Deformation to Users
DEFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.
The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.
Photographs included in the original manuscript have been reproduced xerographically in this copy. Kgher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appealing in this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell InfoTmation Company 300 North Zeeb Road, Ann Arbor MI 48106-1346 USA 313/761-4700 800/521-0600
MOLECULAR AND ENZYMOLOGICAL ANALYSIS OF L-HISTIDINE
NON-UTILIZING MUTANTS OF STREPTOMYCES GRISEUS
DISSERTATION
Presented in Partial Fulfillment of the Requirement for
the Degree of Doctor of Philosophy in the Graduate
School of the Ohio State University
By
KanurV. Srinivasan, B.Sc., M.S.
The Ohio State University
1997
Dissertation Committe Approved By
Charles J. Daniels
Kathleen E. Kendrick, Adviser
Joseph A. Krzycki Adviser
F. Robert Tabita Department of Microbiology UMI Number: 9721164
UMI Microform 9721164 Copyright 1997, by UMI Company. All rights reserved.
This microform edition is protected against unauthorized copying under Title 17, United States Code.
UMI 300 North Zeeb Road Ann Arbor, MI 48103 ABSTRACT
Histidine ammonia-lyase (histidase) catalyzes the non-oxidative (3- eiimination of the a-amino group of L-histidine to yield urocanate and ammonia.
Two Hut" mutant strains of Streptomyœs griseus, SKK896 and SKK906, that were unable to utilize L-histidine as nitrogen source do not make histidase. hutHÿ^ contained a missense mutation in the histidase structural gene (A223N histidase) and restored histidase activity to transformants of SKK896 and
SKK906. In contrast, hutHgog (S426F histidase) restored histidase activity only to
SKK896 transformants. In recombinant strains containing the mutant hutH alleles integrated in the chromosome, the identified mutations were responsible for the
Hut' phenotypes of SKK896 and SKK906. The missense mutation in SKK896 might be responsible for the reduced amount of hutH transcript in this strain.
A223N histidase was active when synthesized in E. coli but had a higher K^, and reduced thermostability when compared to the wild-type histidase. S426F histidase was inactive and highly unstable when expressed in E. coli. DEDICATION
To my parents
III ACKNOWLEDGMENTS
I would like to express my deep sense of gratitude to my advisor, Dr. Kathleen
E. Kendrick, for her encouragement and guidance during my stay in this lab. I
Also thank my Committee members, Drs, Charles Daniels, Joseph Krizycki, and
F. Robert Tabita for their advice and suggestions regarding this project. I am indebted to my colleagues, past and present, for their help and suggestions. I thank my friend G. Convey for his help. Finally I owe my gratitude to my family for their faith and unfailing support during this endeavor.
IV VITA
March 14.1964...... Bom—Madras, India
1982-1986 ...... B.Sc in Agricultural Sciences Bangalore, India
1986-1989 ...... M.S. In Agricultural Microbiology Bangalore, India
1990-present...... Graduate Teaching and Research Associate,
Department of Microbiology, The Ohio State university,
Columbus, Ohio
PUBLICATION
Wu P.C., K.V., Srinivasan, and K.E. Kendrick. 1995. Regulated expression of the
histidase structural gene In Streptomyœs griseus. J. Bacteriol. 177:854-857.
FIELDS OF STUDY
Major Field: Microbiology
Studies in gene regulation in streptomycetes. Dr. Kathleen E. Kendrick TABLE OF CONTENTS
ABSTRACT...... ii
DEDICATION...... iii
ACKNOWLEDGMENTS...... iv
VITA ...... V
LIST OF TABLES...... x
LIST OF FIGURES...... xii
CHAPTERS;
1 INTRODUCTION...... 1
Metabolism of amino acids in Streptomyœs...... 1
Catabolism of L-histidine ...... 6
The active site of histidase ...... 9
hwf gene organization and regulation ...... 14
Kinetic properties of streptomycete histidase ...... 24
Goals of this project ...... 27
2 MATERIALS AND METHODS ...... 28
Bacterial strains ...... 28
Plasmid vectors ...... 28
VI Media and culture conditions ...... 31
Recombinant DNA techniques ...... 34
isolation and manipulation of DNA ...... 34
Ligation reactions ...... 35
Nucleotide sequence determination ...... 35
PCR amplification of DNA fragments ...... 35
Dideoxy chain-termination m ethod ...... 36
fmo/method ...... 38
ABI Prism Dye Terminator Cycle sequencing method ...... 38
Transformation ...... 39
Preparation of cell extracts and enzyme a ssa y s ...... 41
Preparation of crude extracts ...... 41
Assay of histidase and urocanase activities ...... 41
Immunoblot techniques ...... 42
SDS-PAGE and immunoblot assay ...... 42
Preparation of monospecefic antibodies ...... 43
Generation of recombinant strains ...... 43
Protoplast fusion ...... 43
Allele exchange...... 44
Hybridization reactions ...... 45
Colony hybridization ...... 45
Slot Blot hybridization ...... 46
vii Northern hybridization ...... 47
Overexpression of histidase ...... 50
Streptomycin bioassay ...... 51
3 RESULTS ...... 52
Characterization of SKK906 ...... 52
Enzyme and immunoblot analyses ...... 52
Characterization of the mutation in SKK906 ...... 53
Complementation studies ...... 57
Characterization of/jufHgos ...... 62
Characterization of revenants of SKK906 ...... 69
Allele exchange...... 75
Charactrization of SKK896 ...... 82
Enzyme and immunoblot analyses ...... 82
Complementation studies ...... 83
Characterization of recombinant strains ...... 86
Analysis of hutH transcript in wild-type and mutant stra in s ...... 90
Overexpression and characterization of recombinant histidase ...... 93
Enzyme and immunoblot analyses ...... 93
Kinetic studies of overexpressed histidase ...... 106
Negative regulation of hutH expression ...... 109
4 DISCUSSION...... 118
Characterization of SKK906 ...... 118
viii Characterization of s KK896 ...... 127
Overexpression of histidase in E. co li...... 134
Negative regulation of hutH expression ...... 135
LITERATURE CITED ...... 137
APPENDICES...... 146
A Alignment of histidases and phenylalanine ammonla-lyases ...... 146
B Identification of the inducer of Hut enzymes in S. g rise u s...... 154
C Kinetic studies of Pseudomonas histidase ...... 157
D Maps of plasmid vectors used in this study ...... 160
E List of plasmids constructed in this study ...... 169
IX LIST OF TABLES
Table Title Page
1 Bacterial strains used in this study ...... 29
2 Plasmid vectors used in this study ...... 30
3 Media used in this study ...... 32
4 Oligonucleotides used in this study ...... 36
5 Enzyme activities in wild-type and Hut* strains of S. griseus
grown under inducing conditions ...... 54
6 Linkage of analysis of Hut* and Str phenotype in SKK906 ...... 58
7 Relative specific activities of histidase and urocanase in
transformants, containing plJ702-derived vectors grown under
inducing conditions ...... 61
8 Relative specific activities of histidase and urocanase in
transformants containing pXE4-derived vectors grown under
inducing conditions ...... 65
9 Relative enzyme activity of wild-type and recombinant strains grown
under inducing conditions ...... 81
10 Histidase activity of E. coli BL21 (DE3) extracts conatining wild-type
and mutant histidase ...... 105 11 Relative specific activities of histidase and urocanase in
transformants containing plJ702-derived vectors grown under
non-inducing conditions ...... 115
12 Relative specific activities of histidase and urocanase in
transformants containing pXE4-derived vectors grown under
non-inducing conditions ...... 116
13 Urocanase activity of strain SKK306 in the presence and absence of
inducer ...... 156
14 List of plasmids constructed in this study ...... 170
XI LIST OF FIGURES
Figure Title Page
1 Fate of amino acids in streptomycetes ...... 2
2 Pathways of L-histidine utilization in bacteria ...... 7
3 Alignment of the conserved serine residue in histidase and
phenylalanine ammonia-lyase, that is implicated in the formation of
dehydroalanine ...... 13
4 Organization of hut genes in bacteria ...... 15
5 Immunoblot of crude extracts of wild-type and Huf strains ...... 55
6 Plasmids used In transformation studies to determine extent
of recovery of histidase activity in mutant strains ...... 59
7 Restriction map of pKK615 ...... 63
8 Nucleotide sequence of the region of hutH showing the missense
mutation ICC to TTC in SKK906 ...... 67
9 Procedure to obtain Hut* revertants of SKK906 ...... 70
10 Temporal increase in histidase activity in SKK302 ...... 73
11 Method of isolation of recombinant strain by allele exchange ...... 74
XII 12 Slot blot analysis of recombinant strains to confirm the absence 1 of
plJ702 ...... 79
13 Nucleotide sequence of the region of hutH showing the missense
mutation GAC to AAC in SKK896 ...... 87
14 Northern blot of the hutH transcript in the wild-type and mutant strains 91
15 Northern blot comparing the amount of hutH transcript in the wild-type
and recombinant strains ...... 94
16 Construction of plasmids to express wild-type and mutant histidase from
S. gnseus in E. coli BL21(DE3)...... 96
17 Accumulation of histidase directed by T7 RNA polymerase ...... 99
18 Hysteretic histidase from S. griseus...... 101
19 Immunoblots of crude extract of E. coli BL21 (DE3) extract containing
overexpressed histidase ...... 103
20 Kinetics of histidase overexpressed in E. coli BL21 (DE3) ...... 107
21 Thermostability of wild-type and Asp223Asn histidase expressed in
E. coli ...... 110
22 Negative regulation of histidase expression ...... 113
23 Alignment of deduced amino acid sequences from seven histidases and
the consensus sequence of phenylalanine ammonia-lyase ...... 147
24 Lineweaver-burk plot of histidase activity at various concentrations of
histidinol p h o sp h ate...... 158
XIII 25 Circular map of plJ702 ...... 161
26 Circular map of pX E 4 ...... 163
27 Circular map of plJ2925 ...... 165
28 Circular map of pT7-7 ...... 167
XIV CHAPTER 1
INTRODUCTION
I. Metabolism of amino acids in Streptomyœs
Amino acids are essential for the growth of all organisms because they are directly incorporated into polypeptides during protein synthesis. In some organisms amino acids can also serve as carbon, nitrogen, or energy sources.
