Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. ytmtcBotany Systematic n rn 90 mt 90 asivc ta.19;Winner 1990; al. et 2007). Yatskievych Simpson Alt 1980; and 1920; Smith (Weatherby 1960; century Grant past and the over study taxonomic notwith- diversity fern distributed global 2009). standing, species to al. contribution sister et minor (Windham 250 globe rather its the Its than of of areas more success drier the the throughout includes with which sharply group, contrasts accounts geographic narrow This only relatively a today range. inhabiting taxa genus of diverged handful the Yet, a have age, for 2009). sensu to Pryer considerable and clade estimated its (Schuettpelz despite ago hemionitid is years and the million 26 (2009), of about al. members et other Windham all to sister Tbe1.Mr hnhl etr asdbfr second a before passed century a half taxon, than More 1). (Table as (1824) Kaulfuss by published was al. genus, et warranted. distinct clearly Eiserhardt is a 1990), 1998; as al. et treatment (Yatskievych Rollo their and Among phyloge- and isolated 2011) (Gastony 2007). rather position a the al. occupy netic of et ferns part these (Schuettpelz different cheilanthoids, xeric-adapted altogether phylogeny the an Pteridaceae within in resolved lineage, now cheilanthoid are America North Pityrogramma aeo ulcto etme 2 2015 22, September publication Taxonomists of Plant Date of Society American 10.1600/036364415X689366 the DOI by 2015 Copyright © ySih(90 nhsteteto h eu.Sih however, Smith, genus. the of accepted treatment later his in and (1980) (1962), Smith Howell by by described subsequently of varieties as entities (var. four warrant species these to as constant little segregation too or their themselves in slight four too either noted 113) p. extremes (1920, Weatherby group, them called species who distinct and as (1913), treated Maxon were by Both 1879). (Eaton recognized n rn 16)rcgie h aefu aa u elevated but taxa, and four (var. same varieties the two recognized (1960) Grant and h is ftevrostx o srbdto ascribed now taxa various the of first The lhuhoc lcdi h atoia trdi genus pteridoid pantropical the in placed once Although .pl ida pall P. niisaeuulyrcgie ta nrseii ee.I eetyas smn sfv useishv enacie to ascribed been have various subspecies the five however, as cryptic, many generally as are years, differences recent In the level. Because infraspecific chemotypes. an flavonoid at and recognized cytotypes, usually morphotypes, are entities of array diverse a eietf i eeial n opooial itntdpodlnae,ec fwihi eetetda pce.Anwspecies new A species. a as treated here is which of each lineages, diploid distinct morphologically and ( genetically described is six identify in we delimitation taxonomic to approach only sltdwti h ei-dpe hiatodcae lhuhseispo oprdt t itrgroup, sister its to compared species-poor Although clade. cheilanthoid xeric-adapted the within isolated .v scosa vi P. triangularis 1 Abstract Keywords eateto oay ainlMsu fNtrlHsoy mtsna nttto,P o 71,Washington, 37012, Box PO Institution, Smithsonian History, Natural of Museum National Botany, of Department nfe praht aooi eiiaini h enGenus Fern the in Delimitation Taxonomic to Approach Unified A yngam triangularis Gymnogramma ” .pallida P. u rudta hywere they that argued but , Pentagramma 21) 03:p.629 pp. 40(3): (2015), .Affhtxn( taxon fifth A ). h odakadslebc en fwestern of ferns silverback and goldback the , — epciey ntefrtfcsdsuyo the of study focused first the In respectively. , — h aieglbc n ivrakfrso etr ot mrc,cmoigtegenus the composing America, North western of ferns silverback and goldback native The ,var. .glanduloviscida P. aionafoitcpoic,glbc en,lwcp ula ee oyliy ivrakfrs ooa desert. Sonoran ferns, silverback polyploidy, gene, nuclear low-copy ferns, goldback province, floristic California a encniee ufcetydvrett arn eonto sadsic pce.I hssuy etk unified a take we study, this In species. distinct a as recognition warrant to divergent sufficiently considered been has viscosa viscosa 2 eateto ilg,Dk nvriy uhm ot aoia278 .S A. S. U. 27708, Carolina North Durham, University, Duke Biology, of Department a entefcso considerable of focus the been has rcSchuettpelz, Eric n var. and – 644 ,var. ” .triangularis P. eteb hscoet treat to chose thus Weatherby . n he e obntosaemd ( made are combinations new three and ) maxonii pallida var. yngam triangularisGymnogramma iyormatriangularis Pityrogramma iyormatriangularis Pityrogramma “ Pentagramma eaae ycharacters by separated 3 uhrfrcrepnec ([email protected]) correspondence for Author viscosa ,andvar. )tospecies( var. omnctn dtr akP Simmons P. Mark Editor: Communicating 1,3 “ itito ouba203 .S A. S. U. 20013, Columbia of District a formally was , semipallida Pentagramma distinguishable ahenM Pryer, M. Kathleen obnn pr tde ihpyoeei nlsso lsi n ula sequences, nuclear and plastid of analyses phylogenetic with studies spore Combining . Pentagramma Pentagramma pallida .v scosa vi P. (Pteridaceae) )was .Alt ). is 629 .maxonii P. ihasnl etr( = subsp. (M designated each letter pallida P. total), single in and a subsp. (six Winner with in morphotypes sparse as (sensu 2007) is subspecies Simpson it and lamina, species the aforementioned obscure to as rebmanii of dense farina so adaxial is the while however, farinose; white opooia,ctlgcl n htceia tde (Alt studies phytochemical and cytological, morphological, with confusion avoids ultimately conclusions. taxonomic and their taxonomicour entities in uncertain these (1960) the of indicate Grant to status and serves Alt uninomials, of of use precedent the following also, triangularis P. pallida ua n hs fsubsp. of those and subsp. of dular surfaces leaf adaxial The glabrous. r l bxal ht aioe u ifri hi dxa sur- adaxial their subsp. in differ Like taxa but remaining faces. farinose, white The abaxially glabrous. all adaxially are and farinose yellow otrcn ramn Wne n ipo 07,teleaves the the Following 2007), surfaces. Simpson and leaf of (Winner or powdery adaxial treatment glands recent of on of most absence exudate color or resinous and presence a distribution the and the char- (farina) on excretions as relied have such America North acteristics western of ferns verback than an (rather described subspecies of (2007) subspecies Simpson as (fifth) additional and latter Winner the Recently, varieties). of extremes phological eonzdjs w species, two just recognized atrwt orvreis(var. varieties four maxonii with latter Tbe1.Te olwdSih(90 nrcgiigtospe- two recognizing in genus, (1980) ( new Smith followed cies a They to 1). them (Table of transferred cytogenetically (1990) remainder and al. et the morphologically from be isolated to America North Although rvostxnmccasfctoso h odakadsil- and goldback the of classifications taxonomic Previous idn h aieglbc n ivrakfrso western of ferns silverback and goldback native the Finding etgam triangularis Pentagramma 2 n ihe .Windham D. Michael and .pallida P. ,andvar. and semipallida hogotti ae,w ilgnrlyrfrt the to refer generally will we paper, this Throughout . ;R= , .rebmanii P. .t a u ris ar gul ian tr P. Pentagramma subsp. .triangularis P. and semipallida ;T= triangularis .triangularis P. ,and viscosa .triangularis P. .viscosa P. subsp. a entesbeto numerous of subject the been has al 1). Table ; .triangularis P. .Ti sdn o ipiiy but simplicity, for done is This ). Pentagramma subsp. subsp. viscosa .pallida P. ,subsp. .triangularis P. triangularis n rae h ormor- four the treated and ) ). rebmanii Pentagramma Pityrogramma rebmanii 2 Pentagramma triangularis r viscid. are subsp. r phylogenetically are , semipallida and subsp. .triangularis P. r ohadaxially both are ;S= ,var. (subsp. .triangularis P. maxonii triangularis encompasses Yatskievych , r abaxially are .triangularis P. maxonii Pentagramma Pentagramma viscosa sadaxially is rebmanii ,and r glan- are .p li a id ll pa P. ;V= ,var. ;P= ,the ). Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. prnimwsslce rmec pcmnadtaserdt small unopened) a (but to transferred mature and single specimen each a from boom needles, selected 7.5 was dissecting MZ sporangium Leica and a Using scope 1). dissecting (Appendix counts chromosome for vouchers i akdmtr prni rwr nvial o td) swell as study), 11 for and unavailable specimens type were 10 or remaining from sporangia (the individuals as mature sampled the lacked of six 40 from examined were spores ao curda ela rmaesweemr hnoetxnoccurred. taxon one than single more a where where areas Arizona, areas from from California as including sampled well Baja We as plus genus, Mexico. occurred A., taxon in the S. Sur U. of California the Baja in range and Utah and the Oregon, were Nevada, of Collections California, above). most defined mul- throughout (as including morphotype made analyses, each phylogenetic of our exemplars for tiple selected was 1) (Appendix Nuclear Nuclear Plastid Plastid Plastid 40 [Volume BOTANY SYSTEMATIC (1980) Smith (1960) Grant and Alt (1920) Weatherby (1913) Maxon (1879) Eaton (1824) Kaulfuss 630 Plastid Plastid Plastid Plastid Plastid Plastid Plastid ferns. these for classification revised summa- a We in findings individuals. our polyploid rize of and origins delimitation, the infraspecific previ- and investigate test specific lineages, of we ploidy, hypotheses diploid ous infer distinct to genetically identify counts then chromosome by calibrated ments relation- within phylogenetic nuclear molecular- reveal employ a to ships sequencing we Simpson from DNA study, evaluated plastid and this be and In to Winner perspective. yet has phylogenetic 2003; genus the 1990; Yatskievych al. 2007), et and Yatskievych 1985; 1979; and Windham al. al. Wollenweber et et Wollenweber 1980; Wollenweber 1981; Dietz Smith 1971; and al. Wollenweber et 1980; Smith Smith 1960; Grant and ated: yngam yngam iyormaPtrgam iyormaPtrgam etgam etgam Pentagramma Pentagramma Pentagramma Pityrogramma Pityrogramma Pityrogramma Pityrogramma Gymnogramma Gymnogramma pr onsadMeasurements and Counts Spore Table Sampling Taxonomic Table segment segment t ------tt ------= trnG-R trnG-R trnG-R trnG-R atpA atpA atpA atpA atpA atpA gapCp gapCp triangularis .Apiiainadsqecn rmr sdi hssuyof study this in used primers sequencing and Amplification 2. abbrevi- are epithets infraspecific and Specific America. North western of ferns silverback and goldback the of treatments taxonomic Key 1. ou rmrUiiy(ieto)Sqec (5 Sequence (direction) Utility Primer Locus einEAP87 eunig(ees)CTTCGAAGTCC cutpl ta.2006 al. et Schuettpelz 2006 al. et Schuettpelz 2006 al. et Schuettpelz 2006 al. et CATCTCCCGGATATGCTTCTCG Schuettpelz CGAGAAGCATATCCGGGAGATG ATTGTATCTGTAGCTACTGC Amplification/sequencing GGYAAGATTGCTCAAATACCAG (reverse) Sequencing (forward) Sequencing ESTRNR46F (reverse) Sequencing ESATPA877R (forward) Sequencing ESATPA856F ESATPA557R Amplification/sequencing ESATPA283F region region ESATPF412F region region region region einTN6RSqecn rvre CGATGACGAC aaigme l 2007 al. et 2007 Nagalingum al. et Nagalingum GCGGGAATCGAACCCGCATCA TGATGCGGGTTCGATTCCCG Amplification/sequencing (reverse) Sequencing (forward) Sequencing TRNR22R TRNG63R TRNG43F1 region region region einTN1 Amplification/sequencing TRNG1F region sotcopy) (short sotcopy) (short Pentagramma t ; var. var. aeil n Methods and Materials v = vt vv viscosa tt tt — oa f46 of total A ; SAC1R Amplification/sequencing ESGAPCP11R1 SAC81Amplification/sequencing ESGAPCP8F1 m noprtn pr measure- spore Incorporating . = — maxonii Pentagramma oadi h neec fploidy, of inference the in aid To ; p Pentagramma = pallida t t pcmn htwere that specimens var. var. var. var. ; (reverse) (forward) (reverse) (forward) (reverse) (forward) s mt pp p p pp pp vvt tt = semipallida individuals ; r var. var. = Pentagramma rebmanii mt tt aaigme l 07;adasgeto h nuclear the of segment a and 2007); al. et Nagalingum xn the exon, ee cutpl ta.20) h plastid the 2006); al. et Schuettpelz gene; the the of portion a niey n ato xn1;Sheteze l 08.Ec 20 Each 2008). al. et Schuettpelz 11; 8 exon introns of 8, part exon and of entirety, part (comprising gene attobsso h first the of bases two last h oyeaecanrato PR:teplastid using the amplified (PCR): separately reaction were chain loci polymerase Three the protocol kit 2007). published mini Pryer previously plant and a DNeasy (Schuettpelz following the was California), using Valencia, DNA material genomic (Qiagen, leaf analysis, silica-dried phylogenetic from for extracted selected individuals 46 the ecinicue h olwn:1×PRbfe wt . MMgCl mM 1.5 (with buffer PCR × 1 following: the included reaction ld irmtr h enadsadr eito eecluae for calculated were deviation standard and specimen. mean each measured with calibrated The micrometer. were was which slide diameters 2004), al. a spore et (Abramoff Individual 1.41 version spores ImageJ taken. normal using of were scope. subsample present) dissecting a sporan- of 12.5 (when (per measurements counts MZ and spore obtained, malformed Leica were and gium) a normal images, EOS on digital Canon mounted these the a From camera spread using digital to captured drop then XSi the were Rebel preparation on remov- placed the carefully After of was forced glycerol. Images slip the was spores. cover into sporangium a released debris, Each spores any its slide. ing and microscope needles glass the with a open on glycerol of drop 200 Tbe2,ad1 and 2), 0.5 (Table Massachusetts), Holliston, Scientific, (Denville merase mlfctos yl lnain eedcesdt . i;for step min; elongation 1.5 final a to and decreased min) were 2 both elongations for For cycle 71°C min). amplifications, and for 5 sec, (95°C for 30 cycles (71°C for elongation 45°C and sec, annealing, denaturation, 30 35 by followed the N slto,Apiiain lnn,adSequencing and Cloning, Amplification, Isolation, DNA atpA-trnR μ atpA ; ahdT;100 dNTP; each M TTCCYCTGCTC cutpl ta.2008 al. et Schuettpelz GTATCCCCAYTCRTTGTCRTACC TCAGTACGTCG cutpl ta.2008 al. et Schuettpelz ATYCCAAGYTCAACTGGTGCTGC TTCTAAGTGC aaigme l 2007 al. et Nagalingum CTATCCATTAGACGATGGACG CGTTGTATGA aaigme l 2007 al. et Nagalingum GCGGGTATAGTTTAGTGGTAA TTGTCATCATGC cutpl ta.2006 al. et Schuettpelz GTATAGGTTCRARTCCTATTGGACG 2006 al. et Schuettpelz GARCARGTTCGACAGCAAGT g . = glanduloviscida trnG-trnR einetie niiildntrto tp(5Cfr2min) 2 for (95°C step denaturation initial an entailed region t var. var. var. var. negncsae,adtels w aepiso the of pairs base two last the and spacer, intergenic mt vt st tt atpF μ epaeDAeut.Tetemccigpormfor program thermocycling The eluate. DNA template l negncsae,adtefrtbs fthe of base first the and spacer, intergenic ee the gene, asivc tal. et Yatskievych . μ /lBA 0uism hieTqDApoly- DNA Choice-Taq units/ml 50 BSA; g/ml subsp. subsp. subsp. subsp. ′ trnG (1990) o3 to trnG-R atpF-atpA ′ Citation ) xn the exon, mt vt st tt einand region negncsae,the spacer, intergenic inradSimpson and Winner trnG-R trnG – 0adeos9 exons and 10 t subsp. subsp. subsp. subsp. subsp. 