with sequences not present in the transfected dsRNAs. Drosha, CG4792/Dicer-1 and Homeless. Tagged proteins FIG. 2: RNAi in vitro. (a) Transcripts corresponding to were purified from cell lysates by immunoprecipitation and either the first 600 nucleotides of Drosophila cyclin E (E600) were incubated with cyclin E dsRNA. For comparison, reac or the first 800 nucleotides of lacz (Z800) were incubated in tions were also performed in Drosophila embryo and S2 cell lysates derived from cells that had been transfected with 60 extracts. As a negative control, immunoprecipitates were pre either lacZ or cyclin E (cycE) dsRNAs, as indicated. Time pared from cells transfected with a B-galactosidase expres points were 0, 10, 20, 30, 40 and 60 minforcyclin E and 0, 10, sion vector. Pairs of lanes show reactions performed for 0 or 20, 30 and 60 min for lacz. (b) Transcripts were incubated in 60 minutes. The synthetic marker (M) is as described in the an extract of S2 cells that had been transfected with cyclin E legend to FIG. 1. (b) Diagrammatic representations of the dsRNA (cross-hatched box, below). Transcripts corre 65 domainstructures of CG4792/Dicer-1, Drosha and Homeless sponded to the first 800 nucleotides of lacZ or the first 600, are shown. (c) Immunoprecipitates were prepared from deter 300, 220 or 100 nucleotides of cyclin E, as indicated. Eout is gent lysates of S2 cells using an antiserum raised against the US 8,829,264 B2 11 12 C-terminal 8 amino acids of Drosophila Dicer-1 (CG4792). Psi-Blast and is thus shown in a different color. For compari As controls, similar preparations were made with a pre-im son, a domain structure of the RDE1/QDE2/ARGONAUTE mune serum and with an immune serum that had been pre family is shown. It should be noted that the ZAP domains are incubated with an excess of antigenic peptide. Cleavage reac more similar within each of the Dicer and ARGONAUTE tions in which each of these precipitates was incubated with families than they are between the two groups. (c) An align an ~500 nt. fragment of Drosophila cyclin E are shown. For ment of the ZAP domains in selected Dicer and Argonaute comparison, an incubation of the Substrate in Drosophila family members is shown. The alignment was produced using embryo extract was electrophoresed in parallel. (d) Dicer ClustalW. immunoprecipitates were incubated with dsRNA substrates FIG. 9: Purification strategy for RISC. (second step in in the presence or absence of ATP. For comparison, the same 10 substrate was incubated with S2 extracts that either contained RNAi model). added ATP or that were depleted of ATP using glucose and FIG. 10: Fractionation of RISC activity over sizing col hexokinase (see methods). (e) Drosophila S2 cells were trans umn. Activity fractionates as 500 KDa complex. Also, anti fected with uniformly, 'P-labelled dsRNA corresponding to body to Drosophila argonaute 2 cofractionates with activity. the first 500 nt. of GFP, RISC complex was affinity purified 15 FIGS. 11-13: Fractionation of RISC over monoS, monoO, using a histidine-tagged version of Drosophila Ago-2, a Hydroxyapatite columns. Drosophila argonaute 2 protein recently identified component of the RISC complex (Ham also cofactionates. mond et al., in prep). RISC was isolated either under condi FIG. 14: Alignment of Drosophila argonaute 2 with other tions in which it remains ribosome associated (ls, low salt) or family members. under conditions that extract it from the ribosome in a soluble FIG. 15: Confirmation of Drosophila argonaute 2. S2 cells form (hs, high salt). For comparison, the spectrum of labeled were transfected with labeled dsRNA and His tagged argo RNAs in the total lysate is shown. (f) Guide RNAs produced naute. Argonaute was isolated on nickel agarose and RNA by incubation of dsRNA with a Dicer immunoprecipitate are component was identified on 15% acrylamide gel. compared to guide RNAs present in an affinity-purified RISC FIG. 16: S2 cell and embryo extracts were assayed for complex. These precisely co-migrate on a gel that has single 25 22-mer generating activity. nucleotide resolution. The lane labeled control is an affinity FIG. 17: RISC can be separated from 22-mer generating selection for RISC from a cell that had been transfected with activity (dicer). Spinning extracts (S 100) can clear RISC labeled dsRNA but not with the epitope-tagged Drosophila activity from supernatant (left panel) however, S100 spins Ago-2. still contain dicer activity (right panel). FIG. 7: Dicer participates in RNAi. (a) Drosophila S2 cells 30 FIG. 18: Dicer is specific for dsRNA and prefers longer were transfected with dsRNAs corresponding to the two Substrates. Drosophila Dicers (CG4792 and CG6493) or with a control FIG. 19: Dicer was fractionated over several columns. dsRNA corresponding to murine caspase 9. Cytoplasmic FIG. 20: Identification of dicer as enzyme which can pro extracts of these cells were tested for Dicer activity. Trans cess dsRNA into 22 mers. Various RNaseIII family members fection with Dicer dsRNA reduced activity in lysates by 7.4- 35 were expressed with n terminal tags, immunoprecipitated, fold. (b) The Dicer-1 antiserum (CG4792) was used to pre and assayed for 22-mer generating activity (left panel). In pare immunoprecipitates from S2 cells that had been treated right panel, antibodies to dicer could also precipitate 22-mer as described above. Dicer dsRNA reduced the activity of generating activity. Dicer-1 in this assay by 6.2-fold. (c) Cells that had been FIG. 21: Dicer requires ATP. transfected two days previously with either mouse caspase 9 40 FIG. 22: Dicer produces RNAs that are the same size as dsRNA or with Dicer dsRNA were cotransfected with a GFP RNAs present in RISC. expression plasmid and either control, luciferase dsRNA or FIG. 23: Human dicer homolog when expressed and GFP dsRNA. Three independent experiments were quantified immunoprecipitated has 22-mer generating activity. by FACS. A comparison of the relative percentage of GFP FIG. 24: Sequence of Drosophila argonaute 2 (SEQ ID positive cells is shown for control (GFP plasmid plus 45 NO:94). Peptides identified by microsequencing are shown luciferase dsRNA) or silenced (GFP plasmid plus GFP in underline. dsRNA) populations in cells that had previously been trans FIG. 25: Molecular characterization of Drosophila argo fected with either control (caspase 9) or Dicer dsRNAs. naute 2. The presence of an intron in coding sequence was FIG. 8: Dicer is an evolutionarily conserved ribonuclease. determined by northern blotting using intron probe. This (a) A model for production of 22 mers by Dicer. Based upon 50 results in a different 5' reading frame then the published the proposed mechanism of action of Ribonuclease III, we genome sequence. Number of polyglutamine repeats was propose that Dicer acts on its substrate as a dimer. The posi determined by genomic PCR. tioning of the two ribonuclease domains (RIIIa and RIIIb) FIG. 26: Dicer activity can be created in human cells by within the enzyme would thus determine the size of the cleav expression of human dicer gene. Host cell was 293. Crude age product. An equally plausible alternative model could be 55 extracts had dicer activity, while activity was absent from derived in which the RIIIa and RIIIb domains of each Dicer untransfected cells. Activity is not dissimilar to that seen in enzyme would cleave in concert at a single position. In this Drosophila embryo extracts. model, the size of the cleavage product would be determined FIG. 27: A ~500 nt. fragment of the gene that is to be by interaction between two neighboring Dicer enzymes. (b) silenced (X) is inserted into the modified vector as a stable Comparison of the domain structures of potential Dicer 60 direct repeat using standard cloning procedures. Treatment homologs in various organisms (Drosophila—CG4792, with commercially available cre recombinase reverses CG6493, C. elegans—K12H4.8, Arabidopsis—CARPEL sequences within the loxP sites (L) to create an inverted FACTORY, T25K16.4, AC012328 1, human Helicase-MOI repeat. This can be stably maintained and amplified in an sbc and S. pombe YC9A SCHPO). The ZAP domains were mutant bacterial strain (DL759). Transcription in vitro from identified both by analysis of individual sequences with Pfam 65 the promoter of choice (P) yields a hairpin RNA that causes and by Psi-blast searches. The ZAP domain in the putative S. silencing. A Zeocin resistance marker is included to insure pombe Dicer is not detected by PFAM but is identified by maintenance of the direct and inverted repeat structures; how US 8,829,264 B2 13 14 ever this is non-essential in vitro and could be removed by ments model 3010 Luminometer. In this assay Renilla pre-mRNA splicing if desired. (Smith et al. (2000) Nature luciferase serves as an internal control for dsRNA-specific 407:319-20). suppression of firefly luciferase activity. These data demon FIG. 28: RNAi in P19 embryonal carcinoma cells. Ten strate that 500-mer dsRNA can specifically suppress cognate centimeter plates of P19 cells were transfected by using 5 ug gene expression in vitro. of GFP plasmid and 40 g of the indicated dsRNA (or no FIG. 34: Expression of a hairpin RNA produces P19 EC RNA). Cells were photographed by fluorescent (tope panel) cell lines that stably silence GFP. (A) A cartoon of the FLIP and phase-contrast microscopy (bottom panel) at 72 h after cassette used to construct the GFP hairpin. GFP represents the transfection; silencing was also clearly evident at 48 h post first 500 coding base pairs of EGFP. Zeo, Zeocin resistance transfection. 10 gene; L, LOX; P, the cytomegalovirus promoter in the expres FIG.29: RNAi offirefly and Renilla luciferase in P19 cells. sion plasmid pcDNA3. Homologous GFP fragments are first (A and B) P19 cells were transfected with plasmids that direct cloned as direct repeats into the FLIP cassette. To create the expression of firefly and Renilla luciferase and dsRNA inverted repeats for hairpin production, the second repeat is 500 mers (25 or 250 ng, as indicated in A and B, respectively), flipped by using Cre recombinase. When transcribed, the that were either homologous to the firefly luciferase mRNA 15 inverted repeat forms a GFP dsRNA with a hairpin loop. (B) (dsRF) or nonhomologous (dsGFP). Luciferase activities P19 cell lines stably expressing the GFP hairpin plasmid, were assayed at various times after transfection, as indicated. GFPhp.1 (clone 10) and GFPhp.2 (clone 12), along with wt Ratios of firefly to Renilla activity are normalized to dsGFP P19 were transfected with 0.25 ug each of GFP and RFP controls. (C and D) P19 cells in 12-well culture dishes (2 ml reporter genes. Fluorescence micrographs were taken by of media) were transfected with 0.25 ug of a 9:1 mix of using filters appropriate for GFP and RFP. Magnification is pGL3-Control and pRL-SV40 as well as 2 ug of the indicated 200x. (C) P19 GFPhp.1 cells were transfected with pEGFP RNA. Extracts were prepared 9 hafter transfection. (C) Ratio and 0, 0.5, or 1 g of Dicer or firefly dsRNA. Fluorescence of firefly to Renilla luciferase is shown. (I)) Ratio of Renilla micrographs were taken at 48 h post-transfection and are to firefly luciferase is shown. Values are normalized to dsGFP. superimposed with bright field images to reveal non-GFP The average of three independent experiments is shown; error 25 expressing cells. Magnification is 100x. (D) In vitro and in bars indicate standard deviation. vitro processing of dsRNA in P19 cells. In vitro Dicer assays FIG. 30: The panels at the right show expression of either were performed on S2 cells and three independently prepared RFP or GFP following transient transfection into wild type P19 extracts by using 'P-labeled dsRNA (30° C. for 30 min). P19 cells. The panels at the left demonstrate the specific A Northern blot of RNA extracted from control and GFPhp.1 suppression of GFP expression in P19 clones which stably 30 P19 cells shows the production of s22-mer RNA species in express a 500 nt double stranded GFP hairpin. P19 clones hairpin-expressing cells but not in control cells. Blots were which stably express the double stranded GFP hairpin were probed with a P-labeled “sense” GFP transcript. transiently transfected with RFP or GFP, and expression of FIG. 35: dsRNA induces silencing at the posttranscrip RFP or GFP was assessed by visual inspection. tional level. P19 cell extracts were used for in vitro translation FIG. 31: Specific silencing of luciferase expression by 35 of firefly and Renilla luciferase mRNA (100 ng each). Trans dsRNA in murine embryonic stem cells. Mouse embryonic lation reactions were programmed with various amounts of stem cells in 12-well culture dishes (1 ml of media) were dsRNA 500 mers, either homologous to firefly luciferase transfected with 1.5ug of dsRNA along with 0.25ug of a 10:1 mRNA (dsDUC) or nonhomologous (dsGFP). Luciferase mixture of the reporter plasmids pGL3-Control and pRL assays were carried out after a 1 h incubation at 30°C. Ratios SV40. Extracts were prepared and assayed 20 h after trans 40 of firefly to Renilla activity are normalized to no dsRNA fection. The ratio of firefly to Renilla luciferase expression is controls. Standard deviations from the mean are shown. shown for FF ds500; the ratio of Renilla to firefly is shown for FIG. 36: S10 fractions from P19 cell lysates were used for Rends500. Both are normalized to ratios from the dsGFP in vitro translations of mRNA coding for Photinus pyralis transfection. The average of three independent experiments is (firefly) and Renilla reniformis (sea pansy) luciferases. Trans shown; error bars indicate standard deviation. 45 lation reactions were programmed with dsRNA, ssRNA, or FIG. 32: RNAi in C2C12 murine myoblast cells. (A) asRNA 500 mers, either complementary to firefly luciferase Mouse C2C12 cells in 12-well culture dishes (1 ml of media) mRNA (dsEF, ssRF, or asEF), complementary to Renilla were transfected with 1 g of the indicated dsRNA along with luciferase (dsREN, ssREN, or asREN) or non-complemen 0.250 lug of the reporter plasmids pGL3-Control and pRL tary (dsGFP). Reactions were carried out at 30°C. for 1 hour, SV40. Extracts were prepared and assayed 24 h after trans 50 after a 30 min preincubation with dsRNA, ssRNA, or asRNA. fection. The ratio of firefly to Renilla luciferase expression is Dual luciferase assays were carried out using an Analytical shown; values are normalized to ratios from the no dsRNA Scientific Instruments model 3010 Luminometer. On the left, control. The average of three independent experiments is Renilla luciferase serves as an internal control for dsRNA shown; error bars indicate standard deviation. (B) C2C12 specific suppression offirefly luciferase activity. On the right, cells co-transfected with 1 lug of either plasmid alone or a 55 firefly luciferase serves as an internal control for dsRNA plasmid containing a hyperactive mutant of vaccinia virus specific Suppression of Renilla luciferase activity. These data K3L (Kawagishi-Kobayashi et al. 2000, Virology 276:424 demonstrate that 500-mer double-stranded RNA (dsRNA) 434). The absolute counts of Renilla and firefly luciferase but not single-stranded (ssRNA) or anti-sense RNA (asRNA) activity are shown. (C) The ratios of firefly/Renilla activity Suppresses cognate gene expression in vitro in a manner from B, normalized to no dsRNA controls. 60 consistent with post-transcriptional gene silencing. FIG. 33: Hela, Chinese hamster ovary, and P19 (pluripo FIG. 37: P19 cells were grown in 6-well tissue culture tent, mouse embryonic carcinoma) cell lines transfected with plates to approximately 60% confluence. Various amounts of plasmids expressing Photinus pyralis (firefly) and Renilla dsRNA, either homologous to firefly luciferase mRNA reniformis (sea pansy) luciferases and with dsRNA 500 mers (dsDUC) or non-homologous (dsGFP), were added to each (400 ng), homologous to either firefly luciferase mRNA 65 well and incubated for 12 hrs under normal tissue culture (dsDUC) or non-homologous (dsGFP). Dual luciferase conditions. Cells were then transfected with plasmids assays were carried out using an Analytical Scientific Instru expressing Photinus pyralis (firefly) and Renilla reniformis US 8,829,264 B2 15 16 (sea pansy) luciferases and with dsRNA 500 mers (500 ng). FIG. 42: Transcription of functional shRNAs in vitro. (A) Dual luciferase assays were carried out 12 hrs post-transfec Schematic of the pShh1 vector. Sequences encoding shRNAs tion using an Analytical Scientific Instruments model 3010 with between 19 and 29 bases of homology to the targeted Luminometer. In this assay Renilla luciferase serves as an gene are synthesized as 60-75-bp double-stranded DNA oli internal control for dsRNA-specific suppression of firefly 5 gonucleotides and ligated into an EcoRV site immediately luciferase activity. These data show that 500-mer dsRNA can downstream of the U6 promoter. This sequence is represented specifically suppress cognate gene expression in vitro with by SEQ ID NO: 27. (B) Sequence and predicted secondary out transfection under normal tissue culture conditions. structure of the Ffl hairpin (SEQID NO: 27). (C) An shRNA FIG.38: Previous methods for generating siRNAs required expressed from the pShh1 vector suppresses luciferase costly chemical synthesis. The invention provides an in vitro 10 method for synthesizing siRNAs using standard RNA tran expression in mammalian cells. HEK 293T, HeLa, COS-1, Scription reactions. and NIH 3T3 cells were transfected with reporter plasmids as FIG. 39: Short hairpins suppress gene expression in Droso in FIG. 1, and pShh1 vector, firefly siRNA, or pShh1 firefly phila S2 cells. (A) Sequences and predicted secondary struc shRNA constructs as indicated. The ratios offirefly to Renilla ture of representative chemically synthesized RNAs. 15 luciferase activity were determined 48 h after transfection and Sequences correspond to positions 112-134 (siRNA) and represent the average of three independent experiments; error 463-491 (shRNAs) of Firefly luciferase carried on pGL3 bars indicate standard deviation. Control. An siRNA targeted to position 463-485 of the FIG. 43: Dicer is required for shRNA-mediated gene luciferase sequence was virtually identical to the 112-134 silencing. HEK 293T cells were transfected with luciferase siRNA in Suppressing expression, but is not shown. These reporter plasmids as well as pShh 1-Ffl and an siRNA target sequences are represented by SEQID NOs: 6-10. (B) Exog ing human Dicer either alone or in combination, as indicated. enously supplied short hairpins Suppress expression of the The Dicer siRNA sequence (TCAACCAGCCACT targeted Firefly luciferase gene in vitro. Six-well plates of S2 GCTGGA, SEQ ID NO: 37) corresponds to coordinates cells were transfected with 250 ng/well of plasmids that direct 3137-3155 of the human Dicer sequence. The ratios of firefly the expression of firefly and Renilla luciferase and 500 25 to Renilla luciferase activity were determined 26 hafter trans ng?well of the indicated RNA. Luciferase activities were fection and represent the average of three independent experi assayed 48 h after transfection. Ratios of firefly to Renilla ments; error bars indicate standard deviation. luciferase activity were normalized to a control transfected FIG. 44: Stable shRNA-mediated gene silencing of an with an siRNA directed at the green fluorescent protein endogenous gene. (A) Sequence and predicted secondary (GFP). The average of three independent experiments is 30 structure of the p53 hairpin. The 5' shRNA stem contains a shown; error bars indicate standard deviation. (C) Short hair 27-nt sequence derived from mouse p53 (nucleotides 166 pins are processed by the Drosophila Dicer enzyme. T7 tran 192), whereas the 3' stem harbors the complimentary anti scribed hairpins shFfl 22, shFfl 29, and shFfS29 were incu sense sequence. This sequence is represented by SEQID NO: bated with (+) and without (-) 0-2-h Drosophila embryo 28. (B) Senescence bypass in primary mouse embryo fibro extracts. Those incubated with extract produced -22-nt siR 35 blasts (MEFs) expressing an shRNA targeted at p53. Wild NAs, consistent with the ability of these hairpins to induce type MEFs, passage 5, were transfected with pBabe-RasV12 RNA interference. A long dsRNA input (cyclin E 500-mer) with control plasmidor with p53hp (5ug each with FuGENE: was used as a control. Cleavage reactions were performed as Roche). Two days after transfection, cells were trypsinized, described in Bernstein et al., 2001, Nature, 409:363-366. counted, and plated at a density of 1x10/10-cm plate in FIG. 40: Short hairpins function in mammalian cells. HEK 40 media containing 2.0 ug/mL of puromycin. Control cells 293T, HeLa, COS-1, and NIH 3T3 cells were transfected with cease proliferation and show a senescent morphology (left plasmids and RNAs as in FIG. 1 and subjected to dual panel). Cells expressing the p.53 hairpin continue to grow luciferase assays 48 h post-transfection. The ratios of firefly (right panel). Photos were taken 14 d post-transfection. to Renilla luciferase activity are normalized to a control trans FIG. 45: A mixture of two short hairpins, both correspond fected with an siRNA directed at the green fluorescent protein 45 ing to firefly luciferase, does not result in a synergistic Sup (GFP). The average of three independent experiments is pression of gene expression. Suppression of firefly luciferase shown; error bars indicate standard deviation. gene expression resulting from transfection of a mixture of FIG. 41: siRNAs and short hairpins transcribed in vitro two different short hairpins (HPit 1 and HP #2) was examined. Suppress gene expression in mammalian cells. (A) Sequences The mixture of HPH1 and HP H2 did not have a more robust and predicted secondary structure of representative in vitro 50 effect on the Suppression offirefly luciferase gene expression transcribed siRNAs. Sequences correspond to positions 112 than expression of HP #1 alone. 