Certain amino acids are precursors of antibiotics produced by actinomycetes
(Fig. 1 ). These amino acids either can be condensed to form peptide or P-lactam antibiotics (Brana et al., 1988), or can serve as amino donors as is the case for many aminocyclitol and aminoglycoside antibiotics. Macrolide antibiotics such as tylosin that do not have nitrogen in their aglycone moiety utilize amino acids as carbon precursors of the macrolide ring (Braha et a!., 1988). The antibiotic nikkomycin, a chitin synthase inhibitor produced by Streptomyces tendae
(Bormann et al., 1989; Rocs et al., 1992), utilizes L-histidine as a precursor of the carbon skeleton. These observations suggest that amino acid metabolism in
Streptomyces is complex, and the availability and nature of the nitrogen source in the growth medium influence the enzymes synthesized in both primary and FIG. 1. Fate of amino acids in streptomycetes. protein
amino acids transport = 4 > AMINO ACIDS NK biosynthesis "ST antibiotics intermediates other nitrogenous compounds
glutamate
Figure 1 secondary metabolic pathways. Bascaran etal. (1989) isolated mutants of S.
clavuligerus that were simultaneously deregulated for the formation of the
nitrogen-metabolizing enzymes arginase, ornithine aminotransferase, urease,
and glutamine synthetase (GS). GS activity was also altered in S. clavuligerus
strains that were deregulated in nitrogen-catabolizing enzymes, suggesting that
GS plays an important role in the regulation of enzymes involved in nitrogen
metabolism (Bascaran etal., 1989). This pleiotropy suggested a common
regulatory linkage of amino acid-metabolizing enzymes
The specific role of the catabolism of amino acids in antibiotic
biosynthesis has been studied in only a few cases. Spiramycin is a 16-
membered macrolide antibiotic, the synthesis of which is closely linked to
nitrogen metabolism. In the absence of exogenous propionate, the catabolism of
branched chain amino acids leads to the synthesis of propionyl- and 2-
methylmalonyl-CoA, which are precursors of spiramycin (Tang et al., 1994). The
production of spiramycin is stimulated by the catabolism of certain amino acids
such as valine, leucine, isoleucine, and lysine and is linked to nitrogen control
because in the presence of ammonium ions the synthesis of macrolide rings is
greatly reduced (Tang etal., 1994). Valine dehydrogenase, the first enzyme of the valine and isoleucine catabolic pathways, catalyzes the reversible oxidative deamination of these amino acids to yield the corresponding 2-keto acids
(Nguyen etal., 1995a). Depending upon the Streptomyces species, valine dehydrogenase can exist in a dimeric, tetrameric, or dodecameric form (Nguyen etal., 1995a). The presence of exogenous ammonium ions repressed the synthesis of valine dehydrogenase, which resulted in the lower level of precursors for the synthesis of the macrolide (Lounes et al., 1992). The disruption of the valine dehydrogenase gene prevented the biosynthesis of spiramycin in S. ambofaciens and tylosin in S. fradiae (Tang et al., 1994). These results demonstrate that the biosynthesis of some macrolides is linked to nitrogen control even though the amino acids serve as precursors of the carbon skeleton rather than the nitrogen in the antibiotics (Brana et al., 1988).
The amino acid proline is a precursor of undecylprodigiosin and a number of related compounds (Hood etal., 1991). Mutations leading to the loss of proline catabolic activities in S. coe//co/or A3(2) resulted in the increased production of undecylprodigiosin (Hood etal., 1992). Two enzymes required for the degradation of proline in S. coe//co/orA3(2), proline oxidase and pyrroline-5- carboxylate dehydrogenase, are not in a multi-enzyme complex characterstic of enteric bacteria (Hood etal., 1992). Proline oxidase is membrane-bound and differs from the corresponding enzyme of the enteric bacteria in this regard
(Hood etal., 1992). The proline-catabolizing enzymes are constitutive in S. coe//co/or A3(2) and not subject to glucose repression. Both of the enzymes involved in proline utilization are expressed during growth on proline, but the presence of ammonium ions as nitrogen source represses their activities. As the results of the above experiments Indicate, the expression of enzymes involved in amino acid catabolism in Streptomyœs seems to be distinctly different from that of the enteric bacteria and other gram-positive bacteria. In addition the catabolism of amino acids like valine and isoleucine has a direct effect on the activity of secondary metabolic pathways.
II. Catabolism of L-histidine
In bacteria the dissimilation of L-histidine occurs via two different pathways (Fig. 2). In Bacillus subtilis, Klebsiella aerogenes, and Salmonella typhimurium, L-histidine is catabolized via a four enzyme pathway to produce glutamate, formamide, and ammonia (Chasin and Magasanik, 1978; Magasanik,
1978). In contrast, in Pseudomonas putida and Streptomyœs griseus L-histidine is catabolized to the end products glutamate, formate, and ammonia by the use of five enzymes (Coote and Hassall, 1973; Kendrick and Wheelis, 1982). The first enzyme of both pathways is histidine ammonia-lyase (EC 4.3.1.3; histidase).