20)Ti study This (2007) gapCp nrn h second the intron, atpA ein(opiigthe (comprising region mm vv s rr tt ein(comprising region gapCp sotcp)gene copy) (short μ Meachprimer — sotcopy) (short – o ahof each For 0i their in 10 atpA trnR μ PCR l gapCp g - gene; gene, trnG trnR 2 ); Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. itnet t ers eaie(cutpl ta.20;Shetezand Schuettpelz 2007; al. et (Schuettpelz relative nearest genetic its limited to the set to distance Due data above). within plastid (as combined analyzed divergence a and con- trees, constructed topological also plastid no was replicates single-region was 200 the there and between As respectively. each) flict each), replicates replicates RAS RAS (10 in maximum (two replicates 1985) via 1,000 analyses (Felsenstein assessed with likeli- bootstrapping was PAUP*, Parsimony likelihood for Support maximum 2,000. replicates; swapping. and to (RAS) parsimony reduced branch sequence were these TBR addition hood, random and heuris- 10,000 a strategy used included analyses search maximum All criteria. equally-weighted tic likelihood both maximum using and 2002), parsimony (Swofford 4.0b10 PAUP* other and 3). Akaike models, Table the in Best-fitting provided and 1974). are tree statistics, Akaike alignment BIONJ-JC fixed (AIC; a criterion 2008; (Posada using information 0.1.1 2003), sequence jModeltest TreeBASE Gascuel in of and set models in data Guindon possible each deposited 88 for identified of were was best-fitting evolution The alignments 16786). resulting number (study exclusions 2004) The character (Simmons no required. 2005); similarity Maddison were on and (Maddison based 4.08 aligned MacClade in manually were region each ecin hticue:1×KMbfe 01MKl .3MCaCl M 0.03 KCl, M (0.1 buffer KCM × 1 20 included: in that performed were reactions Transformations 4°C. at overnight incubated were 0.5 and volumes reagent recommended manufacturer the Madison, (Promega, following vectors Wisconsin) pGEM-T into ligated successfully were cations Plastid 631 PENTAGRAMMA IN DELIMITATION TAXONOMIC AL.: ET SCHUETTPELZ on visualized were reactions amplification these of gels. results agarose The increased was 55°C. temperature annealing to the amplifications, gene copy) (short 2015] osnu.Tersligallcsqecswr eoie nGenBank in rule deposited below. analyses majority the were in via used sequences were shortest combined and allelic 1), allele,(Appendix were the resulting an sequences in The of colony representative consensus. present constituent be to ignored) its considered was and were tree consensus) mini- (singletons strict Each one computed. (or clade was than consensus inclusive more strict If mally a recovered, swapping. was parsimony branch tree TBR shortest maximum and heuristic replicates random- 100 a with addition-sequence 2002), (Swofford 4.08 4.0b10 and PAUP* MacClade approach. in conducted 2005) in simple was analysis aligned Maddison relatively were a sequences and colony using (Maddison all sequences individual, colony each of For pools the the For below. from used were and 1) nuclear (Appendix GenBank into deposited were lsi obnd2903 .%TPM1uf 0.2% 34 2,970 Nuclear combined Plastid Plastid cutpl ta.20) eunigpiesaepoie nTbe2 The plastid 2. the Table in for provided sequences are assembly 2007; consensus primers read sequencing Pryer for resulting 2008); as and 80°C al. well (Schuettpelz at et protocols as held Schuettpelz established Sequencing, then followed enzymes. and editing, the min inactivate and 15 to for phosphatase min 37°C alkaline tube. 15 shrimp reaction at each incubated of to unit were directly Clean-ups 1 added and Ohio), Cleveland, I Corporation, exonuclease (USB of units 5 using sequencing. and based clean-up copy for this reactions selected target were to these size) us allowed on clones secondary of of screen 13) preliminary results a = 2008; (mean al. The the et nine min. least to At 1 corresponding gel. agarose of amplifications an time on vec- picked, visualized elongation the again within cycle individually were sites overnight. priming a were M13 and 37°C the plate utilizing tor but at each before, as incubated executed 20 from and in were colonies amplified (ampi- secondarily selective Plates white and a re-suspended, plate. on 12 spread LB and least rpm) At X-gal) 200 where at ice, plus (shaking to min cillin returned 60 then for for and 37°C ice min, at on 1 reaction for ligation 42°C 180 and at heat-shocked buffer min, the 30 with together incubated were .5MMgCl M 0.05 h he igergo lgmnswr nlzdidpnetyin independently analyzed were alignments single-region three The h C rdcsrsligfo the from resulting products PCR The euneAinetadPyoeei Analysis Phylogenetic and Alignment Sequence Table h rmr lsi n eodr ula mlfctoswr cleaned were amplifications nuclear secondary and plastid primary The μ fL rt a de.Tetasomtoswr hnincubated then were transformations The added. was broth LB of l atpA trnG-R gapCp gapCp .Dtst sdi hssuyof study this in used Datasets 3. ein1881 .%TPM1uf 0.1% 16 1,828 region 2 ,10 ), ein1121 .%HKY 0.3% 18 1,142 region aae oa hrcesVral hrcesMsigdt etftigmodel Best-fitting data Missing characters Variable characters Total Dataset sotcp)sget761048 V G + I + TVM 4.8% 120 776 segment copy) (short sotcp)gn,allcsqecswr is extracted first were sequences allelic gene, copy) (short μ Pentagramma O1 el,ad0.5 and cells, TOP10 l n h eaieylrephylogenetic large relatively the and “ short μ ’ gapCp rtcl u sn 5 fthe of 25% using but protocol, s C rdc.Lgto reactions Ligation product. PCR l ” Pentagramma oyo h ee(Schuettpelz gene the of copy μ iainrato.Tecells The reaction. ligation l sotcp)rgo amplifi- region copy) (short μ atpA C ecin prepared reactions PCR l — h eune from sequences The and . trnG-R regions 2 ,and μ l eCTto Bcmne l 01 n erfrne pcmndata specimen browser-based georeferenced extent the 2015). and The March (www.gbif.org; 24 2011) Facility using accessed 2012). Information Biodiversity al. taxon Global (IUCN the et each through criteria obtained (Bachman for and tool calculated categories GeoCAT was list occurrence red of IUCN the to 1942; (Mayr isolation reproductive and (Cracraft 1990), 1970). diagnosability Dobzhansky Wheeler primarily 1985), focused and spe- Mishler we Nixon a separation, 1985; 1983; of lineage (Donoghue property of monophyly necessary evidence on only for the looking In be cies. to trajectory species evolutionary unified dent a of existence lineages the recognizing that in concept 2007) (1998, Queiroz de ags nw rpodt etili o eali) Using measured hexaploid). 49 the (or the of of triploid 39 that be inferred than we to greater criteria, all size these triploid and spore tetraploid, known than be mean largest greater to a but tetraploid with triploid known individuals known smallest known size smallest the smallest spore of the mean the that of a of with that that individuals than individuals all than less diploid, all less be size considered to spore tetraploid we mean Thus, a were with they hexaploid). suggest (or to evidence triploid was a there unless to tetraploid tetraploid evidence were were was there they unless diploid assum- suggest of were approach individuals the that took ing We well-formed triploid). thus contained (and 49.0 unreduced individual averaged this that spores from However, spores. sporangia malformed of some abundance an produced phyte ranged means 42.6 diploid Known 33.8 1). from from (Fig. diameters non-overlapping mean were but observed, diploi were cytogenetically-confirmed size spore 2 in than breaks less typically deviations hee 90 ulebc ta.20;SnesnadSafr2002; Shaffer and Sanderson 2002; 1984; al. al. 2006). et Hoot et (Maddison with and problematic rooting Schuettpelz Huelsenbeck outgroup be 1990; alternative, can Midpoint outgroup, the Wheeler (Hess levels related and employed. taxonomic 2007) distantly lower was Russo a at Moraes well approach perform De rooting to and shown midpoint been has a rooting 2009), Pryer dsgae sL=mlomdi pedx1.Malformed 1). 30.7 Appendix from overall spores, ranged in diameters normally-formed mean For malformed measured. not = were spores L as (designated equal Append ( in nearly mixed ual are = (these yielded X spores as malformed individuals designated and normally-formed five mal- of Only numbers of of number number spores. the the individ- an 1), formed exceeded most Appendix greatly with in For spores normal consistent sporangium. = normally-formed N per counts as (designated spores spore uals 64 had of each expectation examined were osrainsau a sesdfralrcgie aaaccording taxa recognized all for assessed was status Conservation aooi eiiainadCnevto Assessment Conservation and Delimitation Taxonomic Spores – cutpl 1291A Schuettpelz 52 h nyctgntclycnimdtili sporo- triploid cytogenetically-confirmed only The 45.2. ” d uio 07 .80.Lkws,w osdra indepen- an consider we Likewise, 880). p. 2007, Queiroz (de — μ “ h 61 The o40.7 to m qae pce ihsprtl vligmetapopulation evolving separately with species equates Pentagramma a opeeylcignra spores normal lacking completely was ) μ n nw erpodmasfrom means tetraploid known and m μ Results ;teesoe eepresumably were spores these m; niiul rmwihspores which from individuals s erpod,adtriploids and tetraploids, ds, d ntr,ta individuals that turn, in nd, μ μ Apni ) e large Few 1). (Appendix m o52.4 to m x1,adjs n individ- one just and 1), ix μ ,wt standard with m, “ unknowns — efollow We ” Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 3 YTMTCBTN Vlm 40 [Volume BOTANY SYSTEMATIC 632 ihcrmsm ubro yesau rvddi aetee a plcbe.Posaegopdb opoye ae ntoeehbtdb the by exhibited those on based starbursts): morphotype, black by in grouped letters specimen lowercase are measured white Plots each with applicable). identify (indicated to (as study used parentheses this are in in numbers provided recognized Collection taxa presented. status are diploid type bars) six or (flanking number deviations chromosome standard and with diamonds) black (small Means r ihbakcrls(nyoehr) uoerpod ihwiedaod,alttaliswt lc imns uorpod ihwiefans, white ta with to publish autotriploids corresponding recently most morphotypes diamonds, the on black to based comparison letters) with a uppercase facilitate allotetraploids (with To labeled hexagons. diamonds, white are white with = individuals autohexaploids M 2007), with and therein: Simpson figure), autotetraploids recognized and this (Winner here), in classification (none one infrageneric fans black (only with circles allotriploids black with triangularis l hoooecut r rmWnhmadYtkeyh(03,except (2003), Yatskievych and data. Windham unpublished from from are counts chromosome All = Fig. .rebmanii P. .Soedaee lt for plots diameter Spore 1. ;S= ; t .triangularis P. = .triangularis P. .triangularis P. subsp. ; p = Pentagramma .pallida P. semipallida subsp. pcmn nerd(e antx)t enra ilisaeidctdwt ht ice,dpodhybrids diploid circles, white with indicated are diploids normal be to text) main (see inferred Specimens . ;P= maxonii nldn 1crmsm oces 1tp pcmn,ad3 te olcin fukonploidy. unknown of collections other 38 and specimens, type 11 vouchers, chromosome 11 including , .pallida P. ;V= .triangularis P. o opoye orsodn otx eonzdi h urn td,seApni 1. Appendix see study, current the in recognized taxa to corresponding morphotypes For . subsp. ida 337 Windham viscosa ;R= U)fo asivc ta.