Eastern Illinois University The Keep
Masters Theses Student Theses & Publications
2017 DNA Markers Identify Genetic Heritage between Chickadees near a Contact Zone in Illinois Fahad M. Alshammari Eastern Illinois University This research is a product of the graduate program in Biological Sciences at Eastern Illinois University. Find out more about the program.
Recommended Citation Alshammari, Fahad M., "DNA Markers Identify Genetic Heritage between Chickadees near a Contact Zone in Illinois" (2017). Masters Theses. 2710. https://thekeep.eiu.edu/theses/2710
This is brought to you for free and open access by the Student Theses & Publications at The Keep. It has been accepted for inclusion in Masters Theses by an authorized administrator of The Keep. For more information, please contact [email protected]. The Graduate School� EASTERN !LLJNOIS UNJVERS!TY Thesis Maintenance and Reproduction Certificate
FOR: Graduate Candidates Completing Theses in Partial Fulfillment of the Degree Graduate Faculty Advisors Directing the Theses
RE: Preservation, Reproduction, and Distribution of Thesis Research
Preserving, reproducing, and distributing thesis research is an important part of Booth Library's responsibility to provide access to scholarship. In order to further this goal, Booth Library makes all graduate theses completed as part of a degree program at Eastern Illinois University available for personal study, research, and other not-for-profit educational purposes. Under 17 U.S.C. § 108, the library may reproduce and distribute a copy without infringing on copyright; however, professional courtesy dictates that permission be requested from the author before doing so.
Your signatures affirm the following: • The graduate candidate is the author of this thesis. • The graduate candidate retains the copyright and intellectual property rights associated with the original research, creative activity, and intellectual or artistic content of the thesis. • The graduate candidate certifies her/his compliance with federal copyright law (Title 17 of the U. S. Code) and her/his right to authorize reproduction and distribution of all copyrighted materials included in this thesis. • The graduate candidate in consultation with the faculty advisor grants Booth Library the non exclusive, perpetual right to make copies of the thesis freely and publicly available without restriction, by means of any current or successive technology, including by not limited to photocopying, microfilm, digitization, or internet. • The graduate candidate acknowledges that by depositing her/his thesis with Booth Library, her/his work is available for viewing by the public and may be borrowed through the library's circulation and interlibrary loan departments, or accessed electronically. • The graduate candidate waives the confidentiality provisions of the Family Educational Rights and Privacy Act (FERPA) (20 U. S. C. § 1232g; 34 CFR Part 99) with respect to the contents of the thesis and with respect to information concerning authorship of the thesis, including name and status as a student at Eastern Illinois University.
I have conferred with my graduate faculty advisor. My signature below indicates that I have read and agree with the above statements, and hereby give my permission to allow Booth Library to reproduce and distribute my thesis. My adviser's signature indicates concurrence to reproduce and distribute the thesis.
Graduate Candidate Signature Faculty Adviser Sign�e
Printed Name Printed Name �1-("'� Zo 17- 2't '2.orr- Graduate Degree Program Date 11(Ay
Please submit in duplicate. DNA Markers IdentifyGenetic Heritage between Chickadees
near a Contact Zone in Illinois
(TITLE)
BY
Fahad M. Alshammari
THESIS
SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
Master of Biological Sciences
IN THE GRADUATE SCHOOL, EASTERN ILLINOIS UNIVERSITY CHARLESTON, ILLINOIS
2017
YEAR
I HEREBY RECOMMEND THAT THIS THESIS BE ACCEPTED AS FULFILLING THIS PART OF THE GRADUATE DEGREE CITED ABOVE
�Ir S/2't l;" I';( THESIS COMMITTEE CHAIR E DEPAR1;fNTISCHOOL CHAIR DATE CHAIR'S DESIGNEE
s-j;a/ ;JoJ f
THESIS COMMITTEE MC:MBER DATE THESIS COMMITTEE MEMBER DATE
::>/�t/17' I THESIS COMMITTEE MEMBER DATE THESIS COMMITTEE MEMBER DATE DNA Markers Identify Genetic Heritage between Chickadees near a Contact Zone in Illinois
Fahad M Alshammari
Dept. of Biological Sciences
Eastern Illinois University
Charleston, IL © Copyright by Fahad M Alshammari 2017
All Rights Reserved
II COMMITTEE IN CHARGE OF CANDIDACY
Professor Dr. Eric K Bollinger, Co-Advisor
Professor Dr. Zhiwei Liu, Co-Advisor
Professor Dr. Gordon C. Tucker
Ill Abstract:
I studied the genetic interactions of Black-capped (Poecile atricapilus) (BCCH) and Carolina (P. carolinensis) (CACH) Chickadees in and near the largest hybrid contact
zone in Illinois. Biologists have assumed Carolina and Black-capped Chickadees hybridize in their large contact zone in Bond and Fayette Counties, based on intennediate morphological measurements, plumage characteristics and the production of aberrant vocalizations. In determining hybridization, however, diagnostic genetics may be more
useful than any other criterion. The genetic and environmental factors that have
contributed to the survival of this chickadees hybrid zone have underscored the genetic integrity of both species. We collected tissues from chickadees during the breeding
season fromdiff erent areas within and near the contact zone. We isolated and compared mitochondrial DNA (mtDNA) which allowed us to assess maternal genotypes for our
samples and compare them with both of the species. Afterwe analyzed the DNA
sequences of each species of our samples, we identifiedthat genetic mixing occurs within this contact zone. In addition, our results confirmedthe mtDNA from all our samples had high expression of BCCH sequences but was distinct enough to suggest closer to CACH.
IV Acknowledgments
I would like to acknowledge my co-advisors, Prof. Eric Bollinger and prof.
Zhiwei Liu, fortheir support and encouragement. Bollinger's guidance helped me the
researching and writing of this thesis, and he was a source of never-ending support. I
appreciate all of his contributions of time, ideas, and help in the field. I would like to
express my gratitude to Prof. Zhiwei Liu forthe continuous support of M.S thesis, forhis
guidance, encouragement, and patience. Every result described in this thesis was
accomplished with his help and support. Dr. Liu and I worked together on many different
phases, and without his effortsmy study would have undoubtedly been much more
difficult. In addition, I am very grateful forwor k of Ms. Shannon Regan, she constructed
the nest-boxes placed them in the field,and helped collect the chickadee tissue samples
used in this study. I would also like to thank Director of DNA Sequencing: Dr, Alvaro
Hernandez, assistant director of DNA sequencing: Chris Wright; and laboratory
supervisor: Leslie D. Benson in Biotechnology Center at the University of Illinois at
Urbana-Champaign fortheir assistance. I would like to thank both Aljouf University and
the Saudi Arabian Cultural Mission (SACM) forbot h financial and logistical support.
Many thanks to Eastern Illinois University, the Graduate school, and the
Department of Biological Sciences for accepting me in to their M.S program. Many thanks to: Prof. Gordon Tucker, forhis time, interest, suggestions, and helpful comments.