Histidase has been purified from a variety of bacteria including Achromobacter liquidum (Shibatni etal., 1975), S. griseus (Wu etal., 1992), Haloferax volcanii
(Kauri etal., 1993), and higher animals including human (Givot etal., 1969), monkey (Dhanam and Radhakrishnan, 1974), and rat (Taylor e t al., 1990). In mammals histidase is detected in the liver and epidermis (Suchi et al., 1993). In contrast to the bacterial systems where histidase enables the bacteria to utilize
L-histidine as a nitrogen or carbon source, the fundamental role of histidase in FIG. 2. Pathways of L-histidine utilization in bacteria. Pathway 1 is found in
Bacillus subtilis and the enteric bacteria, whereas pathway 2 is
found in the pseudomonads and streptomycetes. H H ^C^C-COOH / A KlHzA h,
y r 4 L-Histidine > ^istidase H -Ç=C-COOH f H v s H ,0 Urocanic Acid urocanase H H -é-C-COOH H k V h y Imidazolonepropionic Acid H H imidazolonepropionateimic HOOC — C~C —C~ COOH ^ hydrolase hvd H H NH H,0 formiminoglutamate h n = c h iminohydrolase 2 N-Formlmlno-L-Glutamlc Acid H H H formlmlnoglutamate H,0 HOOC — Ç -Ç - C - COOH formlminohydroiase HN H A A CONH 1 N-Formyiglutamic Acid
H H H formyiglutamase HOOC — C -Ô -C -C O O H N H A iHCOOH Hz L-Glutamic Acid
Figure 2
8 humans is the formation of urocanate (Suchi et al., 1995). Histidase deficiency in
humans results in the condition histidinemia, which is characterized by the
accumulation of histidine as well as the deficiency in urocanic acid in body fluids
(Suchi et al., 1993). Histidinemia remains the most frequent (1:8400) inborn metabolic error in Japan. Although not usually lethal, histidinemia can be lethal when coupled with perinatal hypoxia (Suchi ef a/.,1993).
Histidase catalyzes the (3-elimination of ammonia from L-histidine to produce urocanic acid (Furuta ef a/., 1991,1992). Although previously it was thought that the (3-elimination proceeded by a concerted reaction mechanism
(Givot and Abeles, 1974), Furuta et ai. (1991 ) recently demonstrated that the elimination of ammonia occurs by a stepwise mechanism via a carbanion intermediate, resulting in the production of urocanate. The authors demonstrated that the enzyme-catalyzed hydrogen exchange occurred at the C-5' position of urocanic acid formed by the reaction of doubly labeled histidine (L-[3,3,5'-^H3,3-
^®N]histidine) with the enzyme.
III. The active site of histidase
On the basis of the inactivation of histidase by various nucleophilic reagents, an electrophilic center is implicated in the active site of histidase
(Peterkofsky,1961; Givot et ai, 1970; Klee et ai, 1978). Various researchers have identified a dehydroalanine residue (NHCsCHzCOO ) as the electrophilic center that is required for the activity of histidase (Consevage and Phillips, 1985;
Langer e t al., 1994). The identification of the dehydroalanine residue was made
on the basis of recovery of [^H] alanine after hydrolysis of histidase that was
inactivated with NaB^H^ (Hanson and Havir, 1970). Similarly, histidase treated
with Na’^CN yielded [4-’^C] aspartate after acid hydrolysis (Hodgins, 1971), and
nitro[’'’C]methane-inactivated histidase produced a radiolabeled enzyme that,
when subjected to catalytic hydrogenation and acid hydrolysis, released 2,4-
diamino[^'*C]butyrate (Givot eta!., 1969). Since inactivation by these reagents was prevented when the enzyme was first incubated with substrate or substrate
analog, the dehydroalanine residue is likely to be present in the active site
(Givot eta!., 1969; Havir and Hanson, 1975).
Consevage and Phillips (1985) reported that the dehydroalanine residue arises in histidase by a mechanism involving sulfur elimination. The formation of dehydroalanine was postulated to be autocatalytic because mammalian and bacterial histidases synthesized in COS cells and E. œil, respectively, are active and contain dehydroalanine residues (Taylor and Mclnnes, 1994). An alternative possibility is that the formation of dehydroalanine is an enzymatic process'and COS cells and £ co//contain such an enzyme that converts key residues of enzymes into dehydroalanine. There is a well documented example in E. coll where the formation of dehydroalanine is enzymatic and not due to a spontaneous mechanism, in E. coli, in the process of conversion of seryl-
10 tRNA^^A to selenocysteyl-tRNAg^A by the product of selA, an amlnoacrylyl- tRNAu^A intermediate is formed due to 2,3-elimination of a water molecule from the a-amino group of L-serine, resulting in the formation of dehydroalanine.
(Forchhammer and Bock, 1990; Forchhammer ef a/., 1990). A dehydroalanine residue is also essential for the activity of the peptide antibiotics subtilin produced by B. subtilis (Liu and Hansen, 1992) and gramicidin produced by S. brevis ATCC9999 ( Schlumbohm efal., 1991). In both of these instances a serine residue is postulated to be the precursor of the dehydroalanine residue.
More recent studies have identified a serine residue that is implicated as the precursor of dehydroalanine in histidase (Hernandez and Phillips, 1994).
Histidase from P. putida is inactivated irreversibly upon incubation with
L-cysteine in the presence of Og and at high pH (Klee ef a/., 1974). The L- cysteine-inactivated enzyme formed an enzyme derivative that absorbed light at
340 nm (Hernandez and Phillips, 1993,1994). A closer examination of the peptide containing the 340 nm-absorbing species showed that the peptide had an unidentified modification of 184 Da at the serine residue that corresponds to
Seri43 of pseudomonad histidase (Hernandez and Phillips, 1994; Langer ef al.,
1994a).
11 Comparison of the amino acid sequences of all histidases and phenylalanine
ammonia-lyases (Langer ef a/., 1994a; Taylor and Mclnnes, 1994) characterized
so far revealed four conserved serine residues, one of which is Ser 143 (Fig. 3,
Appendix A). To determine which of the serines was involved in the formation of
dehydroalanine. Langer and coworkers (Langer e t al., 1994a) systematically
changed each of the serine residues of pseudomonad histidase to alanine by
site-directed mutagenesis. Wild-type histidase and Ser112Ala, Ser393Ala and
Ser418Ala are indistinguishable in terms of kinetic constants (K^ and V^ax) and
far-UV CD spectra (Langer eta!., 1994a, 1995). When Seri43 was changed to
either an alanine or a threonine residue, the modified histidase was not active
(Langer et al., 1994b). This observation agrees with another report that also
showed Seri 43 to be essential for the activity of histidase (Hernandez and
Phillips, 1994). The CD spectra of wild-type, Ser143Ala and Ser143Thr
histidases were identical (Langer ef a/., 1994b), hence the lack of histidase
activity was attributed to the inability of the mutant histidase to form
dehydroalanine rather than improper folding of the protein. On the basis of the
results of the site-directed mutageneis experiments, Seri 43 was shown to be
critical and present in the active site of histidase (Hernandez and Phillips, 1994;
Taylor and Mclnnes, 1994; Langer ef a/., 1994b). In phenylalanine ammonia-
lyase isolated from Petroselinum crispum, Ser202 is implicated as the precursor
of the dehydroalanine residue that is also likely to be present in the active site of this related enzyme (Schuster and Retey, 1994).
12 FIG. 3. Alignment of the conserved serine residue, in histidase and
phenylalanine ammonia-lyase, that is implicated in the formation of
dehydroalanine.
13 Mouse 247-268 EKGTVGASGD LAPLSHLALG Rat 247-268 EKGTVGASGD LAPLSHLALG Human 247-268 EKGTVGASGD LAPLSHLALG C. elegan s 261-272 QQGTVGCSGD LCPLAHLALG B. subtilis 134-154 QQGSLGASGD LAPLSHLALA P. p u tid a 136-156 LKGSVGASGD LAPLATMSLV S. g r is e u s 139-159 EYGSLGCSGD LAPLSHCALT PAL P. rub rum 195-215 PRGTITASGD LVPLSYIAGL Consensus —G----SGD L-PL------
Figure 3
13(1) IV. hut gene organization and regulation
The organization of genes encoding the enzymes of the L-histidine catabolic pathway varies depending upon the bacterial species (Fig. 4). In
Pseudomonas putida the genes for the utilization of L-histidine are arranged in at least three transcription units, hutUHIG, hutC, and hutF, for which the corresponding gene products are urocanase {hutU), histidase (huthi),
imidazolonepropionate hydrolase (hutl), formiminoglutamate iminohydrolase
{hutG), and formylglutamase {hutF) (Hu, 1988; Hu and Phillips, 1988; Hu eta!.,
1989; Consevage and Phillips, 1990). hutC encodes a repressor protein that negatively regulates the expression of hut genes in P. putida (Consevage and
Phillips, 1990).