134 (siRNA) and 463-491 (shRNAs) of firefly luciferase car FIG. 46: Encoded short hairpins specifically Suppress gene ried on pGL3-Control. These sequences are represented by expression in vitro. DNA oligonucleotides encoding 29 SEQID NOs: 6-7, 13,95 and 15-20, respectively, in order of nucleotide hairpins corresponding to firefly luciferase were appearance. (B) In vitro transcribed siRNAS Suppress expres 55 inserted into a vector containing the U6 promoter. Three sion of the targeted firefly luciferase gene in vitro. HEK293T independent constructs were examined for their ability to cells were transfected with plasmids as in FIG. 2. The pres specifically Suppress firefly luciferase gene expression in ence of non-base-paired guanosine residues at the 5' end of 293T cells. SiOligo1-2, siOligo 1-6, and siOligo1-19 (con siRNAs significantly alters the predicted end structure and struct in the correctorientation) each Suppressed gene expres abolishes siRNA activity. (C) Sequences and predicted sec 60 sion as effectively as siRNA. In contrast, siOligo 1-10 (con ondary structure of representative in vitro transcribed shR struct in the incorrect orientation) did not suppress gene NAs. Sequences correspond to positions 112-141 of firefly expression. An independent construct targeted to a different luciferase carried on pGL3-Control. These sequences are rep portion of the firefly luciferase gene did not effectively sup resented by SEQ ID NOs: 21-26. (D) Short hairpins tran press gene expression in either orientation (SiOligo2-23, siO scribed in vitro suppress expression of the targeted firefly 65 ligo2-36). luciferase gene in vitro. HEK 293T cells were transfected FIGS. 47-49: Strategies for stable expression of short dsR with plasmids as in FIG. 2. NAS. US 8,829,264 B2 17 18 FIG. 50: Dual luciferase assays were performed as row). (b) Similar studies were performed in the heart. (c) described in detail in FIGS. 28-35, however the cells used in Similar studies were performed in the spleen. Animal proce these experiments were PKR' murine embryonic fibro dures have been approved by the SUNY. Stony Brook Insti blasts (MEFs). Briefly, RNAi using long dsRNAs typically tutional Animal Care and Use Committee (IACUC). envokes a non-specific response in MEFs (due to PKR activ FIG. 56: Reduction in Neill protein correlates with the ity). To evaluate the effect of long dsRNA constructs to spe presence of siRNAs. (a) Expression of Neill protein was cifically inhibit gene expression in MEFs, RNAi was exam examined in protein extracts from the livers of mice carrying ined in PKR MEFs. Such cells do not respond to dsRNA the shRNA transgene (shRNA-positive) or siblings lacking with a non-specific response. The data Summarized in this the transgene (shRNA-negative) by western blotting with figure demonstrates that in the absence of the non-specific 10 PKR response, long dsRNA constructs specifically suppress Neil 1-specific antiserum. A western blot for PCNA was used gene expression in MEFs. to standardize loading. (b) The presence of siRNAs in RNA FIG. 51: Is a schematic representation of the mouse tyro derived from the livers of transgenic mice as assayed by sinase promoter. Primers were used to amplify three separate northern blotting using a 300 nt probe, part of which was regions in the proximal promoter, or to amplify sequence 15 complementary to the shRNA sequence. We note siRNAs corresponding to an enhancer located approximately 12 kb only in mice transgenic for the shRNA expression cassette. upstream. FIG. 57. In vitro processing of 29 nt, shRNAs by Dicer FIG. 52: Reporter expression plasmids and siRNA generates a single siRNA from the end of each short hairpin. sequences used in Figures X and Y. PGL-3-Control and Pluc a) The set of shRNAs containing 19 or 29 nt stems and either NS5B are the expression plasmids used for transfection into bearing or lacking a 2 nucleotide 3' overhang is depicted mouse liver. The nucleotide sequences of the siRNAs used in schematically. For reference the 29 nt sequence from the study are shown underneath. These sequences are repre luciferase (top, blue) strand is given. The presumed cleavage sented by SEQID NOs: 96-101 and 35, respectively, in order sites are indicated in green and by the arrows. FIG. 57A of appearance. discloses SEQID NOS 11-12, 90-91 and 36, respectively, in FIG.53: RNA interference in adult mice using siRNAs. (a) 25 order of appearance.b) In vitro Dicer processing of shRNAs. Representative images of light emitted from mice co-trans Substrates as depicted in a) were incubated either in the fected with the luciferase plasmid pCL3-control and either no presence or absence of recombinant human Dicer (as indi siRNA, luciferase siRNA or unrelated siRNA. A pseudoco cated). Processing of a 500 bp.blunt-ended dsRNA is shown lour image representing intensity of emitted light (red, most for comparison. Markers are end-labeled, single-stranded, intense; blue, least intense) Superimposed on a greyscale ref 30 synthetic RNA oligonucleotides. c) All shRNA substrates erence image (for orientation) shows that RNAi functions in adult mice. Annealed 21-nucleotide siRNAs (40 ug: Dharma were incubated with bacterial RNase III to verify their con) were co-injected into the livers of mice with 2 ug pGL3 double-stranded nature. This sequence is represented by SEQ control DNA (Promega) and 800 units of RNasin (Promega) ID NO: 36. in 1.8 ml PBS buffer in 5-7 s. After 72 h, mice were anaes 35 FIG. 58: Primer extension analysis reveal a single siRNA thetized and given 3 mg luciferin intraperitoneally 15 min generated from Dicer processing of shRNA both in vitro and before imaging. (b) siRNA results (six mice per group) from in vivo. a) 19 nt, shRNAs, as indicated (see FIG. 57a), were a representative experiment. Mice receiving luciferase processed by Dicer in vitro. Reacted RNAs were extended siRNA emitted significantly less light than reporter-alone with a specific primer that yields a 20 base product if cleavage controls (one-way ANOVA with post hoc Fisher's test). 40 occurs 22 bases from the 3' end of the overhung RNA (see Results for reporter alone and unrelated siRNA were statisti FIG. 57a). Lanes labeled siRNA are extensions of synthetic cally similar. Animals were treated according to the US RNAs corresponding to predicted siRNAs that would be National Institutes of Health’s guidelines for animal care and released by cleavage 21 or 22 nucleotides from the 3' end of the guidelines of Stanford University. the overhung precursor. Observation of extension products FIG. 54: RNA interference in adult mice using shRNAs. (a) 45 dependents entirely on the inclusion of RT (indicated). Mark Representative images of light emitted from mice co-trans ers are phosphorylated, synthetic DNA oligonucleotides. b) fected with the luciferase plasmid control, pShh 1-Ffl, and Analysis as described ina) for 29 nt, shRNAs. The * indicates pShh1-Ffl rev. pShh1-Ffl, but not pShh1-Ffl rev, reduced the specific extension product from the overhung shRNA luciferase expression in mice relative to the reporter-alone species. c) Primer extension were used to analyze products control. pShhl-Ffl or pShh 1-rev (10 ug) were co-injected 50 from processing of overhung 29 nt, shRNAs in vivo. For with 2 ug pGL3-control in 1.8 ml PES buffer. (b) Average of comparison, extensions of invitro processed material are also three independent shRNA experiments (n=5). Average values shown. Again, the * indicates the specific extension product. for the reporter-alone group are designated as 100% in each of FIG. 59: Gene suppression by shRNAs is comparable to or the three experiments. Animals were treated according to the more effective than that achieved by siRNAs targeting the US National Institutes of Health’s guidelines for animal care 55 same sequences. a) Structures of synthetic RNAs used for and the guidelines of Stanford University. these studies. FIG. 59A discloses SEQID NOS 102, 102 and FIG.55: Heritable repression of Neill expression by RNAi 92-93, respectively, in order of appearance. b) mRNA sup in several tissues. (a) Expression of Neill mRNA in the livers pression levels achieved by 43 siRNAs targeting 6 different of three mice containing the Neill shRNA transgene genes compared with levels achieved by 19-mer (left) or (shRNA-positive) or three siblings lacking the transgene 60 29-mer (right) shRNAs derived from the same target (shRNA-negative) was assayed by RT-PCR (top row is sequences. All RNAs were transfected at a final concentration Neill). An RT-PCR off-actin was done to ensure that equal of 100 nM. Values indicated on the X and Y axes reflect the quantities of mRNAs were tested for each mouse (second percentage of mRNA remaining in HeLa cells 24 hours after row). Expression of the neomycin resistance gene (neo), car RNA transfection compared with cells treated with transfec ried on the shRNA vector, was tested similarly (third row). 65 tion reagent alone. c) Titration analysis comparing efficacies Finally, the mice were genotyped using genomic DNA that of four siRNA/shRNA sets targeting MAPK14. Curves are was PCR-amplified with vector-specific primers (bottom graphed from data derived from transfections at 1.56, 6.25, US 8,829,264 B2 19 20 25, and 100 nM final concentrations of RNA. (diamonds: As described in further detail below, the present inven 21-mer siRNAs; squares: 19-mer shRNAs; triangles: 29-mer tion(s) are based on the discovery that the RNAi phenomenon shRNAs). is mediated by a set of enzyme activities, including an essen FIG. 60: Microarray profiling reveals sequence-specific tial RNA component, that are evolutionarily conserved in gene expression profiles and more similarity between 29-mer eukaryotes ranging from plants to mammals. shRNAs and cognate siRNAs than observed for 19-mer shR One enzyme contains an essential RNA component. After NAS. Each row of the heat maps reports the gene expression partial purification, a multicomponent nuclease (herein signature resulting from transfection of an individual RNA. “RISC nuclease') co-fractionates with a discrete, 22-nucle Data shown represent genes that display at least a 2-fold otide RNA species which may confer specificity to the 10 nuclease through homology to the substrate mRNAs. The change in expression level (Pvalue <0.01 and log 10 intensity short RNA molecules are generated by a processing reaction >1) relative to mock-transfected cells. Green indicates from the longer input dsRNA. Without wishing to be bound decreased expression relative to mock transfection whereas by any particular theory, these 22-mer guide RNAs may serve red indicates elevated expression. a) 19-mer shRNAs and as guide sequences that instruct the RISC nuclease to destroy siRNAs designed for six different target sequences within the 15 specific mRNAs corresponding to the dsRNA sequences. coding region of the MAPK14 gene were tested for gene As illustrated, double stranded forms of the 22-mer guide silencing after 24 hours in HeLa cells. b) A similar experi RNA can be sufficient in length to induce sequence-depen ment to that described in a) but carried out with five 29-mer dent dsRNA inhibition of gene expression. In the illustrated shRNAs targeting MAPK14. example, dsRNA constructs are administered to cells having a recombinant luciferase reporter gene. In the control cell, DETAILED DESCRIPTION OF CERTAIN e.g., no exogeneously added RNA, the level of expression of PREFERRED EMBODIMENTS the luciferase reporter is normalized to be the value of “1”. As illustrated, both long (500-mer) and short (22-mer) dsRNA I. Overview constructs complementary to the luciferase gene could inhibit 25 expression of that gene product relative to the control cell. On The present invention provides methods for attenuating the other hand, similarly sized dsRNA complementary to the gene expression in a cell using gene-targeted double stranded coding sequence for another protein, green fluorescence pro RNA (dsRNA). The dsRNA contains a nucleotide sequence tein (GFP), did not significantly effect the expression of that hybridizes under physiologic conditions of the cell to the luciferase—indicating that the inhibitory phenomena was in nucleotide sequence of at least a portion of the gene to be 30 each case sequence-dependent. Likewise, single stranded inhibited (the “target' gene). The nucleotide sequence can 22-mers of luciferase did not inhibit expression of that gene— hybridize to either coding or non-coding sequence of the indicating that the inhibitory phenomena is double stranded target gene. dependent. A significant aspect to certain embodiments of the present The appended examples also identify an enzyme, Dicer, invention relates to the demonstration in the present applica 35 that can produce the putative guide RNAs. Dicer is a member tion that RNAi can in fact be accomplished both in cultured of the RNAse III family of nucleases that specifically cleave mammalian cells and in whole organisms. This had not been dsRNA and is evolutionarily conserved in worms, flies, previously described in the art. plants, fungi and, as described herein, mammals. The enzyme Another salient feature of the present invention concerns has a distinctive structure which includes a helicase domain the ability to carry out RNAi in higher eukaryotes, particu 40 and dual RNAse III motifs. Dicer also contains a region of larly in non-oocytic cells of mammals, e.g., cells from adult homology to the RDE1/QDE2/ARGONAUTE family, which mammals as an example. have been genetically linked to RNAi in lower eukaryotes. Furthermore, in contrast to the teachings of the prior art, we Indeed, activation of, or overexpression of Dicer may be demonstrate that RNAi in mammalian systems can be medi sufficient in many cases to permit RNA interference in oth ated with dsRNA identical or similar to non-coding sequence 45 erwise non-receptive cells, such as cultured eukaryotic cells, of a target gene. It was previously believed that although or mammalian (non-oocytic) cells in culture or in whole dsRNA identical or similar to non-coding sequences (i.e., organisms. promoter, enhancer, or intronic sequences) did not inhibit In certain embodiments, the cells can be treated with an RNAi, such dsRNAs were not thought to mediate RNAi. agent(s) that inhibits the general double-stranded RNA In addition, the instant invention also demonstrates that 50 response(s) by the host cells, such as may give rise to short hairpin RNA (shRNA) may effectively be used in the sequence-independent apoptosis. For instance, the cells can subject RNAi methods. In certain embodiments, shRNAs be treated with agents that inhibit the dsRNA-dependent pro specifically designed as Dicer Substrates can be used as more tein kinase known as PKR (protein kinase RNA-activated). potent inducers of RNAi than siRNAs. Not only is maximal Double stranded RNAs in mammalian cells typically activate inhibition achieved at much lower levels of transfected RNA, 55 protein kinase PKR and lead to apoptosis. The mechanism of but also endpoint inhibition is often greater. In certain other action of PKR includes phosphorylation and inactivation of embodiments, mimicking natural pre-miRNAS by inclusion eIF2C. (Fire, Trends Genet 15: 358, 1999). It has also been of a 1-5 nucleotide(s), especially a 2 nucleotide 3' overhang, reported that induction of NF-KB by PKR is involved in enhances the efficiency of Dicer cleavage and directs cleav apoptosis commitment and this process is mediated through age to a specific position in the precursor. The presence of this 60 activation of the IKK complex. This sequence-independent specific processing site further permits the application of response may reflect a form of primitive immune response, rules for siRNA design to shRNAs, both for chemical synthe since the presence of dsRNA is a common feature of many sis and vector-based delivery of such shRNA constructs. viral lifecycles. These teachings provide improved methods for evoking As described herein, Applicants have demonstrated that the RNAi in mammalian cells, and thus improved ability to pro 65 PKR response can be overcome in favor of the sequence duce highly potent silencing triggers in therapeutic applica specific RNAi response. However, in certain instances, it may tion of RNAi. be desirable to treat the cells with agents which inhibit expres US 8,829,264 B2 21 22 sion of PKR, cause its destruction, and/or inhibit the kinase capable of directing the expression of genes to which they are activity of PKR, and such methods are specifically contem operatively linked are referred to herein as “expression vec plated for use in the present invention. Likewise, overexpres tors'. In the present specification, "plasmid' and “vector are sion of agents which ectopically activate eIF2C. can be used. used interchangeably unless otherwise clear from the context. Other agents which can be used to suppress the PKR response As used herein, the term “nucleic acid refers to polynucle include inhibitors of IKK phosphorylation of IKB, inhibitors otides such as deoxyribonucleic acid (DNA), and, where of IKB ubiquitination, inhibitors of IKB degradation, inhibi appropriate, ribonucleic acid (RNA). The term should also be tors of NF-kB nuclear translocation, and inhibitors of NF-KB understood to include, as applicable to the embodiment being interaction with KB response elements. described, single-stranded (such as sense or antisense) and Other inhibitors of sequence-independent dsRNA 10 double-stranded polynucleotides. response in cells include the gene product of the vaccinia virus E3L. The E3L gene product contains two distinct As used herein, the term “gene' or “recombinant gene’ domains. A conserved carboxy-terminal domain has been refers to a nucleic acid comprising an open reading frame shown to bind double-stranded RNA (dsRNA) and inhibit the encoding a polypeptide of the present invention, including antiviral dsRNA response by cells. Expression of at least that 15 both exon and (optionally) intron sequences. The nucleic acid portion of the E3L gene in the host cell, or the use of polypep may also optionally include non-coding sequences such as tide or peptidomimetics thereof, can be used to suppress the promoter or enhancer sequences. A “recombinant gene’ general dsRNA response. Caspase inhibitors sensitize cells to refers to nucleic acid encoding Such regulatory polypeptides, killing by double-stranded RNA. Accordingly, ectopic that may optionally include intron sequences that are derived expression or activation of caspases in the host cell can be from chromosomal DNA. The term “intron” refers to a DNA used to suppress the general dsRNA response. sequence present in a given gene that is not translated into In other embodiments, the subject method is carried out in protein and is generally found between exons. cells which have little or no general response to double A "protein coding sequence' or a sequence that “encodes' stranded RNA, e.g., have no PKR-dependent dsRNA a particular polypeptide or peptide, is a nucleic acid sequence response, at least under the culture conditions. As illustrated 25 that is transcribed (in the case of DNA) and is translated (in in FIGS. 28-32, CHO and P19 cells can be used without the case of mRNA) into a polypeptide in vitro or in vitro when having to inhibit PKR or other general dsRNA responses. placed under the control of appropriate regulatory sequences. Also as described in further detail below, the present inven The boundaries of the coding sequence are determined by a tion(s) are partially based on the discovery that short hairpin start codon at the 5' (amino) terminus and a translation stop RNA specifically designed as Dicer substrates are more 30 codon at the 3' (carboxy) terminus. A coding sequence can potent inducers of RNAi than siRNAs. In certain embodi include, but is not limited to, cDNA from procaryotic or ments, shRNA constructs with 1-5, preferably two 3' over eukaryotic mRNA, genomic DNA sequences from procary hang nucleotides are substrates particularly well-adapted for otic or eukaryotic DNA, and even synthetic DNA sequences. Dicer-mediated cleavage, and are more potent inhibitors of A transcription termination sequence will usually be located target genes then their siRNA counterparts with identical 35 3' to the coding sequence. complementary sequences. Such shRNA can be formed Likewise, “encodes', unless evident from its context, will either in vitro or in Vivo by, for example, sequence-specific be meant to include DNA sequences that encode a polypep pairing after chemical synthesis, or transcription from a pro tide, as the term is typically used, as well as DNA sequences moter operatively-linked to a DNA encoding such hairpin that are transcribed into inhibitory antisense molecules. Structure. 