Nucleosome Phasing and Micrococcal Nuclease Cleavage of African Green Monkey Component a DNA (Nucleosomes and Chromatdn/Primate Dnas/DNA Sequence) PHILLIP R

Proc. Natl Acad. Sci. USA Vol. 79, pp. 118-122, January 1982 Cell Biology

Nucleosome phasing and micrococcal nuclease cleavage of African green monkey component a DNA (nucleosomes and chromatdn/primate DNAs/DNA sequence) PHILLIP R. MUSICH*, FRED L. BROWN, AND JOSEPH J. MAIO Department of Cell Biology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York 10461 Communicated by Harry Eagle, September 14, 1981 ABSTRACT The micrococcal nuclease cleavage of intact nu- gestion was made that these results simply reflect a DNA se- clear chromatin from African green monkey cells and ofthe com- quence specificity of the micrococcal nuclease. Nucleosome pletely deproteinized sequences was studied by using high-reso- phasing would not have to be invoked. Although phase rela- lution analytical and DNA sequencing gels and secondary restric- tionships have been observed for other repetitive and 5S DNA tion enzyme analysis. When deproteinized component a DNAwas (5, 10), some tRNA coding regions (11), gene domains (12), and used as substrate, not all phosphodiester bonds in the 172-base- regions of the simian virus 40 genome (13, 14), these results pair repeat units were cleaved with equal frequency by the nu- would also now be in doubt if micrococcal nuclease shows site clease. A distinct preference for the cleavage of A-T rather than specificity with deproteinized DNA that could give rise to spu- G-C bonds was observed: however, A+T-richness in itselfdid not rious phase relationships in chromatin. confer susceptibility to cleavage by micrococcal nuclease. The re- We performed detailed sequence analysis ofthe micrococcal sults suggested that, in deproteinized DNA, nuclease cleavage at a particular dinucleotides may be influenced more by the effect of nuclease products of completely deproteinized component adjacent sequences than by the composition of the dinucleotide. DNA. The results indicate only a limited preference of micro- In contrast to complex cleavage patterns ofthe deproteinized com- coccal nuclease for some A+T-rich regions. The presence of ponent a DNA which arose because of multiple cleavage sites in numerous sites ofcleavage ofthe naked component a sequence the repeat unit, micrococcal nuclease cleaved component a nu- by micrococcal nuclease contrasts with the single preferred site clear chromatin at one site per nucleosome repeat, near position of cleavage when the sequence is packaged in chromatin. The 126 in the nucleotide sequence. This simple chromatin cleavage results are consistent with the hypothesis that the distinctive pattern is consistent with the discrete nucleosomal structure of cleavage pattern ofcomponent a chromatin by micrococcal nu- component a in chromatin and a direct phase relationship be- clease (5, 6) reflects the specific and discrete structure of the tween the component a DNA sequence repeats and the nucleo- component a nucleosomes and a phase relationship between some protein structural repeats. the 172-bp repeat units and the nucleosomal proteins with which they are associated (5, 6). In eukaryotes, the nucleosome is the fundamental structural unit ofchromatin. The nucleolytic enzyme micrococcal nuclease MATERIALS AND METHODS has been an important tool in the characterization ofthe struc- Isolation and Labeling of Component a DNA Segments. tural properties of nucleosomes: this enzyme, together with AGM component a from strain CV-1 cells was treated in prep- pancreatic DNase I, has been used to resolve differences be- arative amounts with HindIII or EcoRI* to obtain the 172-bp tween transcriptionally active and inactive chromatin (1-3), in monomeric repeat units as described (6). The HindIII orEcoRI* chromatin undergoing repair replication (4), and between con- segments were treated with calfalkaline phosphatase and end- densed and diffuse chromatin (5, 6). A general and basic as- labeled with [y-32P]ATP (Amersham; 2300 Ci/mmol; 1 Ci = 3.7 sumption in these studies is that, other than a preference for x 10'° becquerels) and T4 polynucleotide kinase (15). The de- A+T-rich regions in the substrate (7), there is no nucleotide rivation of the secondary segments labeled at one end and the sequence specificity in the cleavage of a DNA substrate by sequence determination strategy are illustrated in Fig. 1, which micrococcal nuclease. The cleavage pattern observed when shows the relative positions ofthe submonomer segments which chromatin is digested with this nuclease thus reflects the pack- overlap and encompass the entire component a sequence (8). aging of the genomic DNA into nucleosomal structures which Micrococcal Nuclease Digests. CV-1 nuclei.were isolated in afford a relative protection to 145-200 base pairs (bp) of DNA the presence of 80 mM NaCl at 2°C as described (6). All mi- through its intimate association-with the nucleosomal proteins. crococcal nuclease (Worthington) digests of the deproteinized We observed discrete 172-bp DNA segments in micrococcal DNAs and of CV-1 nuclear chromatin were carried out at 2°C nuclease digests of African green monkey (AGM) component in 5 mM sodium phosphate, pH 7.0/80 mM NaCl/0.25 mM a chromatin (5, 6). These segments correspond to the repeat CaCl2/0. 1 mM phenylmethylsulfonyl fluoride. After micrococ- units of component a DNA which are 172 bp long (8). On the cal nuclease digestion of CV-1 nuclei, the DNA was purified basis ofsecondary restriction digests and Southern blot analysis from the digests and the chromatin a bands containing the com- ofthese segments, we interpreted these results as evidence for ponent a sequences and chromatin b bands containing bulk DNA sequence-specific phasing of component a nucleosomes DNA sequences (6) were separated from one another and iso- (5). However, this interpretation has been questioned because lated in preparative amounts by electrophoresis in 1% agarose it was observed that deproteinized component a was cleaved gels. The a band DNAs were labeled with [y-32P]ATP as de- in a nonrandom manner by micrococcal nuclease (9). The sug- scribed above for subsequent restriction analysis. In some ex-