Finally, l would like to acknowledge friends and family who supported me during my time here, especially my wife Amjad. Many thanks to her forunde rstanding the need to take many hours during my lab experiments.
v Table of Contents
Abstract ...... iv
Acknowledgments ...... v
Table of Contents ...... vi
List of Figures ...... viii
List of Tables ...... ix
Introduction ...... l
Effects of Hybridization between closely-related Species ...... 3
Morphology...... 5
Distribution ...... 7
Disparities in Chickadee Populations between Illinois and Other States ...... 10
Previous Studies ...... 11
Aim of Study ...... 12
Methods and Materials ...... 13
Sample Collection ...... 13
DNA Extraction ...... 13
DNA Quantification ...... 14
PCR amplification and Gel Electrophoresis ...... 15
VI Sequencing and Gene Editing ...... 16
Phylogenetic Analysis ...... 17
Results ...... 18
Discussion ...... 29
Conclusions ...... 32
Literature Cited ...... 33
VII List of Figures:
Contact zone between Black-capped (BCCH) and Carolina Chickadees(CACH) . 5
Distribution of the two species, BCCH and CACH ...... 9
DNA Quantification ...... 22
PCR amplification and Gel Electrophoresis ...... 23
Nucleotide Sequences ...... 26
Phylogenetic Tree ...... 27
Map of the Samples Collection ...... 28
VIII List of Tables:
Sample Collection ...... 20
Primers ...... 21
MtDNA Sequences ...... 24
Maximum Likelihood fits ofdiff erent nucleotide substitution models ...... 25
IX Introduction
Hybridization of species is a frequently occurring phenomenon in both plants and animals. Although hybridization often negatively impacts the survival of the resulting offspring, it can be a positive forceof evolution, allowing forthe rapid adaptation of organisms to an ever-changing environment (Engler et al., 20 1 5). Hybridization between two different species can result in an entirely new species through a process called
"hybrid speciation". For example, a mule is a member of its own species that results from the interbreeding of a donkey and a horse, which are different species having different
numbers of chromosomes. When hybridization leads to a new species through homoploid hybrid speciation (HHS), two distinct genomes are recombined without a corresponding change in chromosomal number (Eroukhmanoffet al., 20 13). The resulting offspringtend to share a strong phenotypic resemblance to the parental fonns. Homoploid speciation is
"supervenient," meaning that it is generated through multiple distinct physical processes.
It is different than polyploid speciation, in which the number of chromosomes within the cell increases and typically increases (Elgvin el at., 2011).
In birds, behavioral patterns are not solely determined by genetics. For example, most birds learn many aspects of their behavior, and many researchers consider this when investigating hybridization. Learned behaviors can be affected in contact zones. These learnedbe haviors, like song production in passerines, can mislead researchers because they may initially consider a song as being a genetically influenced aspect of a particular species of bird, when in actuality the song may have been learned or influenced by another bird in the contact zone. Contact zones are locations within a range where two species overlap and hybridization occurs. Some researchers may refer to this area as a
1 "hybrid zone" (Sattler, 1996). In these "contact zones" or "hybrid zones" researchers can
study the process of speciation and the evolution of reproductive isolation between
species (Sattler & Braun, 2000).
Current research involving DNA analysis have found that, hybrids are common
and most of the birds within a hybrid group sound and behave similarity to the parental
species. Many of the hybrids are too cryptic to affinn by field examination alone.
Moreover, in the zone of contact any bird should be distrusted of hybrid existence, and
others exploring different combination attributes are similar to hybrids. Various
researchers have detennined that the process of hybridization happens continuously, and
that the hybrids are not like parental birds. Some hybrids population that are young
maintain stable populations (Miller el at, 2014).
Until very recently, hybridization was hypothesized to play only a minor role in the evolution of animals (Mallet, 2007). However, it has since been detern1ined to be a regular environmental event. According to Mallet (2007), an average of 10 percent of
animal species and 25 percent of plant species are able to hybridize. In fact,new genetic
studies suggest that hybrid speciation is a common process in both animals and plants.
Additionally, Mallet et al. (2007) foundthat hybridization and introgression, or the interspecies transferof genetic information, possibly persists formilli ons of years
followingthe initial separation from one's species (also known as the initial divergence).
2 The effects of hybridization between closely-related species:
When two closely - related species come into close contact, various degrees of
hybridization may occur. The rate at which a hybrid species will occur is dependent on
both environmental and genetic influences, as well as possible sources of variation.
Hybridization can lead to a large number of possible genetic outcome, which will affect
the way the organism interacts with its environment and how or if it will continue to
survive. Both losses in fitnessand gains in fitness may happen as a result of
hybridization. For example, fitnessloss can happen as a consequence of the disruption of
coevolved gene complexes (Nolte & Tautz, 2010). On the other hand, speciation by
hybridization can contribute to evolutionary fitness by increasing biological
diversification (Hermansen et al., 2014). In addition, fitnessgains due to heterosis, or
improved perfonnance of biological functions in hybrid offspring, may also occur when
deleterious recessive genes present in either parent species are diluted and consequently
outbred. Thus, hybridization can be beneficial or detrimental to the hybrid offspring
depending on gene mutations and the impact of these mutations on the organism's ability
to succeed its given environment (Adams & Burg, 2015).
A hybrid organism's genes interact dynamically with the environment driving
fitness effects. Due to the complexity of the genetic processes at play in hybridization, it
is difficultto isolate and identify the specificcombina tions of parental alleles that have
contributed to the adaptive traits of some hybrids (Nolte & Tautz, 2010). Hybridization can create large numbers of new allele combinations. Analyticalme thods in genetic modeling have shown this. Hybridization affects large portions of the hybrid genome, rather than just a fewloci. This indicates that adaptive phenotypes may occur as a
3 consequence oflarge-scale genomic selection. In fact, the process of species
diversification can significantly advance by speciation via hybridization (Hermansen et
al., 2014).
Black-capped chickadees (Poecile atricapillus; BCCH) and Carolina chickadees
(P. carolinensis; CACH) are two closely related bird species that are known to hybridize
(Walsh, 2015). To understand how hybridization occurs between the two species, it is
important to consider both their similarities and differences. By examining the birds'
morphological, distributional, and behavioral patterns,de termining whether a hybrid
species is a new species altogether or merely a variation in phenotype expression becomes clearer. The two species of bird do have many things in common. Both BCCH
and CACH share the same family: Paridae and genus: Poecile. In addition, both BCCH
and CACH inhabit two distinct areas in the eastern portion of North America (Sattler et
al., 2007).
BCCH reside in the northern areas of the United State and Canada; CACH
typically occur in the southeastern United States. Their ranges oftenoverlap in narrow band of contact zones (Figure l ), part of which occurs in Illinois, Missouri and Kansas
(Olson et al., 2010). Hybrid individuals share many characteristics of the parental species,
and a variable combination and expression of the parent species' phenotypes.
4 Figure 1. Black line presents the contact zone between Black-capped and Carolina Chickadees which including Illinois, Missouri and Kansas. In this range hybridization may occur. (Taylor et al., 2014)
Sattler and Braun (2000) discovered introgression and hybridization between the two closely -related species in an overlapping region of habitat in Missouri. The researchers found multiple indicators suggesting their hybridization. According to genetic data, 58% or more of the birds in the overlapping region were of mixed ancestry; furthermore, among these hybrids, recombinant genotypes were common, demonstrating the fertility of the hybrid individual. The hybrid zone, or cline, was described as steep, indicating that there was high variability in the physical attributes of the hybrid individuals in the contact zone. In addition to this morphological indicator, Sattler et al.