40 The term “loss-of-function', as it refers to genes inhibited Thus, the present invention provides a process and compo by the subject RNAi method, refers to a diminishment in the sitions for inhibiting expression of a target gene in a cell, level of expression of a gene(s) in the presence of one or more especially a mammalian cell. In certain embodiments, the dsRNA construct(s) when compared to the level in the process comprises introduction of RNA (the “dsRNA con absence of such dsRNA construct(s). struct’) with partial or fully double-stranded character into 45 The term “expression' with respect to a gene sequence the cell or into the extracellular environment. Inhibition is refers to transcription of the gene and, as appropriate, trans specific in that a nucleotide sequence from a portion of the lation of the resulting mRNA transcript to a protein. Thus, as target gene is chosen to produce the dsRNA construct. The will be clear from the context, expression of a protein coding dsRNA may be identical or similar to coding or non-coding sequence results from transcription and translation of the sequence of the target gene. In preferred embodiments, the 50 coding sequence. method utilizes a cell in which Dicer and/or Argonaute activi “Cells,” “host cells' or “recombinant host cells' are terms ties are recombinantly expressed or otherwise ectopically used interchangeably herein. It is understood that such terms activated. This process can be (1) effective in attenuating gene refer not only to the particular subject cell but to the progeny expression, (2) specific to the targeted gene, and (3) general in or potential progeny of Such a cell. Because certain modifi allowing inhibition of many different types of target gene. 55 cations may occur in Succeeding generations due to either mutation or environmental influences, such progeny may not, II. Definitions in fact, be identical to the parent cell, but are still included within the scope of the term as used herein. For convenience, certain terms employed in the specifica The term “cultured cells' refers to cells suspended in cul tion, examples, and appended claims are collected here. 60 ture, e.g., dispersed in culture or in the form tissue. It does not, As used herein, the term “vector” refers to a nucleic acid however, include oocytes or whole embryos (including blas molecule capable of transporting another nucleic acid to tocysts and the like) which may be provided in culture. In which it has been linked. One type of vector is a genomic certain embodiments, the cultured cells are adults cells, e.g., integrated vector, or “integrated vector, which can become non-embryonic. integrated into the chromosomal DNA of the host cell. 65 By “recombinant virus is meant a virus that has been Another type of vector is an episomal vector, i.e., a nucleic genetically altered, e.g., by the addition or insertion of a acid capable of extra-chromosomal replication. Vectors heterologous nucleic acid construct into the particle. US 8,829,264 B2 23 24 As used herein, the terms “transduction' and “transfec blood cells tested for such HLA antigens as, HLA-A, B and tion” are art recognized and mean the introduction of a DR. Each individual has two sets of these antigens, one set nucleic acid, e.g., an expression vector, into a recipient cell by inherited from each parent. For this reason, it is much more nucleic acid-mediated gene transfer. “Transformation', as likely for a brother or sister to match the patient than an used herein, refers to a process in which a cells genotype is unrelated individual, and much more likely for persons of the changed as a result of the cellular uptake of exogenous DNA same racial and ethnic backgrounds to match each other. or RNA, and, for example, the transformed cell expresses a dsRNA construct. III. Exemplary Embodiments of Isolation Method “Transient transfection” refers to cases where exogenous DNA does not integrate into the genome of a transfected cell, 10 One aspect of the invention provides a method for poten e.g., where episomal DNA is transcribed into mRNA and tiating RNAi by induction or ectopic activation of an RNAi translated into protein. enzyme in a cell (in vitro or in vitro) or cell-free mixtures. In A cell has been “stably transfected with a nucleic acid preferred embodiments, the RNAi activity is activated or construct when the nucleic acid construct is capable of being added to a mammaliancell, e.g., a human cell, which cell may inherited by daughter cells. 15 be provided in vitro or as part of a whole organism. In other As used herein, a “reporter gene construct” is a nucleic acid embodiments, the Subject method is carried out using eukary that includes a “reporter gene' operatively linked to at least otic cells generally (except for oocytes) in culture. For one transcriptional regulatory sequence. Transcription of the instance, the Dicer enzyme may be activated by virtue of reporter gene is controlled by these sequences to which they being recombinantly expressed or it may be activated by use are linked. The activity of at least one or more of these control of an agent which (i) induces expression of the endogenous sequences can be directly or indirectly regulated by the target gene, (ii) stabilizes the protein from degradation, and/or (iii) receptor protein. Exemplary transcriptional control allosterically modifies the enzyme to increase its activity (by sequences are promoter sequences. A reporter gene is meant altering its ki, K, or both). to include a promoter-reporter gene construct that is heterolo A. Dicer and Argonaut Activities gously expressed in a cell. 25 In certain embodiments, at least one of the activated RNAi As used herein, “transformed cells' refers to cells that have enzymes is Dicer, or a homolog thereof. In certain preferred spontaneously converted to a state of unrestrained growth, embodiments, the present method provides for ectopic acti i.e., they have acquired the ability to grow through an indefi vation of Dicer. As used herein, the term “Dicer” refers to a nite number of divisions in culture. Transformed cells may be protein which (a) mediates an RNAi response and (b) has an characterized by Such terms as neoplastic, anaplastic and/or 30 amino acid sequence at least 50 percent identical, and more hyperplastic, with respect to their loss of growth control. For preferably at least 75, 85,90 or 95 percent identical to SEQID purposes of this invention, the terms “transformed phenotype NO: 2 or 4, and/or which can be encoded by a nucleic acid of malignant mammalian cells' and “transformed pheno which hybridizes under wash conditions of 2xSSC at 22°C., type' are intended to encompass, but not be limited to, any of and more preferably 0.2xSSC at 65° C., to a nucleotide rep the following phenotypic traits associated with cellular trans 35 resented by SEQID NO: 1 or 3. Accordingly, the method may formation of mammaliancells: immortalization, morphologi comprise introducing a dsRNA construct into a cell in which cal or growth transformation, and tumorigenicity, as detected Dicer has been recombinantly expressed or otherwise ectopi by prolonged growth in cell culture, growth in semi-solid cally activated. media, or tumorigenic growth in immuno-incompetent or In certain embodiment, at least one of the activated RNAi Syngeneic animals. 40 enzymes is Argonaut, or a homolog thereof. In certain pre As used herein, “proliferating and “proliferation” refer to ferred embodiments, the present method provides for ectopic cells undergoing mitosis. activation of Argonaut. As used herein, the term "Argonaut” As used herein, “immortalized cells' refers to cells that refers to a protein which (a) mediates an RNAi response and have been altered via chemical, genetic, and/or recombinant (b) has an amino acid sequence at least 50 percent identical, means such that the cells have the ability to grow through an 45 and more preferably at least 75, 85,90 or 95 percent identical indefinite number of divisions in culture. to the amino acid sequence shown in FIG. 24. Accordingly, The “growth state' of a cell refers to the rate of prolifera the method may comprise introducing a dsRNA construct tion of the cell and the state of differentiation of the cell. into a cell in which Argonaut has been recombinantly “MHC antigen', as used herein, refers to a protein product expressed or otherwise ectopically activated. of one or more MHC genes; the term includes fragments or 50 This invention also provides expression vectors containing analogs of products of MHC genes which can evoke an a nucleic acid encoding a Dicer or Argonaut polypeptide, immune response in a recipient organism. Examples of MHC operably linked to at least one transcriptional regulatory antigens include the products (and fragments or analogs sequence. Operably linked is intended to mean that the nucle thereof) of the human MHC genes, i.e., the HLA genes. otide sequence is linked to a regulatory sequence in a manner The term “histocompatibility” refers to the similarity of 55 which allows expression of the nucleotide sequence. Regula tissue between different individuals. The level of histocom tory sequences are art-recognized and are selected to direct patibility describes how well matched the patient and donor expression of the Subject Dicer or Argonaut proteins. Accord are. The major histocompatibility determinants are the human ingly, the term transcriptional regulatory sequence includes leukocyte antigens (HLA). HLA typing is performed between promoters, enhancers and other expression control elements. the potential marrow donor and the potential transplant 60 Such regulatory sequences are described in Goeddel, Gene recipient to determine how close a HLA match the two are. Expression Technology: Methods in Enzymology 185, Aca The closer the match the less the donated marrow and the demic Press, San Diego, Calif., 1990. For instance, any of a patient’s body will react against each other. wide variety of expression control sequences, sequences that The term “human leukocyte antigens' or “HLA', refers to control the expression of a DNA sequence when operatively proteins (antigens) found on the surface of white blood cells 65 linked to it, may be used in these vectors to express DNA and other tissues that are used to match donorand patient. For sequences encoding Dicer or Argonaut polypeptides of this instances, a patient and potential donor may have their white invention. Such useful expression control sequences, include, US 8,829,264 B2 25 26 for example, a viral LTR, such as the LTR of the Moloney ing A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch murine leukemia virus, the early and late. promoters of SV40, and Maniatis (Cold Spring Harbor Laboratory Press: 1989) adenovirus or cytomegalovirus immediate early promoter, Chapters 16 and 17. the lac system, the trp system, the TAC or TRC system, T7 In yet another embodiment, the subject invention provides promoter whose expression is directed by T7 RNA poly a "gene activation' construct which, by homologous recom merase, the major operator and promoter regions of phage W. bination with a genomic DNA, alters the transcriptional regu the control regions for fa coat protein, the promoter for latory sequences of an endogenous Dicer or Argonaut gene. 3-phosphoglycerate kinase or other glycolytic enzymes, the For instance, the gene activation construct can replace the promoters of acid phosphatase, e.g., Pho5, the promoters of endogenous promoter of a Dicer or Argonaut gene with a 10 heterologous promoter, e.g., one which causes constitutive the yeast C.-mating factors, the polyhedron promoter of the expression of the Dicer or Argonaut gene or which causes baculovirus system and other sequences known to control the inducible expression of the gene under conditions different expression of genes of prokaryotic or eukaryotic cells or their from the normal expression pattern of Dicer or Argonaut. A viruses, and various combinations thereof. It should be under variety of different formats for the gene activation constructs stood that the design of the expression vector may depend on 15 are available. See, for example, the Transkaryotic Therapies, such factors as the choice of the host cell to be transformed Inc PCT publications WO93/09222, WO95/31560, WO96/ and/or the type of protein desired to be expressed. 29411, WO95/31560 and WO094/12650. Moreover, the vector's copy number, the ability to control In preferred embodiments, the nucleotide sequence used as that copy number and the expression of any other proteins the gene activation construct can be comprised of (1) DNA encoded by the vector, Such as antibiotic markers, should also from Some portion of the endogenous Dicer or Argonaut gene be considered. (exon sequence, intron sequence, promoter sequences, etc.) The recombinant Dicer or Argonaut genes can be produced which direct recombination and (2) heterologous transcrip by ligating a nucleic acid encoding a Dicer or Argonaut tional regulatory sequence(s) which is to be operably linked polypeptide into a vector suitable for expression in either to the coding sequence for the genomic Dicer or Argonaut prokaryotic cells, eukaryotic cells, or both. Expression vec 25 gene upon recombination of the gene activation construct. For tors for production of recombinant forms of the subject Dicer use in generating cultures of Dicer or Argonaut producing or Argonaut polypeptides include plasmids and other vectors. cells, the construct may further include a reporter gene to For instance, suitable vectors for the expression of a Dicer or detect the presence of the knockout construct in the cell. Argonaut polypeptide include plasmids of the types: The gene activation construct is inserted into a cell, and pBR322-derived plasmids, pFMBL-derived plasmids, pFX 30 integrates with the genomic DNA of the cell in such a position So as to provide the heterologous regulatory sequences in derived plasmids, pBTac-derived plasmids and puC-derived operative association with the native Dicer or Argonaut gene. plasmids for expression in prokaryotic cells, such as E. coli. Such insertion occurs by homologous recombination, i.e., A number of vectors exist for the expression of recombi recombination regions of the activation construct that are nant proteins in yeast. For instance, YEP24, YIPS, YEP51, 35 homologous to the endogenous Dicer or Argonaut gene YEP52, pYES2, and YRP17 are cloning and expression sequence hybridize to the genomic DNA and recombine with vehicles useful in the introduction of genetic constructs into the genomic sequences so that the construct is incorporated S. cerevisiae (see, for example, Broachet al. (1983) in Experi into the corresponding position of the genomic DNA. mental Manipulation of Gene Expression, ed. M. Inouye The terms “recombination region' or “targeting sequence' Academic Press, p. 83, incorporated by reference herein). 40 refer to a segment (i.e., a portion) of a gene activation con These vectors can replicate in E. coli due the presence of the struct having a sequence that is substantially identical to or pBR322 ori, and in S. cerevisiae due to the replication deter Substantially complementary to a genomic gene sequence, minant of the yeast 2 micron plasmid. In addition, drug resis e.g., including 5' flanking sequences of the genomic gene, and tance markers such as Ampicillin can be used. In an illustra can facilitate homologous recombination between the tive embodiment, a Dicer or Argonaut polypeptide is 45 genomic sequence and the targeting transgene construct. produced recombinantly utilizing an expression vector gen As used herein, the term “replacement region” refers to a erated by Sub-cloning the coding sequence of a Dicer or portion of a activation construct which becomes integrated Argonaut gene. into an endogenous chromosomal location following The preferred mammalian expression vectors contain both homologous recombination between a recombination region prokaryotic sequences, to facilitate the propagation of the 50 and a genomic sequence. vector in bacteria, and one or more eukaryotic transcription The heterologous regulatory sequences, e.g., which are units that are expressed in eukaryotic cells. The pcDNAI/ provided in the replacement region, can include one or more amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2 of a variety of elements, including: promoters (such as con dhfr, pTk2, pRSVneo, pMSG, pSVT7... pko-neo and pHyg stitutive or inducible promoters), enhancers, negative regula derived vectors are examples of mammalian expression vec 55 tory elements, locus control regions, transcription factor tors suitable for transfection of eukaryotic cells. Some of binding sites, or combinations thereof. these vectors are modified with sequences from bacterial Promoters/enhancers which may be used to control the plasmids, such as pBR322, to facilitate replication and drug expression of the targeted gene in vitro include, but are not resistance selection in both prokaryotic and eukaryotic cells. limited to, the cytomegalovirus (CMV) promoter/enhancer Alternatively, derivatives of viruses such as the bovine pap 60 (Karasuyama et al., J. Exp. Med 169: 13, 1989), the human illomavirus (BPV-1), or Epstein-Barr virus (pHEBo, pREP B-actin promoter (Gunning et al., PNAS 84: 4831-4835, derived and p205) can be used for transient expression of 1987), the glucocorticoid-inducible promoter present in the proteins in eukaryotic cells. The various methods employed mouse mammary tumor virus long terminal repeat (MMTV in the preparation of the plasmids and transformation of host LTR) (Klessig et al., Mol. Cell Biol. 4: 1354-1362, 1984), the organisms are well known in the art. For other Suitable expres 65 long terminal repeat sequences of Moloney murine leukemia sion systems for both prokaryotic and eukaryotic cells, as virus (Mul V LTR) (Weiss et al. (1985) RNA Tumor Viruses, well as general recombinant procedures, see Molecular Clon Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.), US 8,829,264 B2 27 28 the SV40 early or late region promoter (Bernoist et al., Nature gia, Oxyuris, Parascaris, Strongylus, Toxascaris, Trichuris, 290: 304-310, 1981; Templeton et al., Mol. Cell Biol. 4: 817, Tricho strongylus, Tflichonema, Toxocara, Uncinaria) and 1984; and Sprague et al., J. Virol. 45:773, 1983), the promoter those that infect plants (e.g., Bursaphalenchus, Criconerri contained in the 3' long terminal repeat of Rous sarcoma virus ella, Divlenchus, Dity lenchus, Globodera, Helicotylenchus, (RSV) (Yamamoto et al., Cell 22: 787-797, 1980), the herpes Heterodera, Longidorus, Melodoigyne, Nacobbus, Paraty simplex virus (HSV) thymidine kinase promoter/enhancer lenchus, Pratylenchus, Radopholus, Rotelynchus, Tvlenchus, (Wagner et al., PNAS 82: 3567-71, 1981), and the herpes and Xiphinerna). Representative orders of insects include simplex virus LAT promoter (Wolfe et al., Nature Genetics 1: Coleoptera, Diptera, Lepidoptera, and Homoptera. 