The publication costs ofthis article were defrayed in partby page charge Abbreviations: AGM, African green monkey; bp, base pair(s). payment. This article must therefore be hereby marked "advertise- * Present address: Dept. of Biochemistry, Quillen-Dishner College of ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact. Medicine, East Tennessee State Univ., Johnson City, TN 37614. 118 Downloaded by guest on September 28, 2021 Cell Biology: Musich et aL Proc. Natd Acad. Sci. USA 79 (1982) 119

Hindm HindM Hindm A- - I i I i EcoRI * HphI Eco RI * Hph I B * 32 - 140 ____ * 32 P-Hindm/ Eco RI *

140 2 * EcoR.I*/Hin C *- a 2P- dIm 26 i 32p-Hind m / Hph I

FIG. 1. Component a restriction segments used as substrates formicrococcal nuclease cleavage and sequencing. (A) Stretch of component a DNA spanning two tandem repeats, illustrating the relative positions of the restriction sites for Hindu, EcoRI*, and Hph I. In B through D, asterisks denote the sites of the 5_-32p end-label. (a) HindJ[ monomer was cleaved with EcoRI* into two segments of 32 and 140 bp. (C) EcoPJ* monomer was cleaved byHindiLT into two segments of 140 and 32 bp. (D)Hindl monomer was cleaved withHph I into two segments of 146 and26bp. Numbers indicate the length of the segments in bp.