(90 and (1990) al. et Yatskievych from (UT) .triangularis P. m = .maxonii P. subsp. ; g rebmanii = .glanduloviscida P. ;T= ida 446 Windham .triangularis P. ; v = .viscosa P. (DUKE) subsp. ed xa , ; Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. oooysoni dnia ota bandvamxmmlklho nlss olcinnmesaeue oietf ahhpoye l symbols All haplotype. each identify 1. to Fig. used in the used are that those numbers Note to Collection respectively. correspond individuals) branches, analysis. polyploid the likelihood and below maximum taxa, and via diploid above individuals, obtained provided diploid that (for are to labels values and identical bootstrap is likelihood shown maximum topology and parsimony Maximum individuals. n aiu ieiodbosrp(LS upr.Oeof One split support. (MLBS) This large bootstrap 2). likelihood two (MPBS) maximum (Fig. bootstrap rooting, and parsimony revealed maximum midpoint (100%) were strong With received clades recov- tree. diverging dataset best plastid deeply single maximum combined a and the ered parsimony of complete analyses Maximum a likelihood (despite homoplasy). support of for and lack resolution characters minimal variable vided few relatively Pentagramma yielded 633 alignments a infer to which with level. available ploidy evidence higher ploidy was assess there to aga unless used level section); were spores data Discussion When other (see be triploid. measured, proportion be be to high to not inferred inferred a could was were with spores, that sample, malformed remaining spores of the normal two and mostly (reduced); hexaploid hexaploid had PENTAGRAMMA or they IN these DELIMITATION suggesting (unreduced) which TAXONOMIC size of triploid AL.: for a ET a of SCHUETTPELZ samples from spores remaining had were measured tetra- three be be could The spores to 1). determined (Appendix were ploid individuals seven holo additional all An including diploid, be to 2015] lsi Analyses Plastid Fig. .Ms asmnoste roe tismdon)rsligfo nlsso h obndpatdhpoye curdfo 46 from acquired haplotypes plastid combined the of analysis from resulting midpoint) its at (rooted tree parsimonious Most 2. Tbe3,adaaye fteedtst pro- datasets these of analyses and 3), (Table — h plastid The n easmdalwrploidy lower a assumed we in, ye n l u n isotype. one but all and types atpA and trnG-R region Tbe3.Wt oehmpaypeet u nlssof analyses our present, homoplasy dataset some plastid With gapCp the than 3). characters (Table variable more siderably Apni ) hl h te ol o eicue nthe in sporangia. mature included spores of be lack malformed not a to could completely due other analysis with the spore while sample 1), lone (Appendix the was h tes(0o 6 utoe he lei eune were sequences allelic Three one. of just most 46) and from sequences of obtained allelic (10 two others yielded the 46) of (34 viduals Pentagramma nuclear the of xetfrmrhtp ,wihi togyspotdas supported strongly is S). and which P morphotypes morphotypes, T, to the (relative paraphyletic morphotype of monophyly for the reject except or generally accept data insufficient inferred either are are to there one clades and supported and poorly these or hexaploids unresolved within inferred and Relationships two S, tetraploid. P, plus morphotypes diploids, includes trip- clade inferred T major two dip- and other V tetraploids The inferred and loids. six R, as M, well morphotype as includes loids, clades major two the h nuclear The ula Analyses Nuclear sotcp)rsle n6,528 in resulted copy) (short niiul.Nal he-orh fteeindi- these of three-fourths Nearly individuals. emn14051 Rebman gapCp gapCp — sotcp)ainetpoie con- provided alignment copy) (short sotcp)gn rm4 sampled 46 from gene copy) (short ercvrd8 lei sequences allelic 84 recovered We and cutpl 1291A Schuettpelz qal otparsimonious most equally Pentagramma h latter the ; Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 3 YTMTCBTN Vlm 40 [Volume BOTANY SYSTEMATIC 634 46 ili aa n oyli niiul)crepn otoeue nFg ;vria ie r sdt onmlil lee we rsn)obtained present) (when alleles multiple join and to Materials used (see are individuals lines sampled vertical 46 1; ind diploid Fig. from (for in obtained labels used and sequences symbols those consensus All parentheses). to to (in correspond individual. correspond numbers individuals) each allele alleles polyploid assigned arbitrarily recovered and and taxa, 84 numbers collection diploid The by identified trees. are likely and Methods) equally four the support with of nodes all that Note Fig. Pentagramma .Oeo ,2 otprioiu re roe tismdon)rsligfo nlsso h nuclear the of analysis from resulting midpoint) its at (rooted trees parsimonious most 6,528 of One 3. niiul.Mxmmprioyadmxmmlklho otta ausaepoie bv n eo h rnhs respectively. branches, the below and above provided are values bootstrap likelihood maximum and parsimony Maximum individuals. ≥ 0 r lopeeti h titcnesso h ,2 qal asmnostes swl si h titconsensus strict the in as well as trees, parsimonious equally 6,528 the of consensus strict the in present also are 50% gapCp sotcp)allsrcvrdfrom recovered alleles copy) (short ividuals, from Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 05 CUTPL TA. AOOI EIIAINI ETGAM 635 PENTAGRAMMA IN DELIMITATION TAXONOMIC AL.: ET SCHUETTPELZ 2015] e fallsotie e niiulwscnitn ihthese with consistent num- was The individual 1). per (Appendix obtained polyploid alleles of be ber to on determined but were all ten and holotypes all the ing infer to measured able 49 of were specimens we type within size, 10 individu spore approach 39 on of this based ploidy Thus, of 1). demon- usefulness (Fig. data) unpublished the 2003; Windham, Yatskievych strate 1990; but al. cytogeneti- and 2010; 11 et (Windham al. from Yatskievych ferns individuals et measurements Spore Beck in analyzed 2013). 2009; level cally al. al. et ploidy et Dyer Grusz of see 1986; indicator al. et reliable (Barrington reasonably a be ohv enivle nayplpodfrainbsdon based formation appear polyploid not any sampling. do current in the P involved and been S have Morphotypes to and T. M and V morphotypes polyploid morphotypes between cross and a R, from resulted have to eutdfo rse ewe opoyeMadmorpho- polyploid and Likewise, M individuals. T morphotype type between crosses Polyploids from diploids. resulted T 1231A morphotype from Schuettpelz alleles with sively 1268A 1312A Schuettpelz Schuettpelz polyploids 17278, larly, the Rebman among 1269A and Schuettpelz polyploids 14051, within from recovered both Rebman alleles readily The morphotypes. formed diploid appear been polyploids However, dif- have two T). to with and associated (M alleles morphotypes have ferent to diploid morphotypes; inferred only diploid the not among are S morphotype affili- from no monophyletic. with Alleles as resolved 94%), alleles. = polyploid MLBS 96%; ated well- = a (MPBS sampled form clade alleles by supported P linked Morphotype 3). are (Fig. as groupings individuals diploid supported T V, morphotype morphotype strongly with distinct As also S. the and are P morphotypes with they to paraphyletic intermixed and are alleles, diploids = Alleles MLBS polyploid distinct. T 57%; be morphotype = to from = (MPBS appear recovered not (MPBS clades is supported polyploid these other Nonetheless, robustly the associated 60%). 100%); is with = clades MLBS these each 99%; of clades, by One interconnected distinct alleles. diploids are two M Morphotype clades form 3). V monophyletic, (Fig. individuals as morphotype diploid resolved sampled three not is the group but this diploids; V type a = from ( derived (MPBS allele an well-supported ( include mor- and a polyploid clade The 96%) form = MLBS alleles 3). 96%; diploid (Fig. R intermixed MLBS photype phylogenetically and mostly MPBS are both receive did splits rela- scores 15 again bootstrap was but support of low, Branch pool trees. tively the 6,531 from remaining the random from 3 at (Fig. selected remark- trees tree all parsimonious were equally the trees and These similar trees. likely ably most equally four and cutpl 1291A Schuettpelz liyLvlAssessment Level Ploidy hr sltl vdnefrhmpodhybridization homoploid for evidence little is There individuals polyploid and diploid from recovered Alleles eza 171 Metzgar “ unknowns ≥ cutpl 1298A Schuettpelz l alwti opoyeMcae Simi- clade. M morphotype a within fall all lee3 sas soitdwt h morpho- the with associated also is 3) allele 70%. l aeallsta r soitdexclu- associated are that alleles have all and cutpl 1291A Schuettpelz l ape o u eei nlss plus analyses, genetic our for sampled als Pentagramma ” Discussion cutpl 1240A Schuettpelz lee1.Asnl oyli allele polyploid single A 1). allele eeifre ob ili,includ- diploid, be to inferred were — pr iehsbe hw to shown been has size Spore stp Fg ;Apni 1); Appendix 1; (Fig. isotype e sntsbtnieydifferent substantively not is ) Fg ) hrynn fthese of Thirty-nine 1). (Fig. , cutpl 1229A Schuettpelz cutpl 1302A Schuettpelz sacosbetween cross a is eza 171 Metzgar pert have to appear Pentagramma appears and , sthe is and , yeVcae,sgetn usata eei oeindespite cohesion genetic morpho- substantial different suggesting from clades, V originated V type always morphotype same, given the they a All from individual, 3). recovered were (Fig. polytomy alleles clade a two three R when in morphotype the resolved singular but R were the R, alleles with dip- morphotype morphotype these V with containing with morphotype shared clades from shared never sequences were is allelic loids Nuclear that 2). another (Fig. and exudate lotypes viscid a surfaces to leaf 2007). opposed Simpson as adaxial and farina (Winner exhibiting sparse with V, closest dis- covered its to from morphotype some reason distinct is with no relative, it see Morphologically, haplotype taxon. we this a 2), miss (Fig. sharing individuals nuclear R V our morphotype inconclu- morphotype are in results with clade plastid mor- the sive, well-supported Although of a 3). (Fig. form diploids phylogeny do sampled R from photype alleles Nonetheless, 2007). triangularis gramma monophyly. established and framework. have diploid we exclusivity a after only diploid discussed haplotypes are of origins and Polyploid assessments alleles at our polyploid findings our ignoring in most discuss level, first the diploid we can the from Here, 2007) explained. Simpson deviations logically and be (Winner few treatment the taxonomic recent and consistent morphology remarkably are with they Nonetheless, supported. well gramma sadpodbcueteewsn aat ugs otherwise. suggest to ( data specimens no 1291A two was there remaining because The diploid a as ofdn htayefc fmsae neec noroverall our minimal. on be inference would mistaken conclusions of taxonomic where quite effect are cases any we that Nonetheless, in study. confident for especially available incorrect, not were are spores above noted ploidy otecnrr.Tetomrhtp niiul lacking evidence individuals P was morphotype there assumed two unless The we contrary. diploid again, the be to here to obtained position; individuals alleles based of these phylogenetic we number their others, the six on and the primarily of conclusion each our For (Windham 2003). one population Yatskievych same For the and from ploidy. previously inferring taken count of in use assist ( the individual necessitated to another data in complimentary spores normal of just absence had these of none alleles, measure- two spore allele. to Although on one limited based 1). also polyploid, (Appendix were be diploids ments, to inferred inferred 39 single samples the all a of had any diploids from inferred of nuclear 25% about determinations; prs( spores elwti h ili ag Fg 1). (Fig. range nearly diploid were the that within alleles well from possessed those known it to because only 1960). identical diploid Grant is a and be P Alt to diploid; (morphotype the a measured as from only be ( those could with individual spores associated respec- obtained, P closely one were and morphotype 3) (two alleles Fig. their tively; as diploid, be to opoyeVwsfudt aetouiu lsi hap- plastid unique two have to found was V Morphotype as described, been recently only has R Morphotype ili Taxa Diploid of assessments our of some that possible certainly is It ako auesoagafrsxidvdasadthe and individuals six for sporangia mature of lack A ahhdtrealls ugsigte eepolyploid. were they suggesting alleles, three had each ) gapCp cutpl 1350A Schuettpelz Fg.2 )aenihrflyrsle o especially nor resolved fully neither are 3) 2, (Figs. eza 172 Metzgar leeadn oeta w lee eerecovered were alleles two than more no and allele — h hlgne ercvrdfor recovered we phylogenies The subsp. ek1098 Beck ,w sda xsigchromosome existing an used we ), and rebmanii cutpl 1327A Schuettpelz ida 3433 Windham emn14051 Rebman Fg ) hc a spores had which 3), (Fig. re 06 Pryer Wne n Simpson and (Winner mt 9 Smith – eeinferred were ) and 01 o which for ) a inferred was a treated was Schuettpelz Penta- Penta- Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 3 YTMTCBTN Vlm 40 [Volume BOTANY SYSTEMATIC 636 aiona rvneadteohrt i ooa Province. Sonoran his his to to restricted other taxon the and one Province with Californian (1986), Takhtajan plants divisions by other geographic proposed the Our the follows evi- recognition. from closely taxonomic this delimitation distinct of taxonomic of worthy taxon, flo- themselves, sum new California remain, the a that the from as on plants province Based size the ristic leaf). in recognizing the equivalent favor the from we about of dence, those each remainder as pinnae and the (about basal ternate leaf) to with essentially