379-384, 1992). The cell having the target gene may be from the germ line In still other embodiments, the replacement region merely 10 or Somatic, totipotent or pluripotent, dividing or non-divid deletes a negative transcriptional control element of the native ing, parenchyma or epithelium, immortalized or transformed, gene, e.g., to activate expression, or ablates a positive control or the like. The cell may be a stem cellor a differentiated cell. element, e.g., to inhibit expression of the targeted gene. Cell types that are differentiated include adipocytes, fibro B. Cell/Organism blasts, myocytes, cardiomyocytes, endothelium, neurons, The cell with the target gene may be derived from or 15 glia, blood cells, megakaryocytes, lymphocytes, macroph contained in any organism (e.g., plant, animal, protozoan, ages, neutrophils, eosinophils, basophils, mast cells, leuko virus, bacterium, or fungus). The dsRNA construct may be cytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, synthesized either in vitro or in vitro. Endogenous RNA poly osteoclasts, hepatocytes, and cells of the endocrine or exo merase of the cell may mediate transcription in vitro, or crine glands. cloned RNA polymerase can be used for transcription in vitro C. Targeted Genes or in vitro. For generating double stranded transcripts from a The target gene may be a gene derived from the cell, an transgene in vitro, a regulatory region may be used to tran endogenous gene, a transgene, or a gene of a pathogen which scribe the RNA strand (or strands). Furthermore, dsRNA can is present in the cell after infection thereof. Depending on the be generated by transcribing an RNA strand which forms a particular target gene and the dose of double stranded RNA hairpin, thus producing a dsRNA. 25 material delivered, the procedure may provide partial or com Genetic manipulation becomes possible in organisms that plete loss of function for the target gene. Lower doses of are not classical genetic models. Breeding and Screening pro injected material and longer times after administration of grams may be accelerated by the ability to rapidly assay the dsRNA may result in inhibition in a smaller fraction of cells. consequences of a specific, targeted gene disruption. Gene Quantitation of gene expression in a cell may show similar disruptions may be used to discover the function of the target 30 amounts of inhibition at the level of accumulation of target gene, to produce disease models in which the target gene are mRNA or translation of target protein. involved in causing or preventing a pathological condition, "Inhibition of gene expression” refers to the absence (or and to produce organisms with improved economic proper observable decrease) in the level of protein and/or mRNA ties. product from a target gene. “Specificity” refers to the ability The cell with the target gene may be derived from or 35 to inhibit the target gene without manifest effects on other contained in any organism. The organism may be a plant, genes of the cell. The consequences of inhibition can be animal, protozoan, bacterium, virus, or fungus. The plant may confirmed by examination of the outward properties of the be a monocot, dicot or gymnosperm; the animal may be a cell or organism (as presented below in the examples) or by vertebrate or invertebrate. Preferred microbes are those used biochemical techniques such as RNA solution hybridization, in agriculture or by industry, and those that are pathogenic for 40 nuclease protection, Northern hybridization, reverse tran plants or animals. Fungi include organisms in both the mold Scription, gene expression monitoring with a microarray, and yeast morphologies. antibody binding, enzyme linked immunosorbent assay Plants include arabidopsis; field crops (e.g., alfalfa, barley, (ELISA), Western blotting, radioimmunoassay (RIA), other bean, corn, cotton, flax, pea, rape, rice, rye, safflower, Sor immunoassays, and fluorescence activated cell analysis ghum, soybean, Sunflower, tobacco, and wheat); vegetable 45 (FACS). For RNA-mediated inhibition in a cell line or whole crops (e.g., asparagus, beet, broccoli, cabbage, carrot, cauli organism, gene expression is conveniently assayed by use of flower, celery, cucumber, eggplant, lettuce, onion, pepper, a reporter or drug resistance gene whose protein product is potato, pumpkin, radish, spinach, squash, taro, tomato, and easily assayed. Such reporter genes include acetohydroxy Zucchini); fruit and nut crops (e.g., almond, apple, apricot, acid synthase (AHAS), alkaline phosphatase (AP), beta banana, blackberry, blueberry, cacao, cherry, coconut, cran 50 galactosidase (LacZ), beta glucoronidase (GUS), chloram berry, date, faloa, filbert, grape, grapefruit, guava, kiwi, phenicol acetyltransferase (CAT), green fluorescent protein lemon, lime, mango, melon, nectarine, orange, papaya, pas (GFP), horseradish peroxidase (HRP), luciferase (Luc), sion fruit, peach, peanut, pear, pineapple, pistachio, plum, nopaline synthase (NOS), octopine synthase (OCS), and raspberry, Strawberry, tangerine, walnut, and watermelon); derivatives thereof. Multiple selectable markers are available and ornamentals (e.g., alder, ash, aspen, azalea, birch, box 55 that confer resistance to amplicillin, bleomycin, chloram wood, camellia, carnation, chrysanthemum, elm, fir, ivy, jas phenicol, gentamycin, hygromycin, kanamycin, lincomycin, mine, juniper, oak, palm, poplar, pine, redwood, rhododen methotrexate, phosphinothricin, puromycin, and tetracyclin. dron, rose, and rubber). Depending on the assay, quantitation of the amount of gene Examples of Vertebrate animals include fish, mammal, expression allows one to determine a degree of inhibition cattle, goat, pig, sheep, rodent, hamster, mouse, rat, primate, 60 which is greater than 10%, 33%, 50%, 90%, 95% or 99% as and human. compared to a cell not treated according to the present inven Invertebrate animals include nematodes, other worms, tion. Lower doses of injected material and longer times after Drosophila, and other insects. Representative generae of administration of dsRNA may result in inhibition in a smaller nematodes include those that infect animals (e.g., Ancylos fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or toma, Ascaridia, Ascaris, Bunostomum, Caenorhabditis, 65 95% of targeted cells). Quantitation of gene expression in a Capillaria, Chabertia, Cooperia, Dictyocaulus, Haernon cell may show similar amounts of inhibition at the level of chus, Heterakis, Nematodirus, Oesophagostomum, Osterta accumulation of target mRNA or translation of target protein. US 8,829,264 B2 29 30 As an example, the efficiency of inhibition may be deter in an amount which allows delivery of at least one copy per mined by assessing the amount of gene product in the cell: cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies mRNA may be detected with a hybridization probe having a per cell) of double-stranded material may yield more effec nucleotide sequence outside the region used for the inhibitory tive inhibition; lower doses may also be useful for specific double-stranded RNA, or translated polypeptide may be applications. Inhibition is sequence-specific in that nucle detected with an antibody raised against the polypeptide otide sequences corresponding to the duplex region of the sequence of that region. RNA are targeted for genetic inhibition. As disclosed herein, the present invention is not limited to dsRNA constructs containing a nucleotide sequences iden any type of target gene or nucleotide sequence. But the fol tical to a portion, of either coding or non-coding sequence, of lowing classes of possible target genes are listed for illustra 10 the target gene are preferred for inhibition. RNA sequences tive purposes: developmental genes (e.g., adhesion mol with insertions, deletions, and single point mutations relative ecules, cyclin kinase inhibitors, Writ family members, Pax to the target sequence (dsRNA similar to the target gene) have family members, Winged helix family members, Hox family also been found to be effective for inhibition. Thus, sequence members, cytokines/lymphokines and their receptors, identity may be optimized by sequence comparison and growth/differentiation factors and their receptors, neurotrans 15 alignment algorithms known in the art (see Gribskov and mitters and their receptors); oncogenes (e.g., ABLI, BCLI, Devereux, Sequence Analysis Primer, Stockton Press, 1991, BCL2, BCL6, CBFA2, CBL, CSFIR, ERBA, ERBB, and references cited therein) and calculating the percent dif EBRB2, ETSI, ETS1, ETV6, FGR, FOS, FYN, HCR, HRAS, ference between the nucleotide sequences by, for example, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, the Smith-Waterman algorithm as implemented in the BEST MYCLI, MYCN, NRAS, PIM1, PML, RET, SRC, TALI, FIT Software program using default parameters (e.g., Univer TCL3, and YES); tumor suppressor genes (e.g., APC, BRCA sity of Wisconsin Genetic Computing Group). Greater than 1, BRCA2, MADH4, MCC, NF1, NF2, RB 1, TP53, and 90% sequence identity, or even 100% sequence identity, WTI); and enzymes (e.g., ACC synthases and oxidases, ACP between the inhibitory RNA and the portion of the target gene desaturases and hydroxylases, ADP-glucose pyrophorylases, is preferred. Alternatively, the duplex region of the RNA may ATPases, alcohol dehydrogenases, amylases, amyloglucosi 25 be defined functionally as a nucleotide sequence that is dases, catalases, cellulases, chalcone synthases, chitinases, capable of hybridizing with a portion of the target gene tran cyclooxygenases, decarboxylases, dextrinases, DNA and script (e.g., 400 mM. NaCl, 40 mM PIPES pH 6.4, 1 mM RNA polymerases, galactosidases, glucanases, glucose oxi EDTA, 50° C. or 70° C. hybridization for 12-16 hours; fol dases, granule-bound starch synthases, GTPases, helicases, lowed by washing). In certain preferred embodiments, the hemicellulases, integrases, inulinases, invertases, 30 length of the dsRNA is at least 20, 21 or 22 nucleotides in isomerases, kinases, lactases, lipases, lipoxygenases, length, e.g., corresponding in size to RNA products produced lysozymes, nopaline synthases, octopine synthases, by Dicer-dependent cleavage. In certain embodiments, the pectinesterases, peroxidases, phosphatases, phospholipases, dsRNA construct is at least 25, 50, 100,200,300 or 400 bases. phosphorylases, phytases, plant growth regulator synthases, In certain embodiments, the dsRNA construct is 400-800 polygalacturonases, proteinases and peptidases, pullanases, 35 bases in length. recombinases, reverse transcriptases, RUBISCOs, topoi In one embodiment, the dsRNA is a single-stranded hairpin Somerases, and Xylanases). ribonucleic acid (shRNA) comprising self complementary D. dsRNA Constructs sequences of 19 to 100 nucleotides that form a duplex region, The dsRNA construct may comprise one or more strands of which self complementary sequences hybridize under intra polymerized ribonucleotide. It may include modifications to 40 cellular conditions to a target gene, wherein said hairpin either the phosphate-sugar backbone or the nucleoside. For RNA: (i) is a substrate for cleavage by a RNaseIII enzyme to example, the phosphodiester linkages of natural RNA may be produce a double-stranded RNA product, (ii) does not pro modified to include at least one of a nitrogen or sulfur het duce a general sequence-independent killing of the mamma eroatom. Modifications in RNA structure may be tailored to lian cells, and (iii) reduces expression of said target gene in a allow specific genetic inhibition while avoiding a general 45 manner dependent on the sequence of said complementary panic response in some organisms which is generated by regions. In a preferred embodiment, the shRNA comprises a dsRNA. Likewise, bases may be modified to block the activ 3' overhang of about 1-4 nucleotides. ity of adenosine deaminase. The dsRNA construct may be In a related embodiment, he dsRNA is a single-stranded produced enzymatically or by partial/total organic synthesis, hairpin ribonucleic acid (shRNA) comprising self comple any modified ribonucleotide can be introduced by in vitro 50 mentary sequences of 19 to 100 nucleotides that form a enzymatic or organic synthesis. duplex region, which self complementary sequences hybrid The dsRNA construct may be directly introduced into the ize under intracellular conditions to a target gene, wherein cell (i.e., intracellularly); or introduced extracellularly into a said hairpin RNA: (i) is cleaved in the mammalian cells to cavity, interstitial space, into the circulation of an organism, produce an RNA guide sequence that enters an Argonaut introduced orally, or may be introduced by bathing an organ 55 containing complex, (ii) does not produce a general ism in a solution containing RNA. Methods for oral introduc sequence-independent killing of the mammalian cells, and tion include direct mixing of RNA with food of the organism, (iii) reduces expression of said target gene in a manner depen as well as engineered approaches in which a species that is dent on the sequence of said complementary regions. In a used as food is engineered to express an RNA, then fed to the preferred embodiment, the shRNA comprises a 3' overhang of organism to be affected. Physical methods of introducing 60 about 1-4 nucleotides. nucleic acids include injection of an RNA solution directly The size of the duplex region of the subject shRNA may be into the cell or extracellular injection into the organism. longer (e.g., anywhere between 19 to about 1000 nucleotides, The double-stranded structure may be formed by a single or 19-about 500 nt, or 19-about 250 nt, etc.), but in many self-complementary RNA strand (such as in the form of applications, about 29 nucleotides is Sufficient. In certain shRNA) or two complementary RNA strands (such as in the 65 embodiments, the duplex region is any where between about form of siRNA). RNA duplex formation may be initiated 25-29 nt. In other embodiments, the duplex region is any either inside or outside the cell. The RNA may be introduced where between about 19-25 nt. US 8,829,264 B2 31 32 The size of the 3' overhang may be 1-5 nucleotides, pref cellular RNA polymerase. Examplery but not limiting pro erably 2-4 nucleotides. In one embodiment, the 3' overhang is moters include: a U6 promoter, a T7 promoter, a T3 promoter, 2 nucleotides. The specific sequences of the 3' overhang or an SP6 promoter. In certain embodiments, the transcrip nucleotides are less important. In one embodiment, the over tional regulatory sequences includes an inducible promoter. hang nucleotides can be any nucleotides, including “non The dsRNA constructs may be integrated into the host standard” or modified nucleotides. In other embodiments, the genome. Such that the target cells are stably transfected with overhang sequences are mostly pyramidines. Such as U. C. or the dsRNA expression constructs. The constructs may be T. In one embodiment, the 2-nucleotide overhang is UU. suitable for stable integration into either cells in culture or in In certain embodiments, the 5' of the shRNA may have 1-5 an animal. For example, the constructs may be integrated into nt overhang that does not pair with the 3' overhang. 10 embryonic cells, such as a mouse ES cell, to generate a The size of the “loop” between the paired duplex region transgenic animal. The constructs may also be integrated into may vary, but preferably contains at least about 3-8 nucle adult somatic cells, either primary cellorestablished cell line. otides, such as 4 nucleotides. In certain embodiments, the expression of a target gene 100% sequence identity between the RNA and the target (either endogenous or heterologous gene) is attenuated by at gene is not required to practice the present invention. Thus the 15 least about 33%, or about 50%, about 60%, 70%, 80%, 90%, invention has the advantage of being able to tolerate sequence 95%, or 99% or more, relative to expression in cells not variations that might be expected due to genetic mutation, treated with the dsRNA (e.g., shRNA). strain polymorphism, or evolutionary divergence. The shRNA may be chemically synthesized, or in vitro The dsRNA construct may be synthesized either in vitro or transcripted, and may further include one or more modifica in vitro. Endogenous RNA polymerase of the cell may medi tions to phosphate-Sugar backbone or nucleosides residues. ate transcription in vitro, or cloned RNA polymerase can be Other methods known in the art for introducing nucleic used for transcription in vitro or in vitro. For transcription acids to cells may be used, such as lipid-mediated carrier from a transgene in vitro or an expression construct, a regu transport, chemical mediated transport, Such as calcium phos latory region (e.g., promoter, enhancer, silencer, splice donor phate, and the like. Thus the dsRNA construct may be intro and acceptor, polyadenylation) may be used to transcribe the 25 duced along with components that perform one or more of the dsRNA strand (or strands). Inhibition may be targeted by following activities: enhance RNA uptake by the cell, pro specific transcription in an organ, tissue, or cell type; stimu mote annealing of the duplex Strands, stabilize the annealed lation of an environmental condition (e.g., infection, stress, Strands, or otherwise increase inhibition of the target gene. temperature, chemical inducers); and/or engineering tran E. Illustrative Uses Scription at a developmental stage or age. The RNA strands 30 One utility of the present invention is as a method of iden may or may not be polyadenylated; the RNA strands may or tifying gene function in an organism, especially higher may not be capable of being translated into a polypeptide by eukaryotes, comprising the use of double-stranded RNA to a cells translational apparatus. The dsRNA construct may be inhibit the activity of a target gene of previously unknown chemically or enzymatically synthesized by manual or auto function. Instead of the time consuming and laborious isola mated reactions. The dsRNA construct may be synthesized by 35 tion of mutants by traditional genetic screening, functional a cellular RNA polymerase or a bacteriophage RNA poly genomics would envision determining the function of unchar merase (e.g., T3, T7, SP6). The use and production of an acterized genes by employing the invention to reduce the expression construct are known in the art (see also WO amount and/or alter the timing of target gene activity. The 97/32016; U.S. Pat. Nos. 5,593.874, 5,698,425, 5,712,135, invention could be used in determining potential targets for 5,789,214, and 5,804,693; and the references cited therein). If 40 pharmaceuticals, understanding normal and pathological synthesized chemically or by in vitro enzymatic synthesis, the events associated with development, determining signaling RNA may be purified prior to introduction into the cell. For pathways responsible for postnatal development/aging, and example, RNA can be purified from a mixture by extraction the like. The increasing speed of acquiring nucleotide with a solvent or resin, precipitation, electrophoresis, chro sequence information from genomic and expressed gene matography or a combination thereof. Alternatively, the 45 Sources, including total sequences for mammalian genomes, dsRNA construct may be used with no or a minimum of can be coupled with the invention to determine gene function purification to avoid losses due to sample processing. The in a cell or in a whole organism. The preference of different dsRNA construct may be dried for storage or dissolved in an organisms to use particular codons, searching sequence data aqueous solution. The Solution may contain buffers or salts to bases for related gene products, correlating the linkage map promote annealing, and/or stabilization of the duplex strands. 