(2007) noted song admixture as evidence of hybridization between the Black-capped and
Carolina chickadees. Among differentiated populations of birds, vocal admixture is common when both populations inhabit the same geographic area. This admixture can be
5 some subtle differences in morphology between the two species. For example, Black-
capped chickadees always have whiter on the outer edges and tips of their wings than
Carolina chickadees; they also tend to be larger. Despite the similarities to the parent organisms, researchers can identifyth e hybrid offspring via their differentiated vocalizations. Identifying the hybrid birds by their song provides the most reliable means ' of identification in the field. In fact, the two species of bird have traditionally been recognized as separate due to the differences in their song, rather than being seen as possessing a varied phenotypic expression
Typically, scientists are able to distinguish the two species via their vocalizations
(Curry & Reudink, 2007). For example, Black-capped chickadees have a particular song composed of 2 or 3 notes ''fee-bee". On the other hand, Carolina chickadee song is composed of"high-low-high-low" notes. However, the hybrids may have aberrant songs
that combine characterize of both parental species. To conclude, BCCH and CACH have · more variation, and not only by their morphological features, but also by vocalizations, within the hybrid zone (Enstrom & Bollinger, 2009). Both these species differ from each other in tennsof behaviors and morphology, one fromthe North and the other from the
South, but these species show similarities with each the other in hybridization termssuch as their feathers and neck sides (Michael et al., 2015).
The analysis of DNA, cytochrome b, chromosomes, and morphologyclea rly show that these are separate species (Rheindt, & Edwards, 2011). The Poecile genus name was not specifiedby any professional genetic author. In the end, the species epithet for BCCH became atricapillus and was taken as the masculine feature(Gill et al., 1993). Due to genetic similarities in the past, black-capped chickadees were taken as Eurasia, Willow tit
7 by con-specification and also genetic similarities. In old guide book of bird species, black-capped chickadees were used as an alternativename forWillow tit. These old manuals also suggest the secondary similarity of Carolina chickadees with Willow tits.
Analyzed by several authors it was proved that in the case of genetics, Black-capped and
Carolina chickadees have similarity with each other. The slight differences in Black capped and Carolina chickadees are due to genetic and chromosomal differences. Both
Carolina and Black-capped chickadees contain similarities and difference. Slight differences of weight and length occur between these two taxa, but in genetic terms these are species are nearly identical (Reudink et al., 2007).
Distribution:
In generaltenn s, there two species are fairly sedentary and referred to as
"permanent residential". Thus, these two species can easily be differentiated from each other on the basis of their ranges. Black-capped chickadees are those that occur in northernregi ons of America and southern Canada. On the other hand, Carolina chickadees are those that occur in southernregi ons of the United States (Olson et al.,
2010) (Figure 2).
8 Figure 2. The distribution of the two species BCCH and CACH, the BCCH is found in northernUS, whereas CACH is from the southeastern US (Olson et al., 2010). (Smith, 2010).
Enstrom and Bollinger (2009) identifiedfou r distinct hybrid zones along the interface of the geographic range of Poecile atricapillus and P. carolinensis in Illinois.
These zones were determined by the differences in singing patternbe tween the parent species and individuals in these areas. Thus, the researchers concluded that the hybrid zones of Black-capped and Carolina chickadees have maintained relative stability in
Illinois, in contrast to similar populations of chickadees in the northeastern United States, which have undergone redistribution in recent decades (Enstrom & Bollinger, 2009).
Anothergroup ofresearchers (Reudink, et al., 2005) extensively studied the mating patterns of populations of Black-capped and Carolina chickadees within the state of
Pennsylvania. Out of 90 examined broods, 56%, or approximately 51 broods, were discovered to have hybridized. In addition, all females that acquired extra-pair
9 fertilizations (EPF's), regardless of species, tended to preferCa rolina-like males as an extra-pair mate. This findingmay attest to the virility of the male Carolina Chickadee and the adaptive success of this offspring. In addition, the high rate of paternityowing to extra-pair copulation may suggest that the mother's choice of mate is an important source of influencein the northward movement of the hybrid zone forpopu lations in southern
Pennsylvania and Missouri (Reudink, et al., 2005).
When the southern region become too cold, Black-capped chickadees moved toward the north and according to the season. In the summer season both Black-capped and Carolina chickadees appeared as freshand molt. Global wanning presents life changes forth ese species. From all these studies, researchers determined that chickadees move fromtheir South region to the North region because Paridae are strongly impacted by global warming. (Shyloh A. van Delft, 2015). (Harr, & Price, 2014).
Carolina chickadees are capable of reducing their core body temperature and can go into an intentional state of as torpor. The Carolina chickadees try do this to save energy in cold seasons. In winter seasons Carolina chickadees search fortree cavities wherein they can roost forup to fifteenhours . In the course of this time, they save energy
(Gill et al., 2005).
Disparities in Chickadee Populations between Illinois and Other States
Although both Black-capped and Carolina Chickadees may be found outside of
Illinois, the recent range changes of Illinois-based Black-capped and Carolina Chickadees are markedly different fromthat of either of the populations that inhabit Missouri and southern Pennsylvania. Reudink et al. (2007) showed that the chickadee population of
Pennsylvania was moving northward, whereas the ranges Illinois chickadees have
10 apparently not changed much. Similarity, the Carolina chickadees are more frequently less in weight in comparison to Black-capped chickadees. However, CACH inhabiting the mountains of western Kentucky and Tennessee showed no hybridization with BCCH.
Every state's chickadees contain different behavior compared with other chickadees
(Tanner, 1952). The Illinois chickadees are of special interest due to the four distinct hybrid zones they presumably occupy. Sattler et al. (2007), perfonned a principal component analysis (PCA) to identify unique variations in the song characteristics across different population samples. Along all twelve populations of the two examined
Appalachian transects, multiple song types exhibiting sympatry were identified(S attler et al., 2007).
Previous Studies.
Many studies have focused on black- capped and Carolina chickadees in their contact zones. Group of researchers focused on various vocalizations in different parts of the contact zone such as near Columbus, Ohio (Focht, 2013). Focht, (2013) hypothesized that the Carolina chickadees would show a differencewhen it comes to territorial response to some specificsongs . For this research, they used recorded black-capped chickadee songs, and when the Carolina chickadees heard the voice froma distance they responded positively to the sound. However, they responded differently fromth eir own songs; their response was weak compared to the typical way they respond to their own song. More research, however, could determine if the results indicating that chickadees show a different response in allopatric regions holds true for the regions north of the hybrid zone in the historically black �-capped chickadee range. Further research could also explain and if character displacement is beginning to develop within the hybrid zone
11 and if this could reduce the amount of the hybridization of Carolina chickadees with less dominant black-capped chickadees so as to reduce the black-capped chickadees (Focht,
2013).
Another researcher studied structure and dynamics ofBCCH and CACH in the
contact zone in southern Pennsylvania. The reason for the analysis of the structure was to determine whether there can be a place in which the hybrid zone can be stable during the breeding season. DNA samples frombi rds were collected across the contact zone. At the
end of the research, there were some results that showed that there was certain hybridization at one site. Birds with Carolina mtDNA mated with a male Black-capped haplotype, and they successfullyproduced offspring without any complications. The
Carolina chickadees may have asserted dominance over the Black-capped males, and they may have mated and produced another hybrid (Reudink et al. 2007).
Aim of Study.