wide the are pinnate as that of long smaller leaves remainder essentially each having the areas pinnae are other than basal that with size wide in leaves than flo- California longer having the also (somewhat from morphology province plants leaf with ristic Gross clades, the areas. between in other varies observed like the never are, from condition province a specimens floristic viscid, adaxially California V, the morphotype from Cal specimens prot Baja ally, such prov- lacking and floristic glands California stalked California in the in province from floristic ince plants California other the (and from California those incon- the whereas have frequ and ances, California) glands Baja Sonora, stalked and Mexico, spicuously California New in from Sur, Desert plants clades. Sonoran California other M (and Baja morphotype Arizona Arizona, two from specimens the sampled between surfaces. morphol- Our differs gland leaf that actually clear adaxial is ogy the it inspection, on closer upon glands However, of presence ubiquitous between decision. flow this r supports gene out, more of turns evidence seems any subdivision of lack them, the and clades, geogr two the Considering is mo phyletic. there that continue However, suggest taxon. to to single nothing acceptable also a phylogenetically as morphotype be this would treating morphotype it of and monophyly M the contradicting nothing is that there uncovered we polyploidy). hybridization with of associated not individ- evidence was this those only for with origin (the hybrid rather ual a but suggesting T, Arizona, other morphotype from with of resolved alleles from not M was 1 allele morphotype This (allele above. mor- described Arizona 85%; one tern from in = allele (MPBS collected 1229A nuclear Schuettpelz clade single individual A a M 2). in photype Fig. together 87%; = resolved Arizona MLBS are from plastid that haplotype The tions one shown). not although con- supported strict ( trees; similar, the shortest well are in present 6,528 results not is all but (of 60%), is = sensus from MLBS province), 57%; sampled alleles = floristic (all the (MPBS of individuals California all 99%; California including the = diploid clade, (MPBS our other monophyletic The from 100%). as = supported individuals MLBS well Arizona is of diploid of 1 below), allele all sampled exception, nearly our sole containing (the from clades, phy- nuclear these alleles our of in the One size 3). equal (Fig. roughly of logeny clades two to 1990). fined al. et Yatskievych the 1960; warrants leaves Grant and dissected this (Alt uniquely feel its We by monophyly. recognitio taxonomic of continued lack apparent an cutpl 473 Schuettpelz h yeMmrhtp a rvosyrcgie ythe by recognized previously was morphotype M type The above, mentioned hybrid T × M inferred the Excluding con- mostly are diploids M morphotype from Sequences sioae rmteohrAioacollec- Arizona other the from isolated is ) i.3 i o ofr oteoealpat- overall the to conform not did 3) Fig. ; rphotypeMasawholeismono- cutpl 1229A Schuettpelz fti niy characterized entity, this of n pi xlsvt ewe the between exclusivity aphic nl ern ml protuber- small bearing ently brne Fg E.Addition- 4E). (Fig. uberances aoal.Mrhlg,a it as Morphology, easonable. fri)hv conspicuously have ifornia) ihvsi dxa surfaces adaxial viscid with sdiscussed is , la ikbtenteedt n u hlgntcresults, phylogenetic our no several and is that data there likely these because seems between 1960; However, link it Grant present. clear 1980), and are Smith lineages (Alt 1971; distinct authors al. within et previous detected Smith by variation T chemical morphotype and preclude Considering to T, alleles. morphological support diploid the the T additional of morphotype no remainder of was the monophyly There the from clade. distinct P as and = S, 92%) (MPBS = supported with MLBS 99%; strongly 91%; are = associated populations) (MPBS alleles outlying allele from two ( S Additionally, T is an morphotype allele 100%). to T 3). = morphotype (Fig. sister one MLBS S as but and supported alleles, P shared strongly no morphotypes are from There those to paraphyletic oe bv,ncerallsfo opoyeTwr also were T morphotype from As alleles sequences. nuclear S = and MLBS above, 2); P 86%; noted morphotype (Fig. = considerable identical (MPBS with monophyletic well-supported has clade as a 90%) in it resolved haplotypes placed were six not that two the were then analysis, recovered plastid Windham surprising we our and not In diversity. Yatskievych is dis- genetic 1960; widely It most Grant the 1993). and far, al. by (Alt et also, tributed Yatskievych is 1971; morphotype 1960; mor- This al. Grant considerable 1990). and and et (Alt 1985) variation (Smith al. phological encom- et chemotypes Wollenweber It 1980; the taxa. flavonoid Smith is recognized several previously surfaces the leaf passes of farinose complex yellow most abaxially and glabrous sim- (characterized surfaces). T leaf glabrous morphotype adaxially expanded by an ply the 1960; morpho- into favor incorporating Grant S (2004), we type Smith and and Therefore, (Alt Mickel of 1993). T con- approach Windham is morphotype and S of morphotype Yatskievych that are of within distribution gla- that narrow tained adaxially are the abaxial surfaces Both and farina. has yellow brous leaf T in morphotype covered abaxial whereas surfaces farina leaf farina, in has white only differ in S they covered as Morphotype slight, relatively is color. T ( morpho- and between allele S distinction types T morphological morphotype The sequences. nuclear a One to 3). 1364A sister (Fig. clade as a ( supported form S alleles morphotype not nuclear of its do allele although they and unique, 2), are (Fig. T morphotype unique with its analyses. nuclear to our due in monophyly distinct maintain clear and taxonomically to morphology reasonable morpho- as seems to P it relationship morphotype unresolved, its remains Although T and 2). T haplotypes type morphotype (Fig. P with haplotypes morphotype polytomy a S analyses, samples in T plastid resolved similarly morphotype our are most In indi- and the 3). all S encompassing (Fig. of polytomy morphotype remainder large of classifications; a the earlier of viduals part on to instead, based is, sister expected it sup- be 3). not would Fig. well as is 94%; and genus, = clade alleles MLBS unique 96%; this find be = However, (MPBS we to monophyletic diploids analyses, as ported P nuclear the morphotype our and surfaces in from In leaf elements adaxial petioles. farinose other densely farinose its from on distinguished based genus readily is taxon species, within opoyeT lhuhesl ergtdb t adaxially its by segregated easily although T, Morphotype haplotype plastid recovered only its shares S Morphotype opoyePhsln ense stems distinctive most the as seen been long has P Morphotype lee1 oteecuino h te opoyeS morphotype other the of exclusion the to 1) allele Pentagramma .pallida P. ek1098 Beck YtkeyhadWnhm19) This 1993). Windham and (Yatskievych n ti eeal rae saseparate a as treated generally is it and , cutpl 1358A Schuettpelz lee2and 2 allele mt 9 Smith lee2 sstrongly is 2) allele lee2 both 2, allele Schuettpelz Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. .Dti fgad naailsraeo aia .Aailsraeo aiawt aiaadsoaga .Soagu ltrlve) .Sporangium H. view). (lateral Sporangium G. sporangia. and farina with lamina of surface population. type Abaxial F. in on plant lamina. based of of drawings surface All adaxial view). on (face glands of Detail E. 05 CUTPL TA. AOOI EIIAINI ETGAM 637 PENTAGRAMMA IN DELIMITATION TAXONOMIC AL.: ET SCHUETTPELZ 2015] Fig. 4. etgam glanduloviscida Pentagramma cutpl 1264A Schuettpelz .Hbt .Dti frioeadptoebss .Saefo aeo eil.D dxa ufc flamina. of surface Adaxial D. petiole. of base from Scale C. bases. petiole and rhizome of Detail B. Habit. A. . DK,hltp) xetBadCfrom C and B except holotype), (DUKE, cutpl 1266A Schuettpelz DK) n rmfedphotograph field from D and (DUKE), Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 3 YTMTCBTN Vlm 40 [Volume BOTANY SYSTEMATIC 638 ahrta useis ee floigteuiidspecies unified species, the the (following at level recognition subspecies, we of than and worthy independently are rather evolving they be feel to therefore above identified taxa combinations. new three a and of above) description (as the taxon require new only single previ- would from it departure classifications, genus substantial ous the a within represents species this distinct Although as taxa six all maxonii pce oacmoaetesltigof splitting the accommodate to simply species would this triangularis 1), P. (Fig. diploid synonymizing taxa holo- be involve relevant to diploid all inferred With six here here. equivalent). types effectively all uncovered be treat to have varieties of to we subspecies be variability as would as genetic approach 1), (Table the Another group variability the as morphological within recognized the well action been for of long account has course to that this fails favor it not because do We division. infraspecific well- of and classification analyses, deep limited. the somewhat phylogenetic other revising for our no the options are from the with there emerging compatible As splits not 2). are supported (Fig. 3) data (Fig. results plastid nuclear the and p of described division we the section, the assess previous supporting to the evidence In able segregates. better its are among we within obtained structure data, genetic newly nuclear our and With morphological slight. plastid the and taxa they ubiquitous, among be discontinuities Hybridi- identified, to level. thought were infraspecific divergence was an segregates zation at treated of additional always almost degree as were (Weatherby 1990; and, the questioned was al. 1920) 1920) beginning, morphotypes (Weatherby known et the one the among Yatskievych even From or 1980; 2007), species. (Smith Simpson and two Winner 1960), Grant Pentagramma ie ae norpatdte,te ol aet parallel to have taxa would separating they split recog- the tree, deep be plastid to are the our were species on than two based divergent If nized 3). phylogenetically 2, (Figs. less, entities subspecies remaining be or well varieties may as taxa other Simpson (of the and recognizing taxon Winner while 1990; treating al. of et 2007) Yatskievych 1980; taxa (Smith these which at rank the discuss recognized. we be Here, should 3). and 2 Figs. of taxon. single whole a the as S, treating morphotype as of premature. well approach be as T, would the morphotype group favor this of we splitting Therefore, any that feel we eefo.I diin efudams oeiec finter- of evidence of no absence almost in found the even we with addition, alleles, In consistent flow. nuclear is gene shared which to no populations, key were (see mixed diagnosed There The easily below). morphology. therefore we taxa are with phylogenies recognize consistent we The taxa remarkably 2007). are 1998, support, Queiroz for de recovered of concept brackets by (indicated taxa diploid oee,mrhlgclspotfrti pi slacking, is split this for support morphological However, . ae nteaalbeeiec,w liaeyfn h six the find ultimately we evidence, available the on Based n pinwudb orecognize to be would option One ae norrsls ti la httecmo practice common the that clear is it results, our on Based Species Diploid .triangularis P. icse bv.Atidoto ol et accept to be would option third A above. discussed aebe ena opiigtre(l and (Alt three comprising as seen been have subsp. Pentagramma ,i neal.Taxon untenable. is ), .triangularis P. — nteps,tetx o sindto assigned now taxa the past, the In triangularis .triangularis P. Pentagramma p lhuhmsl akn strong lacking mostly although , sadsic pce ( species distinct a as m , w osdrtetetas treatment consider (we n eciiganwsub- new a describing and g , v subsp. ,and m n okfrgn flow gene for look and .triangularis P. Pentagramma , .triangularis P. p g , r sn oe and more, no is semipallida v Pentagramma rmtaxa from , r , Pentagramma t and , .pallida P. nosix into without subsp. under t p and are in ), . Fg ) ae norpatddat plastid our on Based 3). (Fig. of range the within collected both were hsdpod oee,i scerfo h ula aathat data nuclear the from clear is triangularis of P. characteristic it However, surfaces leaf diploid. adaxial this glandular the have 1) and Fig. size; spore Tetraploids allopolyploids. on of formation (based the and in 1971) involved al. been et Smith 1960; needed. certainly Grant is and work (Alt additional common be within formation may polyploid that indicated studies spores, esn efe htrcgiina h pce ee swar- is within level species pallida six species P. below): identify the Treatment Taxonomic here at (see we recognition this For and that trajectory. ranted evolutionary feel separate we a reason, on be to appears taxon. the of core the and clades outlying cutpl 1353A Schuettpelz om(eryalwr oml,w identified we and normal), were indistin- all morphologically (nearly form otherwise are from but guishable 1), (Fig. spores uooyli omto ihnbt pce xiiiga exhibiting of ( species evidence morphotype both find we glandular within exclu- Here, formation derived diploids. were autopolyploid glandular they that from assumed sively generally 2003), was Yatskievych it and and (Windham reported previously size). been spore in only (differing parents their were of uniformly one examined allopolyploids resemble we individuals and polyploid The and autopolyploids encountered. 