50 of genetic traits with the physical map from which the nucle Physical methods of introducing nucleic acids include otide sequences are derived, and artificial intelligence meth injection of a solution containing the dsRNA construct, bom ods may be used to define putative open reading frames from bardment by particles covered by the dsRNA construct, soak the nucleotide sequences acquired in Such sequencing ing the cell or organism in a solution of the RNA, microin projects. jected into the target (e.g., mammalian target) cells, or 55 A simple assay would be to inhibit gene expression accord electroporation of cell membranes in the presence of the ing to the partial sequence available from an expressed dsRNA construct. A viral construct packaged into a viral sequence tag (EST). Functional alterations in growth, devel particle would accomplish both efficient introduction of an opment, metabolism, disease resistance, or other biological expression construct into the cell and transcription of dsRNA processes would be indicative of the normal role of the EST's construct encoded by the expression construct. In one 60 gene product. embodiment, the shRNA is a transcriptional product that is The ease with which the dsRNA construct can be intro transcribed from an expression construct introduced into the duced into an intact cell/organism containing the target gene target (e.g., mammalian target) cells, which expression con allows the present invention to be used in high throughput struct comprises a coding sequence for transcribing said screening (HTS). For example, duplex RNA can be produced shRNA, operably linked to one or more transcriptional regu 65 by an amplification reaction using primers flanking the inserts latory sequences. Such transcriptional regulatory sequences of any gene library derived from the target cell or organism. may include a promoter for an RNA polymerase, Such as a Inserts may be derived from genomic DNA or mRNA (e.g., US 8,829,264 B2 33 34 cDNA and cFNA). Individual clones from the library can be tional equivalent of conditional mutations may be produced replicated and then isolated in separate reactions, but prefer by inhibiting activity of the target gene when or where it is not ably the library is maintained in individual reaction vessels required for viability. The invention allows addition of RNA (e.g., a 96 well microtiter plate) to minimize the number of at specific times of development and locations in the organism steps required to practice the invention and to allow automa without introducing permanent mutations into the target tion of the process. genome. In an exemplary embodiment, the Subject invention pro The present invention may be useful in allowing the inhi vides an arrayed library of RNAi constructs. The array may be bition of genes that have been difficult to inhibit using other in the form of solutions, such as multi-well plates, or may be methods due to gene redundancy. Since the present methods “printed on solid substrates upon which cells can be grown. 10 To illustrate, solutions containing duplex RNAs that are may be used to deliver more than one dsRNA to a cell or capable of inhibiting the different expressed genes can be organism, dsRNA identical or similar to more than one gene, placed into individual wells positioned on a microtiterplate as wherein the genes have a redundant function during normal an ordered array, and intact cells/organisms in each well can development, may be delivered. be assayed for any changes or modifications in behavior or 15 If alternative splicing produced a family of transcripts that development due to inhibition of target gene activity. were distinguished by usage of characteristic exons, the In one embodiment, the Subject method uses an arrayed present invention can target inhibition through the appropri library of RNAi constructs to screen for combinations of ate exons to specifically inhibit or to distinguish among the RNAi that are lethal to host cells. Synthetic lethality is a functions of family members. For example, a protein factor bedrock principle of experimental genetics. A synthetic that contained an alternatively spliced transmembrane lethality describes the properties of two mutations which, domain may be expressed in both membrane bound and individually, are tolerated by the organism but which, incom secreted forms. Instead of isolating a nonsense mutation that bination, are lethal. The subject arrays can be used to identify terminates translation before the transmembrane domain, the loss-of-function mutations that are lethal incombination with functional consequences of having only secreted hormone alterations in other genes, such as activated oncogenes or 25 can be determined according to the invention by targeting the loss-of-function mutations to tumor Suppressors. To achieve exon containing the transmembrane domain and thereby this, one can create “phenotype arrays' using cultured cells. inhibiting expression of membrane-bound hormone. That is, Expression of each of a set of genes, such as the host cells the subject method can be used for selected ablation of splic genome, can be individually systematically disrupted using ing variants. RNA interference. Combination with alterations in oncogene 30 The present invention may be used alone or as a component and tumor Suppressor pathways can be used to identify syn of a kit having at least one of the reagents necessary to carry thetic lethal interactions that may identify novel therapeutic out the invitro or invitro introduction of RNA to test samples targets. or subjects. Preferred components are the dsRNA and a In certain embodiments, the RNAi constructs can be fed vehicle that promotes introduction of the dsRNA. Such a kit directly to, or injected into, the cell/organism containing the 35 may also include instructions to allow a user of the kit to target gene. Alternatively, the duplex RNA can be produced practice the invention. by in vitro or in vitro transcription from an expression con Alternatively, an organism may be engineered to produce struct used to produce the library. The construct can be rep dsRNA which produces commercially or medically benefi licated as individual clones of the library and transcribed to cial results, for example, resistance to a pathogen or its patho produce the RNA; each clone can then be fed to, injected into, 40 genic effects, improved growth, or novel developmental pat or delivered by another method known in the art to, the terns. cell/organism containing the target gene. The function of the Another aspect of the invention provides a method for target gene can be assayed from the effects it has on the attenuating expression of a target gene in mammalian cells, cell/organism when gene activity is inhibited. This screening comprising introducing into the mammalian cells a single could be amenable to Small subjects that can be processed in 45 stranded hairpin ribonucleic acid (shRNA) comprising self large number, for example, tissue culture cells derived from complementary sequences of 19 to 100 nucleotides that form mammals, especially primates, and most preferably humans. a duplex region, which self complementary sequences If a characteristic of an organism is determined to be hybridize under intracellular conditions to a target gene, genetically linked to a polymorphism through RFLP or QTL wherein said hairpin RNA: (i) is a substrate for cleavage by a analysis, the present invention can be used to gain insight 50 RNaseIII enzyme to produce a double-stranded RNA prod regarding whether that genetic polymorphism might be uct, (ii) does not produce a general sequence-independent directly responsible for the characteristic. For example, a killing of the mammaliancells, and (iii) reduces expression of fragment defining the genetic polymorphism or sequences in said target gene in a manner dependent on the sequence of the vicinity of such a genetic polymorphism can be amplified said complementary regions. In a preferred embodiment, the to produce an RNA, the duplex RNA can be introduced to the 55 shRNA comprises a 3' overhang of about 1-4 nucleotides. organism or cell, and whether an alteration in the character In a related aspect, the invention provides a method for istic is correlated with inhibition can be determined. Of attenuating expression of a target gene in mammalian cells, course, there may be trivial explanations for negative results comprising introducing into the mammalian cells a single with this type of assay, for example: inhibition of the target stranded hairpin ribonucleic acid (shRNA) comprising self gene causes lethality, inhibition of the target gene may not 60 complementary sequences of 19 to 100 nucleotides that form result in any observable alteration, the fragment contains a duplex region, which self complementary sequences nucleotide sequences that are not capable of inhibiting the hybridize under intracellular conditions to a target gene, target gene, or the target gene's activity is redundant. wherein said hairpin RNA: (i) is cleaved in the mammalian The present invention may be useful in allowing the inhi cells to produce an RNA guide sequence that enters an Argo bition of essential genes. Such genes may be required for cell 65 naut-containing complex, (ii) does not produce a general or organism viability at only particular stages of development sequence-independent killing of the mammalian cells, and or only in specific cellular compartments or tissues. The func (iii) reduces expression of said target gene in a manner depen US 8,829,264 B2 35 36 dent on the sequence of said complementary regions. In a which are included merely for purposes of illustration of preferred embodiment, the shRNA comprises a 3' overhang of certain aspects and embodiments of the present invention and about 1-4 nucleotides. are not intended to limit the invention. In yet another embodiment, the invention provides a method for attenuating expression of one or more target genes Example 1 in mammalian cells, comprising introducing into the mam malian cells a variegated library of single-stranded hairpin An RNA-Directed Nuclease Mediates RNAi Gene ribonucleic acid (shRNA) species, each shRNA species com Silencing prising self complementary sequences of 19 to 100 nucle otides that form duplex regions and which hybridize under intracellular conditions to a target gene, wherein each of said 10 In a diverse group of organisms that includes Caenorhab hairpin RNA species: (i) is a substrate for cleavage by a ditis elegans, Drosophila, planaria, hydra, trypanosomes, RNaseIII enzyme to produce a double-stranded RNA prod fungi and plants, the introduction of double-stranded RNAs uct, (ii) does not produce a general sequence-independent inhibits gene expression in a sequence-specific manner killing of the mammalian cells, and (iii) if complementary to (Sharp, Genes and Development 13: 139-141, 1999; a target sequence, reduces expression of said target gene in a 15 Sanchez-Alvarado and Newmark, PNAS 96: 5049-5054, manner dependent on the sequence of said complementary 1999; Lohman et al., Developmental Biology 214: 211-214, regions. In a preferred embodiment, the shRNA comprises a 1999; Cogoni and Macino, Nature 399: 166-169, 1999; 3' overhang of about 1-4 nucleotides. Waterhouse et al., PNAS95: 13959-13964, 1998; Montgom In certain embodiments, the variegated library of shRNA ery and Fire, Trends Genet. 14: 225-228, 1998: Ngo et al., species are arrayed a solid Substrate. PNAS95: 14687-14692, 1998). These responses, called RNA In another embodiment, the method includes the further interference or post-transcriptional gene silencing, may pro step of identifying shRNA species of said variegated library vide anti-viral defense, modulate transposition or regulate which produce a detected phenotype in the mammalian cells. gene expression (Sharp, Genes and Development 13: 139 Yet another aspect of the invention provide a method of 141, 1999; Montgomery and Fire, Trends Genet. 14:225-228, enhancing the potency/activity of an RNAi therapeutic for a 25 1998: Tabara et al., Cell 99:123-132, 1999; Kettinget al., Cell mammalian patient, the RNAi therapeutic comprising an siRNA of 19-22 paired polynucleotides, the method compris 99: 133-141, 1999; Ratcliff et al., Science 276: 1558-1560, ing replacing the siRNA with a single-stranded hairpin RNA 1997). We have taken a biochemical approach towards eluci (shRNA) of the subject invention, wherein said duplex region dating the mechanisms underlying this genetic phenomenon. comprises the same 19-22 paired polynucleotides of the Here we show that loss-of-function phenotypes can be cre siRNA. This aspect of the invention is partly based on the 30 ated in cultured Drosophila cells by transfection with specific Surprising discovery that shRNA constructs designed as double-stranded RNAs. This coincides with a marked reduc Dicer Substrates perform at least as well as, and in most cases tion in the level of cognate cellular messenger RNAs. Extracts much better/potent than the corresponding siRNA form of of transfected cells contain a nuclease activity that specifi dsRNA (e.g., with the same eventual target guide sequence of cally degrades exogenous transcripts homologous to trans about 22 nucleotides). 35 fected double-stranded RNA. This enzyme contains an essen In certain embodiments, the half-maximum inhibition by tial RNA component. After partial purification, the sequence the RNAi therapeutic is achieved by a concentration of the specific nuclease co-fractionates with a discrete, ~25 shRNA at least about 20%, or about 30%, 40%, 50%, 60%, nucleotide RNA species which may confer specificity to the 70%, 80%, 90% lower than that of the corresponding siRNA. enzyme through homology to the Substrate mRNAS. In another embodiment, the end-point inhibition by the 40 Although double-stranded RNAs (dsRNAs) can provoke shRNA is at least about 40%, or about 50%, 75%, 100%, gene silencing in numerous biological contexts including 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, or 10-fold higher than Drosophila (Kennerdell et al., Cell 95: 1017-1026, 1998: that of the siRNA. Misquitta and Paterson, PNAS 96: 1451-1456, 1999), the Another aspect of the invention provides a method of mechanisms underlying this phenomenon have remained designing a short hairpin RNA (shRNA) construct for RNAi, 45 mostly unknown. We therefore wanted to establish a bio the shRNA comprising a 3' overhang of about 1-4 nucle chemically tractable model in which Such mechanisms could otides, the method comprising selecting the nucleotide about be investigated. 21 bases 5' to the most 3'-end nucleotide as the first paired Transient transfection of cultured, Drosophila S2 cells nucleotide in a cognate doubled-stranded siRNA with the with a lacZ expression vector resulted in B-galactosidase same 3' overhang. Such shRNA can be used, for example, for 50 activity that was easily detectable by an in situ assay (FIG. RNAi in mammalian cells. 1a). This activity was greatly reduced by co-transfection with In one embodiment, the shRNA comprises about 15-45, a dsRNA corresponding to the first 300 nucleotides of the preferably about 25-29 paired polynucleotides. lacZ sequence, whereas co-transfection with a control In one embodiment, the 3' overhang has 2 nucleotides. dsRNA (CD8) (FIG. 1a) or with single-stranded RNAs of In one embodiment, the shRNA, when cut by a Dicer 55 either sense or antisense orientation (data not shown) had enzyme (e.g., a human Dicer enzyme), produces a product little or no effect. This indicated that dsRNAs could interfere, siRNA that is either identical to, or differ by a single basepair in a sequence-specific fashion, with gene expression in cul immediately 5' to the 3' overhang from the cognate siRNA. tured cells. In one embodiment, the shRNA construct has substantially To determine whether RNA interference (RNAi) could be the sameprofiles of off-target gene inhibition effects as com 60 used to target endogenous genes, we transfected S2 cells with pared to the cognate siRNA construct with substantially iden a dsRNA corresponding to the first 540 nucleotides of Droso tical target sequences. phila cyclin E, a gene that is essential for progression into S phase of the cell cycle. During log-phase growth, untreated IV. Exemplification S2 cells reside primarily in G2/M (FIG. 1b). Transfection 65 with lacZ dsRNA had no effect on cell-cycle distribution, but The invention, now being generally described, will be more transfection with the cyclin E dsRNA caused a G1-phase readily understood by reference to the following examples, cell-cycle arrest (FIG. 1b). The ability of cyclin EdsRNA to US 8,829,264 B2 37 38 provoke this response was length-dependent. Double to position effects because -100-nucleotide transcripts stranded RNAs of 540 and 400 nucleotides were quite effec derived from other portions of the transfected dsRNA tive, whereas dsRNAs of 200 and 300 nucleotides were less behaved similarly (data not shown). As expected, the potent. Double-stranded cyclin E RNAs of 50 or 100 nucle nuclease activity (or activities) present in the extract could otides were inert in our assay, and transfection with a single 5 also recognize the antisense strand of the cyclin E mRNA. stranded, antisense cyclin E RNA had virtually no effect. Again, Substrates that contained a Substantial portion of the One hallmark of RNAi is a reduction in the level of mRNAs targeted region were degraded efficiently whereas those that that are homologous to the dsRNA. Cells transfected with the contained a shorter stretch of homologous sequence (~130 cyclin E dsRNA (bulk population) showed diminished nucleotides) were recognized inefficiently (FIG.2c, as 600). endogenous cyclin E mRNA as compared with control cells 10 For both the sense and antisense strands, transcripts that had (FIG. 1c). Similarly, transfection of cells with dsRNAs no homology with the transfected dsRNA (FIG. 2b, Eout: homologous to fizzy, a component of the anaphase-promot FIG. 2c, as300) were not degraded. Although we cannot ing complex (APC) or cyclinA, a cyclin that acts in S. G2and exclude the possibility that nuclease specificity could have M, also caused reduction of their cognate mRNAs (FIG. 1c). migrated beyond the targeted region, the resistance of tran The modest reduction in fizzy mRNA levels in cells trans 15 Scripts that do not contain homology to the dsRNA is consis fected with cyclin A dsRNA probably resulted from arrest at tent with data from C. elegans. Double-stranded RNAs a point in the division cycle at which fizzy transcription is low homologous to an upstream cistron have little or no effect on (Wolf and Jackson, Current Biology 8: R637-R639, 1998: a linked downstream cistron, despite the fact that unproc Kramer et al., Current Biology 8: 1207-1210, 1998). These essed, polycistronic mRNAs can be readily detected (Tabara results indicate that RNAi may be a generally applicable et al., Science 282: 430-432, 1998; Bosher et al., Genetics method for probing gene function in cultured Drosophila 153: 1245-1256, 1999). Furthermore, the nuclease was inac cells. tive against a dsRNA identical to that used to provoke the The decrease in mRNA levels observed upon transfection RNAi response in vitro (FIG. 2b). In the in vitro system, of specific dsRNAs into Drosophila cells could be explained neither a 5' cap nor a poly(A)tail was required, as Such by effects at transcriptional or post-transcriptional levels. 25 transcripts were degraded as efficiently as uncapped and non Data from other systems have indicated that some elements of polyadenylated RNAs. the dsRNA response may affect mRNA directly (reviewed in Gene silencing provoked by dsRNA is sequence specific. A Sharp, Genes and Development 13: 139-141, 1999; Mont plausible mechanism for determining specificity would be gomery and Fire, Trends Genet. 