The main goal of this study was to investigate the genetic interaction between Black capped and Carolina chickadees in the largest contact zone in Illinois because other studies have looked at hybrid zones in other states. We hypothesized that the contact zone chickadees are genetic hybrids and that the results fromIll inois may differ than other areas because of the landscape in Illinois. However, we expected that there would be a significant genetic distinction between Black-capped and Carolina chickadees. To test this hypothesis, I examined many samples of Black-capped and Carolina chickadees' tissues in different locations in Illinois. Then I answered the questions if results from
Illinois may differthan other areas or not and identified the hybrid individuals (species) and genetic distinction between BCCH and CACH.
12 Methods and Materials
Sample Collection
Black-capped and Carolina chickadees are known to hybridize in several areas along their adjacent border "( e.g Missouri: Braun and Robbins 1986; Sawaya 1990; Illinois:
Brewer 1963)" Bronson et al. (2003). The specimens forthi s study were collected from
central Illinois within or near hybrid zones where reported, as well as from other areas in
southern Illinois where only one of the species is found. We chose this area because the longest "hybrid zone" between BCCH and CACH in Illinois occurs as the Greenville and
Vandalia areas. The samples were collected in the breeding season of the birds at the end of the spring and the beginning of the summer from 15 April to 15 July in 2016 and 201 7 as well as dating to 2008. We collected 17 samples of feathers from different populations from Southern Illinois (Table 1.). The samples collected were tissues and blood because it has shown genetic evidences forth is study. After the data were sampled by E.
Bollinger, frozenwi thin fewhou rs on dry ice till they were kept in a - 20 °( freezer until b used for DNA extraction. eing freezing samples around this temperature suggests as a better procedure to perform the DNA extraction and keep samples fresh.
DNA Extraction
DNeasy Blood and Tissue kit (Qiagen, USA), a tool for the purification of DNA from animal tissues and blood, is used for DNA extraction (Trier et al., 2014). Tissue was cut into small pieces, and then placed in a 1.5 ml micro centrifuge tube. DNA extraction was then performed by following the protocol provided by the manufacturer: 180µ1Bu ffer
ATL, "Animal Tissue Lysis, buffer", and 20 µl proteinase K were then added to each, and the mixture was then thoroughly dispensed by vortexing. The mixture was then incubated
13 at 56°C on a rotating wheel for a couple of hours or overnight until completely lysed.
Fully homogenized tissue was then vortexed for 15s in order to break up the matrix from
the fluidcontai ning the purged DNA. Before200 µl AL Buffer was added, the mixture
was then vortexed thoroughly for 10s, incubated at 56°C for 5 mins, then added with
200µ1 ethanol (100%) forDNA precipitation. The entire content was then transferred to a
new Mini spin column (MSC) 2ml collection tube and spinned in a centrifuge for 1 min
at� 8000 rpm.
The MSC was placed in a new 2ml collection tube, to which 500µ1 A WI buffer was
added to break the proteins so they can cross through the filter. Aftera brief incubation,
the set was then centrifuged for 1 min at� 8000 rpm. The MSC was subsequently
transferred to in a new 2ml collection tube and added with 500µ1 AW2 buffer to remove
salts fromth e samples and centrifugedat 13,200 rpm for 3 min. The spin column together
with ON As bound to its membrane was transferred to a new 1.5 ml microcentrifuge tube, and added with 200µ1 AE buffer at the central of the membrane to dissolve the DNA
from the membrane. The spin column was then centrifugedthe samples for 1 min at�
6000 x g (8,000 rpm) afterbeing incubated at 15-25°C for 1 min. The extracted DNA samples were stored at 4°C for later genetic analysis.
DNA Quantification
Adequate quantity of DNA is essential forthe success of subsequent PCR amplification of the target gene. There are many ways to quantify DNA or RNA, and the most common procedure is Spectrophotometry for DNA or RNA quantification. In this
study, we used Epoch™ 2 Microplate Spectrophotometer (BioTek®, USA), which offers
an effective means forDNA quantification that only requires micro-volume of samples,
14 and DNA quantity data is ready to read and analyze with the provided Gen5 Software. As
standard for the method, we loaded 2 µL of each sample in the blank Take3 plate with 2
µL of AE buffer in the top row of two wells for calibration. Epoch™ Epoch™ 2
Microplate Spectrophotometer is also suited for some other related applications, including RNA quantification, protein purity assays, and enzyme kinetic assays.
(Figure3)
PCR amplification and gel electrophoresis.
The polymerases chain reaction, or PCR, is commonly used in molecular biology to produce millions of copies of DNA sequences and a common technique used in medical and biological research labs (Joshi et al, 201 1). A segment of mtDNA for the control region Amplifiedusing the primers LbcchCRl (CCA CCA CCC CAT AAT AAG GA) and HCRCbox (CCA CTT GTA TCT GTG ARG AGC) was shown to be useful for identifying maternal lineage (Grava et al 2012). We followed the original PCR protocol of (Grava et al 2012) with small modifications. For each 25 µL reaction, 12.5 µL of
Tag® Green Master Mix (Promega, USA), 1 µL of l 0 µM primer 1 (Lbcchcrl ), 1 µL of
10 µM primer 2 (HcRcbox). LbcchCRl and HCRCbox (Table 2), mostly 2 µL of DNA, and finally 7.5 µL ofRNase-free water to bring up the final volume to 25µL foreac h reaction. For some reactions, I modifiedthe volume, depending on DNA concentration and the volume of water accordingly.
The reactions were run on a MJ Research PTC-100 Thermal Cycler (MJR, USA) with the thermal profile: 94°C for 120 s, 50°C for 45 s, 72°C for 1 cycle, followedby 37 cycles of 94°C for30 s, 54°C for45 s, and 72°C for60 s, and a final step of 72°C for5 mins, and held at 4 °C until being transferred to a refrigerator fortemporary storage
15 beforemini- gel check and final sequencing. For mini-gel checkup, I used 15µL GelRed
Nucleic, the gel and for electrophoresis buffer. PCR products (4µL) and DNA ladder
(Qiangen, USA) each were mixed with l OµL of 6x load Dye on parafilmand then
transferred to sample wells in the gel. The gel was let to run in 100 Volt DC power for
approximately 30 mins, and then visualized using Molecular Imager (Gel Doc™ XR+
imaging system, USA).