1). tetraploids, (Appendix both triploids, data included hexaploids; other polyploids polyploid, or be putative measurements to The spore inferred on were 11 based analysis, phylogenetic for re,trewt togspot(i.3;ol taxon only 3); (Fig. support nuclear our strong in monophyletic with as three resolved were trees, taxa six the ( of encountering hybrid level, homoploid diploid putative the one at only taxa six the among breeding eovda aahltcwt togspot u vnhere see even individuals; but (within support, connections are strong there with paraphyletic as resolved uefcal dnia oadpyoeeial fiitdwith affiliated maxonii phylogenetically P. and to identical superficially 17278 Rebman lsiiaini h etrpeetto ae ntettlt of to totality the approach on this based available. that currently representation evidence feel best test the to we is required but classification be hypothesis, will taxonomic research this extensive and intensive more ag Fg ) Similarly, 1). (Fig. range ( within placement and (taxon assumed we otherwise, triploid. suggest 14051 as Rebman to spores evidence individual malformed Without this range. many interpreted also 1269A we Schuettpelz but 1); 1), (Appendix (Fig. spores normal 1268A Schuettpelz for alleles (three cutpl 1268A Schuettpelz ihteecpinof exception the With nsmay aho h i aaw noee Fg.2 3) 2, (Figs. uncovered we taxa six the of each summary, In lnua oylisascae ihmrhtp have M morphotype with associated polyploids Glandular Polyploids uooyliswr loecutrdwithin encountered also were Autopolyploids emn14051 Rebman 1302A t cutpl 1312A Schuettpelz ). , cutpl 1298A Schuettpelz .r man i ni a bm re P. (taxon sptnilhxpod.Wt oehtsmaller somewhat With hexaploids. potential as — rmteSnrnDsr nBj aiona is California, Baja in Desert Sonoran the from , a tetraploid. a was (taxon .triangularis P. fte46 the Of emn14051 Rebman ,and a otynra prsi h tetraploid the in spores normal mostly had .glanduloviscida P. m a bevdt aeeceigylarge exceedingly have to observed was xii opooycnitn ihtheir with consistent morphology exhibit and , ,ythssoe ntettali size tetraploid the in spores has yet ), t .triangularis P. a loivle nterformation their in involved also was ) cutpl 1347A Schuettpelz cutpl 1269A Schuettpelz cutpl 1268A Schuettpelz sifre ob erpod Earlier tetraploid. a be to inferred is .maxonii P. .pallida P. Pentagramma , ae nsoesz Fg )and 1) (Fig. size spore on Based . 1302A ugssahge liylevel. ploidy higher a suggests ) a(Fig.2)andourunderstanding cutpl 1231A Schuettpelz .glanduloviscida P. ,and ,and l ili pce have species diploid all , (taxon and cutpl 1229A Schuettpelz i.3 ewe the between 3) Fig. ; niiul sampled individuals 1312A .viscosa P. .maxonii P. , rall number allele or ) .glanduloviscida P. cutpl 1269A Schuettpelz g ek1098 Beck cutpl 1298A Schuettpelz ,btsoesize spore but ), l aelarge have all .triangularis P. .triangularis P. Pentagramma .Ofcourse, , and .maxonii P. (taxon , mt 9 Smith .Four ). 1240A t m is ). ) , , , Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 05 CUTPL TA. AOOI EIIAINI ETGAM 639 PENTAGRAMMA IN DELIMITATION TAXONOMIC AL.: ET SCHUETTPELZ 2015] rvnei aiona(paetyrsrce oSnDiego San to California. restricted Baja (apparently and County) California in province u h hr with third the but 1291A Schuettpelz with allopolyploid, second a of tion osysakdgad akn ml rtbrne n in 4. Figure and wide. than protuberances longer somewhat small are that lacking leaves having conspic- glands with stalked surfaces leaf uously adaxial viscid having in Windham glanduloviscida Pentagramma ...... farinose . . white surfaces leaf farinose abaxial white these; rarely of farinose, combination yellow some surfaces or leaf farinose, abaxial white glandular, farina; viscid, yellow surfaces sparse leaf with rarely Adaxial glabrous, surfaces leaf 1. Adaxial 1. results plastid The 1). parent. maternal (Fig. the was size that indicate spore 2) (Fig. on based ( tetraploid allopolyploid this of representative reported as pathways chemical incompati- other competing reflect in the may poorly allotetraploids between the and the bility 1981) in Smith farina and developed Wollenweber 1980; Dietz and and Wollenweber 1980; (Smith chemistry (Gastony farina different have parents ferns cheilanthoid and ent in identify can we inheritance 1992), Yatskievych plastid of h he eso chromosomes. resembled of most sets three allotriploid the this parent, expected, paternal be the would from As formed tion. autotetraploid an obtained whereas within diploid alleles parent that nuclear infer maternal can of the we distribution individual, the From this the allotriploid. from reason- and an seems is data it specimen this plastid recovered, that spore) alleles conclude normal unique to single able of a number find the not did and (we spores malformed of looyli,wihicroae eoe from genomes viscida incorporates which allopolyploid, etgam triangularis Pentagramma Distribution ifr from Differs nuclear The .Aailla ufcsdneyo preywiefrns 3 ...... farinose white sparsely or densely surfaces leaf Adaxial 2. .Aailla ufcsvsi,gadlr rbt,ocsoal pern elwfrns 4 ...... farinose yellow appearing occasionally both, or glandular, viscid, surfaces leaf Adaxial 2. 2522 16742 lvto 5 ,1 a 2008, May 13 m, Road, 351 Valley 1264A Marron Schuettpelz elevation along -116.76492, Springs: Engineer 32.59292, of S km 4 nov. (taxon .Aailla ufcsdneywiefrns,gnrlyosuiglmn;ptoe ht aioe lnso the of plants farinose; white petioles lamina; obscuring generally farinose, white densely surfaces leaf Adaxial 3. .Dsa ineadpoia aicpclbso aa inerglrypnaii rmr iie;aailla surfaces leaf adaxial divided; more or pinnatifid regularly pinnae surfaces basal leaf of adaxial lobes pinnatifid; basiscopic irregularly proximal or and entire pinnae pinnae Distal basal of lobes 4. basiscopic County proximal Diego and San pinnae of Distal plants glabrous; petioles 4. lamina; obscuring not farinose, white sparsely surfaces leaf Adaxial 3. .triangularis P. .triangularis P. Pentagramma — .Aailla ufcsvsi n ihcnpcosysakdgad akn ml rtbrne;lae somewhat leaves protuberances; small lacking glands stalked conspicuously with and viscid surfaces leaf Adaxial protuberances; 5. small bearing frequently glands stalked inconspicuously with but viscid not surfaces leaf Adaxial 5. YE .S . aiona a ig County: Diego San California, A.: S. U. TYPE: etr iraNvd Clfri)fohls...... foothills (California) Nevada Sierra western lnua,vsi rnt...... 5 ...... not . . or . . viscid . glandular, ...... glandular . also . sometimes . viscid-resinous, ...... California Baja adjacent and (California) g gapCp — )and aaClfri ...... leaf); California . of Baja . remainder and . than California . size in . in province . smaller floristic . each Californian . pinnae the . (basal of . pinnate plants . essentially and . leaf); wide, California . of than in . remainder longer Desert . to Sonoran . size the . in and . equivalent Sonora, . about . Mexico, each New pinnae Sur, California (basal California Baja ternate Baja essentially Arizona, wide, of as plants long as about leaves etgam maxonii Pentagramma nw nyfo h aionafloristic California the from only Known eeascae with associated were .v csa scos vi P. .rebmanii P. .triangularis P. aaas eeldteeitneo third a of existence the revealed also data sptra otiuo.Teetodiploid two These contributor. paternal as a h oreo h aenlcontribu- paternal the of source the was yrd Sihe l 91 mt 1980). Smith 1971; al. et (Smith hybrids .rebmanii P. hltp:DK![ceso 405736]). [accession DUKE! (holotype: a loipiae nteforma- the in implicated also was (taxon hc h oyli resembles, polyploid the which , (taxon .maxonii P. cutp ida,sp. Windham, & Schuettp. hc otiue w of two contributed which , eza 171 Metzgar .viscosa P. v .Bsdo h presence the on Based ). .triangularis P. Wah)Shet.& Schuettp. (Weath.) r e oteDpodSeisof Species Diploid the to Key .Teol sampled only The ). stemtra par- maternal the as w lee from alleles Two . )appearstobe .v csa scos vi P. .glandulo- P. (taxon was t ), .S .Clfri:SnDeoCut:5k Eo au:off Jamul: of SE km 5 County: Diego San California: A. S. U. eo,floigteifre rkondpodspecimens. diploid known separately larger or listed inferred are with the these but following found; below, been species have this sizes spore resembling average polyploids text, main itiuin(xeto curneetmtdt eabout be to estimated occurrence km of 6,000 (extent distribution pr esrmns morphol a ( measurements; spore ra.I sasge rlmnr osrainsau fnear of status conservation (NT). preliminary threatened a assigned is It areas. Pentagramma important this plants. of of history solutiongroup evolutionary workable the a understanding represents samplefor breadth, We in sequencing restricted characteristics. and here although size morphological fre- approach, and our of 1977) that al. Walkerbelieve suite et (e.g. Löve limited polyploidy 1968; of Vida quently and levels Manton high 1984; their 1966, are for Ferns paper. known current the well additional attempted that in not taxonomy of have polyploid certain address discovery we such, to are the As here. to sampled we not lead polyploids and will frequency enti- research poly- diploid additional considerable the Such between with polyploids. and within ties of almost both formation sample, arisen have our the ploids on to based limited are, entirely species Interac- these below). among Treatment all Taxonomic tions them (see treat species we distinct and reasons, as isolated these reproductively For be evolving. to independently mono- appear demonstrably taxa suite always these unique not phyletic, a of Although and each alleles. genus, nuclear morphology the evidence of distinctive within found a taxa exhibits diploid have six which We of levels. existence the polyploid for and diploid of evolution the the into insights important ida 98 Windham diinlIfre rKonDpodSpecimens Diploid Known or Inferred Additional Notes osrainAssessment Conservation u pr tde n hlgntcaaye provide analyses phylogenetic and studies spore Our as. ida .Wollenw. E. & Windham Yatsk., .8:1.1990. 13. 80: J. P — ENTAGRAMMA 2 ,btmn ouain r iutdi protected in situated are populations many but ), Theholotypeisinferredtobediploidbasedon – 084 as. ida .Wlew,Ae.Fern Amer. Wollenw., E. & Windham Yatsk., sakondpod(i.1.A oe nthe in noted As 1). (Fig. diploid known a is ) aooi Treatment Taxonomic — TYPE: etgam triangularis Pentagramma — hsseishsarestricted a has species This gclysmlrspecimen similar ogically Pentagramma .glanduloviscida P. .triangularis P. .rebmanii P. .maxonii P. (Kaulf.) .viscosa P. tboth at .pallida P. .2 — Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. a pr ie ewe hs ftokontetraploids collections, known other two of several those with between ( along sizes spore isotype, had MO The uin(xeto curneetmtdt eaot4000km 400,000 about be to estimated occurrence of (extent bution Sonoran California. the Baja and and Sur, California California in Baja Desert Sonora, to Arizona across maxonii Pentagramma eo,floigteifre rkondpod.Asingle A resembling diploids. separately. also listed known specimen, or inferred hybrid the following other-below, to were morphology in which similar specimens, wise polyploid These polyploid. be assessed is (LC). concern It least areas. of protected be to situated populations some with ob ili Fg ) ihtesoe ftehltp being inferred holotype the were of isotypes spores of the GH those with than and 1), smaller holo- slightly (Fig. ARIZ The diploid isotype). the be DS to and the (US) examine not type did (we specimens inr il 2754 16932 lvto 9 ,1 May 13 m, 192 Dic- elevation Valley: -116.98322, 2008, Spring 32.72544, County: Hill, Diego tionary 2008, San May California: 32.72544, 13 (DUKE). Hill, m, Dictionary 192 Valley: elevation -116.98322, Spring (Del County: -117.1325, S-6 2008, Diego 33.085, Feb of San Hodges, 17 west Lake m, 357 of just Highlands elevation NW Escondido, Dios and Del Highway) of County: Dios SW Diego Preserve: San California: County A. S. U. diploid]). [known (UT ain130m 5Mr2005, Mar 15 m, 1,330 ele- -111.43583, 34.09167, vation Canyon, Barnhardt 1981, Forest: National Nov Canyon, 14 Garden m, 337 of 1,735 elevation Mar tributary -110.3466, 18 31.469, small Mountains: m, Huachuca 1,725 elevation -110.34667, 2005, 31.46889, Garden of tributary Canyon, Huachuca: Fort County: Cochise Arizona: ln lc onanRa nL ol aly 33.0023, Valley, 1998, Jolla Mar La 30 32.6783, m, in 115 dam, Road 2007, elevation Bernardo the Mountain -117.1215, Rancho May of of Black SW 8 County: along the side Diego m, San around east California: 492 (SD). slope the elevation northwest-facing on -116.6703, the area on immediate Lake: Ecological Barrett 2008, Jamul May 1266A (Rancho 13 m, Creek Schuettpelz 311 Jamul elevation -116.86026, of 32.67782, SE Reserve), hill CA-94: of 4 YTMTCBTN Vlm 40 [Volume BOTANY SYSTEMATIC 640 rzn:Pm ony 4k fbre ihMexico, May 11 with National m, Cactus 763 border Pipe elevation (Organ of -112.70966, Canyon N Alamo 32.06489, AZ-85: Monument), km of 24 E km County: 7 Pima Arizona: ida 447 Windham osrainAssessment Conservation Distribution diinlIfre rKonDpodSpecimens Diploid Known or Inferred Additional Notes nerdPlpodSeiesRsmln hsSpecies this Resembling Specimens Polyploid Inferred mr enJ 0 6 1990. 