In S. typhimurium and K. aerogenes the genes encoding the enzymes of the histidine utilization pathway are clustered in the region between gal and bio on the chromosome, and the genes are arranged in two adjacent opérons, hut
{M)IGC and hut{P)UH (Meiss etal., 1969; Hagen etal., 1975; Nieuwkoop eta!.,
1988). hut{M) and hut{P) are c/s-active sites necessary for the regulated expression of the huti and hutU operon, respectively (Hagen and Magasenik,
1976; Osuna etal., 1991). In contrast, the hut genes in S. subtilis are located in a single operon in the order hut{P)HUIG (Atkinson et al., 1990; Wrayet al.,
1994). Thehut system of S. griseus is unique because hutH is transcribed as a monocistronic unit, and other hut genes do not appear to be adjacent to hutH
14 FIG. 4. Organization of hut genes in bacteria. Open boxes indicate hut
genes, and arrows indicate transcription units. Dotted arrows show
transcription units of uncertain length.
15 - ^ 'SLi h” u
B. subtilis ------►
— 1 G C U H
K. aerogenes
S. typhimurium
H U C
P. putida
Orf 1 H
S. griseus
Figure 4
16 (Wu etal., 1992). Moreover, the transcription and translation start site of hutH of
S. griseus are identical (Wu, 1994). A partial open reading frame of 300 nt
upstream of hutH was also identified, but the analysis of its nucleotide sequence
and studies conducted by Wu suggest that this open reading frame most likely
does not have a role in the utilization of L-histidine (Wu, 1994). The Orf
upstream of hutH has 52% similarity at the amino acid level to OrfISS, a gene
that is implicated in the replication of an integrative plasmid, pSAM2, from S.
ambofaciens {\Nu, 1994).
To ensure the appropriate expression of the genes involved in the
utilization of L-histidine, the induction of the hut genes is controlled by regulatory systems that have evolved differently in each species. For example, in P. putida the induction of the hut opérons occurs maximally during growth under nitrogen-
limiting conditions (Consevage et ai .,1985). In this species urocanate serves as the inducer of all hut genes, and the expression of hutG is induced by either urocanate or N-formylglutamate (Hu et a!., 1989; Allison and Phillips, 1990).
Urocanate is also the inducer of the fîi/f enzymes in S. typhimurium and
Enterobacteraerogenes (Meiss etal., 1969). These authors isolated mutants unable to utilize L-histidine as sole carbon and nitrogen source due to the lack of histidase but able to synthesize urocanase upon induction with the urocanic acid analog, imidazolepropionic acid.
17 In contrast to these gram-negative bacteria, in B. subtilis the degradation of L-histidine is induced by L-histidine (Wray and Fisher, 1994). By isolating mutant strains altered in the utilization of L-histidine, Kimhi et al. (1970) identified a locus, hutP, that was necessary for the expression of histidase. The hut promoter is constitutive and is transcriptionally active even in the absence of
L-histidine. However the presence of L-histidine enhanced the transcription from this promoter (Oda et al., 1992). The product of hutP positively regulates hut expression (Oda et al., 1992). In vitro transcription studies revealed that in the absence of L-histidine a palindromic sequence located between hutP and hutH terminates the transcript initiated at the ht/f promoter (Oda etal., 1990; Wray et al., 1994). In the presence of L-histidine, the expression of the hut operon is probably mediated by antitermination of transcription at the stem-loop region by
HutP (Oda etal., 1990,1992).
The expression of the hut genes in Pseudomonas is relatively straightforward, hut is inducible only when L-histidine is the sole carbon and nitrogen source (Consevage and Phillips, 1990). The regulation of expression of the hut enzymes in P. putida appears to be subject to negative control (Hu e t al.,
1989). These authors elucidated the structure of the hutUHIG operator by gel retardation and DNAase I footprint analyses. They overexpressed hutC in E. coli and partially purified the repressor protein. Potential operator sites upstream of hutUHIG, hutF or hutC, and hutG were identified on the basis of the ability of the
18 repressor to bind to these sites. Whereas urocanate inhibits binding of the
repressor to all three operators, N-formylglutamate inhibits binding of the
repressor to the hutG operator only. There is no inhibition of repressor binding to
any operator in the presence of L-histidine, providing direct evidence that
urocanate is the physiological inducer of the hut genes in this organism (Hu et
al., 1989; Allison and Phillips, 1990). A 40 bp region from -10 to -50 relative to
the transcription initiation site for hutU was Identified as the operator region to
which the repressor protein bound (Consevage and Phillips, 1990).
A similar mechanism of negative control exists in the enteric bacteria. On
the basis of DNA protection assays, repressor binding sites were localized in
regions upstream at huthi in S. typhimunum (Hagen and Magasanik, 1976) and
K. aerogenes (Nieuwkoop etal., 1988). The extent of amino acid identity
between the Pseudomonas repressor and the repressor purified from K.
aerogenes is 62% (Allison and Phillips, 1990).
The synthesis of streptomycete histidase is inducible (Kendrick and
Wheelis, 1983; Kroening and Kendrick, 1989; Wu etal., 1994). Because urocanase activity was evident in a hutH null mutant of S. griseus when urocanate was included in the medium, the physiological inducer of the histidine
degradation pathway in S. grisues is likely to be urocanate (Appendix 8 ). The synthesis of streptomycete histidase is not governed by either nitrogen
19 regulation or carbon catabollte repression (Kendrick and Wheelis, 1982;
Kroening and Kendrick, 1987; Wu etal., 1992). Wu (1994) identified a region
upstream of huthi of S. griseus that is involved in the negative regulation of
expression of hutH. Results of repressor titration studies led Wu et ai. (1995) to
hypothesize that a factor negatively regulates the expression of hutH in S. griseus. The authors postulated that an inverted repeat centered at -67 relative to the transcription start site of hutH might function as a repressor-binding site.
Because the presence of multiple copies of the repressor-binding region resulted in the restoration of both histidase and urocanase activities in S. griseus during growth under non-inducing conditions, the expression of hutH and hutU might be controlled by the same regulatory factor (Wu, 1994; Wu et al., 1995).
In contrast to the synthesis of histidase in streptomycetes, the expression of several bacterial hut systems is governed not only by specific regulatory factors but also by global regulatory processes. In enteric bacteria carbon starvation is signaled by a high level of intracellular 3'-5'-cyclic adenosine monophosphate (cAMP). In K. aerogenes (Nieuwkoop et al., 1984; Osuna et al.,
1991; Osuna etal., 1994) and S. typhimurium (Brill and Magasanik, 1969), the catabolite activator protein (Crp) in the presence of cAMP activates the expression of a number of genes and opérons in response to carbon and energy limitations. By in vitro transcription assays and DNA protection studies,
Nieuwkoop et al. (1988) identified a consensus-like sequence for two
20 overlapping but divergent binding sites for RNA polymerase in the promoter region of hutUH. PhutU is a weak promoter that requires Crp-cAMP for maximal activity. Gel retardation assays and DNAase I protection analysis revealed a
Crp-binding site centered at -81.5 and a weaker Crp-binding site centered at about -41.5 relative to P;,^(Osuna etal., 1994a).
In K. aerogenes, hutUH expression is controlled not only by carbon catabolite repression but also by nitrogen regulation. When cells are grown under nitrogen-limiting conditions, a nitrogen-controlled transcription activator,
Mac, binds to a single site in PhutUH centered at -65 relative to the transcription start site. Even though the extent of activation of Auf transcription achieved with
Mac or Crp-cAMP is similar (Schwacha and Bender, 1993), it is not known whether the Mac- and Crp- mediated activations of PhutUH operate by similar mechanisms (Schwacha and Bender, 1993).
The synthesis of histidase inB. subtilis is complex, and a number of gene products have been identified that interact or bind to sequences upstream of hutH to control the expression of hutH and downstream genes under various growth conditions. Expression of hutH in S. subtilis is subject not only to induction but also to catabolite repression, amino acid repression, and growth phase regulation (Chasin and Magasanik, 1968; Atkinson etal., 1990; Oda et al., 1992; Atkinson etal., 1993). Histidase synthesis was repressed when a
21 culture of B. subtilis was grown in a medium containing glucose, glycerol, or L- malate (Kimhi and Magasanik, 1970). These authors also noted that the enzyme was produced at a somewhat higher level when the culture was grown in a medium containing citrate as carbon source. Thus there was an effect of carbon source on the production of histidase. hut promoter-/acZ transcriptional fusion studies revealed that the region between +204 and +231 downstream of the hut promoter includes a c/s-active region that is involved in catabolite repression
(Oda etal., 1992). Catabolite repression of/ 7 uf expression is mediated by two c/s-active sites, hufOcRi and hutOç^ (Fisheret al., 1994). ThehutOç^ site lies within hutP.