Sequencing and gene editing
Sequencing was perfonned at the W.M. Keck Center, part of the Roy J. Carver
Biotechnology Center at the University of Illinois at Urbana-Champaign. Sequencing
reactions were set up as follows: 8µ1 of water, 4µ1of 5M betaine, 2µ1of 5X Sequencing
Buffer (Applied Biosystems), 1.5 µl of BigDye® Terminator v3.1 (Applied Biosystems),
0.5 µl dGTP BigDye® Terminator v3.0 (Applied Biosystems), 2µ1 of primer and 2µ1 of template per sample. Thermal cycling was perfonnedat 98°C for 5 min followed by 40
cycles of 98°C for 15 secs, 45°C for 5 sec and 60°C for 4 min. When complete, reaction products were then cleaned up using a DyeEx kit (Qiagen). Samples were denatured at
95°C for 2.5 minutes, then loaded onto the Applied Biosystems 3730xl equipped with a
50 cm 96-capillary array and running POP-7TM polymer (ABI). Samples were run using a modifiedvers ion of the default LongSeq50_POP7 run module, where injection time was increased to 25 seconds and run time decreased to 5040 seconds. Samples were analyzed on Sequencing Analysis v5.2 software (ABI). Each sample was analyzed in two directions (forward and reversed) (Table 3). (Alvaro, el at 2017)
16 Phylogenetic analysis
Prior to phylogenetic analysis, Mr. ModelTest implemented implemented in Mega
7.0 (Kimura 2016) was used to estimate the best molecular evolution model forthe target mtDNA gene region. For phylogenetic analysis, Maximum Likelihood (ML) method implemented in Mega 7.0 (Kimura 2016) was used K2. Models with the lowest BIC scores (Bayesian Information Criterion) are considered to describe the substitution pattern the best. For each model, AICc value (Akaike Information Criterion, corrected),
Maximum Likelihood value (lnL), and the number of parameters (including branch lengths) are also presented [1]. Non-uniformity of evolutionary rates among sites may be modeled by using a discrete Gamma distribution ( +G) with 5 rate categories and by assuming that a certain fraction of sites are evolutionarily invariable (+I). Whenever applicable, estimates of gamma shape parameter and/or the estimated fraction of invariant sites are shown. Assumed or estimated values of transition/transversion bias (R) are shown for each model, as well. They are followedby nucleotide frequencies (f) and rates of base substitutions (r) foreach nucleotide pair. Relative values of instantaneous r should be considered when evaluating them. For simplicity, sum of r values is made equal to 1 for each model. For estimating ML values, a tree topology was automatically computed. The analysis involved 14 nucleotide sequences. Codon positions included were lst+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 122 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 [2]. (Table 4)
17 Results
More than morphological distinctions alone, genetic markers proved a greater
resource in detecting the incidence of hybridization and introgression between disparate
populations of chickadees. With the advent of advanced diagnostic methods, the genetic
interactions of hybridizing taxa can now be assessed with greater accuracy than the
methods available (Sattler & Braun, 2000). The genetic relationship among individuals of
the Black-capped chickadee and the Carolina chickadee, as well as likely hybrid
individuals revealed by molecular data, is then compared with morphology and
vocalization-based relationship.
Due to differences in the analytic methods applied to the different sets of
specimens collected from each of the considered geographic areas (Figure 7), we tested
17 specimen mtDNA, individuals from different locations were successfullygenoty ped,
and mtDNA was successfully significant in all the samples. The DNA extraction was
presented by the purity and concentration of all the specimens. Most of the samples had a high purity and concentration, and that refers tothe quality of the specimens as well as the region where the data was collected from. We tested the quantity of DNA in order to confirm well in a PCR experiment. The results of the DNA were positive, and the concentration of the extracted DNA samples were then compared (Figure 3)
In term of PCR examinations, it showed that the amount of the mtDNA in each sample was extremely clear and usable in all the samples except the samples that were collected fromthe Greenville and Coles county region, which was due to the low quality of the DNA (Figure 4). The results of the PCR examination were clarifiedby using
Molecular Imager (Gel Doc™ XR+ imaging system, USA) in order to test mtDNA
18 sequences (Figure 4). The results of sequencing and gene editing presented the mtDNA
sequences ofBCCH and CACH chickadees (Table3).
We looked at the National Center forBi otechnology Information (NCBI) forbo th
BCCH and CACH mtDNA sequences, but we did not find mtDNA sequences for CACH.
We considered Mountain Chickadees (MOCH) instead of CACH, and used it as the
control region ( outgroup) because they share the same social hierarchy classification
(Grava et al 2012). We identifiedthe genetic relationship by using CLUSTAL W editor
Mega (figure5) (Tamura et al. 2007). The specimens were collected fromthe contact
zone which are hybirds of Black capped and Carolina chickadees because a few
specimens were homogeneous to BCCH more than others (Figure 6). More specifically,
the phylogenetic tree showed that the genetic relationship among BCCH with our
specimens based on their mtDNA (Figure 6). From the phylogenetic tree, we identified
that all the samples are fairlydiff erent from BCCH, and the samples collected from
Ramsey (Northside) are the closest to BCCH. Our results confirmed that the samples
collected fromCa rlyle Lake (Southside) were different frombl ack-capped chickadees because the mtDNA was not similar to the samples fromRa msey (Northside). Because
Carlyle Lake's samples were different from Ramsey's samples, we identified that they are likely "mostly" CACH (Figure6&7). After the analysis of genetic markers was
conducted, it concluded that all of the specimens were collected from the overlapping
zone were within the hybridization range.
19 Table 1:
17 tissue samples of chickadees were collected fromdifferent locations in the putative hybrid zone in Illinois fromA pril to July in 2016-17. The samples are labeled from A to Q.
Sample Location Date of collection
A Ramsey 31-May-16
B Ramsey 31-May-16
c Carlyle Lake 18-May-16
D Carlyle Lake 18-May-16
E Carlyle Lake 18-May-16
F Carlyle Lake 19-May-16
G Carlyle Lake 18-May-16
H Carlyle Lake 18-May-16
I Carlyle Lake 18-May-16
J Greenville 15-May-08
K Carlyle Lake 18-May-16
L Carlyle Lake 18-May-16
M Coles county 19-May-16
N Coles county 19-May-16
0 Greenville 15-May-08
p Coles county 19-May-16
Q Coles county 19-May-16
20 Table 2:
Premiers sets used forPCR analyses
Primers Primer Sequence Size bp References
designation
LbcchCRl CCA CCA CCC CAT AAT AAG GA 734 (Grava et al 2012)
HCRCbox CCA CTT GTA TCT GTG ARG AGC 734 (Grava et al 2012)
21 DNA Concentration per Samples
300
259 2 3
217 204 184 191 c 200 184 184 0 179 165 156 154 � 150
so 24 I I 0 A 6 C D G H M N 0 P Q ONA Sa rnpl �s
Figure 3.
DNA concentrations of total DNA extracts forall samples. The graph shown that the concentration of the DNA in each sample. Except forsa mple G and M, most samples had high to very high DNA yield.
22 Figure 4.
The amplified mtDNA control region checked on agarose mini- gel presenting all the conformations labeled from sample: (A to Q). PCR amplification was not successful initially for1 and 0 samples. Reamplifications of 1 with reduced DNA template concentrations - JI and 12 representing lµL and 0.5µL of DNA added to 25 µL PCR reactions, respectively, - were able to achieve much improved results. However, same level of success was not obtained forsam ple 0 (JI) refer to the 1 sample and the amount of the DNA was lµL, 12 refer to the amount 0.5µL. So, by reducing the amount of the DNA the concentration was higher than (J). Samples 0 I and 0 were differentamount of the DNA; (01 and 0 used was 0.5µL and 0 was lµL DNA in 25, µL PCR reactions, respectively). M to Q have high concentration of the DNA.
23 Table 3:
Variable locales in the mitochondrial control region of black-capped (BCCH) and
Carolina chickadee (CACH). *indicates the samples have been successfully sequenced in both forward and reverse directions. The other samples were only successfully sequenced in reverse direction and are considered unreliable and thus discarded forfurther analysis.