14: 225-228, 1998). We incorporation of nucleic-acid guide sequences into the com therefore sought to develop a cell-free assay that reflected, at 30 plexes that accomplish silencing (Hamilton and Baulcombe, least in part, RNAi. Science 286: 950-952, 1999). In accord with this idea, pre S2 cells were transfected with dsRNAs corresponding to treatment of extracts with a Ca"-dependent nuclease (micro either cyclin E or lacz. Cellular extracts were incubated with coccal nuclease) abolished the ability of these extracts to synthetic mRNAs of lacZorcyclin E. Extracts prepared from degrade cognate mRNAs (FIG. 3). Activity could not be cells transfected with the 540-nucleotide cyclin E dsRNA 35 rescued by addition of non-specific RNAS Such as yeast trans efficiently degraded the cyclin Etranscript; however, the lacz fer RNA. Although micrococcal nuclease can degrade both transcript was stable in these lysates (FIG. 2a). Conversely, DNA and RNA, treatment of the extract with DNAse I had no lysates from cells transfected with the lacZ dsRNA degraded effect (FIG.3). Sequence-specific nuclease activity, however, the lacZ transcript but left the cyclin E mRNA intact. These did require protein (data not shown). Together, our results results indicate that RNAi ablates target mRNAs through the 40 support the possibility that the RNAi nuclease is a ribonucle generation of a sequence-specific nuclease activity. We have oprotein, requiring both RNA and protein components. Bio termed this enzyme RISC (RNA-induced silencing complex). chemical fractionation (see below) is consistent with these Although we occasionally observed possible intermediates in components being associated in extract rather than being the degradation process (see FIG. 2), the absence of stable assembled on the target mRNA after its addition. cleavage end-products indicates an exonuclease (perhaps 45 In plants, the phenomenon of co-suppression has been coupled to an endonuclease). However, it is possible that the associated with the existence of small (-25-nucleotide) RNAi nuclease makes an initial endonucleolytic cut and that RNAs that correspond to the gene that is being silenced non-specific exonucleases in the extract complete the degra (Hamilton and Baulcombe, Science 286: 950-952, 1999). To dation process (Shuttleworth and Colman, EMBO.J. 7: 427 address the possibility that a similar RNA might exist in 434, 1988). In addition, our ability to create an extract that 50 Drosophila and guide the sequence-specific nuclease in the targets lacZ in vitro indicates that the presence of an endog choice of substrate, we partially purified our activity through enous gene is not required for the RNAi response. several fractionation steps. Crude extracts contained both To examine the substrate requirements for the dsRNA sequence-specific nuclease activity and abundant, heteroge induced, sequence-specific nuclease activity, we incubated a neous RNAs homologous to the transfected dsRNA (FIGS. 2 variety of cyclin-E-derived transcripts with an extract derived 55 and 4a). The RNAi nuclease fractionated with ribosomes in a from cells that had been transfected with the 540-nucleotide high-speed centrifugation step. Activity could be extracted by cyclin EdsRNA (FIG.2b, c). Just as a length requirement was treatment with high salt, and ribosomes could be removed by observed for the transfected dsRNA, the RNAi nuclease an additional centrifugation step. Chromatography of soluble activity showed a dependence on the size of the RNA sub nuclease over an anion-exchange column resulted in a dis strate. Both a 600-nucleotide transcript that extends slightly 60 crete peak of activity (FIG. 4b, cyclin E). This retained speci beyond the targeted region (FIG.2b) and an ~1-kilobase (kb) ficity as it was inactive against a heterologous mRNA (FIG. transcript that contains the entire coding sequence (data not 4b, lacZ). Active fractions also contained an RNA species of shown) were completely destroyed by the extract. Surpris 25 nucleotides that is homologous to the cyclin E target (FIG. ingly, shorter Substrates were not degraded as efficiently. 4b, northern). The band observed on northern blots may rep Reduced activity was observed against either a 300- or a 65 resent a family of discrete RNAs because it could be detected 220-nucleotide transcript, and a 100-nucleotide transcript with probes specific for both the sense and antisense cyclin E was resistant to nuclease in our assay. This was not due solely sequences and with probes derived from distinct segments of US 8,829,264 B2 39 40 the dsRNA (data not shown). At present, we cannot determine Typically, 5ul extract was used in a 10ul assay that contained whether the 25-nucleotide RNA is present in the nuclease also 10,000 c. p.m. synthetic mRNA substrate. complex in a double-stranded or single-stranded form. Extract Fractionation RNA interference allows an adaptive defense against both Extracts were centrifuged at 200,000 g for 3 h and the exogenous and endogenous dsRNAs, providing something 5 resulting pellet (containing ribosomes) was extracted in akin to a dsRNA immune response. Our data, and that of hypotonic buffer containing also 1 mM MgCl2 and 300 mM others (Hamilton and Baulcombe, Science 286: 950-952, KOAc. The extracted material was spun at 100,000 g for 1 h 1999), is consistent with a model in which dsRNAs present in and the resulting Supernatant was fractionated on Source 15Q a cell are converted, either through processing or replication, column (Pharmacia) using a KCl gradient in buffer A (20 mM into Small specificity determinants of discrete size in a man 10 HEPES pH 7.0, 1 mM dithiothreitol, 1 mM MgCl). Fractions ner analogous to antigen processing. Our results suggest that were assayed for nuclease activity as described above. For the post-transcriptional component of dsRNA-dependent northern blotting, fractions were proteinase K/SDS treated, gene silencing is accomplished by a sequence-specific phenol extracted, and resolved on 15% acrylamide 8M urea nuclease that incorporates these Small RNAS as guides that gels. RNA was electroblotted onto Hybond N+ and probed target specific messages based upon sequence recognition. 15 with strand-specific riboprobes derived from cyclin E mRNA. The identical size of putative specificity determinants in Hybridization was carried out in 500 mMNaPO pH 7.0, 15% plants (Hamilton and Baulcombe, Supra) and animals pre formamide, 7% SDS, 1% BSA. Blots were washed in 1XSSC dicts a conservation of both the mechanisms and the compo at 37-45° C. nents of dsRNA-induced, post-transcriptional gene silencing in diverse organisms. In plants, dsRNAS provoke not only Example 2 post-transcriptional gene silencing but also chromatin remod eling and transcriptional repression (Jones et al., EMBO.J. 17: Role for a Bidentate Ribonuclease in the Initiation 6385-6393, 1998: Jones et al., Plant Cell 11: 2291-2301, Step of RNA Interference 1999). It is now critical to determine whether conservation of gene-silencing mechanisms also exists at the transcriptional 25 Genetic approaches in worms, fungi and plants have iden level and whether chromatin remodeling can be directed in a tified a group of proteins that are essential for double sequence-specific fashion by these same dsRNA-derived Stranded RNA-induced gene silencing. Among these are guide sequences. ARGONAUTE family members (e.g. RDE1, QDE2) (Tabara Methods: et al., Cell 99: 123-132, 1999; Catalanotto et al., Nature 404: Cell Culture and RNA Methods S2 cells (Schneider, J. 30 245, 2000; Fagard et al., PNAS 97: 11650-11654, 2000), Embryol Exp Morpho 27: 353–365, 1972) were cultured at recC-family helicases (MUT-7, QDE3) (Ketting et al., Cell 27°C. in 90% Schneider's insect media (Sigma), 10% heat 99: 133-141, 1999; Cogoni and Macino, Science 286: 2342 inactivated fetal bovine serum (FBS). Cells were transfected 2344, 1999), and RNA-dependent RNA polymerases (e.g., with dsRNA and plasmid DNA by calcium phosphate co EGO-1, QDE1, SGS2/SDE1) (Cogoni and Macino, Nature precipitation (DiNocera and Dawid, PNAS 80: 7095-7098, 35 399: 166-169, 1999: Smardon et al., Current Biology 10: 1983). Identical results were observed when cells were trans 169-178, 2000; Mourrain et al., Cell 101: 533-542, 2000; fected using lipid reagents (for example, Superfect, Qiagen). Dalmayet al., Cell 101:543-553, 2000). While potential roles For FACS analysis, cells were additionally transfected with a have been proposed, none of these genes has been assigned a vector that directs expression of a green fluorescent protein definitive function in the silencing process. Biochemical (GFP)-US9 fusion protein (Kaleita et al., Exp Cell Res. 248: 40 studies have suggested that PTGS is accomplished by a mul 322–328, 1999). These cells were fixed in 90% ice-cold etha ticomponent nuclease that targets mRNAS for degradation nol and stained with propidium iodide at 25ug/ml. FACS was (Hammond et al., Nature 404: 293-296, 2000; Zamore et al., performed on an Elite flow cytometer (Coulter). For northern Cell 101:25-33, 2000; Tuschl et al., Genes and Development blotting, equal loading was ensured by over-probing blots 13:3191-3197, 1999). We have shown that the specificity of with a control complementary DNA (RP49). For the produc 45 this complex may derive from the incorporation of a small tion of dsRNA, transcription templates were generated by guide sequence that is homologous to the mRNA substrate polymerase chain reaction Such that they contained T7 pro (Hammond et al., Nature 404: 293-296, 2000). Originally moter sequences on each end of the template. RNA was identified in plants that were actively silencing transgenes prepared using the RiboMax kit (Promega). Confirmation (Hamilton and Baulcombe, Science 286: 950-952, 1999), that RNAs were double stranded came from their complete 50 these ~22nt. RNAs have been produced during RNAi in vitro sensitivity to RNAse III. Target mRNA transcripts were syn using an extract prepared from Drosophila embryos (Zamore thesized using the Riboprobe kit (Promega) and were gel et al., Cell 101:25-33, 2000). Putative guide RNAs can also purified before use. be produced in extracts from Drosophila S2 cells (FIG. 5a). Extract Preparation With the goal of understanding the mechanism of post-tran Log-phase S2 cells were plated on 15-cm tissue culture 55 Scriptional gene silencing, we have undertaken both bio dishes and transfected with 30 ug dsRNA and 30 ug carrier chemical fractionation and candidate gene approaches to plasmid DNA. Seventy-two hours after transfection, cells identify the enzymes that execute each step of RNAi. were harvested in PBS containing 5 mM EGTA, washed Our previous studies resulted in the partial purification of a twice in PBS and once in hypotonic buffer (10 mM HEPES nuclease, RISC, that is an effector of RNA interference. See pH 7.3, 6 mM f-mercaptoethanol). Cells were suspended in 60 Example 1. This enzyme was isolated from Drosophila S2 0.7 packed-cell volumes of hypotonic buffer containing Com cells in which RNAi had been initiated in vitro by transfection plete protease inhibitors (Boehringer) and 0.5 units/ml of with dsRNA. We first sought to determine whether the RISC RNasin (Promega). Cells were disrupted in a dounce homog enzyme and the enzyme that initiates RNAi via processing of enizer with a type B pestle, and lysates were centrifuged at dsRNA into 22 mers are distinct activities. RISC activity 30,000 g for 20 min. Supernatants were used in an in vitro 65 could be largely cleared from extracts by high-speedcentrifu assay containing 20 mM HEPES pH 7.3, 110 mM KOAc, 1 gation (100,000xg for 60 min.) while the activity that pro mM Mg(OAc), 3 mM EGTA, 2 mM CaCl, 1 mM DTT. duces 22 mers remained in the supernatant (FIG.5b,c). This US 8,829,264 B2 41 42 simple fractionation indicated that RISC and the 22 mer these cases, although we do routinely observe these in ATP generating activity are separable and thus distinct enzymes. depleted embryo extracts. The requirement of this nuclease However, it seems likely that they might interact at Some point for ATP is a quite unusual property. We hypothesize that this during the silencing process. requirement could indicate that the enzyme may act proces RNAse III family members are among the few nucleases sively on the dsRNA, with the helicase domain harnessing the that show specificity for double-stranded RNA (Nicholson, energy of ATP hydrolysis both for unwinding guide RNAs FEMS Microbiol Rev 23: 371-390, 1999). Analysis of the and for translocation along the Substrate. Drosophila and C. elegans genomes reveals several types of Efficient induction of RNA interference in C. elegans and RNAse III enzymes. First is the canonical RNAse III which in Drosophila has several requirements. For example, the contains a single RNAse III signature motif and a double 10 initiating RNA must be double-stranded, and it must be sev stranded RNA binding domain (dsRBD: e.g. RNC CAEEL). eral hundred nucleotides in length. To determine whether Second is a class represented by Drosha (Filippov et al., Gene these requirements are dictated by Dicer, we characterized 245: 213-221, 2000), a Drosophila enzyme that contains two the ability of extracts and of immunoprecipitated enzyme to RNAse III motifs and a dsRBD (Cedrosha in C. elegans). A digest various RNA Substrates. Dicer was inactive against third class contains two RNAse III signatures and an amino 15 single stranded RNAS regardless of length (see Supplement terminal helicase domain (e.g. Drosophila CG4792, 4). The enzyme could digest both 200 and 500 nucleotide CG6493, C. elegans K12H4.8), and these had previously dsRNAs but was significantly less active with shorter sub been proposed by Bass as candidate RNAi nucleases (Bass, strates (see Supplement 4). Double-stranded RNAs as short Cell 101: 235-238, 2000). Representatives of all three classes as 35 nucleotides could be cut by the enzyme, albeit very were tested for the ability to produce discrete, ~22nt. RNAs inefficiently (data not shown). In contrast, E. coli RNAse III from dsRNA substrates. could digest to completion dsRNAs of 35 or 22 nucleotides Partial digestion of a 500 nt. cyclin EdsRNA with purified, (not shown). This Suggests that the Substrate preferences of bacterial RNAse III produced a smear of products while the Dicer enzyme may contribute to but not wholly determine nearly complete digestion produced a heterogeneous group of the size dependence of RNAi. ~ 11-17 nucleotide RNAs (not shown). In order to test the 25 To determine whether the Dicer enzyme indeed played a dual-RNAse III enzymes, we prepared T7 epitope-tagged role in RNAi invitro, we sought to deplete Dicer activity from versions of Drosha and CG4792. These were expressed in S2 cells and test the effect on dsRNA-induced gene silencing. transfected S2 cells and isolated by immunoprecipitation Transfection of S2 cells with a mixture of dsRNAs homolo using antibody-agarose conjugates. Treatment of the dsRNA gous to the two Drosophila Dicer genes (CG4792 and with the CG4792 immunoprecipitate yielded ~22 nt. frag 30 CG6493) resulted in an ~6-7 fold reduction of Dicer activity ments similar to those produced in either S2 or embryo either in whole cell lysates or in Dicer-1 immunoprecipitates extracts (FIG. 6a). Neither activity in extract nor activity in (FIG. 7A,B). Transfection with a control dsRNA (murine immunoprecipitates depended on the sequence of the RNA caspase 9) had no effect. Qualitatively similar results were substrate since dsRNAs derived from several genes were seen if Dicer was examined by Northern blotting (not shown). processed equivalently (see Supplement 1). Negative results 35 Depletion of Dicer in this manner substantially compromised were obtained with Drosha and with immunoprecipitates of a the ability of cells to silence subsequently an exogenous, GFP DExH box helicase (Homeless (Gillespie et al., Genes and transgene by RNAi (FIG. 7C). These results indicate that Development 9: 2495-2508, 1995); see FIG. 6a,b). Western Dicer is involved in RNAi in vitro. The lack of complete blotting confirmed that each of the tagged proteins was inhibition of silencing could result from an incomplete Sup expressed and immunoprecipitated similarly (see Supple 40 pression of Dicer (which is itself required for RNAi) or could ment 2). Thus, we conclude that CG4792 may carry out the indicate that in vitro, guide RNAs can be produced by more initiation step of RNA interference by producing -22 int. than one mechanism (e.g. through the action of RNA-depen guide sequences from dsRNAs. Because of its ability to dent RNA polymerases). digest dsRNA into uniformly sized, small RNAs, we have Our results indicate that the process of RNA interference named this enzyme Dicer (Dcr). Dicer mRNA is expressed in 45 can be divided into at least two distinct steps. According to embryos, in S2 cells, and in adult flies, consistent with the this model, initiation of PTGS would occur upon processing presence of functional RNAi machinery in all of these con of a double-stranded RNA by Dicer into ~22 nucleotide guide texts (see Supplement 3). sequences, although we cannot formally exclude the possi The possibility that Dicer might be the nuclease respon bility that another, Dicer-associated nuclease may participate sible for the production of guide RNAs from dsRNAs 50 in this process. These guide RNAs would be incorporated into prompted us to raise an antiserum directed against the car a distinct nuclease complex (RISC) that targets single boxy-terminus of the Dicer protein (Dicer-1, CG4792). This stranded mRNAs for degradation. An implication of this antiserum could immunoprecipitate a nuclease activity from model is that guide sequences are themselves derived directly either Drosophila embryo extracts or from S2 cell lysates that from the dsRNA that triggers the response. In accord with this produced -22 int. RNAs from dsRNA substrates (FIG. 6C). 55 model, we have demonstrated that P-labeled, exogenous The putative guide RNAs that are produced by the Dicer-1 dsRNAs that have been introduced into S2 cells by transfec enzyme precisely co-migrate with 22 mers that are produced tion are incorporated into the RISC enzyme as 22 mers (FIG. in extract and with 22 mers that are associated with the RISC 7E). However, we cannot exclude the possibility that RNA enzyme (FIG. 6 D.F). It had previously been shown that the dependent RNA polymerases might amplify 22 mers once enzyme that produced guide RNAs in Drosophila embryo 60 they have been generated or provide an alternative method for extracts was ATP-dependent (Zamore et al., Cell 101: 25-33, producing guide RNAS. 2000). Depletion of this cofactor resulted in an ~6-fold lower The structure of the Dicer enzyme provokes speculation on rate of dsRNA cleavage and in the production of RNAs with the mechanism by which the enzyme might produce dis a slightly lower mobility. Of interest was the fact that both cretely sized fragments irrespective of the sequence of the Dicer-1 immunoprecipitates and extracts from S2 cells 65 dsRNA (see Supplement 1, FIG. 8a). It has been established require ATP for the production of -22 mers (FIG. 6D). We do that bacterial RNAse III acts on its substrate as a dimer not observe the accumulation of lower mobility products in (Nicholson, FEMS Microbiol Rev 23: 371-390, 1999; Rob US 8,829,264 B2 43 44 ertson et al., J Biol Chem 243: 82-91, 1968; Dunn, J Biol was added to the amino terminus of each by PCR, and the Chem 251: 3807-3814, 1976). Similarly, a dimer of Dicer tagged cDNAs were cloned into pRIP, a retroviral vector enzymes may be required for cleavage of dsRNAs into ~22nt. designed specifically for expression in insect cells (E. Bern pieces. According to one model, the cleavage interval would stein, unpublished). In this vector, expression is driven by the be determined by the physical arrangement of the two RNAse 5 Orgvia pseudotsugata IE2 promoter (Invitrogen). Since no III domains within Dicer enzyme (FIG. 8a). A plausible alter cDNA was available for CG4792/Dicer, a genomic clone was native model would dictate that cleavage was directed at a amplified from a bacmid (BACR23F10; obtained from the single position by the two RIII domains in a single Dicer BACPAC Resource Center in the Dept. of Human Genetics at protein. The 22 nucleotide interval could be dictated by inter the Roswell Park Cancer Institute). Again, during amplifica action of neighboring Dicer enzymes or by translocation 10 tion, a T7 epitope tag was added at the amino terminus of the along the mRNA substrate. The presence of an integral heli coding sequence. The human Dicer gene was isolated from a case domain Suggests that the products of Dicer cleavage cDNA library prepared from HaCaT cells (GJH, unpub might be single-stranded 22 mers that are incorporated into lished). AT7-tagged version of the complete coding sequence the RISC enzyme as such. was cloned into pCDNA3 (Invitrogen) for expression in A notable feature of the Dicer family is its evolutionary 15 human cells (Linx-A). conservation. Homologs are found in C. elegans (K12H4.8), Cell Culture and Extract Preparation. Arabidopsis (e.g., CARPEL FACTORY (Jacobson et al., S2 and embryo culture. S2 cells were cultured at 27°C. in Development 126: 5231-5243, 1999), T25K16.4, 5% CO in Schneider's insect media supplemented with 10% AC012328 1), mammals (Helicase-MOI (Matsuda et al., heat inactivated fetal bovine serum (Gemini) and 1% antibi Biochim Biophy's Acta 1490: 163-169, 2000) and S. pombe otic-antimycotic solution (GIBCO BRL). Cells were har (YC9A SCHPO) (FIG. 8b, see Supplements 6,7 for vested for extract preparation at 10x10 cells/ml. The cells sequence comparisons). In fact, the human Dicer family were washed 1x in PBS and were resuspended in a hypotonic member is capable of generating ~22nt. RNAs from dsRNA buffer (10 mM HEPES pH 7.0, 2 mM MgCl, 6 mM BME) Substrates (Supplement 5) suggesting that these structurally and dounced. Cell lysates were spun 20,000xg for 20 min similar proteins may all share similar biochemical functions. 