periments, the chromatin oligomer DNA segments were iso- (Fig. 3, lanes e and f). These segments migrated as distinct lated for subsequent digestion with HindIII or EcoRI* and bands superimposed upon a background smear in nondenatur- Southern blotting with a nick-translated radioactive component ing polyacrylamide gels. This result indicated that, in contrast a DNA probe. to the results when the sequence was cleaved at about position The end-labeled component a restriction segments were 126 in chromatin, micrococcal nuclease cleaved the deprotein- treated with various amounts ofmicrococcal nuclease for 15 min ized DNA at multiple sites along the entire 172-bp repeat. at 20C. The samples were precipitated in ethanol and resus- Micrococcal nuclease treatment ofthe monomer segments gen- pended in 20 mM Tris-HCl, pH 8.4/1 mM EDTA/10% (wt/ erated by EcoRI* also yielded a complex pattern of submon- vol) sucrose for nondenaturing polyacrylamide gel analysis (6) omer segments that was distinct from that obtained with the or in 80%Yo formamide/50 mM Tris borate, pH 8.3/1 mM EDTA HindIII monomers (Fig. 3, lane g). This indicated that the pat- for analysis on DNA sequencing gels (15). Gel Analysis. Preparative and analytical electrophoresis of a b c d e f g DNA segments in nondenaturing agarose or polyacrylamide slab gels was performed as described (6). Molecular weight markers included end-labeled restriction segments obtained I - 344 from HinfI digestions of pBR322 or from double digestions (HindIll and EcoRI*) of component a DNA. The nucleotide V sequences ofthese segments, whose lengths extend from 32 to 172 1.6 kb, have been determined (8, 16). Sequence studies were -- 126 - according to standard techniques (15) in 8-20% polyacrylamide -94 gels containing 8.4 M urea. The nucleotides at which micro- - -78 coccal nuclease cleavage occurred could be mapped in the average sequence by reference to parallel lanes in the gel con- _-46 taining the purine and pyrimidine cleavage products ofthe same I - DNA segment.

FIG. 2. Micrococcal nuclease cleavage of component a sequences RESULTS in chromatin. Lane a: CV-1 nuclei were treated with micrococcal nu- Micrococcal Nuclease Cleavage Site of Component a Se- clease (1200 units/ml) for30 min at2C andthe purified DNA was then quences in AGM Nuclear Chromatin. Treatment of CV-1 nu- analyzed in 1% agarose gels asdescribed (6). Roman numerals indicate clei with micrococcal nuclease released two distinct populations chromatin monomer, dimer, and tetramer segments. The bands denoted a contain component a sequences whereas the bands denoted b of nucleosomes: one contained component a segments 172 bp contain bulk DNA sequences. DNA from the a bands was isolated for long (a bands) and the other contained bulk DNA sequences subsequent 32P-labeling and restriction enzyme analysis Lanes b-d: spanning 180-200 bp (b bands) (ref. 6; Fig. 2, lane a). The di- autoradiograms obtained from 6.5% polyacrylamide gel analysis of the nucleosome a bands were isolated preparatively, end-labeled end-labeled dinucleosome a bands after treatment with EcoRI (lane b), with polynucleotide kinase, and cleaved with EcoRI, EcoRI*, EcoRI* (lane c), and Hindl (lane d). Lengths of the segments were determined by calibration with end-labeledHinfl-generated segments or HindIII. The of these restriction sites in the positions major of pBR322 run in parallel (autoradiograms not shown). The cleavage repeat units are known (8) and it was possible to map the unique' products resolved into two pairs of bands, the members of-each pair site of micrococcal nuclease cleavage of the sequence in chro- differing in length by about 8 bp. The lengths of the segments are ex- matin by length measurements ofthe secondary segments thus pressed as the average length ofeach pair. The lengths ofthe segments generated. Lanes b-d of Fig. 2 show that, in chromatin, mi- indicate specific micrococcal cleavage at an accessible site (-position 126; see Fig. 5) of the component a nucleosomes. Results similar to crococcal nuclease cleaved the sequence at position 126 (±6 bp) these were also obtained with the trinucleosome a bands (autoradi- from the leftward HindIII site of component a DNA (see Fig. ograms not shown). Lane e: dinucleosome DNA released by micrococcal 5). These results were confirmed by a similar analysis of a band nuclease, comprising both the a and b bands, was cleaved with Hindm DNA from other oligomeric segments of chromatin DNA and and resolved on a 6.5% polyacrylamide gel. The gel was blotted and by an analysis of the dinucleosome population in which South- hybridized with a nick-translated component a probe. Lane f: control ern blotting with a radioactive component a probe was used to (not treated with Hindu). Lane g: component a DNA cleaved with identify the secondary segments (Fig. 2, lanes f-g). both HindM and EcoRI* before the Southern blotting, to serve as a molecular weight marker. Although visible in .the stained gels, the Cleavage of Deproteinized Component a DNA by Micro- matching segments of 46 bp (lane e) or 32 bp (lane g) either did not coccal Nuclease. Micrococcal nuclease treatment ofdeprotein- transfer efficiently or did not hybridize with the probe under these ized end-labeled component a monomer segments generated experimental conditions. Results similar to these were also obtained by HindIII produced many labeled submonomer segments with the chromatin monomer segments (autoradiograms not shown). Downloaded by guest on September 28, 2021 120 Cell Biology: Musich et aL Proc. Natl. Acad. Sci. USA 79 (1982)