Samples Sequences
A* AATAGCGCAAAAGAGCAAGTCGCGCTCGGGGCTrTAGGGGGAGTTCAAGTCCATTGAAGCCAATAACCT
B* AATAGCGCAAAAGAGCAAGTCGCGCTCGGGGCTTTAGGGGGAGTTCAAGTCCATTGAAGCCAATAACCT
C* TTTTGTGAGGGGCAAGGGAGATGGAGTTCATTGTCTGAGTTCCACCAATAGCGCAAAAGAGCAAGTCGTACTCG
D* TTCGTGAGGGCAAGGGAGATGGAG1T AGTTGGTCCATCAGCAAACGGTTGGGGTTACT ACAGTGGGGT AAAACG
F* CCTrTCGAGCGMGRGGRGTTTCCGATYTTAAGTGACGCTTGCGGCCTTTCGGGCTGGAGGT AGGA TC ATTTGGG
G* TTTTTTTTTGAGGAGCAAGGGAGATGGAGTTCAACAGGGSTTTAGGGGGAGTTTAAGACAGTTCTC
H* TTTTTTTTTTGAGGAGCAAGGGAGATGGAGTTCAACAAGTTATGGTCCTGAACCTTGAAGCCAATAACCTAA
TTTTTTTTGTGAGGAGCAAGGGAGATGGAGTTCACCAAGTTATGGTCCTAGCAAAGCGGTTGGGGlTACTACA I*
J* TTTTTTTTTGTGAAGAGCAAGGGAGATGGAGTTCCAGGATTACATAACTGGGGCACATGTGTGAAC
K* TrTTrTGAGGAGCAAGGGAGATGGAGTTCAACAAGTTATGGTCCTGATACAGCAAGTCGGGGTTTTT
L* TrTTTTGAGGAGCAAGGGAGATGGAGTTCAACAAGTTATGGGAAGTTCACAGCAAAGGGGTTTT
Mr AATNTTATGGGGCACAATTCTGCGGGCAGNCCNCCCTGAATGATGCCCNTCCANCCCTCNCATTATAGC
Nr CGNATCACAGCATACTAGCTGGGACGTCCTCACAGGATACAAGATGGACTCTTTTCATCCTGTCTATACG
Qlr TNGGTGGAGAGGTGGAGCTCCGCTGGATTTAACTrTCCNGGGTCTTC ACAGAT ACAGTGGA TCCGCCC
Qr TCTCCTCAGGGAGCCCGCCTCCGTCCAATTATAGCAGGTCGGATCACAGCATACTTAGTTGGGACGTCCTTCA
24 Table 4. Maximum Likelihood fits of 24 different nucleotide substitution models
r(CG} r{ (Mi 11 1!54.6 !lif!U ·526A3 11/a lOO HS UlS 0.25 rus 0.25 G.Cltl M4l U£& OJ>ll 6.166 OJ>ll ll.ll4l U66 Ml2 IU66 O.o.ll 0.f>l1 m 11 1!55J !!!19.t ·521.09n/a Fifa 1.99 o.1s1 0.201 <>.2!9 o.m M« M4 o.m n� u.m 0.1)4 � u.m OA\4 ll.m 0,044 O.J)l. (l.i\+l is mu m-0",4 ·526.74 Ml lW Z.0$ C1$ O.lS (US 0.25 M41 Mil 0.16& il.Jl.11 U&9 OA\41l).Cl(t o.169 OA\41 IU69 O.o41 01)1! m.i 18 mu i!l(l.9 ·5lM9 OJli5 Fl/a 2.1 0161 0.261 u� o.m Ml! Mla o.m 6.DU 0:.161 01)35 ll.ll41 U7l M38 D.m O.o.ll 0.()38 m+G 18 1261£ tll1.1 ·521'°9 n/i. lW w����� il.Jl.l��� -�� OA\4�� 0A\4 JC ;s ms.i l!l)J ·54154 n/1 n/1 UQWWU______m+IW l'9 1169.S 1113 -5l7 1).1)5, l.\'lll u�������ll.ll4l ��ll.ll41 ����� �:n l9 UBS U!&.7 ·51Ul n/1 �{1 !JS a.m 01s &.m o.m ilMl M19 o.m ilM! M54 0£141 &.641 o.m 0£141 ll.!61 o.o.u Ml9 JC+G 16 1276S lllSJ ·54!.49 n/1 100 uwwww•••••••••••• i!i'J3 � 1mh ms.4 ·517.H nfa Fl/• 2 o.m OlB fr•.m Q.144 M47 M39 0.111 l).CI(! 6101 Ot.141 OM! c.m 0Jl41 0.1!1 OJJ47 M!9 l(* M3� om ues Ml9 ll.t&i 0.{14> M>B 11«1'4.i l-0 mos mu ·51U! �ta w� u�������������� 11(� It USM llll.9 ·SU.� uwwww•••••••••••� T�3 lli'S3.C.. n mu ms.6 · 52M9 o.oo 200 139 0,243 �JS o.m 0114 Ml! M* 0.1-03 ll.0!6 0:111 M36 Ml6 o.m M36 0.102 0.{14! O.Ol4 urn B !Z'l6.l 111 ! ·51534 ·11/a !Ja UH OlS �1 '13 ill44 0112 l)JJ6 O.lll 0Jl17 0.199 QJ)l! l)J)61 1lll9 ll.li51 G.ll! 1.all Oi6B GTJ\'1 >t l�Lh !!17.9 -524.iii IJ.l! n/a 254 o.m o.1s D ..m C..144 M7 0.091 o !J,B5 O.il14 i:wn o.m ooo M'.!7 �.01s o�E filfto{i * BOLi ma.1 ·515.B 11ja 2b£l 1..1)3 o.m Ol8 {I.Bl 0114 0.018 Mo G.111 Ml6 tu O.lllS l!ll63 -0.141 0,06 o.m Mll 0£•oB GiR<{i ull9.t mo.1 -s1us llJt 200 154 014� ug 1)1" U44 0 M1 0.0:91 0 013S Mt4 ll.tm -0181 000 Oll97 -0.Dla il»}li Abbreviations: GTR: General Time Reversible; HKY: Hasegawa-Kishino-Yano; TN93: Tamura-Nei; T92: Tamura 3-parameter; K2: Kimura 2-parameter; JC: Jukes-Cantor. 1. Nei M. and Kumar S. (2000). Molecular Evolution and Phylogenetics. Oxford University Press, New York. 2. Tamura K., Stecher G., Peterson D., Filipski A., and Kumar S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution30: 2725-2729. Disclaimer: Although utmost care has been taken to ensure the correctness of the caption, the caption text is provided "as is" without any warranty of any kind. Authors advise the user to carefullycheck the caption prior to its use for anypur pose and report any errors or problems to the authors immediately (www.megasoftware.net). In no event shall the authors and their employers be liable forany damages, including but not limited to special, consequential, or other damages. Authors specificallydisclaim all other warranties expressed or implied, including but not limited to the determination of suitability of this caption text for a specific purpose, use, or application. 25 Figure 5: Sequence alignment was done using CLUST AL W implemented in the phylogenetic analysis computer software package Mega 7.0 (Kimura 2016). Included in the comparison are sequences retrived from genbank for black-capped (BCCH) (JX164153.l_PA and JX164178_PA 1) and mountain chickadees (MOCH) (DQ989104. l_PG and DQ989 103.l_PG). In all retrieved reference sequences, the part preceding the underscore is the Genbank accession number). 26 G H D c L �F ------BCCH ------MOCH 0.1 Figure 6: The phylogenetic analysis of the sampled individuals in the current study and the retrieved CACH sequences using the MOCH sequences as outgroups using Maximum Likelihood (ML) method. Prior to ML analysis. Prior to ML analysis, Mr. ModelTest implemented in Mega 7.0 (Kimura 2016) was used to estimate the best molecular evolution model for the target mtDNA gene region. (H, L, G, D, C, F, I, K) refer to the samples were collected from Carlyle lake. (A and B) refer to the samples were collected from Ramsey "JXl 64153.1_P A" referto Black-capped chickadee. DQ989104.l_PG referto Mountain chickadees (MOCH) and these were collected from NCBI GenBank. 27 O I S .Monticello . Tayiorvil le > .c.rtinviD• .utdlfWld � .alney BCCH • Hybrids .Bellevllkt � CACH Figure7: The map of the contact zone "overlapping" in Illinois. Between Chickadees in Ramsey County in the northside are considered to be BCCH while those from the Carlyle Lake area in the Southside are considered to belong to CACH. 28 Discussion Several molecular models have been used to understand and determine genetic interactions of hybrid species among chickadee species and with other birds because hybridization occurs occasionally more than 9% of birds species (Grant & Grant 1992). The rate of hybridization is dependent on both environmental and genetic influences, and can lead to a large number of possible genetic outcomes. To understand how hybridization occurs between two species, it is significant to consider genetic and chromosome distinction among species. Also, hybridization in Parid species has been studied within both North America and European species (reviewed by Curry 2005, Curry et al. 2007). In this study, I observed that most of the samples had a high expression of their mtDNA shown in (Figure3). In this Figure, sample (G) presented the lowest concentration among all the samples (24ng/µL). Sample (E) presented the highest concentration (259ng/µL). Both samples were collected from Carlyle Lake, suggesting that the mtDNA concentration