25 utes. Extracts were stored at -80° C. Drosophila embryos It has been demonstrated that exogenous dsRNAs can affect were reared in fly cages by standard methodologies and were gene function in early mouse embryos (Wianny et al., Nature collected every 12 hours. The embryos were dechorionated in Cell Biology 2: 70-75, 2000), and our results suggest that this 50% chlorox bleach and washed thoroughly with distilled regulation may be accomplished by an evolutionarily con water. Lysis buffer (10 mM Hepes, 10 mM KC1, 1.5 mM served RNAi machinery. 30 MgCl, 0.5 mM EGTA, 10 mM f-glycerophosphate, 1 mM In addition to RNAsell and helicase motifs, searches of DTT, 0.2 mM PMSF) was added to the embryos, and extracts the PFAM database indicate that each Dicer family member were prepared by homogenization in a tissue grinder. Lysates also contains a ZAP domain (FIG. 8c) (Sonnhammer et al., were spun for two hours at 200,000xg and were frozen at -80° Proteins 28: 405-420, 1997). This sequence was defined C. Linx-A cells, a highly-transfectable derivative of human based solely upon its conservation in the Zwille/ARGO 35 293 cells, (Lin Xie and GJH, unpublished) were maintained NAUTE/Piwi family that has been implicated in RNAi by in DMEMA 10% FCS. mutations in C. elegans (Rde-1) and Neurospora (Qde-2) Transfections and Immunoprecipitations. (Tabara et al., Cell 99: 123-132, 1999; Catalanotto et al., S2 cells were transfected using a calcium phosphate pro Nature 404: 245, 2000). Although the function of this domain cedure essentially as previously described (Hammond et al., is unknown, it is intriguing that this region of homology is 40 Nature 404: 293-296, 2000). Transfection rates were -90% as restricted to two gene families that participate in dsRNA monitored in controls using an in situ B-galactosidase assay. dependent silencing. Both the ARGONAUTE and Dicer Linx-A cells were also transfected by calcium phosphate families have also been implicated in common biological co-precipitation. For immunoprecipitations, cells (-5x10' processes, namely the determination of stem-cell fates. A per IP) were transfected with various clones and lysed three hypomorphic allele of carpel factory, a member of the Dicer 45 days later in IP buffer (125 mMKOAc, 1 mM MgOAc, 1 mM family in Arabidopsis, is characterized by increased prolif CaCl, 5 mM EGTA, 20 mM Hepes pH 7.0, 1 mM DTT, 1% eration infloral meristems (Jacobsen et al., Development 126: NP-40 plus Complete protease inhibitors, Roche). Lysates 5231-5243, 1999). This phenotype and a number of other were spun for 10 minutes at 14,000xg and supernatants were characteristic features are also shared by Arabidopsis ARGO added to T7 antibody-agarose beads (Novagen). Antibody NAUTE (ago1-1) mutants (Bohmert et al., EMBOJ 17: 170 50 binding proceeded for 4 hours at 4° C. Beads were centri 180, 1998; C. Kidner and R. Martiennsen, pers. comm.). fuged and washed in lysis buffer three times, and once in These genetic analyses begin to provide evidence that RNAi reaction buffer. The Dicer antiserum was raised in rabbits may be more than a defensive response to unusual RNAs but using a KLH-conjugated peptide corresponding to the C-ter may also play important roles in the regulation of endogenous minal 8 amino acids of Drosophila Dicer-1 (CG4792). genes. 55 Cleavage Reactions. With the identification of Dicer as a catalyst of the initia RNA Preparation. Templates to be transcribed into dsRNA tion step of RNAi, we have begun to unravel the biochemical were generated by PCR with forward and reverse primers, basis of this unusual mechanism of gene regulation. It will be each containing a T7 promoter sequence. RNAS were pro of critical importance to determine whether the conserved duced using Riboprobe (Promega) kits and were uniformly family members from other organisms, particularly mam 60 labeling during the transcription reaction with P-UTP. mals, also play a role in dsRNA-mediated gene regulation. Single-stranded RNAs were purified from 1% agarose gels. Methods: dsRNA cleavage. Five microliters of embryo or S2 extracts Plasmid Constructs. were incubated for one hour at 30° C. with dsRNA in a A full-length cDNA encoding Drosha was obtained by reaction containing 20 mM Hepes pH 7.0, 2 mM MgOAc, 2 PCR from an EST sequenced by the Berkeley Drosophila 65 mM DTT, 1 mM ATP and 5% Superasin (Ambion). Immu genome project. The Homeless clone was a gift from noprecipitates were treated similarly except that a minimal Gillespie and Berg (Univ. Washington). The T7 epitope-tag volume of reaction buffer (including ATP and Superasin) and US 8,829,264 B2 45 46 dsRNA were added to beads that had been washed in reaction clones were screened to identify the desired construct (Tav buffer (see above). For ATP depletion, Drosophila embryo ernarakis et al., Nature Genetics 24: 180-183, 2000). extracts were incubated for 20 minutes at 30°C. with 2 mM The presence of hairpin structures often induces plasmid glucose and 0.375 U of hexokinase (Roche) prior to the addi rearrangement, in part due to the E. coli sbc proteins that tion of dsRNA. recognize and cleave cruciform DNA structures (Connelly et Northern and Western Analysis. al., Genes Cell 1: 285-291, 1996). We have developed a Total RNA was prepared from Drosophila embryos (0-12 method for the construction of hairpins that does not require hour), from adult flies, and from S2 cells using Trizol cloning of inverted repeats, per se. Instead, the fragment of (Lifetech). Messenger RNA was isolated by affinity selection the gene that is to be silenced is cloned as a direct repeat, and using magnetic oligo-dT beads (Dynal). RNAS were electro 10 the inversion is accomplished by treatment with a site-spe phoresed on denaturing formaldehyde/agarose gels, blotted cific recombinase, either in vitro (or potentially in vitro) (see FIG. 27). Following recombination, the inverted repeat struc and probed with randomly primed DNAs corresponding to ture is stable in a bacterial strain that lacks an intact SBC Dicer. For Western analysis, T7-tagged proteins were immu system (DL759). We have successfully used this strategy to noprecipitated from whole cell lysates in IP buffer using 15 construct numerous hairpin expression constructs that have anti-T7-antibody-agarose conjugates. Proteins were released been Successfully used to provoke gene silencing in Droso from the beads by boiling in Laemmli buffer and were sepa phila cells. rated by electrophoresis on 8% SDS PAGE. Following trans In the following examples, we use this method to express fer to nitrocellulose, proteins were visualized using an HRP long dsRNAs in a variety of mammalian cell types. We show conjugated anti-TT antibody (Novagen) and that such long dsRNAs mediate RNAi in a variety of cell chemiluminescent detection (SuperSignal, Pierce). types. Additionally, since the vector described in FIG. 27 RNAi of Dicer. contains a selectable marker, dsRNAS produced in this man Drosophila S2 cells were transfected either with a dsRNA ner can be stably expressed in cells. Accordingly, this method corresponding to mouse caspase 9 or with a mixture of two allows not only the examination of transient effects of RNA dsRNAs corresponding to Drosophila Dicer-1 and Dicer-2 25 Suppression in a cell, but also the effects of stable and pro (CG4792 and CG6493). Two days after the initial transfec longed RNA Suppression. tion, cells were again transfected with a mixture containing a Methods: GFP expression plasmid and either luciferase dsRNA or GFP Plasmids expressing hairpin RNAs were constructed by dsRNA as previously described (Hammond et al., Nature cloning the first 500 bps of the GFP coding region into the 404: 293-296, 2000). Cells were assayed for Dicer activity or 30 FLIP cassette of pRIP-FLIP as a direct repeat. The FLIP fluorescence three days after the second transfection. Quan cassette contains two directional cloning sites, the second of tification of fluorescent cells was done on a Coulter EPICS which is flanked by LoxP sites. The Zeocin gene, present cell sorter after fixation. Control transfections indicated that between the cloning sites, maintains selection and stability. Dicer activity was not affected by the introduction of caspase To create an inverted repeat for hairpin production, the direct 9 dsRNA. 35 repeat clones were exposed to Cre recombinase (Stratagene) in vitro and, afterwards, transformed into DL759 E. coli. Example 3 These bacteria permit the replication of DNA containing cru ciform structures, which tend to form inverted repeats. A Simplified Method for the Creation of Hairpin Constructs for RNA Interference 40 Example 4 In numerous model organisms, double stranded RNAS Long dsRNAs Suppress Gene Expression in have been shown to cause effective and specific Suppression Mammalian Cells of gene function (Bosher and Labouesse, Nature Cell Biology 2: E31-E36, 2000). This response, termed RNA interference 45 Previous experiments have demonstrated that dsRNA, pro or post-transcriptional gene silencing, has evolved into a duced using a variety of methods including via the construc highly effective reverse genetic tool in C. elegans, Droso tion of hairpins, can Suppress gene expression in Drosophila phila, plants and numerous other systems. In these cases, cells. We now demonstrate that dsRNA can also suppress double-stranded RNAs can be introduced by injection, trans gene expression in mammalian cells in culture. Additionally, fection or feeding; however, in all cases, the response is both 50 the power of RNAi as a genetic tool would be greatly transient and systemic. Recently, stable interference with enhanced by the ability to engineer stable silencing of gene gene expression has been achieved by expression of RNAs expression. We therefore undertook an effort to identify that form snap-back or hairpin structures (Fortier and Belote, mammalian cells in which long dsRNAs could be used as Genesis 26: 240-244, 2000; Kennerdell and Carthew, Nature RNAi triggers in the hope that these same cell lines would Biotechnology 18: 896-898, 2000; Lam and Thummel, Cur 55 provide a platform upon which to develop stable silencing rent Biology 10:957-963, 2000; Shiet al., RNA 6: 1069-1076, strategies. We demonstrate that RNA suppression can be 2000; Smith et al., Nature 407: 319-320, 2000; Tavernarakis mediated by stably expressing along hairpin in a mammalian et al., Nature Genetics 24: 180-183, 2000). This has the poten cell line. The ability to engineer stable silencing of gene tial not only to allow stable silencing of gene expression but expression in cultured mammalian cells, in addition to the also inducible silencing as has been observed in trypano 60 ability to transiently silence gene expression, has many somes and adult Drosophila (Fortier and Belote, Genesis 26: important applications. 240-244, 2000; Lam and Thummel, Current Biology 10:957 A. RNAi in Pluripotent Murine P19 Cells. 963, 2000; Shiet al., RNA 6: 1069-1076, 2000). The utility of We first sought to determine whether long dsRNA triggers this approach is somewhat hampered by the difficulties that could induce sequence-specific silencing in cultured murine arise in the construction of bacterial plasmids containing the 65 cells, both to develop this approach as a tool for probing gene long inverted repeats that are necessary to provoke silencing. function and to allow mechanistic studies of dsRNA-induced In a recent report, it was stated that more than 1,000 putative silencing to be propagated to mammalian systems. We, there US 8,829,264 B2 47 48 fore, attempted to extend previous studies in mouse embryos tively low concentrations of dsRNA (25 ng/ml culture media; (Wianny et al., Nat. Cell Biol. 2: 70-75, 2000; Svoboda et al., see FIG. 29A). The response was concentration-dependent, Development 127:41.47-4156, 2000) by searching for RNAi with maximal Suppression of s20-fold being achieved at a like mechanisms in pluripotent, embryonic cell types. We dose of 1.5 Lig/ml culture media. Silencing was established surveyed a number of cell lines of embryonic origin for the rapidly and was evident by 9 h post-transfection (the earliest degree to which generalized suppression of gene expression time point examined). Furthermore, the response persisted occurred upon introduction of dsRNA. As an assay, we tested without significant changes in the degree of Suppression for the effects of dsRNA on the expression of GFP as measured in up to 72 h following a single dose of dsRNA. situ by counting fluorescent cells. As expected, in both human FIG.30 further shows wild-type P19 cells which have been embryonic kidney cells (293) and mouse embryo fibroblasts, 10 co-transfected with either RFP or GFP (right panel). Note the GFP expression was virtually eliminated irrespective of the robust expression of RFP or GFR respectively approximately sequence of the cotransfected dsRNA. In some pluripotent 42 hours post-transfection. We isolated P19 clones which teratocarcinoma and teratoma cell lines (e.g., N-Teral, F9). stably express a 500 nt. GFP hairpin. Such clones were then the PKR response was attenuated but still evident; however, in transfected with either RFP or GFP and expression of RFP or contrast, transfection of nonhomologous dsRNAS had no 15 GFP was assessed by visual inspection of the cells. The left effect on the expression of reporter genes (e.g., GFP or panel demonstrates that a 500 nt GFP hairpin specifically luciferase) either in mouse embryonic stem cells or in p19 suppresses expression of GFP in P19 cells. embryonal carcinoma cells (FIG. 28). B. RNAi in Embryonic Stem Cells. Transfection of P19 embryonal carcinoma cells with GFP To assess whether the presence of a sequence-specific in the presence of cognate dsRNA corresponding to the first response to dsRNA was a peculiarity of P19 cells or whether s500 nts of the GFP coding sequence had a strikingly differ it also extended to normal murine embryonic cells, we per ent effect. GFP expression was eliminated in the vast majority formed similar silencing assays in mouse embryonic stem of cotransfected cells (FIG. 28), Suggesting that these cul cells. Cotransfection of embryonic stem cells with noncog tured murine cells might respond to dsRNA in a manner nate dsRNAs (e.g., GFP), again, had no dramatic effect on similar to that which we had previously demonstrated in 25 either the absolute values or the ratios of Renilla and firefly cultured, Drosophila S2 cells (Hammond et al., Nature 404: luciferase activity (FIG. 31). However, transfection with 293-296, 2000). either firefly or Renilla luciferase dsRNA dramatically and To quantify the extent to which dsRNA could induce specifically reduced the activity of the targeted enzyme (FIG. sequence-specific gene silencing, we used a dual luciferase 31). reporter assay similar to that which had first been used to 30 This result Suggests that RNAi can operate in multiple demonstrate RNAi in Drosophila embryo extracts (Tuschl et murine cell types of embryonic origin, including normal al., Genes Dev. 13: 319.1-3197, 1999). P19 EC cells were embryonic stem cells. The ability to provoke silencing in a transfected with a mixture of two plasmids that individually cell type that is normally used for the generation of genetic, direct the expression of firefly luciferase and Renilla mosaic animals suggests the possibility of eventually testing luciferase. These were cotransfected with no dsRNA, with 35 the biological effects of silencing both in culture and in recon dsRNA that corresponds to the first s500 nts of the firefly stituted animal models. Our ability to Successfully manipu luciferase, or with dsRNA corresponding to the first nts of late ES cell via RNAi allows the use of RNAi in the generation GFP as a control. Cotransfection with GFP dsRNA gave of transgenic and knock-out mice. luciferase activities that were similar to the no-dsRNA con C. RNAi in Murine Somatic Cells. trol, both in the firefly/Renilla activity ratio and in the abso 40 RNAi effector pathways are likely to be present in mam lute values of both activities. In contrast, in cells that received malian somatic cells, based on the ability of siRNAs to induce the firefly luciferase dsRNA, the ratio of firefly to Renilla transient silencing (Elbashir et al., Nature 411: 494-498, luciferase activity was reduced by up to 30-fold (250ng, FIG. 2001). Furthermore, we have shown that RNAi initiator and 29B). For comparison, we carried out an identical set of effector pathways clearly exist in embryonic cells that can experiments in Drosophila S2 cells. Although qualitatively 45 enforce silencing in response to long dsRNA triggers. We similar results were obtained, the silencing response was therefore sought to test whether the RNAi machinery might more potent. At equivalent levels of dsRNA, S2 cells Sup exist intact in Some Somatic cell lines. pressed firefly luciferase activity to virtually background lev Transfection of HeLa cells with luciferase reporters in els. combination with long dsRNA triggers caused a nearly com The complementary experiment, in which dsRNA was 50 plete suppression of activity, irrespective of the RNA homologous to Renilla luciferase, was also performed. sequence. In a murine myoblast cell line, C2C12, we noted a Again, in this case, Suppression of the expression of the mixture of two responses. dsRNAs homologous to firefly Renilla enzyme was s 10-fold (FIG. 29D). Thus, the dsRNA luciferase provoked a sequence-specific effect, producing a response in P19 cells was flexible, and the silencing machin degree of suppression that was slightly more potent than was ery was able to adapt to dsRNAs directed against any of the 55 observed upon transfection with cognate siRNA (Elbashir et reporters that were tested. al., Nature 411: 494-498, 2001) (see FIG. 32A). However, We took two approaches to test whether this response was with long dsRNA triggers, the specific effect was Superim specific for dsRNA. Pretreatment of the trigger with purified posed upon a generalized Suppression of reporter gene RNase III, a dsRNA-specific ribonuclease, before transfec expression that was presumably because of PKR activation tion greatly reduced its ability to provoke silencing. Further 60 (FIG.32B). more, transfection of cells with single-stranded antisense Numerous mammalian viruses have evolved the ability to RNAs directed against either firefly or Renilla luciferase had block PKR as an aid to efficient infection. For example, little or no effect on expression of the reporters (FIGS. 29C adenoviruses express VA RNAs, which mimic dsRNA with and 29D). Considered together, these results provided a respect to binding but not to activation of PKR (Clarke et al., strong indication that double-stranded RNAs provoke a 65 RNA 1: 7-20, 1995). Vaccinia virus uses two strategies to potent and specific silencing response in P19 embryonal car evade PKR. The first is expression of E3L, which binds and cinoma cells. Efficient silencing could be provoked with rela masks dsRNAs (Kawagishi-Kobayashi et al., Virology 276: US 8,829,264 B2 49 50 424-434, 2000). The second is expression of K3L, which tested by transfecting P19 cells stably transfected with GFP binds and inhibits PKR via its ability to mimic the natural hairpin constructs with mouse Dicer dsRNA. Treatment with substrate of this enzyme, eIF2C. (Kawagishi-Kobayashi et al. Dicer dsRNA, but not control dsRNA, resulted in derepres 2000, supra). sion of GFP (FIG. 34C). Transfection of C2C12 cells with a vector that directs K3L 5 E. dsRNA Induces Posttranscriptional Silencing. expression attenuates the generalized repression of reporter A key feature of RNAi is that it exerts its effect at the genes in response to dsRNA. However, this protein had no posttranscriptional level by destruction of targeted mRNAs effect on the magnitude of specific inhibition by RNAi (FIG. (Hammond et al., Nat. Rev. Genet. 