a b c d e f g 0 0 C+T o0g0 q t v X to I- T cA 1725 ,Ii I* 4 6 , b .I ,t i l

C+T

G4-A FIG. 4. High-resolution sequencing gel of the denatured products of component a restriction segments cleaved with micrococcal nuclease. End-labeled Hindrl monomer segments were cleaved with _0 . EcoRI*. The 140-bp segments thus released were then treated with _0 1 micrococcal nuclease at enzyme concentrations of 21 (lane a), 42 (lane b), or 167 (lane c) units/ml for 15 min at 20C. These 140-bp segments 40- were also partially cleaved chemically at their purine and pyrimidine residues for analysis in 10% polyacrylamide sequencing gels. FIG. 3. Nondenaturing polyacrylamide gel analysis of micrococcal nuclease digests of deproteinized component a DNA. (Left) High molecular weight component a was labeled by nick-translation (6) and ponent a are illustrated by this map. then treated with micrococcal nuclease (300 units/ml, 15 min at 200) (i) There was some preference for cleavage of dinucleotides or in a limit b). (lane a) cleaved with HindIll digestion (lane Gel anal- containing A or T. Of the 56 dinucleotides in the component ysis was in 6.5% polyacrylamide. (Center) Molecular weight marker a sequence containing one or both ofthese nucleotides, 47 ex- (lane c) was prepared by treating high molecular weight component a with HindI; the isolated segments were then end-labeled and sub- hibited cleavage, with 17 of intermediate and 9 of high fre- sequently treated with EcoRI*. Dinucleosome a bands produced by quency. In contrast, phosphodiester bonds between G or C micrococcal nuclease digestion of CV-1 chromatin were isolated and were rarely cleaved: only 5 of the 27 such bonds exhibited hy- end-labeled, and the deproteinized sequences were treated with mi- drolysis and these only at a low frequency. Ofthe 88 dinucleo- a The crococcal nuclease in graded series of digestions (lane d). (Right) tides containing A or T and G or C, 48 were cleaved, with 8 172-bp monomers generated byHindll cleavage of deproteinized com- exhibiting high, 13 intermediate, and 27 low levels ofcleavage. ponent a were end-labeled and treated with micrococcal nuclease in a graded series of digestions before polyacrylamide gel analysis. The (ii) Although all the dinucleotide bonds cleaved at high or DNA was treated with 264 (lane e) or 1300 (lane units of micrococcal intermediate frequencies by micrococcal nuclease contained at nuclease per ml for 15 min at 20C. Also, a similar analysis was carried least one A or T nucleotide, A+T-richness in itself apparently out but with end-labeled monomer segments produced byEcoRl* (lane did not confer a susceptibility to nuclease cleavage. For in- g). stance, the A+T runs at positions 12-14, 48-50, 55-57, 95-98, and 160-163 exhibited an overall lower cleavage frequency than terns of micrococcal nuclease cleavage were not due simply to those runs at positions 4-7, 78-80, 102-104, 122-124, 131-133, the effect ofthe proximal termini in these relatively short sub- and 168-170, which were cleaved frequently. Similarly, the strates. When these samples were denatured before loading, pentanucleotide 5' C-T-T-T-C 3' or its complement, 5' G-A-A- the segments migrated ahead of their double-stranded coun- A-G 3', occurs at four positions in the 172-bp component a re- terparts but, other than this downward shift in the segment peat, but only two of these pentanucleotides