depended on the quality of the samples. For example, samples I & L were collected fromthe same area and were closest in term of their concentration among all the samples (184.026 ng/µL and 184.027 ng/µL) (Figure 3). By comparison, most of the samples collected fromColes County did not amplify well using PCR experiment, and that refers to the quality of the samples because their DNA quantification showed that they had a low concentration (Figure 3). The results of the sequencing and gene editing showed that the samples collected from Ramsey likely had the same sequences (Table 3). From looking at this result, I inferred that all the samples had strong genetic relationship. On the other hand, the 29 samples collected from Carlyle Lake had different mtDNA sequences than other samples such as Ramsey species. For a clear identification, the mtDNA sequences of the samples collected from Ramsey did not exactly match the black-capped chickadees' sequences that were a viable from NCBI, but they were much closer than others. Likewise, black-capped sequences that were collected fromNCBI were different than the Carlyle Lake's samples and these appeared to be Carolina Chickadees because the variations were within their fragments of nucleotide sequences (Figure5). The phylogenetic tree in my study was based on the mtDNA of the hybridization data within NCBI data as a control region of my data. The differentiations among these results presented, based on mtDNA hybridizations, could probably be explained by the taxon from Ramsey (A&B) were in the same nodes and that referred to their differences fromCarly le Lake (H, L, G, D, C, F, I, K). But all the group were in the same clades, and that expressed that they were much closer than NCBI data (Figure 6). However, DQ989104.l_PG (BCCH) and JX164153.l_PA (MOCH) are sister groups because according to their mtDNA sequences they were in different branches than the samples that were collected from contact zone in Illinois. Finally, the contact zone in Illinois compared with other contact zones between Black-capped and Carolina chickadees may determine if my results could be developed to the species zones where they move towards contact. Many studies have been done on BCCH and CACH across their extensive contact zone, which extends from the East coast into Kansas. According to Sattler, (2000), experiments were done in the hybrid zone, where and determining if hybrids existed was 30 not easy. In this study, they sampled 268 individual chickadees which had different characters' diagnostic of each species. One of the results that they obtained was that, only the male hybrid displayed a heterozygous pattern forthe marker. The end results showed that the birds had something in common. Research also showed that some hybrid zones behave like semi-permeable membranes due to the factthat they allow some genes to enter and restrict movement of others (Sattler, 2000). In this study, I observed that Carolina Chickadee genotypes were likely dominant over Black-capped chickadees in the contact zone in Illinois because our samples showed noticeable genetic differences to Black-capped chickadees. Further, we noticed that moving to the north of the contact zone. Thus, our results showed some evidences of genetic mixing between Black-capped and Carolina chickadees. This was not surprising because according to their distribution, hybridization occurs and near their contact zone (Lack 1969). However, our results were surprising when all the data collected from hybrid zones showed Carolina chickadees were dominant over Black-capped chickadees. The data collected from Ramsey (Figure?) were much closer to BCCH because they were close to the north side of the contact zone in Illinois. Also, the data collected from Carlyle Lake were frequently closest to other birds, likely CACH, because they were in different branches in the phylogenetic tree and that explained that they were not probably Black capped chickadees (Figure 6). 31 Conclusion Hybridization can be beneficial or detrimental to the offspring hybrid depending on gene mutations and the effect of these mutations on the organism's ability to succeed in the given environment. In addition, Hybridization can lead to a large number of possible genetic outcome, which will affect the way the organism interacts with its environment and how it will continue to survive. To understand how hybridization occurs among any species, it is more important to consider their genetic uniqueness in order to identify whether a hybrid species is a new species altogether or merely a variation in phenotype expression becomes clearer such as such as Cytochromes. The analysis of DNA, b-sequence, chromosomes, and morphology that separate analysis of each attribute clearly shows the association of any species. In this study, afterthe analysis of genetic markers was conducted, we concluded that, all of the specimens were collected from the overlapping zone were within the hybridization range because the samples were collected from the contact zone in Illinois showed Carolina Chickadees were dominant over Black-capped chickadees. Moreover, the samples that had clear evidences of mixed species in the contact zone were genetic mixing occurs within this contact zone, and all but two were much closest to black-capped chickadees. Finally, the contact zone in Illinois compared with other contact zones between Black capped and Carolina chickadees will detennine if my results could be developed to the species zones where they move towards contact. 32 Literature Cited Adams, R., & Burg, T. 2015. Gene Flow of a Forest-Dependent Bird across a Fragmented Landscape. PLOS ONE, 10(1 1), e01 40938 Braun, M. J ., and M. B. Robbins. 1986. Extensive protein similarity of the hybridizing chickadees Parits atricapillus and P. caroli- nensis. Auk 103:667-675. Brewer, R. 1963. Ecological and reproductive relationships of black-capped and Carolina chickadees. Auk 80:9-47. Bronson, C. L., Grubb, T. C., & Braun, M. J. 2003. A Test of The Endogenous and exogenous selection hypotheses forthe maintenance of a narrow avian hybrid zone. evolution, 57: 630-63 CmTy R.L. 2005. Hybridization in chickadees: much to learn from familiar birds. The Auk 122:747-758. Curry R.L., Rossano L.M. & Reudink M.W. 2007. Behavioral aspects of chickadee hybridization. in: Ecology and behavior of chickadees and titmice: an integrated approach (Ed. by K. A. Otter), pp 95-110. Oxford: Oxford University Press Delft, S. 2015. The Analysis of Black-capped, Boreal, and Mountain Chickadee Population Trends across North America in Correlation with Changing Climate. Chickadee population trends: 2-1 1 Director of DNA Sequencing: Alvaro Hernandez Ph.D.Assistant Director of DNA Sequencing: Chris Wright Laboratory Supervisor: Leslie D. Benson 2017 33 Elgvin, T., Hennansen, J., Fijarczyk, A., Bonnet, T., Borgr, T Stein A. Saether, Kj etll L. Voj e and Glenn-Peter Saeyre. 