Unlike the enteric bacteria, in S. subtilis the expression of the hut genes is also controlled by amino acid repression (Atkinson etal., 1990). The expression of hut and put (genes encoding proline-utilizing enzymes) is repressed severely when cells were grown in a medium containing a mixture of 16 amino acids. This repression is mediated at the level of transcription (Wray and Fisher, 1994). By analyzing strains containing mutations in gInR or gInA, the authors established that the repression by amino acids is not a consequence of nitrogen regulation by gInR but rather due to the inability of the histidine permease to transport L- histidine in the presence of other amino acids (Atkinson ef al., 1990).
22 The expression of the hut operon in B. subtilis is also growth phase dependent (Atkinson etal., 1992). expression is repressed in an exponentially growing culture in nutrient sporulation medium, but in stationary phase cultures the expression of the genes is derepressed (Atkinson at al.,
1992). The analysis of mutants insensitive to catabolite repression and the rate of uptake of L-histidine from the growth medium showed that the derepression of hut expression during stationary phase is due to the relief of amino acid repression of transport of L-histidine. The protein AbrB is also shown to modulates expression of hut genes during exponential growth (Fisher et al.,
1994). By DNAase I protection studies the authors demonstrated that AbrB
bound to a region of 24 bp of the f?ufOcR 2 site. AbrB is postulated to regulate the expression of several enzymes that are subject to catabolite repression or synthesized after exponential growth. Some of these enzymes are involved in motility, competence, dipeptide transport, and antibiotic production (Fisher et al.,
1994). Since /juf expression remains subject to catabolite repression in an abrB null mutant, it is likely that AbrB is not solely responsible for the regulation of hut expression in response to carbon availability (Fisher et a/., 1994). An additional protein, CodY, has been identified that binds to to mediate negative regulation of hut expression in the presence of amino acids and preferred carbon sources (Fisher etal., 1996).
23 V. Kinetic properties of streptomycete histidase
Streptomyœs histidase has kinetic properties that set it apart from
histidase isolated from other bacterial and mammalian species (Kroening and
Kendrick, 1987; White and Kendrick, 1993). W hereas thiol reagents and R/ln^*
are necessary for maximal activity of histidase purified from Pseudomonas
(Klee, 1970; Givot etal., 1969), these reagents have no effect on the activity of
histidase from Streptomyœs (Kroening and Kendrick, 1989). The K^, of
streptomycete histidase is 0 . 8 mM, whereas the K^, of pseudomonad histidase is
4.0 mM (Hernandez ef a/.,1993, Langer et al., 1994a). Histidinol phosphate is a competitive inhibitor of streptomycete histidase with a K, of 0.27 mM (White and
Kendrick, 1993), but for histidase purified from P. fluorescens the Kj was 19 mM
(Appendix C).
Because histidinol phosphate is an intermediate metabolite in the synthesis of L- histidine, the inhibition of the histidase activity might have an important physiological significance in the cell.
The dicarbonyl reagents phenylglyoxal and methylglyoxal react with one or more arginine residues in streptomycete histidase to inactivate the enzyme
(White and Kendrick, 1993). Smith etal. (1967) reported that carbonyl reagents inactivate P. fluoresœns histidase. Eleven arginine residues are conserved among all of the histidases sequenced to date; of these only ArglOO is conserved among all examples of histidase and phenylalanine ammonia-lyase.
24 One possible role for an arginine residue in the active site would be to provide a
strong two-point interaction with the carboxylate of L-histidine to ensure correct
orientation of the substrate (White and Kendrick, 1993).
A distinguishing feature of histidase from S. griseus is its hysteretic
nature. Hysteretic enzymes respond slowly in terms of some kinetic
characteristics to a rapid change in the concentration of ligand. The ligand can
be either the substrate or a modifier (Freiden, 1970). Such a slow response
relative to the rate of the overall catalytic reaction results in the slow conversion of the enzyme from one kinetic form to another.The most convenient way to monitor hysteretic behavior is by continuous measurement of absorbance or fluorescence. Although there is no single mechanism responsible for this effect, several time-dependent mechanisms might result in an enzyme showing hysteretic behavior. Two mechanisms responsible for this slow response are isomerization of the enzyme and displacement of a tightly bound ligand (Freiden,
1970; Mouttet etal., 1974). Many hysteretic enzymes are regulatory and frequently occupy key branch points in metabolic pathways. Such a slow kinetic response might in turn control the flux of metabolites in different metabolic pathways (Freiden, 1979). Hysteretic behavior might have a physiological function, but it is difficult to prove that the enzyme shows the same response In vivo and in vitro.
25 Histidase from S. griseus can be purified in two different forms. One form
shows curved kinetics: the rate of product formation increases in a predictable
manner during the reaction. The other form displays linear kinetics (Kendrick
and Wheelis, 1982; Kroening and Kendrick, 1989). The hysteretic behavior of streptomycete histidase is particularly evident when the extract is prepared in
phosphate buffer (pH 7.2). The curved kinetics reflects a slow conversion from an inactive to an active form, whereas the enzyme showing linear kinetics reflects a fully active preparation. The hysteretic (inactive) form of histidase and the active form were identical with respect to molecular weight, subunit organization and isoelectric point (White and Kendrick, 1993). The activation of histidase is a pseudo-first order process and the rate of activation is constant.
The activation is independent of substrate concentration but is slightly affected by pH, temperature, and dénaturants such as SDS (White, unpublished). In addition, histidase undergoes activation upon dilution or can be activated by alkaline phosphatase or one or more proteins that have been partially purified from S. griseus (White, unpublished). The histidase-activating protein present in extracts of S. griseus is not alkaline phosphatase. These results suggest that the hysteretic activation of histidase occurs by non-covalent interaction with a small, probably phosphorylated, molecule, and the enzyme is activated upon dissociation of this molecule (Kroening and Kendrick, 1989; White, unpublished)
2 6 Another example of a hysteretic enzyme is ribulose-1,5-bisphosphate
carboxylase (Rubisco), which exists in two interconvertible forms, an inactive
form and a ternary form that is activated upon incubation with CO; and at
alkaline pH (Robinson e t at, 1988; Robinson and Portis, 1989). This activation
is dependent upon an additional protein, Rubisco activase. In vitro spontaneous
activation of Rubisco requires elevated COg and is inhibited by physiological
levels of ribulose-1,5-bisphosphate (Robinson and Portis, 1989). Portis et al.
(1986) reported the isolation of mutants of Arabidopsis thaliana that were unable
to activate Rubisco under normal physiological conditions. This phenotype was
ascribed to the absence of Rubisco activase in the chloroplast. Unlike
streptomycete histidase, Rubisco activation requires the hydrolysis of ATP.
VI. Goals of this project
The overall objective of this research was to characterize Hut" strains of
S. griseus to better understand molecular mechanisms involved in the utilization
of L-histidine by Streptomyœs. To accomplish this the two goals of this study were:
1 ) Molecular characterization of the two Hut* strains, SKK896 and SKK906.
2) Overexpression and characterization of wild-type and mutant histidases
from S. griseus.
27 CHAPTER 2
MATERIALS AND METHODS
I. Bacterial strains
The bacterial strains used in this study are listed in Table 1. The wild-
type strain of Streptomyces griseus, NRRL B-2682 (Northern Regional Research
Laboratory, Peoria, IL), was designated SKK821. All S. gnseus strains in this
study were derived from this strain. S. lividans TK24 was obtained from D.A.