were cleaved at distribution, the gel patterns remained relatively unchanged a high frequency (positions 3-8 and 167-171), the remaining two (gels not shown). It seems that, under the conditions of ionic were attacked at either a low or an intermediate frequency strength and low temperature used here, micrococcal nuclease (positions 54-48 and 71-75). There are 16 oligonucleotides con- made predominantly double-stranded cleavages in component taining three or more contiguous A or T in the component a a DNA. sequence and, in terms oftheir relative sensitivities to the nu- Sequence Map ofthe Micrococcal Nuclease Cleavage Sites. clease, these can be grouped into almost equal numbers ofsites The results shown in Fig. 3 suggested that some phosphodiester showing low, intermediate, and high frequency cleavages. bonds in the component a repeat were cleaved readily by mi- These results suggest that regions of a DNA substrate rich in crococcal nuclease whereas other bonds were cleaved less fre- A and T residues are not inherently the preferred sites of mi- quently or not at all. To map these cleavage sites precisely to crococcal nuclease cleavage. specific internucleotide linkages, -submonomer restriction seg- (iii) The mapping results shown in Fig. 5 suggested that, in ments ofcomponent a, labeled at a single terminus, were gen- addition to the composition of the dinucleotide at which cleav- erated according to the scheme shown in Fig. 1. These were age occurred, other factors-perhaps the effects ofadjacent se- then treated with micrococcal nuclease and the cleavage prod- quences-modulated the frequency of DNA cleavage by mi- ucts were analyzed by electrophoresis in high-resolution DNA crococcal nuclease. sequencing gels (15). An example ofsuch a gel is shown in Fig. In summary, there is no special or.intense clustering of pre- 4: as the pattern illustrates, micrococcal nuclease cleaved the ferred micrococcal nuclease sites near the position (position 126) phosphodiester bonds between some nucleotides more fre- at which the nuclease specifically cleaves the component a sequently than between others and some sites appeared not to quence in intact nuclear chromatin. By high-resolution poly- have been cleaved. To record the relative frequency at which acrylamide gel analysis, the lengths of the segments released the phosphodiester bonds were cleaved, a scoring scheme was by micrococcal nuclease digestion of the deproteinized DNA devised based on the relative intensity of the autoradiographic did not correspond to the lengths ofthe component a segments bands obtained from the sequencing gels. A summary compi- (172 bp) released by micrococcal nuclease digestion of the se- lation ofthe nuclease cleavage patterns according to the relative quences in chromatin (Figs. 2, 3, and 5). The simplest inter- frequencies with which cleavages occurred at a specific site is pretation of these results is that they reflect the mode ofpack- presented in Fig. 5 as a map ofthe nuclease-sensitive sites along aging of component a in chromatin. The results indicated the the complete sequence. existence of a discrete phase relationship between the repeat Several features ofthe micrococcal nuclease cleavage ofcom- units and their associated nucleosomal proteins. Downloaded by guest on September 28, 2021 Cell Biology: Musich et al. Proc. Natl. Acad. Sci. USA 79 (1982) 121