201 1. Hybrid speciation in sparrows II: a role for sex chromosomes?. Molecular Ecology, 20, 3823-3837 Engler, J., Twietmeyer, S., Secondi, J., Elle, 0., & Hochkirch, A. 2015. Analytical limits of hybrid identificationusing genetic markers: an empirical and simulation study in Hippolais warblers. 10.11011026781: 1-12 Enstrom, Patrick C., and Eric K. Bollinger. 2009 Stability in distributions ofblack capped, Carolina, and aberrant chickadee song types in Illinois The Wilson Journal of Ornithology 121.: 265-272. Eroukhmanoft� Fabrice, Richard I. Bailey, and Glenn-Peter Saetre. 2013. Hybridization and genome evolution, I: The role of contingency during hybrid speciation . Current Zoology 59.5: 667-674. Focht, S. 2013. Territorial response of Carolina chickadee (Poecile carolinensis) to playback of Carolina chickadee and black-capped chickadee (Poecile atricapillus) son. School of Environment and Natural Resources. M. thesis Gill F.B., Mostrom A.M. & Mack A.L. 1993. Speciation in north American chickadees: I. Patterns of mtDNA genetic divergence. Evolution. 47: 192-212. Gill F.B., Slikas B. & Sheldon F.H. 2005. Phylogeny of titmice (Paridae): II. Species relationships based on sequences of the mitochondrial cytochrome-b gene. The Auk. 122 :121-143. Grant P.R. & Grant B.R. 1992. Hybridization ofbi rds species. Science 256: 193-1 97. 34 Grava, A., Grava, T., Didier, R., Lait, L., Dosso, J . , & Koran, T. M Burg and K. A otter. 2012. Interspecific dominance rel ationships and hybridization between black capped and mo untain chickadees . B ehavioral Ecology. 23, 566-572. Haff, B., & Price , T. 2014. Cli mate Change: A Hybrid Zone Moves North. CmTent Biology, 24 , 230-232 Hennansen, Jo S., Fredrik Hass , Cassandra N. Trier, Richard I. Balley, Alexaner J. Nederbragt, A. Marzal, and Glenn-Peter Saeter. 2014. Hybrid speciation through sorting of parental incompatibilities in Italian sparrows. Molecular ecology 23.23: 583 1 -5842. Joshi , M., & Deshpande , J. 2011. Polymerase chain reaction: methods , principle and Application. International Journal of Biomedical Research , 1-6. s Kimura M. (20 16). A simple method fore timating evol utionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16:1 1 1-120. Lack D. 1969. Tit niches in two worlds; or homage to Evelyn Hutchinson. The American Naturalist. 103 :43-49. Mallet, James. 2007. Hyb1id speciation. Nature 446.: 279-283. s Michael , A.,M cq uillan. And Amber, M. (2015). Differential effectof climate and peci es interactions on range limits at a hybrid zone: potential direct and indirect impacts of climate change. J ournal of Biological Sciences and Ecol ogy. 5: 5120-5 137 Genetic lVI iller, M., Lipshutz, S., Smith, N., & Bermingham , E. 20 14. and phenotypic characteri zation of a hybrid zone between polyandrous No1ihern and Wattled Jacanas in Western Panama. BMC Evolutionary Biology, 1 4(1). 35 Nolte, Ame W., and Diethard Tautz. 2010. Understanding the onset of hybrid speciation. Trends in Genetics 26.2: 54-58. Olson, J. R., Cooper, S. J., & Swanson, D. L. 20 1 0 . The Relationship of Metabolic Perfom1ance and Distribution in Black-Capped and Carolina Chickadees. Physiological & Biochemical Zoology, 83: 263-275. Reudink, M. 2005. Extrapair paternityand mate choice in a chickadee hybrid zone. Behavioral Ecology, 17: 56-62. Reudink, M., Mech, S., Mullen, S., & Curry, R. 2007 . Structure and dynamics of the hybrids zone between capped Chickadee (Poecile atricapillus) and Carolina Chickadee (P. carolinensis) have ... recent movement of the chickadee hybrid zone in southeastern Pennsylvania. The Auk 124, 463-478 Rhcindt, F., & Edwards, S. 20 l l. Geneti c Introgression: An Integral but neglected component of speciation i n birds. The Auk, 1 28(4) , 62 0-632 . Sattler, E. D. 1996. The dynamics of vocal, morphological and molecular interaction between hybridizing Black-capped and Carolina Chickadees. Ph.D. dissertation, University of Maryland, Amherst, MA. Sattler, Gene D., and Michael J. Braun. 2000. Morphometric variation as an indicator of genetic interactions between Black-capped and Carolina chickadees at a contact zone in the Appalachian Mountains. The Auk 117.: 427-444. Sattler, G ene D., P atricia Sawaya, and I'vl iclr ncl J. Braun. 2007. J-\n assessment of song admixture as an indi�akir of hybridization in Black-capped Chickadees (Poccile atricapillus) and Carolina Chickadees (P. carolinensis). The Auk 124.: 926-944. 36 Sawaya, P. L. 1990. A detailed analysis of the genetic interaction at a hybrid zone between the chickadees Parus atricapillus and P. carolinensis as revealed by nuclear and mitochondrial DNA restriction fragmentle ngth variation. Ph.D. diss. University of Cincinnati, Smith, S. M. 2010. Black-capped Chickadee (Poecile atricapillus). In The Birds of North America, no. 39 (A. Poole, P. Stettenheirn, and F. Gill, Eds.). Philadelphia: The Academy of Natural Sciences; Washint,rton, DC: The American Ornithologists' Union. Sneath P.H.A. and Sokal R.R. 1973. Numerical Taxonomy. Freeman, San Fran cisco. Tamura K., Stecher G., Peterson D., Fil ipski A.,a nd Kumar S. (20 13). MEGA6: Molecular Evolutionary Genetics Anal ysis version 6.0. Molecular Biology and Evolution30: 2725-2729. Tamura T., Dudley J., Nei M. & Kumar S. 2007. MEGA4: Molecular evolutionary genetics anal ysi s (MEGA) softwarev ersion 4.0. Molecular Biology and Evolution. 24: 1596 1 599 Tanner, James T. 1952. Black-capped and Carolina chickadees in the southern Appalachian mountains. Auk 69:407-424. Taylor, S., C uny, R., White, T., Ferretti , V., & Lovette, I. 2014. Spatiotemporally consistent genomic signatures of reproductive i solation in a moving hybrid zone. Evolution, 68, 3066-308 1. Trier, Cassandra N . , et al . 20 14. Evidence for mi to-nucl ear and sex-linked reproductive barriers between the hybrid Ital ian sparrow and its parent speci es . PLoS genetics 1 0. : cl004075. 37 Walsh, J., W.G. Shriver, B.J. Olsen, K.M. O'Brien, and A.I. Kovach. 20 15. Relationship of phenotypic variation and genetic admixture in the Saltmarsh-Nelson's sparrow hybrid Zone. Auk. 132: 704-716. 38