Hopwood. The isolation and phenotypes of SKK832, SKK844, SKK896, and
SKK906 were described previously (Kroening and Kendrick, 1989). The phenotypic and genotypic characteristics of SKK301 through SKK311, generated in this study, are described in Table 1. E. coli strains TB1 and DHSaF' were used for transformation. Strain BL21(DE3) (obtained from J. Reeve) was used to overexpress histidase.
II. Plasmid vectors
The plasmid vectors used in this study are listed in Table 2. The structures of the plasmid vectors are presented in Appendix D.
28 Strain Relevant genotype/phenotype Source or reference S. grfseus strains NRRL B-2682 (SKK821) wild-type NRRL* SKK832 hisGI Kroening and Kendrick, 1989 SKK844 Lys- Kroening and Kendrick, 1989 SKK896 hutHl Kroening and Kendrick, 1989 SKK906 hisGI, hutHS, Str Kroening and Kendrick, 1989 SKK301 hisGI, hutHS, hut-9 This study SKK302 hisG1, hutHS, hut-10 This study SKK303 hIsGI, hutHS, hut-11 This study SKK304 Str, hutHS This study SKK305 Str, hutHS This study SKK306 hutH::pKK779 J. Wang SKK307 Hut* This study SKK308 hisGI, Hut* This study SKK309 hutHS This study SKK310 hutHS This study SKK311 hutH2 This study S. IMdans strain TK24 str-6 D A Hopwood E.coH strains TB1 — C.J. Daniels DHSa — C.J. Daniels BL21(DE3) — J. Reeve B. subtilis strain ATCC 6633 wild-type (StO ATCC"
Table 1. Bacterial strains used in this study. * Northern Regional Research Laboratory, Peoria, IL; ** American Type Culture Collection, Rockville, MD 29 Host System Plasmid Relevant phenotype' Source E. coli pUC18 Amp C. J. Daniels PÜ2925 Amp G. R. Janssen pT7-7 Amp J. N. Reeve E.coli/ pXE4 XylE(P'),Tsr, Amp J. Westpheling Streptomyces (bifunctionalj Streptomyces plJ7G2 Mel, Tsr D.A. Hopwood
Table 2. Plasmid vectors used in this study.
® Amp, ampicillin resistance; XylE(P'), promoterless catechol 2,3- dioxygenase; Tsr, thiostrepton resistance; Mel, tyrosinase.
30 The construction of plasmids is described in Results. Detailed descriptions of
the constructed plasmids are provided in Appendix E.
III. Media and culture conditions
The media used to grow the bacterial cultures and the purposes for which
the media were used are listed in Table 3. Typically S. griseus cells used for
enzyme assays were grown in 250 ml of 2XYT or glucose-ammonia minimal
medium supplemented with 1 % casein hydrolysate (HyCase, vitamin-free, salt-
free; ICN Biochemicals, Inc., Cleveland, OH) and 10 mM L-histidine (United
States Biochemical Corp., (USB) Cleveland, OH). The compositions of these
media have been described previously (Kroening and Kendrick, 1989). The
minimal agar medium contained (% wt/vol): 0.05% K 2 HPO 4 , 0.02% MgSO^THgO,
0.005% ferric citrate, 10 mM glucose, 10 mM NH 4 CI, NaK2 HP 0 4 buffer pH 7.2,
and 1% Noble agar (Difco Laboratories, Detroit, Ml). In all media containing L-
histidine as sole nitrogen source, NH 4 CI was omitted. In glutamate minimal
medium, 20 mM L-glutamate served as the sole carbon and nitrogen source. To
satisfy the L- histidine auxotrophic requirement of SKK832 and its derivative strains, 0.1 mM L-histidine was added to the culture medium. Trypticase soy broth (TSB) was purchased from Becton Dickinson Microbiology Systems
(Cockeysville, MD).
31 Medium Purpose Strain R eference 2XYT genomic DNA isolation, S. grisues (Sambrook ef al., analysis of Hut enzymes 1989) minimal analysis of Hut enzymes, S. griseus (Kendrick and medium RNA isolation, repressor Ensign, 1983) titration studies LB (Luria plasmid isolation, histidase E. coli, S. (Sambrook et al., Broth) overexpression, genomic griseus 1989) DNA LB agar strain maintenance E. coli (Sambrook etal., 1989) minimal agar identification of Hut mutants S. griseus This study medium R2YE spore preparation, S. lividans (Hopwood etal., protoplast regeneration, 1985) strain maintenance SpM broth spore preparation, plasmid S. griseus (Kendrick and isolation, starter culture Wheelis, 1982) SpM agar strain maintenance S. griseus (Kendrick and Wheelis, 1982) SpMR regeneration of protoplasts S. griseus (Babcock and Kendrick, 1988) TSB generation of protoplasts, S. griseus ( Babcock and (Trypticase isolation of plasmid DNA and S. Kendrick, 1988) Soy Broth) lividans
Table 3. Media used in this study
32 E. CO// and S. griseus cultures were grown in 3 ml Luria broth (LB) to isolate plasmid and genomic DNA. E. co//transformants were screened for the presence of plasmid by the addition to the LB agar plates of the color indicator
5-bromo-4-chloro-3-indolyl-P-D galactoside (X-gal; Bethesda Research
Laboratories Inc., (BRL), Gaithersburg, MD) at a concentration of 40 pg/ml.
For the growth of plasmid-containing strains the following antibiotics were included in the media at the indicated concentrations. Ampicillin (sodium salt.
Sigma Chemical Co., St. Louis, Mo) was included at 100 pg/ml for pUCIS derivatives. Thiostrepton (Squibb institute for Medical Research, Princeton, NJ, or Sigma) was included at 5 pg/ml to grow transformants of S. griseus, 40 pg/ml
for S. //V/c/a/ 7 S transformants containing plJ702, and 10 pg/ml for S. lividans containing pXE4 derivatives.
All Streptomyces cultures were grown at 30°C. 5% polyethylene glycol
8000 (Sigma) was included in Streptomyœs cultures grown in flasks with coiled springs to improve dispersion of the mycelia (Kendrick and Wheelis, 1982). The cultures were incubated in a rotary shaker at 250 rpm. When Streptomyces
cultures were grown in test tubes, 6 . 0 mm glass beads were used to enhance dispersed growth (Kendrick, personal communication).
33 For propagation of S. griseus, a 1:30 dilution of a 36 hr culture grown in 3
ml of LB or SpM broth was used as the inoculum. A single sporulated colony served as inoculum for S. griseus and S. lividans for propagation in test tubes.
IV. Recombinant DNA techniques
A. Isolation and manipulation of DNA
Plasmid DNA from E. coli or Streptomyœs was prepared according to the procedure described by Babcock and Kendrick (1988). For routine analysis, cells were grown in 3 ml of LB or TSB conatining the appropriate antibiotic.
Streptomyœs cells were lysed by the addition of lysozyme (Sigma) at a concentration of 0.5 mg/ml prior to isolation of the DNA. DNA fragments were generated by the use of restriction endonucleases purchased from Boehringer
Mannheim Co. (Indianapolis, IN), BRL, or New England Biolabs (NEB, Beverly,
MA). DNA fragments obtained after restriction digestion were resolved by electrophoresis on agarose gels with GGB buffer (40 mM Trizma base (USB), 20 mM sodium acetate, 2 mM EDTA (disodium salt), adjusted to pH 8.3 with glacial acetic acid). The DNA fragments were visualized by staining with ethidium bromide and photographed with a photoimager.
DNA fragments were isolated from agarose gels (Seakem GTG agarose,
FMC BioProducts, Rockland, ME) and purified by the phenol-freeze-fracture method (Huff, 1991 ). Subsequently DNA was precipitated with 0.1 volume of 0
34 3.3 M sodium acetate, pH 4.6, and 2.5 volumes of 95% ethanol. In some instances the Wizard DNA purification system (Promega, Madison, Wl) was used according to the manufacturer's instructions. All DNA samples were dissolved in double-distilled water or TE buffer and stored at -20°C.