10 20 30 40 50 60 70 80

5'-AGCTTTCTGAG.AAACTGCTCTGTGTTCTGTTAATTCATCTCACAGAGTTACATCTTTCCCTTCAAGAAGCCTTTCGCTAAGGCTGT 90 100 110 120 130 140 150 160 170

. . . I II'I iI TCTTGTGGAATTGGCAAAGGGATATTTGGAAGCCCATAGAGGGCTATGGTGAAAAAGGAAATATCTTCCGTTCAAAACTGGAAAGA-3'

FIG. 5. Mapping of the micrococcal nuclease cleavage sites and cleavage frequencies in deproteinized component a and in component a DNA packaged in chromatin. The nucleotide sequences are numbered fromthe leftwardHindl site in the component a average sequence (8). The number of triangles above the bond between any two nucleotides indicates the relative frequency with which.that bond was cleaved in deproteinized DNA by micrococcal nuclease. In this scheme, the intense autoradiographic bands (see Fig. 4) indicating sites sensitive to the nuclease are scored with three triangles. Sites cleaved at intermediate or low frequencies are indicated by two triangles or one triangle, respectively. The absence of any marking indicates minimal or no observable cleavage at that position. The consensus scoring scheme is based upon the examination of sequencing autoradiograms of different overlapping segments, each cleaved with three different concentrations of micrococcal nuclease for 15 min at 2TC. The arrow marks the site of micrococcal nuclease cleavage of component a in chromatin. We originally estimated that this site was near an accessible EcoRI site (5) but the more refined measurements provided here. show that this site is at about position 126 as indicated by the arrow. DISCUSSION deproteinized component a DNA is treated with the nuclease. In chromatin, the simple arithmetic series of multimeric seg- We proposed (5, 6, 18, 19) that the subunit structure of con- ments produced reflects one accessible site per repeat (Fig. 2, stitutive heterochromatin modulated the evolution ofrepetitive lane a; ref. 6) whereas the deproteinized DNA was cleaved DNAs and that many mammalian repetitive DNA sequences, many times per repeat. (Figs. 1 and 5; figure 2 of ref. 9). including component a DNA, are in a direct phase relationship (ii) In component a chromatin, the nuclease cleaved the with their nucleosomal proteins. AGM component a is now DNA at or very near a specific site (position 126, Fig. 5) but the known to be only one member of a large and complex family cleavage mapping results revealed that this site was not the only ofrelated DNA sequences-the alphoid DNAs-that recurs in highly preferred site for micrococcal nuclease in the deprotein- various arrangements throughout the major primate taxa (18, ized DNA. For example, there are 17 sites cleaved at relatively 19). Although the sequences have changed in certain nonran- high frequency in deproteinized component a DNA but these dom ways throughout primate evolution, their repeat structure, are not preferred sites of cleavage in chromatin (Fig. 2). The based on ;172 bp, has been conserved. It therefore is possible preferred sites ofcleavage in the naked DNA, or the preferred that phase relationships between DNA sequences and their as- site in chromatin , could not be stringently correlated with the sociated nucleosomal proteins may occur generally throughout presence of A+T-rich runs. the order Primates and among other mammalian orders. (iii) As shown by the end-labeling experiments, the chro- The micrococcal nuclease cleavage patterns ofdeproteinized matin a bands contain a unique set of component a sequences component a presented here have significance for the many [rather than a permuted set as predicted by random or non- studies of eukaryotic chromatin, nucleosome structure, and phasing models (9)]. We have previously shown that, in order phasing problems in which this nuclease is routinely used. We to detect this, it is important to control the composition of the proposed that, in chromatin, component a is organized into buffer and the temperature used in the nuclear isolation and nucleosomes ofdiscrete size (5, 6) and protein composition (20) digestions with the nuclease because the structure of the nu- and in which there is a phasing or sequence-specific alignment cleosome is sensitive to these variables (6) as well as to the extent between the DNA sequence repeat unit and the repeating nu- ofdigestion. These variables may have been overlooked in stud- cleosomal protein structure (5, 6). This phasing of the compo- ies that failed to detect phasing (9, 21). nent a polynucleosome arrays has been questioned by Fittler These results provide further evidence for the precise nu- and Zachau (9) in a study of the micrococcal nuclease cleavage clear organization of component a DNA into polynucleosomal a of component a chromatin and of deproteinized component a arrays with discrete nucleosomal structure. In this structure, DNA. In agreement with our earlier observations (5, 6), these there appears to be a simple and direct phase relationship be- authors found that the component a chromatin was cleaved by tween the DNA sequence repeat units and the nucleosomal micrococcal nuclease to yield component a DNA segments that repeat units (5). At variance with previous work (9), we have also were exact multimers of the 172-bp sequence repeat. These detected component a segments 172 bp long in Southern blot authors also confirmed our observation that the component a analyses ofgraded DNase II digestions ofCV-1 nuclei (unpub- sequences released by.micrococcal nuclease digestions ofAGM lished data). chromatin were cleaved by restriction enzymes to release a About the time this work was completed, two articles ap- discrete set of secondary segments. The gel photographs rele- peared describing preferred sites ofmicrococcal nuclease cleav- vant to this important observation were not presented (9) (but age in defined DNA sequences (22, 23). The results from the see Fig. 2 of this paper). Contrary to our proposal that this nu- various laboratories are in good agreement. If the phasing hy- clease cleavage pattern reflected the phased structure of the pothesis is valid, then it would appear that one ofthe susceptible component, a nucleosomes, it was concluded that the pattern cleavage sites may occur in the linker regions of component a was an artifact resulting from specific cleavage by the nuclease nucleosomes, at about position 126 as indicated here (Fig. 5). at certain nucleotide sequences within the deproteinized DNA Interestingly, this is the preferred cleavage site ofa site-specific repeat. We differ from this. interpretation ofthe data as follows. mammalian endonuclease in deproteinized component a DNA (i) The simple pattern produced by micrococcal nuclease (24, 25). cleavage of component a in chromatin is distinctly different We thank Dr. E. Benz for his assistance with the high-resolution from the far more complex patterns observed when completely DNA sequencing gels and Dr. W. Gillies McKenna forhis critical read- Downloaded by guest on September 28, 2021 122 Cell Biology: Musich et aL Proc. Nad Acad. Sci. USA 79 (1982)