2: 110-119, 2001). To test 32C). whether dsRNAs induced silencing in mouse cells via post FIG. 33 further shows the results of a transient co-trans 10 transcriptional mechanisms, we used an assay identical to fection assay performed in Hela cells, CHO cells, and P19 that, used initially to characterize RNAi responses in Droso cells. The cell lines were each transfected with plasmids phila embryo extracts (Tuschl et al., Genes Dev. 13: 3191 expressing Photinus pyralis (firefly) and Renila reniformis 3197, 1999). We prepared lysates from P19 EC cells that were (sea pansy) luciferases. The cells lines were additionally competent for in vitro translation of capped mRNAs corre transfected with 400 ng of 500 nt dsRNAs corresponding to 15 sponding to Renilla and firefly luciferase. Addition of non either firefly luciferase (dsDUC) or dsGFP. The results dem specific dsRNAs to these extracts had no substantial effect on onstrate that dsRNA can specifically mediate Suppressionina either the absolute amount of luciferase expression or on the multiple mammalian cells types in culture. ratio of firefly to Renilla luciferase (FIG. 35). In contrast, These results raise the possibility that, at least in some cell addition of dsRNA homologous to the firefly luciferase lines and/or cell types, blocking nonspecific responses to induced a dramatic and dose-dependent Suppression of activ dsRNA will enable the use of long dsRNAs for the study of ity. Addition of RNA corresponding to only the antisense gene function. This might be accomplished through the use of strand of the dsRNA had little effect, comparable to a non viral inhibitors, as described here, or through the use of cells specific dsRNA control, and pretreatment of the dsRNA isolated from animals that are genetically modified to lack silencing trigger with RNase III greatly reduced its potential undesirable responses. 25 to induce silencing in vitro. A second hallmark of RNAi is the D. Stable Suppression of Gene Expression Using RNAi. production of small, 22-nt siRNAs, which determine the To date, dsRNAS have been used to induce sequence-spe specificity of silencing. We found that such RNA species were cific gene silencing in either cultured mammalian cells or in generated from dsRNA in P19 cell extracts (FIG. 34D, in embryos only in a transient fashion. However, the most pow vitro), indicative of the presence of a mouse Dicer activity. erful applications of genetic manipulation are realized only 30 These species were also produced in cells that stably express with the creation of stable mutants. The ability to induce GFPhairpin RNAs (FIG.34D, in vitro). Considered together, silencing by using long dsRNAs offers the opportunity to the posttranscriptional nature of dsRNA-induced silencing, translate into mammalian cells work from model systems the association of silencing with the production of siRNAs, Such as Drosophila, plants, and C. elegans wherein stable and the dependence of this response on Dicer, a key player in silencing has been achieved by enforced expression of hairpin 35 the RNAi pathway, strongly suggests that dsRNA Suppresses RNAs (Kennerdellet al., Nat. Biotechnol. 18: 896-898, 2000; gene expression in murine cells via a conventional RNAi Smith et al., Nature 407:319-320, 2000; Tavernarakis et al., mechanism. Nat. Genet. 24: 180-183, 2000). F. RNAi-Mediated Gene Silencing is Specific and Requires P19 EC cells were transfected with a control vector or with dsRNAs. an expression vector that directs expression of a s500-nt GFP 40 We carried out experiments to verify that the suppressive hairpin RNA from an RNA polymerase II promoter (cytome effects observed in the in vitro system were specific to double galovirus). Colonies arising from cells that had stably inte stranded RNA. Briefly, experiments were performed in accor grated either construct were selected and expanded into dance with the methods outlined above. Either dsRNA (ds), clonal cell lines. Each cell line was assayed for persistent single-stranded RNA (ss), orantisense-RNA (as) correspond RNAi by transient co-transfection with a mixture of two 45 ing to firefly (FF) or Renilla (Ren) luciferase was added to the reporter genes, dsRED to mark transfected cells and GFP to translation reaction. Following reactions performed at 30°C. test for stable silencing. for 1 hour, dual luciferase assays were performed using an Transfection of clonal P19 EC cells that had stably inte Analytical Scientific Instruments model 3010 Luminometer. grated the control vector produced equal numbers of red and FIG.36 Summarizes the results of these experiments which green cells, as would be expected in the absence of any 50 demonstrate that the Suppression of gene expression observed specific silencing response (FIG. 34B), whereas cells that in this in vitro assay is specific for dsRNA. These results express the GFP hairpin RNA gave a very different result. further Support the conclusion that dsRNA Suppresses gene These cells expressed the dsRED protein with an efficiency expression in this mammalian in vitro system in a manner comparable to that observed in cells containing the control consistent with post-transcriptional silencing. vector. However, the cells failed to express the cotransfected 55 G. Mammalian Cells Soaked with dsRNAs Results in Gene GFP reporter (FIG. 34B). These data provide a strong indi Silencing. cation that continuous expression of a hairpin dsRNA can Studies of post-transcriptional silencing in invertebrates provoke stable, sequence-specific silencing of a target gene. have demonstrated that transfection or injection of the In Drosophila S2 cells and C. elegans, RNAi is initiated by dsRNA is not necessary to achieve the suppressive affects. the Dicer enzyme, which processes dsRNA into s22-nt siR 60 For example, dsRNA Suppression in C. elegans can be NAs (Bernstein et al., Nature 409:363-366, 2001: Grishoket observed by either soaking the worms in dsRNA, or by feed al., Cell 106: 23-34, 2001; Hutvagner et al., Science 293: ing the worms bacteria expressing the dsRNA of interest. We 834-838, 2001; Ketting et al., Genes Dev. 15: 2654-2659, addressed whether dsRNA suppression in mammalian cells 2001; Knight et al., Science 293:2269-2271, 2001). In both, could be observed without transfection of the dsRNA. Such a S2 cells and C. elegans experiments by using dsRNA to target 65 result would present additional potential for easily using Dicer suppress the RNAi response. Whether Dicer plays a dsRNA Suppression in mammalian cells, and would also central role in hairpin-induced gene silencing in P19 cells was allow the use of dsRNA to suppress gene expression in cell US 8,829,264 B2 51 52 types which have been difficult to transfect (i.e., cell types hairpin production, EGFP direct repeat clones were exposed with a low transfection efficiency, or cell types which have to Cre recombinase (Stratagene) in vitro and, afterward, proven difficult to transfect at all). transformed into DL759 Escherichia coli (Connelly et al., P19 cells were grown in 6-well tissue culture plates to Genes Cells 1: 285-291, 1996). These bacteria permit the approximately 60% confluency in growth media (CMEM/ replication of DNA containing cruciform structures, which 10% FBS). Varying concentrations of firefly dsRNA were tend to form from inverted repeats. DL759 transformants added to the cultures, and cells were cultured for 12 hours in were screened for plasmids containing inverted repeats growth media+dsRNA. Cells were then transfected with plas (s.50%). mids expressing firefly or sea pansy luciferase, as described in Silencing of Dicer was accomplished by using a dsRNA detail above. Dual luciferase assays were carried out 12 hours 10 post-transfection using an Analytical Scientific Instruments comprising exon 25 of the mouse Dicer gene and correspond model 3010 Luminometer. ing to nucleotides 5284-5552 of the human Dicer cDNA. FIG. 37 summarizes these results which demonstrate that In Vitro Translation and In Vitro Dicer Assays. dsRNA can Suppress gene expression in mammalian cells Logarithmically growing cells were harvested in PBS con without transfection. Culturing cells in the presence of 15 taining 5 mM EGTA washed twice in PBS and once in hypo dsRNA resulted in a dose dependent suppression of firefly tonic buffer (10 mM Hepes, pH 7.3/6 mM f-mercaptoetha luciferase gene expression. nol). Cells were suspended in 0.7 packed-cell volumes of Methods: hypotonic buffer containing Complete protease inhibitors Cell Culture. (Roche Molecular Biochemicals) and 0.5 units/ml of RNasin P19 mouse embryonic carcinoma cells (American Type (Promega). Cells were disrupted in a Dounce homogenizer Culture Collection, CRL-1825) were cultured in C-MEM with a type B pestle, and lysates were centrifuged at 30,000xg (GIBCO/BRL) supplemented with 10% heat-inactivated for 20 min. Supernatants were used in an in vitro translation FBS and 1% antibiotic/antimycotic solution (GIBCO/BRL). assay containing capped m7G(5')pppG firefly and Renilla Mouse embryo stem cells (J1, provided by S. Kim, Cold luciferase mRNA or in in vitro Dicer assays containing P Spring Harbor Laboratory) were cultured in DMEM contain 25 labeled dsRNA. For in vitro translation assays, 5ul of extract ing ESgro (Chemicon) according to the manufacturers were mixed with 100 ng of firefly and Renilla mRNA along instructions. C2C12 murine myoblast cells (gift of N. Tonks, with 1 g of dsRNA (or buffer)/10 mM DTT/0.5 mM sper Cold Spring Harbor Laboratory) were cultured in DMEM midine/200 mM Hepes, 3.3 mM MgOAc/800 mM KOAc/1 (GIBCO/BRL) supplemented with 10% heat-inactivated mM ATP/1 mM GTP/4 units of Rnasin/215 lug of creatine FBS and 1% antibiotic/antimycotic solution (GIBCO/BRL). 30 phosphate/1 ug of creatine phosphate kinase/1 mM amino RNA Preparation. acids (Promega). Reactions were carried out for 1 h at 30°C. For the production of dsRNA, transcription templates were and quenched by adding 1x passive lysis buffer (Promega). generated by PCR; they contained T7 promoter sequences on Extracts were then assayed for luciferase activity. In vitro each end of the template (see Hammond et al. 2000, Nature assays for Dicer activity were performed as described (Bern 404: 293-296). dsRNAs were prepared by using the RiboMax 35 stein et al., Nature 409: 363-366, 2001). kit (Ambion, Austin, Tex.). Firefly and Renilla luciferase Construction of Stable Silencing Lines. mRNA transcripts were synthesized by using the Riboprobe Ten-centimeter plates of P19 cells were transfected with 5 kit (Promega) and were gel purified before use. ug of GFP hairpin expression plasmid and selected for stable Transfection and Gene Silencing Assays. integrants by using G-418 (300 ng/ml) for 14 days. Clones Cells were transfected with indicated amounts of dsRNA 40 were selected and screened for silencing of GFP. and plasmid DNA by using FuGENE6 (Roche Biochemicals) according to the manufacturers instructions. Cells were Example 5 transfected at 50-70% confluence in 12-well plates contain ing either 1 or 2 ml of medium per well. Dual luciferase assays Compositions and Methods for Synthesizing siRNAs (Promega) were carried out by co-transfecting cells with plas 45 mids contain firefly luciferase under the control of SV40 Previous results have indicated that short synthetic RNAs promoter (pGL3-Control, Promega) and Renilla luciferase (siRNAs) can efficiently induce RNA suppression. Since under the control of the SV40 early enhancer/promoter region short RNAs do not activate the non-specific PKR response, (pSV40, Promega). These plasmids were co-transfected by they offer a means for efficiently silencing gene expression in using a 1:1 or 10:1 ratio of pCL3-control (250 ng/well) to 50 a range of cell types. However, the current state of the art with pRL-SV40. Both ratios yielded similar results. For some respect to siRNAs has several limitations. Firstly, siRNAs are experiments, cells were transfected with vectors that direct currently chemically synthesized at great cost (approx. $400/ expression of enhanced green fluorescent protein (EGFP)- siRNA). Such high costs make siRNAs impractical for either US9 fusion protein (Kaleita et al., Exp. Cell Res. 248: 322 Small laboratories or for use in large scale Screening efforts. 328, 1999) or red fluorescent protein (RFP) (pDsRed N1, 55 Accordingly, there is a need in the art for methods for gener CLONTECH). RNAi in S2 cells was performed as described ating siRNAS at reduced cost. (Hammond et al., Nature 404: 293-296, 2000). We provide compositions and methods for synthesizing Plasmids expressing hairpin RNAs (RNAs with a self siRNAs by T7 polymerase. This approach allows for the complimentary stem loop) were constructed by cloning the efficient synthesis of siRNAs at a cost consistent with stan first 500 bp of the EGFP coding region (CLONTECH) into 60 dard RNA transcription reactions (approx. S16/siRNA). This the FLIP cassette of pRIP-FLIP as a direct repeat. The FLIP greatly reduced cost makes the use of siRNA a reasonable cassette contains two directional cloning sites, the second of approach for small laboratories, and also will facilitate their which sports flanking LoxP sites (see FIG.35A). The Zeocin use in large-scale screening projects. gene (Stratagene), present between the cloning sites, main FIG.38 shows the method for producing siRNAs using T7 tains selection and, thus, stability of the FLIP cassette. The 65 polymerase. Briefly, T7 polymerase is used to transcribe both FLIP cassette containing EGFP direct repeats was subcloned a sense and antisense transcript. The transcripts are then into pcDNA3 (Invitrogen). To create an inverted repeat for annealed to provide an siRNA. One of skill in the art will US 8,829,264 B2 53 54 recognize that any one of the available RNA polymerases can among at least a Subset of miRNAS, we sought to design be readily substituted for T7 to practice the invention (i.e., T3, retargeted miRNA mimics to conserve these predicted struc Sp6, etc.). tural features. Only the let-7 and lin-4 miRNAs have known This approach is amenable to the generation of a single mRNA targets (Wightman et al., Cell 75: 855-862, 1993: siRNA species, as well as to the generation of a library of 5 Slack et al., Mol. Cell 5: 659-669, 2000). In both cases, siRNAs. Such a library of siRNAs can be used in any number pairing to binding sites within the regulated transcripts is of high-throughput Screens including cell based phenotypic imperfect, and in the case of lin-4, the presence of a bulged screens and gene array based screens. nucleotide is critical to Suppression (Ha et al., Genes & Dev. 10: 3041-3050, 1996). We therefore also designed shRNAs Example 6 10 that paired imperfectly with their target substrates. A subset of these shRNAs is depicted in FIG. 39A. Generation of Short Hairpin dsRNA and Suppression To permit rapid testing of large numbers of shRNA variants of Gene Expression Using Such Short Hairpins and quantitative comparison of the efficacy of Suppression, we chose to use a dual-luciferase reporter system, as previ Since the realization that Small, endogenously encoded 15 ously described for assays of RNAi in both Drosophila hairpin RNAS could regulate gene expression via elements of extracts (Tuschl et al., Genes & Dev. 13:3191-3197, 1999) the RNAi machinery, we have sought to exploit this biological and mammalian cells (Caplen et al., Proc. Natl. Acad. Sci. 98: mechanism for the regulation of desired target genes. Here we 97.42-9747, 2001; Elbashir et al., Nature 411: 494-498, show that short hairpin RNAs (shRNAs) can induce 2001). Cotransfection of firefly and Renilla luciferase sequence-specific gene silencing in mammalian cells. AS is reporter plasmids with either long dsRNAs or with siRNAs normally done with siRNAs, silencing can be provoked by homologous to the firefly luciferase gene yielded an ~95% transfecting exogenously synthesized hairpins into cells. suppression of firefly luciferase without effect on Renilla However, silencing can also be triggered by endogenous luciferase FIG. 39B; data not shown). Firefly luciferase could expression of shRNAs. This observation opens the door to the also be specifically silenced by co-transfection with homolo production of continuous cells lines in which RNAi is used to 25 gous shRNAs. The most potent inhibitors were those com stably Suppress gene expression in mammalian cells. Further posed of simple hairpin structures with complete homology more, similar approaches should prove efficacious in the cre to the substrate. Introduction of G-U basepairs either within ation of transgenic animals and potentially in therapeutic the stem or within the Substrate recognition sequence had strategies in which long-term Suppression of gene function is little or no effect (FIGS. 39A and 39B; data not shown). essential to produce a desired effect. 30 These results show that short hairpin RNAs can induce Several groups (Grishok et al., Cell 106: 23-34, 2001; gene silencing in Drosophila S2 cells with potency similar to Ketting et al., Genes & Dev. 15:2654-2659, 2001: Knight et that of siRNAs (FIG. 39B). However, in our initial observa al., Science 293: 2269-2271, 2001; Hutvagner et al., Science tion of RNA interference in Drosophila S2 cells, we noted a 293:834-838, 2001) have shown that endogenous triggers of profound dependence of the efficiency of silencing on the gene silencing, specifically small temporal RNAs (stRNAs) 35 length of the dsRNA trigger (Hammond et al., Nature 404: let-7 and lin-4, function at least in part through RNAi path 293-296, 2000). Indeed, dsRNAs offewer than ~200 nt trig ways. Specifically, these small RNAs are encoded by hairpin gered silencing very inefficiently. Silencing is initiated by an precursors that are processed by Dicer into mature, ~21-nt RNase III family nuclease, Dicer, that processes long dsR forms. Moreover, genetic Studies in C. elegans have shown a NAs into ~22-nt siRNAs. In accord with their varying requirement for Argonaute-family proteins in StRNA func 40 potency as initiators of silencing, long dsRNAS are processed tion. Specifically, alg-1 and alg-2, members of the EIF2c much more readily than short RNAs by the Dicer enzyme subfamily, are implicated both in stRNA processing and in (Bernstein et al., Nature 409: 363-366, 2001). We therefore their downstream effector functions (Grishok et al., 2001, tested whether shRNAs were substrates for the Dicer enzyme. supra). We have recently shown that a component of RISC, We had noted previously that let-7 (Ketting et al., Genes & the effector nuclease of RNAi is a member of the Argonaute 45 Dev. 15:2654-2659, 2001) and other miRNAs (E. Bernstein, family, prompting a model in which stRNAS may function unpublished data) are processed by Dicer with an unexpect through RISC-like complexes, which regulate mRNA trans edly high efficiency as compared with short, nonhairpin dsR lation rather than mRNA stability (Hammond et al., Science NAs. Similarly, Dicer efficiently processed shRNAs that tar 293: 1146-1150, 2001). geted firefly luciferase, irrespective of whether they were A. Short Hairpin RNAs Triggered Gene Silencing in Droso 50 designed to mimic a natural Dicer substrate (let-7) or whether phila Cells. they were simple hairpin structures (FIG. 39C). These data We wished to test the possibility that we might retarget suggest that recombinant shRNAs can be processed by Dicer these Small, endogenously encoded hairpin RNAS to regulate into siRNAs and are consistent with the idea that these short genes of choice with the ultimate goal of Subverting this hairpins trigger gene silencing via an RNAi pathway. regulatory system for manipulating gene expression stably in 55 B. Short Hairpin RNAS Activated Gene Silencing in Mam mammalian cell lines and in transgenic animals. Whether malian Cells. triggered by long dsRNAs or by siRNAs, RNAi is generally Mammalian cells contain several endogenous systems that more potent in the Suppression of gene expression in Droso were predicted to hamper the application of RNAi. Chief phila S2 cells than in mammalian cells. We therefore chose among these is a dsRNA-activated protein kinase, PKR, this model system in which to test the efficacy of short hairpin 60 which effects a general Suppression of translation via phos RNAs (shRNAs) as inducers of gene silencing. phorylation of EIF-2C. (Williams, Biochem. Soc. Trans. 25: Neither stRNAs nor the broadergroup of miRNAs that has 509-513, 1997: Gilet al., Apoptosis 5: 107-114, 2000). Acti recently been discovered form perfect hairpin structures. Vation of these, and other dsRNA-responsive pathways, gen Indeed, each of these RNAs is predicted to contain several erally requires duplexes exceeding 30 bp in length, possibly bulged nucleotides within their rather short (~30-nt) stem 65 to permit dimerization of the enzyme on its allosteric activa structures. Because the position and character of these bulged tor (e.g., Clarke et al., RNA 1: 7-20, 1995). Small RNAs that nucleotides have been conserved throughout evolution and mimic Dicer products, siRNAs, presumably escape this limit