B. Ligation reactions
Vector DNA (0.1 pg) was dephosphorylated with calf intestine or shrimp alkaline phosphatase (Boehringer Mannheim) according to the manufacturer’s instructions. Dephosphorylation was terminated by incubating the reaction mixture at 70°C for 30 min. DNA was extracted and precipitated as described above when calf intestine alkaline phosphatase was used. For ligation reactions
a 2 : 1 molar ratio of insert fragment to vector ( 0 . 1 pg) was maintained, and reactions were carried out at room temperature with 1 unit of 14 DNA ligase
(Boehringer Mannheim) in a total volume of 10 pi, for a minimum of 2 hr.
V. Nucleotide sequence determination
A. PCR amplification of DNA fragments
In some instances PCR was used to generate the template for determination of the nucleotide sequence. Amplification of DNA fragments by polymerase chain reaction was done using a DNA Thermal Cycler (Perkin Elmer
Cetus, Norwalk, CT). The reaction volume was either 50 pi or 100 pi.
Conditions were optimized for each template and primer combination to
35 maximize the yield by varying the MgClz and dimethyl sulfoxide concentrations.
All other reagents were added according to the instructions for Deep Ventp (exo )
DNA Polymerase (NEB). The protocols used to generate these fragments are described in Results.
8 . Dideoxy chain-termination method
The nucleotide sequence of DNA was determined by the dideoxy chain- termination method by using Sequenase version 2.0 (USB) according to the
manufacturer's instructions. 2 . 0 pg of double-stranded alkaline-denatured plasmid DNA was prepared. Synthetic oligonucleotides internal to the hutH coding sequence were used as primers (Table 4). The annealing temperature was optimized for each oligonucleotide. Changes were made to the protocol to reduce compressions by adding 1.0% dimethyl sulfoxide (DMSO) and replacing dGTP with 7-deaza-dGTP. The synthesized fragments were labeled with deoxycytidine-5'-a-[“ S]-thio-triphosphate ( a-[“ S]-dCTP, ^1000 Ci/mmol;
Amersham Corp., Arlington Heights, IL) The reaction products were resolved by electrophoresis on a 6.0% denaturing polyacrylamide gel (Sambrook et al.,
1989). The gel was run at constant power (60 watts) and subsequently soaked in 10% acetic acid and 12% methanol for 20 min to remove the urea. After drying in vacuo at 80°C for 1 hr, the gel was exposed to Kodak X-OMAT film for 2-3 days at room temperature.
36 ACGTGAATTCGTGCTGCACGGCCGG 87 GCGT PGR amplification of DNA upstream of hutH TCGATCTAGAGCACCGAGCCGAAACG 88 T PGR amplification of DNA upstream of hutH 103 ACCCCGGCTCACGGCCGGTTG 736-715 internal primer, antisense 104 GTCGCCCAGCTCGATCAC 508-491 internal primer, antisense 105 AGACAGCGTAGACCGGCTC 1009-991 internal primer, antisense 106 TCGTGGACGACGGGCGTGATG 1249 -1229 internal primer, antisense 107 AGGTGTAGAGGTTCCTCAGGTC 1495 -1474 Internal primer, antisense 108 GGCGTGGTCGAGGGTGTC 1742-1735 internal primer, antisense w 109 CTGGGTGTACTGGGCGATCA 2010-1991 internal primer, antisense N 110 GCCACGACGGCCTCCGAGG 2249-2231 internal primer, antisense 141 GATCGTCGCCGTCGAGCTGTAC Internal sequencing primer 142 CTTCGTCACCTACTCCGTGC internal primer 143 GTGATGCCATGGTGTCCGAC internal primer GAGAGGCGGCGGCGGCACCTTCGG 144 G 946-922 internal primer, antisense 146 CTGATGTTGCTCCGGCTG 1138 -1155 internal primer, sense 147 AGTTGGGTGGGGATGTG 1055 -1039 internal primer, antisense 148 AGGTTGTGGGTAGGGAG 1550-1534 internal primer, antisense 149 AAGAAGGGGTGGCAGGG 1927 -1943 internal primer, sense GTGAGAATTCATATGGATATGGACAG 168 T expression in pT7-7
Table 4. Oligonucleotides used in this study. c. fMol method
The fMol sequencing procedure (Promega Madison, Wl) was followed to
obtain nucleotide sequence information in short internal regions of hutH. The
manufacturer’s protocol for the use of end-labeled primer was followed. 2.5 pi of
the appropriate deoxy-dideoxy nucleoside-triphosphate mixture and 0.3 pg of
plasmid DNA were combined in a PCR reaction with 1 pi DMSO in a total volume
of 16 pi. Oligonucleotides were labeled with [y^^-P]ATP (^3000 Ci/mmol,
Amersham) by using T4 polynucleotide kinase (Promega). The reaction
conditions for sequencing with oligonucleotide 1 1 0 consisted of a hot start at
96°C for 5 min followed by 25 cycles of dénaturation at 96°C for 1 min,
annealing at 62°C for 30 sec, and extension at 72°C for 1 min. The annealing
temperature for oligonucleotide 107 was 48°C. The labeled DNA fragments
were resolved in a 6 % polyacrylamide gel as described above. A drawback of this procedure was the apparently random insertion of additional adenosine residues during polymerisation. Thus this method was not used to generate any new sequence information but only to compare nucleotide sequence of mutant and wild-type alleles.
C. ABI Prism Dye Terminator Cycle Sequencing method
To resolve some of the discrepancies in the sequences obtained by the standard or fMol method, the nucleotide sequences of pKK615 and pKK594 were also determined with universal or reverse primers for vector plasmid
38 pUC18, or oligonucleotides 107 or 109 by using the automatic ABI Prism Dye
Termination Cycle Sequencing system with Amplitaq DNA polymerase, FS. The
plasmid template for sequencing was purified from E coli DH5a using the
QIAGEN plasmid purification kit (QIAGEN Inc., Chatsworth,CA). The procedure
was that of the manufacturer except that I used 1.0 pg of DNA and added 1 %
DMSO to the reaction mixture. The PCR reaction included a hot start wherein
the DNA was incubated at 96°C for 5 min prior to the initiation of the first cycle.
Care was taken to remove excess dye from the reaction by washing the PCR
product in 1 ml of 70% ethanol three to four times. The column temperature
used to separate the fragments was set at 48°C.
VI. Transformation
Competent cells of E. coli strains TB1, DH5a F', and BI_21(DE3) were
prepared according to the protocol of (Sambrook et al., 1989). The cells were grown to an optical density at Agoo of 0.4. Subsequent steps were performed at
4°C. 5 pi of ligation mix or 1 pi of plasmid DNA (approx. 10 to 100 ng) was used
in each transformation.
S. griseus protoplasts were prepared from 3 ml of culture grown in TSB
with 1 .0 % glycine and 1 0 mM MgClg (Kendrick, personal communication). The cells were harvested at AgooOf 6-10. Cells were converted to protoplasts by
treatment with lysozyme ( 1 mg/ml) and filtered through glass wool in a syringe to
39 separate protoplasts from mycelial fragments. The protoplasts were adjusted to
a concentration of 4x10®/ml in P-Buffer (Hopwood et a/. ,1995)and stored at -
70°C. For the preparation of S. lividans protoplasts, 50 ml cultures were grown
in 250 ml flasks, and 0.5% glycine was added 4 hr prior to harvesting the cells.
S. lividans cultures were grown to exponential phase (Ag^of 4-5) in TSB medium
prior to harvest and furthur treatment (Hopwood et. al., 1989). The regeneration
medium w as SpMR for S. griseus transformants and R2YE for S. lividans transformants. Transformed cells that had grown for 18 to 20 hrs at 30°C were
overlaid with 1 . 2 ml of water containing thiostrepton to generate a final concentration of 5 pg/ml assuming 25 ml of agar medium per plate.
To overcome the restriction system of S. griseus, plasmid DNA containing a streptomycete replicon was first introduced into S. lividans and then into S. griseus. To introduce DNA isolated from S. lividans into S. griseus strains, a modified transformation procedure was followed (Kendrick, personal communication). The transformation mixture contained freshly prepared protoplasts (25 pi), plasmid DNA (0.1 pg in a volume s 2.5 pi), and T-buffer
(200 pi) (Hopwood et ai, 1985) with 26% PEG-1000. 45 pi of this mixture was added to 2.5 ml of SpMR containing 0.6% agar and 20 mM CaCI; that had been equilibrated to 52°C. The soft agar containing the transformed protoplasts was overlaid on SpMR agar and thiostrepton was added after overnight incubation as described above.