16. 80: J. Fern Amer. subsp. triangularis var. nov. stat. et acsin524] stps RZ,D pod ee not polyploid]). [inferred level MO! [ploidy GH!, DS assessed], ARIZ!, isotypes: 592740]; [accession in107m 7Jl 1909, July 27 m, eleva- 1,067 Valley, Rincon tion of head Mountains: Rincon County: U kondpod) rzn:Gl ony Tonto County: Gila Arizona: diploid]). [known (UT cutpl 1269A Schuettpelz cutpl 473 Schuettpelz — maxonii prswr esrdfo oro h ietype five the of four from measured were Spores maxonii and — Kuf)Ytk,Wnhm&E Wollenw. E. & Windham Yatsk., (Kaulf.) et. hdr 2 1.1920. 119. 22: Rhodora Weath., xedn rmsuhetr e Mexico New southwestern from Extending iyormatriangularis Pityrogramma DK) aiona a ig County: Diego San California: (DUKE). Wah)Ytk,Wnhm&E Wollenw., E. & Windham Yatsk., (Weath.) ida 773 Windham Wah)Shet.&Wnhm comb. Windham, & Schuettp. (Weath.) DK) rzn:CcieCounty: Cochise Arizona: (DUKE). (DUKE). — — ida 337 Windham emn14051 Rebman .maxonii P. hsseishsaboddistri- broad a has species This TYPE:U.S.A.:Arizona,Pima n eetu nerdto inferred thus were and ) lmr3271 Blumer cutpl 445 Schuettpelz .maxonii P. r itdseparately listed are , nw diploid. known a , cutpl 1268A Schuettpelz ida 98 Windham S) California: (SD). Kuf)Maxon (Kaulf.) emn13506 Rebman hltp:US! (holotype: slikewise is , Pentagramma — (DUKE). Windham .S A. S. U. – 084 — 2 ), ra itiuin(xeto curneetmtdt be to estimated occurrence km of 40,000 (extent about distribution broad stp w i o xmn h Sioye.Bt were Both evidence isotype). no found DS have we that the and indicating 1), examine (Fig. diploid be not to inferred did (we isotype eo es ocr (LC). concern least of be o ltCeki enRvrCno a .5k Wof SW km 1.55 Apr ca. 28 m, Canyon 549 near 2006, elevation River -118.69389, Bakersfield Kern 35.49972, Spring, of in Democrat NE Creek Flat County: Cow Kern 2008, May California: 39.77900, 21 (DUKE). Hole, m, Chico 111 Salmon Big elevation and along -121.74800, Dam Park: Diversion Bidwell between Upper Creek, Chico: County: Butte individual. or taxon polyploid any etgam pallida Pentagramma 2008, May 5 National m, 1229A 1,272 Schuettpelz (Coronado Junction: elevation Trail -109.76332, Canyon Swift 32.68347, Forest), Jacobson of SW Moutains: km Pinaleno 7 County: Graham Arizona: mWo lPra:ofo A10 ecdGre(Sierra Gorge Merced May CA-140: 19 m, of 562 off elevation 2008, -119.80443, Portal: 37.66830, El Forest), National of W km 2 re TnoNtoa oet,3.35,-1.88,elevation 2008, -111.48484, May 33.93553, 10 m, Forest), 1,211 National (Tonto 28 Creek m, Mounta Mazatzal of 2,340 County: side Maricopa elevation SE 1985, -109.7711, Aug Mountains: 32.6785, Canyon, Pinaleño 2008, Jacobson County: May Graham 5 Arizona: m, -109.81448, 1,870 32.65157, Forest), elevation J 1983, National Trail (Coronado Swift Jun Canyon of BarnhardtWet 1 SW km of m, 13 County: 1,350 wall 447 elevation S Windham -111.4357, Mountains: 34.0917, Mazatzal Canyon, County: m, Gila 1,350 1983, elevation -111.4357, Jun 34.0917, 1 2009, Canyon, Barnhardt Apr El of Arroyo 26 of m, (E) 820 off elevation canyon 17278 Rebman -113.617, palm small 28.5435, the along a Paraiso, Paraiso: of El area Rancho abandoned riparian the of NE Libertad: 2008, iraNvd fClfri nteU .A. S. U. the in California of Nevada Sierra .5k fCnrs a h rwfis:Ssd fDate of side S May flies): 17 crow m, the 1,021 elevation 2008, (as -112.88153, 34.2438, Congress Road, of Creek N km 9.25 Notes diinlIfre ili Specimens Diploid Inferred Additional nerdHbi pcmnRsmln hsSpecies this Resembling Specimen Hybrid Inferred wall S Mountains: Mazatzal County: Gila Arizona: A. S. U. osrainAssessment Conservation Distribution nerdo nw oyli pcmn eebigthis Resembling Specimens Polyploid Species Known or Inferred broe0037] stps S[liylvlnot level [ploidy DS isotypes: MO!). assessed], 00023173]; [barcode 1990. 15. 1920. 119. 80: 22: J. triangularis Fern Amer. Wollenw., aiona aeaCut:Hlsaottremiles three about 1906, Hills Apr 11 1960. Pollasky, County: 168. above 12: Madera Brittonia California, Grant, E. V. cutpl 1327A Schuettpelz ohes2570 Rothfels ida 3433 Windham cutpl 1242A Schuettpelz — — prswr esrdfo h ooyeadone and holotype the from measured were Spores ida 773 Windham ida 446 Windham EIO aaClfri:Esnd:Ser La Sierra Ensenada: California: Baja MEXICO. (SD). — U konttali].Aioa Graham Arizona: tetraploid]). [known (UT .p li a id ll pa P. Kuf)Mxnvar. Maxon (Kaulf.) 2 etitdt h etr otil fthe of foothills western the to Restricted (DUKE). n ayppltos ti sesdto assessed is It populations. many and ) iyormapallida Pityrogramma (DUKE). DK) aiona aioaCounty: Mariposa California: (DUKE). cutpl 1240A Schuettpelz (DUKE). DK) rzn:YvpiCounty: Yavapai Arizona: (DUKE). a enivle nteoii of origin the in involved been has DK kontili].Arizona: triploid]). [known (DUKE U konttali].Arizona: tetraploid]). [known (UT Wah)Ytk,Wnhm&E. & Windham Yatsk., (Weath.) — hsseishsarelatively a has species This nto:Pnln Moutains: Pinaleno unction: cutpl 1231A Schuettpelz elr8141 Heller n:Tiuayo Sycamore of Tributary ins: pallida (DUKE). — Wah)K .At& Alt S. K. (Weath.) — .S .California: A. S. U. cutpl 1350A Schuettpelz et. Rhodora Weath., YE .S A.: S. U. TYPE: hltp:GH! (holotype: Pityrogramma — (DUKE). .S A. S. U. Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 05 CUTPL TA. AOOI EIIAINI ETGAM 641 PENTAGRAMMA IN DELIMITATION TAXONOMIC AL.: ET SCHUETTPELZ 2015] uin(xeto curneetmtdt eoe ,0,0 km 1,000,000 over be to estimated occurrence of (extent bution itiuin(xeto curneetmtdt eabout be to estimated occurrence km of 8,000 (extent distribution aaat aaClfri nMxc.I h .S . the A., S. U. Utah, Oregon, the Nevada, In Idaho, Washington. California, Mexico. and in in found is California in species Baja Columbia British to from America, Canada North of portion ernmost ob flatcnen(LC). concern assessed least is of be It areas. to protected situated populations many with aprnl etitdt a ig ony n northwest- and County) California. Diego Baja ern San to restricted (apparently pcmni itdsprtl eo,floigteinferred the following One below, specimens. separately 1). diploid listed mor- (Fig. is but diploid size specimen to spore be similar average to larger phology isotypes); with specimens UC polyploid, and both inferred BCMEX the inferred examine we not did (we isotype near of status conservation (NT). preliminary threatened a assigned is It areas. asrCek 261,-1.67 lvto 6 ,9Mar 9 m, along 560 slope elevation N-facing -116.5697, lower 2003, and 32.6714, a Lake Creek, on Morena Hauser Corners: of Cameron SW (USFS Mountain: of Area NW Hauser Wilderness of Canyon N (Walker Hauser property), Canyon County: Walker 2008, Diego I-8: May San elevation 12 of -116.20762, m, off 32.66151, 807 Reserve), Boulevard: Ecological of Canyon E of 2008, km May intersection 5 13 Alpine: m, 1257A National 635 of (Cleveland Schuettpelz elevation Creek -116.65454, SE Valley 32.74433, km Pine Forest), and 15 Creek County: Espinosa Diego San etgam rebmanii Pentagramma etgam triangularis Pentagramma 2006, -116.47667, Apr Creek 32.60694, 24 Campo 94, m, Highway above 770 elevation CA County: of Diego alignment San old California: along A. S. U. osrainAssessment Conservation osrainAssessment Conservation Distribution diinlIfre ili Specimens Diploid Inferred Additional Notes Distribution nerdPlpodSeie eebigti Species this Resembling Specimen Polyploid Inferred stps CE pod ee o sesd,RA,UC RSA!, assessed], assessed]). not not level level [ploidy [ploidy Mar north- 23 BCMEX Creek, m, isotypes: 610 Valley elevation Pine -116.6533, 2005, of 32.7442, slope, west Canyon facing just east Horsethief Descanso, of and of southeast Trailhead south Road, Valley and Japatul Lake Wilder-of Barrett Creek of Pine north Forest: ness: National Cleveland County: 2007. 345. 1816, 3.1902. 630. triangularis subsp. nov. stat. et triangularis comb. Windham, & Schuettp. .S al eb 7 7.1913. 173. 17: Herb. Natl. S. U. oln. mr enJ 0 5 1990. 15. 80: J. Fern triangularis Amer. Wollenw., emn8919 Rebman — 2 hmsos n. s. Chamisso ,btsm ouain r iutdi protected in situated are populations some but ), prswr esrdfo h ooyeadone and holotype the from measured were Spores emn11483 Rebman rebmanii iyormatriangularis Pityrogramma — — — Kuf)Udr. ul oryBt lb29: Club Bot. Torrey Bull. Underw., (Kaulf.) Kuf)Ytk,Wnhm&E Wollenw. E. & Windham Yatsk., (Kaulf.) al. nm ii.7.1824. 73. Filic. Enum. Kaulf., ral itiue hogottewest- the throughout distributed Broadly nw nyfo otwsenCalifornia southwestern from only Known YE .S . aiona a Diego San California, A.: S. U. TYPE: (MO). DK) aiona a ig County: Diego San California: (DUKE). .rebmanii P. inr&M .Smsn arñ 54: Madroño Simpson, G. M. & Winner cutpl 1247A Schuettpelz hltp:B broeB2 0090557]). 20 B [barcode B! (holotype: hltp:S![ceso 159328]; [accession SD! (holotype: Wne .G Simpson) G. M. & (Winner — — eza 171 Metzgar hsseishsaboddistri- broad a has species This Kuf)Ytk,Wnhm&E. & Windham Yatsk., (Kaulf.) hsseishsarestricted a has species This a on.Ti polyploid This found. was , — TYPE:U.S.A.:California, Kuf)Mxn Contr. Maxon, (Kaulf.) — DK) California: (DUKE). (DUKE). .S .California: A. S. U. Gymnogramma Pentagramma Ceropteris — 2 ), 1178,eeain95m 4Jn1984, Jun 14 40.3419, m, 945 development, housing elevation Ranch -121.7886, Sky of Ponderosa 2008, of May intersection corner 13 m, Alpine: 1254A National 622 of Schuettpelz elevation (Cleveland -116.65335, Creek SE Valley 32.74438, km Pine Forest), and 15 Creek County: Espinosa Diego 2008, (San San May Creek 14 Dry m, elevation -116.78321, with 798 33.70902, intersection Forest), Fork near S National CA-74: River, Bernardino of Jacinto off Vista: San Valle of of E km 11 County: Mar Riverside 31 m, Hot 255 of elevation 1998, tributary -117.5086, 33.6028, along Canyon, Mountains, Spring Ana Santa County: Orange lvto 9 ,2 p 2006, Apr -117.5075, 25 33.60361, m, Canyon, 297 Springs elevation Hot of canyon side Forest: 2008, May 18 m, 1316A 306 Forest), of elevation National E Padres -121.48687, (Los km 35.99553, Creek 1 Kirk above Road: Ocean: Fergusson Pacific Nacimiento along Mountains: 2008, May 18 m, 1317A 314 of Forest), elevation National E Padres -121.48584, (Los km 35.99529, Creek 1 Kirk above Road: Ocean: Fergusson Pacific Nacimiento along Mountains: 2008, May 19 Forest), m, 1332A National 555 (Sierra elevation Gorge -119.80458, of Merced W 37.66802, CA-140: of km off 2 Portal: County: El 1998, Mariposa California: Apr diploid]). 1 [known m, 65 elevation -118.9326, Mountain Monica Santa May County: 15 m, (Angeles 819 I-210 2008, elevation and -118.39161, CA-14 34.36076, Fernando: Forest), between San National Road: of Canyon N Sand County: along Angeles Los California: loid]). in40m p 1998, Apr eleva- -117.8704, 1 34.2413, m, River, along Gabriel 470 Azusa San tion of the N of 2006, County: Fork Apr West 35.49972, Angeles Spring, 28 Los California: Democrat m, (DUKE). of 556 SW Kern elevation km in 1.57 -118.69417, Creek ca. Flat Cow Canyon near River Bakersfield of NE elevation Trail County: 2008, Kern -121.27385, May Scenic 20 39.64168, National m, Falls 615 Forest), Feather National of (Plumas spur overlook along 2008, May 21 Hole, m, Salmon 1353A 121 and elevation Dam -121.74615, Diversion 39.78157, between Creek, Chico Big Chi 2008, County: May Butte 21 California: -121.55133, m, 39.59535, (North 409 Hollow Reserve), elevation Beatson Ecological Mountain: Mountain Table Table National North 2008, (Plumas Oroville: May of Rock 21 Bald m, 1358A 964 Big Schuettpelz elevation Oroville: -121.34321, 39.64533, of Forest), NE km 20 ainlFrs) 9659 11265 lvto 4 ,2 May (Plumas 20 along Trail m, Falls: Scenic 544 elevation 2008, National Feather -121.26615, Falls of 39.63599, Forest), Feather SE National of km route 1 upper County: Butte California: specimens. below, Putative diploid separately known encountered. listed or inferred are the commonly sample following our are in main present the sizes polyploids in discussed spore As average larger 1). with (Fig. polyploids indistinguishable diploid morphologically text, be to inferred we diinlIfre rKonDpodSpecimens Diploid Known or Inferred Additional Notes cutpl 1347A Schuettpelz cutpl 1282A Schuettpelz ida 98 Windham DK) aiona Orange California: (DUKE). DK) aiona otryCut:SnaLucia Santa County: Monterey California: (DUKE). DK) aiona ut ony erFahrFalls: Feather Near County: Butte California: (DUKE). DK) aiona otryCut:SnaLucia Santa County: Monterey California: (DUKE). — prswr esrdfo h ooye which holotype, the from measured were Spores DK) aiona ut ony mN km 9 County: Butte California: (DUKE). DK) aiona eaaCut:SW County: Tehama California: (DUKE). – 096 cutpl 1277A Schuettpelz cutpl 1346A Schuettpelz DK) aiona ut County: Butte California: (DUKE). U kondpod) California: diploid]). [known (UT ida 98 Windham DK) aiona o Angeles Los California: (DUKE). eza 179 Metzgar o pe iwl ak along Park: Bidwell Upper co: ,aogAry eut 34.0647, Sequit, Arroyo along s, cutpl 1364A Schuettpelz ony lvln National Cleveland County: – akr753 Ranker 101 ida 98 Windham DK) California: (DUKE). DK) California: (DUKE). DK) California: (DUKE). U kondip- [known (UT ida 3431 Windham U [known (UT — Schuettpelz Schuettpelz Schuettpelz Schuettpelz – (DUKE). 