ing of the manuscript. These studies were supported by National In- 12. Stalder, J., Larsen, A., Engel, J. D., Dolan, M., Groudine, M. stitutes of Health Grants CA16790 and GM19100. & Weintraub, H. (1980) Cell 20, 451-460. 13. Scott, W. A. & Wigmore, D. J. (1978) Cell 15, 1511-1518. *14. Sundin, 0. & Varshavsky, A. (1979) J. Mol Biol 132, 535-546. 15. Maxam, A. & Gilbert, W. (1979) Methods Enzymot 65, 499-560. 1. Weintraub, H. & Groudine, M. (1976) Science 193, 848456. 16. Sutcliffe, J. G. (1978) Cold Spring Harbor. Symp. Quant. Biol 43, 2. Garel, A. & Axel, R. -(1976) Proc. Natt Acad. Sci. USA 73, 77-90. 3966-3970. 17. Maio, J. J., Brown, F. L. & Musich, P. R. (1977)J. Mol Biol. 117, 3. Bellard, M., Gannon, F. & Chambon, P. (1977) Cold Spring 637-655. Harbor Symp. Quant Biol 42, 779-791. 18. Maio, J. J., Brown, F. L. & Musich, P. R. (1981) Chromosoma 4. Bodell, W. J. & Cleaver, J. E. (1981) Nucleic Acids Res. 9, 83, 103-125. 203-213. 19. Maio, J. J., Brown, F. L., McKenna, W. G. & Musich, P. R. 5. Musich, P. R., Maio, J. J. & Brown, F. L. (1977)J. Mol Biol 117, (1981) Chromosoma 83, 127-144. 657-677. 20. Musich, P. R., Brown, F. L. & Maio, J. J. (1977) Proc. Natd Acad. 6. Brown, F. L., Musich, P. R. & Maio, J. J. (1979)J. Mol BioL. 131, Sci. USA 74, 3297-3301. 777-799. 21. Singer, D. S. (1979) J. Biol Chem. 254, 5506-5514. 7. Roberts W. K., Dekker, C. S., Rushizky, G. W. & Knight, C. A. 22. Horz, W. & Altenburger, W. (1981) Nucleic Acids Res. 9, (1962) Biochim. Biophys. Acta 55, 674-682. 2543-2658. 8. Rosenberg, H., Singer, M. & Rosenberg, M. (1978) Science 200, 23. Dingwall, C., Lomonossoff, G. P. & Laskey, R. A. (1981) Nucleic 394-402. Acids Res. 9, 2659-2673. 9. Fittler, F. & Zachau, H. G. (1979) Nucleic Acids Res. 7, 1-12. 24. McKenna, W. G., Maio, J. J. & Brown, F. L. (1981) J. Biol 10. Louis, C., Schedl, P., Samal, B. & Worcel, A. (1980) Cell 22, Chem 256, 6435-6443. 387-392. 25. McKenna, W. G., Brown, F. L., Musich, P. R. & Maio, J. J. 11. Wittig, B. & Wittig, S. (1979) Cell 18, 1173-1183. (1982) J. Mole Biol., in press. Downloaded by guest on September 28, 2021