108 .S A. S. U. (UT Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. es ocr (LC). concern least eifre ob ili Fg ) sdsusdi h main mor- the with in polyploids discussed to putative similar As no phology 1). encountered (Fig. have we diploid text, be to inferred we at abr ony at rzIln:Cñd e Puerto del Cañada Island: Cruz Santa County: 2008, elevation Barbara Prisoners May Santa -119.71449, 16 (between 34.00149, m, Puerto Ranch), 58 Main del and Apr Cañada Harbor 25 Island: m, Cruz below 61 Santa Highway elevation Dios -117.14861, 2006, Del 33.0436, along Hodges, ravine Lake County: Diego San etgam viscosa Pentagramma 40 [Volume m, 502 Padres 2008, elevation intersec- May (Los -119.83929, 18 of Canyon 34.52184, NW Spring Forest), Cold km Ynez National Cielo: 2 Camino Santa Road: with Stagecoach County: tion of Barbara off Santa Moutains: 34.00659, 2008, California: Ranch), May 16 (DUKE). Main m, 31 and elevation Puerto-119.69948, Harbor del Prisoners Cañada Island: (between Cruz Santa County: elevation 2008, Barbara Prisoners Santa -119.71449, May 16 (between 34.00149, 2008, m, Ranch), Puerto 58 May Main del and Cañada 17 Harbor Island: m, Cruz Cruz Pelican 4 Santa Santa and elevation County: Harbor 1302A -119.70109, Schuettpelz Prisoners Barbara 34.03178, between Santa Bay, trail California: along BOTANY A. SYSTEMATIC Island: S. U. 2006, May 19 m, 775 elevation -122.875, 44.2976, Crawfordsville, SWof Ridge, Rock Horse County: 1986, Linn Oregon: Jun 16 m, eleva- -124.1263, 105 44.1223, tion 101, m, Route US along 1193 Caves Lion elevation Sea -114.7596, 2008, May 35.2633, Mountains: 16 Newberry Pass, Tree lands: BLM Christmas 1984, County: Jun Clark 19 Nevada: eleva- m, -123.4917, 300 40.8578, River, tion Trinity and 299 Highway along Trinity California: diploid]). 642 mrl al,3.58,-1.65,eeain152m Apr 4 m, 1,552 2009, elevation -112.96659, near 37.25783, Park: Falls, National Emerald Zion County: Washington Utah: (DUKE). ra itiuin(xeto curneetmtdt eover be to km estimated occurrence 100,000 of (extent distribution broad icuigteCanlIlns n otws aaCalifornia. Baja northwest and Islands) Channel the (including Notes diinlIfre ili Specimens Diploid Inferred Additional nerdPlpodSeiesRsmln hsSpecies this Resembling Specimens Polyploid Inferred osrainAssessment Conservation Distribution .C ao,FrsN mr :1.1879. 16. 2: 1902. 631. Amer. 29: N. Club Ferns Eaton, viscosa C. D. nov. comb. Windham, ao)Mxn ot.U .Nt.Hr.1:13 1913. 173. 17: Herb. Natl. triangularis S. U. Pityrogramma Contr. Maxon, Eaton) Nt.e .C ao)Wah,Rooa2:17 1920. 117. 22: subsp. Rhodora Wollenw. Weath., Eaton) triangularis C. Pentagramma D. ex (Nutt. YE .S .Clfri:SnDeoCounty, Diego San 1990. California: 15. A. n. 80: s. S. J. Fern U. Amer. TYPE: Wollenw., E. & Windham mt 9 Smith eza 172 Metzgar — hltp:P![ceso 1085482]). [accession PH! (holotype: prswr esrdfo h ooye which holotype, the from measured were Spores 2 Nt.e .C ao)Udr. ul oryBot. Torrey Bull. Underw., Eaton) C. D. ex (Nutt. n ayppltos ti sesdt eof be to assessed is It populations. many and ) ek1098 Beck (DUKE). cutpl 1312A Schuettpelz — ofndt osa otws California southwest coastal to Confined DK) aiona at abr County: Barbara Santa California: (DUKE). DK) aiona at abr County: Barbara Santa California: (DUKE). .viscosa P. cutpl 1298A Schuettpelz cutpl 1297A Schuettpelz viscosa DK) rgn aeCut:above County: Lane Oregon: (DUKE). Nt.e .C ao)Shet.& Schuettp. Eaton) C. D. ex (Nutt. iyormaviscosa Pityrogramma ida 836 Windham akr754 Ranker . ony ryFlsCampground, Falls Gray County: — yngam viscosa Gymnogramma Nt.e .C ao)Yatsk., Eaton) C. D. ex (Nutt. Kuf)Ytk,Wnhm&E. & Windham Yatsk., (Kaulf.) hsseishsarelatively a has species This (DUKE). Kuf)Mxnvar. Maxon (Kaulf.) U kondiploid]). [known (UT U kondiploid]). [known (UT — DK) California: (DUKE). DK) California: (DUKE). .S .California: A. S. U. cutpl 1291A Schuettpelz Nt.e .C. D. ex (Nutt. re 06 Pryer Ceropteris ut ex Nutt. Nuttall viscosa – — — 01 baof .D,P .Mglas n .J a.20.Iaeprocessing Image 2004. Ram. J. S. and Magelhaes, J. P. D., M. Abramoff, United the DEB-1405181). and and in Documentation (DEB-0717398 provided Botanical Foundation Two for was Science Institute National research species. Hunt States all this recognized the Editor-in-Chief for by the the Funding part and comments. of Editor, useful Associate status provided the conservation reviewers, of the anonymous illustration and assessing Michael beautiful help in Sigel, their the Erin for prepared glanduloviscida gramma their Yatskievych Tangerini Huiet, to George Alice Layne access and feedback. Grusz, for Winner, Smith Amanda Annette Scott Simpson, to and Tom and Metzgar, Rothfels, Jordan the Carl specimens collections, Beck, and James collect Rebman, to Service, to Jon grateful Forest also permission Ranker, are States We for research. United Service this the Park for Chico, National of States City United the Game, and atn,G .adD .Rlo 98 hiatodfrs(Pteridaceae: ferns Cheilanthoid 1998. Rollo. R. D. and J. G. Gastony, kie .17.Anwlo ttesaitclmdlidentification. model statistical the at look new A 1974. H. Akaike, at rzIln:Cñd e uro(ewe Prisoners 2008, elevation May (between -119.69948, 16 34.00659, m, Puerto 31 Ranch), del 2008, Main Cañada and May Main Harbor Island: 16 and Cruz m, Santa Harbor 31 1287A elevation Prisoners Schuettpelz -119.69948, (between 34.00659, 34.00659, Island: Puerto Ranch), Cruz 2008, Ranch), del Santa County: May Main Cañada Barbara 16 Santa and m, California: (DUKE). 31 Harbor elevation -119.69948, Prisoners (between l,K .adV rn.16.Cttxnmcosrain nthe on observations Cytotaxonomic 1960. Grant. V. and S. K. Alt, iehrt .L,J .Rhe,S .Rsel .C eiyr,adH Schneider. H. and Yesilyurt, C. J. Russell, J. and S. Rohwer, G. figures J. L., W. Colored Eiserhardt, America. North of ferns The 1879. C. D. Eaton, 2013. Schneider. H. and Leitch, J. I. Savolainen, V. Pellicer, and J. concept J., species R. Dyer, biological the of critique A 1985. J. M. Donoghue, 1970. T. Dobzhansky, eQerz .20.Seiscnet n pce delimitation. species and concepts Species 2007. K. Queiroz, de species species, of concept lineage general The 1998. K. Queiroz, analysis. de speciation and concepts 2010. Species Pryer. 1983. M. J. Cracraft, K. and Yatskievych, G. Windham, D. M. B., J. Beck, aha,S,J ot .W il .d aTre n .Sot 2011. Scott. inferences B. Systematic 1986. Ranker. and A. Torre, T. and Paris, la A. de C. S., J. D. Barrington, Hill, W. A. Moat, J. S., Bachman, esnti,J 95 ofdnelmt npyoeis napproach An phylogenies: on limits Confidence 1985. J. Felsenstein, Acknowledgments. ihImageJ. with hiatoda)i h otwsenUie ttsadadjacent and States United southwestern Mexico the in Cheilanthoideae) rnatoso uoai Control Automatic on Transactions Aliso tcBiology atic odakfern. goldback 01 vdnefrrdain fcelnhi en nteGetrCape Greater the in Region. ferns Floristic cheilanthoid of radiations for Evidence 2011. Cassino. E. S. Boston: Possessions. American America North of the British States the United of and the distribution, of Ophioglossaceae) geographical the (Including and ferns synonymy with descriptions, the in DNA size nuclear (Aspleniaceae). spore between relationship and the content and expansion size Genome alternative. phylogenetic 172 a for recommendations Press. University Columbia xodUiest Press. University Oxford and unification speciation conceptual and a 57 speciation: Pp. recommendations. of terminological process the and criteria, thology interpreting and genus fern delimitation Botany the species in evolution to polyploid approach diploids-first A 149 rmsoeadsoaesz nteferns. the in size stomate and spore Geospatial from GeoCAT: with assessments tool. threat assessment conservation list red Supporting sn h bootstrap. the using – – 159. 181. 7 131 17: 5 223 35: — :159 1: oeua hlgntcrassmn fgnrclines. generic of reassessment phylogenetic molecular a 6 879 56: – – ipooisInternational Biophotonics d.D .Hwr n .H elce.NwYork: New Berlocher. H. S. and Howard J. D. eds. , – 144. 187. 234. Brittonia M ln Biology Plant BMC Taxon DK) aiona at abr County: Barbara Santa California: (DUKE). n ayKunc rvddivlal assistance invaluable provided Krupnick Gary and – eeiso h vltoayprocess evolutionary the of Genetics cutpl 1290A Schuettpelz 886. Evolution etakteClfri eateto Fish of Department California the thank We 0 1269 60: ieaueCited Literature 2 153 12: – ZooKeys 9 783 39: – 1283. 170. slnu monanthes Asplenium 9 716 19: 3 219. 13: Astrolepis – 1 36 11: 791. 5:117 150: – – (DUKE). 723. 5in 75 mrcnFr Journal Fern American – 42. (Pteridaceae). – nls om:Species forms: Endless cutpl 1284A Schuettpelz 126. h Bryologist The e York: New . encomplex fern urn Orni- Current Systematic System- Penta- IEEE 88: 76: Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 05 CUTPL TA. AOOI EIIAINI ETGAM 643 PENTAGRAMMA IN DELIMITATION TAXONOMIC AL.: ET SCHUETTPELZ the of inheritance Maternal 1992. Yatskievych. G. and J. G. Gastony, 2015] rs,A . .D ida,adK .Pyr 09 eihrn the Deciphering 2009. Pryer. M. K. and Windham, D. M. L., A. Grusz, oaa .20.joeTs:Pyoeei oe averaging. model Phylogenetic jModelTest: 2008. D. Posada, cutpl,E n .M re.20.Eiec o eoocradiation Cenozoic a for Evidence 2009. Pryer. M. K. and E. Schuettpelz, of root the Inferring 2006. Hoot. B. S. and E. Schuettpelz, cutpl,E n .M re.20.Fr hlgn nerdfrom inferred phylogeny Fern 2007. Pryer. M. K. and E. Schuettpelz, phylo- molecular Troubleshooting 2002. Shaffer. B. H. and J. M. Sanderson, cutpl,E,A .Guz .D ida,adK .Pyr 08 The 2008. Pryer. M. K. and Windham, D. M. Grusz, L. A. E., Schuettpelz, ulebc,J . .P olak n .M eie 02 nern the Inferring 2002. Levine. M. A. and Bollback, P. J. P., J. Huelsenbeck, plants western of varieties New 1962. T. J. Howell, es .N n .A eMre us.20.A miia eto the of test empirical An 2007. Russo. Moraes De A. C. and N. P. Hess, algorithm accurate and fast, simple, A 2003. Gascuel. O. and S. Guindon, mt,D .18.Faoodaayi fthe of analysis Flavonoid 1980. M. D. Smith, Pryer. M. K. and Windham, D. M. Huiet, L. Schneider, H. E., Schuettpelz, Plastid 2006. Pryer. M. K. and Korall, P. E., Schuettpelz, atn .adG ia 98 yooyo h enfoao rsa da Tristan of flora fern the of Cytology 1968. of Vida. Analysis G. MacClade: and I. 2005. Manton, Maddison. P. W. and Outgroup R. 1984. Maddison. D. R. Maddison, D. and Donoghue, J. M. 1977. P., Sermolli. W. Pichi Maddison, G. E. R. and Löve, D. Á., Löve, Terram Circa Itinere in quas Filicum Second Enumeratio 3.1. 1824. Version F. criteria: G. and Kaulfuss, categories list red IUCN 2012. IUCN. imn,M .20.Idpnec fainetadte search. tree and alignment of Independence 2004. P. M. Simmons, mt,D . .P ri,adJ atrs.17.Ctlgcladchemi- and Cytological 1971. Santarosa. J. and Craig, P. S. M., D. Smith, ao,W .11.Suiso rpclaeia ferns 1942. american E. Mayr, tropical of Studies 1913. R. W. Maxon, io,K .adQ .Welr 90 napiiaino h phyloge- the of amplification An 1990. Wheeler. D. Q. and C. K. Nixon, aaigm .S,H cnie,adK .Pyr 07 oeua phy- Molecular 2007. Pryer. M. K. and Schneider, H. S., phyloge- N. Nagalingum, and developmental, morphological, The 1985. D. 2004. B. Smith. Mishler, R. A. and T. J. Mickel, hools n iohnra eoe ncelnhi ferns. cheilanthoid in JournalofBotany genomes mitochondrial and chloroplast rgn faoitcplpod nthe in polyploids apomictic of origins ilg n Evolution and Biology (Pteridaceae). ffrsi nagopr-oiae canopy. angiosperm-dominated USA Sciences an of Academy in National ferns of 0 etsoagaeseisadtrepatdgenes. plastid three and species 1037 leptosporangiate 400 outgroup. acceptable an of absence Botany the in alternatives ing analyses. genetic ieipoe upr o eprltosisaogferns. among relationships deep 897 for 55: support improved vide Botany atic tlt fnuclear of utility oto hlgntctree. phylogenetic a of root Botany ina oit fLondon of Society Linnean method. rooting midpoint likelihood. maximum by phylogenies Biology large estimate to lrPyoeeisadEvolution and Phylogenetics ular Evolution and Phylogenetics genera.Molecular unsampled previously of Assessing Pteridaceae: affinities family the fern and relationships overall the of phylogeny molecular A 2007. complex. hlgn n hrce vlto,vrin40.Sunderland: Sciences 4.08. Cunha. version evolution, character Associates. Sinauer and phylogeny parsimony. and analysis Harum vel Pteridophyta Omnia the Cognitas of in Satis Cnobloch. Adiectis non Caroli Sumtibus Species Lipsiae: Chamisso Animadversionibus. Permultasque Novas de Genera Adalbertus Plantarum Cl. Legit IUCN. Cambridge: and Gland edition. 8 292 58: in variation cal in rmteUie ttsNtoa Herbarium National States United the from tions ei pce concept. species netic oeei eainhp n opooia vlto ntehetero- the in evolution genus fern morphological sporous and relationships logenetic bryophytes. in concepts species 207 of basis netic Press. Garden Botanical York New York: Press. University – – 214. 1050. – – 1 258 31: :223 9: 2 696 52: rceig fteRylSceyo odn eisB Biological B, Series London. of Society Royal the of Proceedings 7:361 170: 906. 299. ultno h oryBtnclClub Botanical Torrey the of Bulletin ytmtc n h rgno species of origin the and Systematics 3 621 33: – mrcnJunlo Botany of Journal American – 224. – 270. 704. iyormatinuai.Aeia ora fBotany of Journal American triangularis. Pityrogramma 9 716 79: – nulRve fEooyadSystematics and Ecology of Review Annual au:Cramer. Vaduz: . 379. gapCp – 629. asla ytmtcBotany Systematic Marsilea. 5 1253 25: Cladistics – 722. nrsligplpodfr origins. fern polyploid resolving in ytmtcZoology Systematic 2 669 92: ytmtcBiology Systematic ilgclJunlo h ina Society. Linnean the of Journal Biological – 1256. 1 874 31: :211 6: – 674. 0:11200 106: h trdpyyso Mexico of Pteridophytyes The 4 1172 44: – hiate yavapensis Cheilanthes – 223. 879. 6 1636 96: – iyormatriangularis Pityrogramma 3 83 33: – 0:134 107: 1185. 11205. e ok Columbia York: New . — 1 32 51: 7 133 17: 2 16 32: IV. yoaooia atlas Cytotaxonomical – – 1645. h Bryologist The rceig fthe of Proceedings — 103. efeso Western of Leaflets – – – 43. o 4. no. – 145. atpA Isoëtes 25. 179. 3 49 33: Systematic Systematic Taxon aapro- data Molecular Contribu- Explor- : American complex System- .New Molec- – Taxon 72. 56: 88: .,N ,- ,diploid -, -, diploid -, -, -, N, -, N, 1.2, 1.6, ± 34.3 T, S, diploid diploid KR132675/KR132676, -, KR132620, -, -, N, 1.3, hee,W .19.Ncecai eunepyoeyadrandom and phylogeny sequence acid Nucleic 1990. C. W. Wheeler, .,N ,- ,diploid -, -, -, N, 1.1, R360K127,diploid KR132670/KR132671, DK) ,V ,- R639 R368 R368K126,diploid KR132668/KR132669, KR132618, KR066339, -, viscosa P. -, V, V, (DUKE), R366K126,alttali resembling allotetraploid KR132666/KR132667, 171 Metzgar ida,M .adG asivc.20.Crmsm tde of studies Chromosome 2003. Yatskievych. G. and D. M. Windham, eteb,C .12.Vreisof Varieties 1920. A. C. Weatherby, diploid 2.4,N,-,-,-,diploid .pallida P. ida,M . .Hit .Shetez .L rs,C ohes .Beck, J. Rothfels, C. Grusz, L. A. Schuettpelz, E. Huiet, L. D., M. Windham, R= ,- uoerpodresembling autotetraploid diploid -, diploid -, -, -, -, -, -, -, N, 2.5, N, 2.0, ± 41.5 inr .L n .G ipo.20.Anwsbpce of subspecies new A 2007. Simpson. G. M. and L. A. Winner, pr iema tnaddvain( deviation standard ± mean size spore R361K128,diploid KR132681/KR132682, opeevuhrifrainfrec pcmni rvddi h main the in provided Treatment). is (Taxonomic specimen text here. each summarized for conclu- conclusions information concerning taxonomic voucher rationale Complete our for text and main numbers, See sion. accession GenBank segment mixed), copy) = X malformed; akr .G 96 yoaooi uvyo h trdpye of Pteridophytes the of survey cytotaxonomic A 1966. G. parsi- T. Walker, using analysis 1986. Phylogenetic A. Takhtajan, PAUP*. 2002. L. D. Swofford, olnee,E,V .Dez .Shlig .FveBni,adD M. D. and Favre-Bonvin, J. Schilling, G. holo- Dietz, the H. of V. chemoidentity E., The Wollenweber, 1981. Smith. M. D. and farina E. the Wollenweber, in patterns Flavonoid 1980. Dietz. H. V. and E. Wollenweber, akr .G 94 hoooe n vlto npteridophytes. in evolution and Chromosomes 1984. G. T. Walker, olnee,E,V .Dez .M mt,adD .Silr 1979. Seigler. S. D. and Smith, M. D. Dietz, H. V. E., Wollenweber, asivc,G n .D ida.1993. Windham. D. M. and G. Yatskievych, asivc,G,M .Wnhm n .Wlewbr 90 reconsid- A 1990. Wollenweber. E. and Windham, D. M. G., Yatskievych, ntecretsuy = G study: current the prior on recent its most subsp. = indicate the M first in subsp. 2007): we recognized Simpson taxa specimen, maxonii and the (Winner each on classification For based analyses. morphotype phylogenetic or ek1098 Beck Appendix .rebmanii P. outgroups. 113 hiatodfrs(trdca:Celnhiee rmtewestern the Mexico. and from States Cheilanthoideae) United (Pteridaceae: ferns cheilanthoid N eune orda eei onaisaddmsiyspecies ferns. demystify cheilanthoid and boundaries in generic complexes redraw to sequences DNA G.Yatskievych,andK.M.Pryer.2009.Usingplastidandnuclear etgam triangularis Pentagramma Jamaica. Sunderland: 10. beta Press. 4.0 California version methods) Associates. other Sinauer (*and mony mt.18.Faood rmceoye fteglbc fern, goldback the of chemotypes Phytochemistry from triangularis. Pityrogramma Flavonoids 1985. Smith. of type ferns. silverback Ecology and ferns goldenback of p 101 Pp. oe -ehltddhdohloefrom var. dihydrochalcone C-methylated novel A d.A .Sam n .Sam.Bc ao:CCPress. CRC Raton: Boca Sharma. A. and Sharma K. A. eds. rto ftegenus the of eration Press. University Oxford York: New America Committee. North of Flora America. semipallida viscosa ;P= .triangularis P. – ; ; ics.Zishitfe Naturforschung fuer Zeitschrift viscosa. 120. elr8141 Heller eza 179 Metzgar – iyormatinuai.Aeia enJournal Fern American triangularis. Pityrogramma .pallida P. :21 8: eas rvd h opoyefrec pcmnbased specimen each for morphotype the provide also We . 4 in 141 rnatoso h oa oit fEdinburgh of Society Royal the of Transactions .Seiesof Specimens 1. ;T= mrcnFr Journal Fern American DK) ,R 70±38 ,K063,KR132617, KR066338, X, 3.8, ± 47.0 R, R, (DUKE), DK) ,T 90±12 ,K063,KR132616, KR066337, N, 1.2, ± 39.0 T, T, (DUKE), Cladistics ;T= – 33. .triangularis P. hoooe neouino uaytcgroups eukaryotic of evolution in Chromosomes .rbmanii m reb P. lrsi ein fteworld the of regions Floristic ;R= .maxonii P. ; .maxonii P. .viscosa P. M) ,P 17±18 ,- ,- diploid -, -, -, N, 1.8, ± 31.7 P, P, (MO), elr8141 Heller .triangularis P. DK) ,T 52±19 ,K064,KR132619, KR066340, N, 1.9, ± 35.2 T, T, (DUKE), .triangularis P. :363 6: atpA .glanduloviscida P. .triangularis P. Pityrogramma o.2 d lr fNrhAeiaEditorial America North of Flora ed. 2, vol. , .maxonii P. (Pteridaceae). .triangularis P. ; ; ; .maxonii P. .triangularis P. ; emn11483 Rebman mrcnJunlo Botany of Journal American Pentagramma – hmsos.n. Chamisso region, .triangularis P. re 06-01 Pryer ;V= lmr3271 Blumer 368. G) ,P 07±19 ,- ,- diploid -, -, -, N, 1.9, ± 30.7 P, P, (GH), iyormatinuai.Rhodora triangularis. Pityrogramma 0 9 80: AmericanFernJournal ; subsp. .viscosa P. emn11483 Rebman ; μ trnG-R subsp. ) pr om( oml = L normal; = (N form spore m), lmr3271 Blumer ; Ainaee nwsenNorth western in (Adiantaceae) – .triangularis P. lmr3271 Blumer 17. ;M= ; triangularis Madroño ; DK) ,T ,- KR066341, -, -, T, T, (DUKE), Pentagramma utl s.n. Nuttall ; 4 876 34: M) ,M 35±23 ,-, X, 2.3, ± 43.5 M, M, (MO), B,T ,4. .,N ,- -, -, -, N, 2.2, ± 42.0 T, T, (B), nlddi u pr and/ spore our in included lmr3271 Blumer S) ,R 76±20 ,- -, -, N, 2.0, ± 37.6 R, R, (SD), 4 965 24: akr754 Ranker hn els a available) (as list we Then, . iceia ytmtc and Systematics Biochemical rebmanii ein and region, ekly nvriyof University Berkeley: . .rebmanii P. .maxonii P. iyormatriangularis Pityrogramma – .triangularis P. – 4 345 54: 877. RA,R ,3. ± 36.8 R, R, (RSA), G) ,M 24± 42.4 M, M, (GH), 971. ;V= U) ,M 04± 40.4 M, M, (US), ; ;S= (PH),V,V,42.5± akr753 Ranker (UT),T,T,39.6± p 149 Pp. . 9 128 99: 6 169 66: 0 1788 90: AI) ,M, M, (ARIZ), ;P= ; – .triangularis P. .triangularis P. 1 120. 71: gapCp 353. eza 172 Metzgar oue2, Volume .pallida P. .pallida P. – – 132. 237. – – subsp. 5 in 151 (short 1800. (UT), 22: ; ; Delivered by Ingenta to: Michael Simpson IP: 146.244.226.49 on: Tue, 13 Dec 2016 20:40:50 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 74±13 ,K066,K124,K121/R374 diploid KR132713/KR132714, KR132643, KR066364, N, 1.3, ± 37.4 ,M 10±20 ,K064,K122,K127/R360 diploid KR132679/KR132680, KR132625, KR066346, N, maxonii 2.0, P. ± 41.0 M, M, R366 loerpodresembling allotetraploid KR132686, 1231A 4 YTMTCBTN Vlm 40 [Volume BOTANY SYSTEMATIC diploid KR132739/KR132740, KR132621, diploid -, 644 DK) ,T ,L R633 R362 KR132710/KR132711/KR132712, resembling KR132642, KR066363, allotriploid L, -, T, T, diploid (DUKE), KR132709, KR132641, KR066362, diploid KR132708, diploid KR132706, KR132639, 1287A KR066360, N, 1.6, R361 R361 diploid KR132691, KR132631, .,N R630 R369 R369 diploid loid KR132689, KR132629, 1247A KR066350, N, 1.7, allotetra- KR132687/KR132688, KR132628, KR066349, resembling N, ploid 1.6, ± 43.7 M, M, resembling hybrid KR132683/KR132684, KR132626, diploid KR132677/KR132678, KR132624, 27±21 ,K064,K122,K124/R375 autotetraploid KR132744/KR132745, KR132741/KR132742/KR132743, KR132623, KR066344, KR132622, resembling N, 2.1, KR066343, ± -, 42.7 -, resembling G, autotetraploid M, (SD), ,R 71±18 ,K065,K123,K129/R363 diploid KR132692/KR132693, KR132632, KR066353, ii an N, bm re 1.8, ± P. 37.1 R, R, R367 diploid KR132697, 1266A diploid KR132694/KR132695, KR132633, 24±17 ,K065,K123,K129/R369 autotriploid KR132698/KR132699, KR132635, KR066356, X, resembling 1.7, ± 52.4 R638 R367 R372K120,diploid KR132702/KR132703, KR132637, KR066358, resem- autotetraploid KR132700/KR132701, bling KR132636, KR066357, N, 1.8, R375 diploid KR132705, 1282A .r ma ii an bm re P. .glanduloviscida P. DK) ,R 03±13 ,K065,K123,K129,dip- KR132690, KR132630, KR066351, N, 1.3, ± 40.3 R, R, (DUKE), DK) ,M 42±18 ,K064,K122,KR132685/ KR132627, KR066348, N, 1.8, ± 44.2 M, M, (DUKE), DK) ,G 90±13 ,K065,K123,KR132696/ KR132634, KR066355, N, 1.3, ± 39.0 G, M, (DUKE), DK) ,V 84±17 ,K066,K124,KR132707/ KR132640, KR066361, N, 1.7, ± 38.4 V, V, (DUKE), DK) ,T 14±17 ,K065,K123,KR132704/ KR132638, KR066359, N, 1.7, ± 41.4 T, T, (DUKE), ; .rbanii rebma P. ; .maxonii P. cutpl 1229A Schuettpelz .glanduloviscida P. cutpl 1264A Schuettpelz ; cutpl 1254A Schuettpelz .maxonii P. .viscosa P. .triangularis P. .glanduloviscida P. ; ; emn13506 Rebman emn8919 Rebman ; .triangularis P. cutpl 1277A Schuettpelz ; .glanduloviscida P. cutpl 1290A Schuettpelz ; ; DK) ,M 24±18 ,KR066347, N, 1.8, ± 42.4 M, M, (DUKE), cutpl 1242A Schuettpelz DK) ,G 05±15 ,KR066354, N, 1.5, ± 40.5 G, M, (DUKE), cutpl 1269A Schuettpelz .triangularis P. ; cutpl 1284A Schuettpelz DK) ,T 52±14 ,KR066352, N, 1.4, ± 35.2 T, T, (DUKE), M) ,R 97±26 ,KR066345, N, 2.6, ± 39.7 R, R, (MO), (SD),M,G,38.1±1.7,N,KR066342, .maxonii P. ; ; cutpl 1268A Schuettpelz cutpl 1297A Schuettpelz .r ma ii an bm re P. .glanduloviscida P. .glanduloviscida P. (DUKE),T,T,36.7±1.3,N, .viscosa P. ; ; ; emn17278 Rebman DK) ,V 93±13 N, 1.3, ± 39.3 V, V, (DUKE), cutpl 1257A Schuettpelz cutpl 1240A Schuettpelz DK) ,M 00± 40.0 M, M, (DUKE), .triangularisP. DK) ,G 31± 43.1 G, M, (DUKE), ; .maxonii P. .viscosa P. ohes2570 Rothfels .maxonii P. (DUKE),V,V,34.8± ; cutpl 1291A Schuettpelz DK) ,G, M, (DUKE), ; (DUKE),V,V, emn14051 Rebman ; ; (SD),M,M, ; ; ; Schuettpelz Schuettpelz Schuettpelz Schuettpelz Schuettpelz (DUKE), (DUKE), (DUKE), R370 uoerpodresembling autotetraploid KR132720, 1312A resembling autohexaploid KR132717/KR132718, 1302A Schuettpelz resembling autohexaploid KR132715/KR132716, KR132644, ,P 55±11 ,K067,K124,K122/R374 diploid KR132723/KR132724, KR132649, KR066370, N, pallida 1.1, diploid P. ± KR132721, 35.5 KR132647, P, P, KR066368, diploid N, KR132722, 1.5, KR132648, ± triangularis 40.1 P. T, T, (DUKE), viscosa P. ,P ,- R634 R363 R379K123,diploid KR132729/KR132730, KR132653, diploid KR066374, -, KR132727, -, KR132651, P, KR066372, P, diploid N, KR132728, 1.3, KR132652, ± 39.8 triangularis P. T, S, (DUKE), diploid KR132725/KR132726, KR132650, R368 R364K126,diploid KR132664/KR132665, KR132662/KR132663, KR132658, KR132657, KR066378, N, 1.4, diploid ± 41.3 M, M, (DUKE), diploid KR132731/KR132732, 1353A Schuettpelz R366 R375K123,diploid diploid KR132733/KR132734, KR132735/KR132736, KR132655, KR132656, KR066376, N, triangularis 1.3, P. ± 37.9 T, S, ,- R630 R369 R377K123,diploid KR132737/KR132738, KR132659, KR066380, -, -, .,X ,- ,attili resembling autotriploid -, 45.2±1.5,N,-,-,-,autotetraploidresembling -, -, X, 3.1, diploid KR132672, KR132661, diploid KR132674, 3431 337 Windham U) ,G 38±19 ,- ,- diploid -, -, -, N, 1.9, ± 33.8 G, M, (UT), ,T 72±11 ,- ,- diploid -, -, -, 38.1±1.4,N,-,-,-,diploid N, 1.1, diploid ± -, -, 37.2 T, -, T, N, 1.3, ± 33.9 T, T, (UT), resembling autotetraploid -, -, -, N, 836 2.7, ± 42.6 M, M, U) ,T 07±23 ,- ,- diploid -, -, -, N, 2.3, ± 40.7 T, T, (UT), DK) ,T 84±15 ,K068,K126,KR132673/ KR132660, KR066381, N, 1.5, ± 38.4 T, T, (DUKE), DK) ,T 79±16 ,K066,K124,KR132719/ KR132646, KR066367, N, 1.6, ± 47.9 T, T, (DUKE), .maxonii P. ; ; cutpl 1332A Schuettpelz cutpl 1298A Schuettpelz ; ; ; U) ,M 05±15 ,- ,- diploid -, -, -, N, 1.5, ± 40.5 M, M, (UT), cutpl 1317A Schuettpelz cutpl 1347A Schuettpelz cutpl 1364A Schuettpelz ; .tiagua is ular ang tri P. cutpl 473 Schuettpelz DK) ,T 95±17 ,K066,KR132645, KR066366, N, 1.7, ± 49.5 T, T, (DUKE), DK) ,T 39±20 ,K067,KR132654, KR066375, N, 2.0, ± 33.9 T, T, (DUKE), .triangularis P. .pallida P. DK) ,T 18±19 ,KR066371, N, 1.9, ± 31.8 T, T, (DUKE), DK) ,T 94±15 ,KR066365, N, 1.5, ± 49.4 T, T, (DUKE), ; .triangularis P. .triangularis P. .triangularis P. ida 3433 Windham .triangularis P. DK) ,T 99±19 ,KR066369, N, 1.9, ± 39.9 T, T, (DUKE), DK) ,T 94±17 ,KR066373, N, 1.7, ± 39.4 T, T, (DUKE), DK) ,M 81±12 ,KR066379, N, 1.2, ± 38.1 M, M, (DUKE), DK) ,T 01±19 ,KR066377, X, 1.9, ± 40.1 T, T, (DUKE), .maonii axo m P. .triangularis P. ; ida 446 Windham .glanduloviscida P. .triangularis P. . .maxonii P. .triangularis P. .triangularis P. .triangularis P. .m o ii xon ma P. ; ; ; ; (DUKE),P,P,-,-,KR066382, cutpl 1327A Schuettpelz cutpl 1350A Schuettpelz cutpl 1358A Schuettpelz ; ida 98-108 Windham ida 447 Windham .triangularis P. ; ; ida 98-101 Windham DK) ,M 90± 49.0 M, M, (DUKE), mt 9 Smith .maxonii P. ; .maxonii P. ; ; ida 773 Windham cutpl 1316A Schuettpelz ; ; cutpl 1346A Schuettpelz ; ida 98-084 Windham ida 98-096 Windham cutpl 445 Schuettpelz .triangularis P. .triangularis P. DK) ,T, T, (DUKE), (UT),M,M, ; ; Schuettpelz ; (UT),T,T, .pallida P. Windham Windham (DUKE), (DUKE), (DUKE), (UT), (UT), ; ; ;