40 VII. Preparation of cell extracts and enzyme assays
A. Preparation of crude extracts
The preparation of crude extracts of Streptomyœs cultures and the
spectrophotometric methods for the analysis of histidase and urocanase were
carried out as described previously (Kendrick and Wheelis, 1982). Cultures of
Streptomyœs grown in complex medium or in glutamate minimal medium were
harvested at mid-exponential growth, washed with 1 M KOI, and suspended in
3.5 to 5 ml of 50 mM Tris-HCI buffer, pH 7.5.1-2 g wet weight of cells was
disrupted in a French press at 14,000 psi, and the material was collected after
centrifugation at 31,000 g for 20 min. The supernatant, referred to as the crude
extract, was decanted and kept at 4°C for no more than 8 hr prior to assay.
B. Assay of histidase and urocanase activities
The enzyme assays were conducted in a Kontron Uvikon 930 thermoregulated recording spectrophotometer (Kontron Instruments Inc.,
Everett, MA). Histidase activity was measured at 277 nm by monitoring the rate of product formation in a continuous assay for 10 min at 30°C. The extinction coefficient for the product, urocanate, at 277 nm is 18.8 x 10^ I/mol/cm (Rechler and Tabor, 1971). The reaction mixture contained 1 ml of 50 mM Tris-HCI, pH
8.5, 50 pi of 100 mM L-histidine, pH 6.0, and 150 pg of protein (20-25 pi of crude extract). Urocanase activity was measured by monitoring the decrease in absorbance at 300 nm at 30“C, at which wavelength the extinction coefficient is
41 7.05 X10^ l/mol/cm (Kendrick and Wheelis, 1982). The reaction mixture in this case contained 1 ml of 50 mM K^HPO/KH^PO^ buffer (pH 7.2), 20 pi of 10 mM urocanate, pH 7.0, and 150 pg of protein.
VIII. Immunoblot techniques
A. SDS-PAGE and immunoblot assay
Crude extracts of S. griseus or £ coli harvested from cultures grown to mid-exponential phase were combined with an equal volume of 2X sample loading buffer after adjusting the protein concentration to 3-4 pg /ml. The
proteins were separated by 8 % SDS-PAGE (Ausubel eta!., 1991) in Laemmli's buffer (25 mM Trizma, 192 mM glycine, pH 8.55) containing 2.5% SOS using the
SE250-Mighty Small II slab gel electrophoresis unit (Hoeffer Scientific instruments, San Francisco, CA). The proteins from the gel were transferred to a nitrocellulose membrane (Schleicher and Schuell, Keene, NH ) in IX Laemmli buffer with 20% methanol at a constant current of 300 mA for 2 hr in a plate transfer apparatus (Idea Scientific Company, Minneapolis MN). An immunoblot assay was performed on the membrane according to the procedure described by
Bio-Rad. 3% gelatin in 50 mM TrisHCI, pH 7.5, was used as the blocking agent.
The alkaline phosphatase color development reagents, BCIP (5- bromo-4- chloro-3-indolylphosphate, p-toluidine salt) and NBT (p-nitroblue tétrazolium chloride), were used to detect histidase bound to the membrane. These substrates develop an insoluble purple product on the membrane surface when
42 reacted with alkaline phosphatase conjugated to goat anti-rabbit IgG (Sigma),
which was used as the secondary antibody at a dilution of 1:30,000.
B. Preparation of monospecific antibodies
Monospecific antibodies were obtained for histidase from rabbit serum
containing polyclonal anti-histidase antibody by the method described by
Olmstead (1986). Purified histidase was electrophoresed by SDS-PAGE and transferred to nitrocellulose membrane as described above. The membrane was
stained with Ponceau 8 (2% Ponceau S in 30% TCA) diluted 1:200 in water. The portion of the membrane containing the histidase was excised, destained with water, and incubated with rabbit anti-histidase antiserum. After washing to remove unbound proteins, the bound antibodies were eluted from the complex with 0.2 M glycine-HCI, pH 2.8, 0.5 M NaCI, 0.1% Tween 20 by gently shaking the membrane in 2.5 ml buffer for 10 min. The eluant was neutralized with an equal volume of 0.5 M KgHPO^ buffer, pH 7.2. This preparation w as used undiluted as the primary antibody.
IX. Generation of recombinant strains
A. Protoplast fusion
To determine whether the Strand Hut" phenotypes of SKK906 were caused by a single mutation, protoplast fusion experiments were conducted according to the method of Hopwood et al. (1985). 50 pi (4x10® protoplasts/ml) of
43 SKK906 (Str Hut' Mis') protoplasts was mixed with an equal number of SKK844
(Str* Hut*, Lys *) protoplasts. The mixture was centrifuged at 3000 rpm for 7 min and washed twice in P buffer (Hopwood e t al., 1985). The supernatant was discarded and the pellet was resuspended in 50% polyethylene glycol (2 g of polyethylene glycol (mol.wt. 1000; Sigma) dissolved in 2 ml of P buffer). The
preparation was incubated at room temperature for 2 min, diluted in P-buffer
(10 ■®, 10"®, and 10'^), and plated on non-selective regeneration medium. After harvesting the spores the prototrophic recombinants were selected by plating on glucose-ammonia minimal medium and analyzed for segregation of hut (growth on histidine as a sole nitrogen source) and sfr (ability to produce streptomycin) by patching on the appropriate media.
B. Allele exchange
Recombinant strains were generated by exchanging the hutH allele borne on a plasmid with the chromosomal allele. The plasmid containing the hutH allele was introduced into S. griseus strains and thiostrepton-resistant transformants were selected. 100 to 200 colonies were patched onto SpM agar plates and grown for three passages (through sporulation) in the absence of the drug. For the fourth round the colonies were patched on duplicate SpM plates in the presence and absence of thiostrepton. The colonies that had become sensitive to thiostrepton were used for further studies after screening for the appropriate Hut phenotype. Virgin toothpicks need to be used to pick all the
44 colonies to prevent carry over of nutrients from the rich medium to the minimal
medium. The absence of plJ702 was confirmed by Southern blot analysis. The
region of hutH that contained the mutation was amplified by PCR, and the
nucleotide sequence was determined by the fMol method to confirm the
replacement of the chromosomal hutH allele with the plasmid-bome allele.
X. Hybridization reactions
A. Colony hybridization
To clone the 4 kb BamH\ fragments containing the hutH allele from
SKK906 and the wild-type strain, colony hybridization was carried out. Genomic
DNA (40 pg) prepared from each strain was digested with SamHI and fractionated on a 1 % agarose gel. Fragments of DNA that migrated to approximately 4 kb in length were excised and purified by the phenol freeze- fracture method. 0.4 pg of this DNA was ligated to flamHI-digested pUC18 that had been dephosphorylated by calf intestine alkaline phosphatase. The ligated products were introduced into E. co//strain TB1, and transformants were plated on LB medium containing ampicillin and X-gal. 200 ampicillin-resistant, white colonies were patched on duplicate plates of the same medium and transferred to nitrocellulose membranes (Schleicher and Schuell). In situ hybridization of lysed colonies was performed according to Sambrook etal. (1989). The DNA on the membranes was fixed by exposing the membrane to UV light centered at 280 nm for 5 min. Oligonucleotide 106, internal to the hutH coding sequence (from nt
45 1249 to 1229), was labeled at Its 5' end with y-[^P1-ATP (Amersham) and used as a probe. The labeling reaction was performed with T4 polynucleotide kinase as described by Sambrook etal. (1989). The membranes were prepared, washed, and exposed to Kodak X-OMAT film for 24 hr (Ausubel e t a/., 1991 ).
Colonies showing strong hybridization signals were purified and the plasmid
DNA isolated. The presence of hutH in the insert was confirmed by restriction analysis and determination of the nucleotide sequence by using universal and reverse primers.
B. Slot blot hybridization
To confirm that recombinant strains that were obtained by allele exchange had lost the vector, plJ702, slot blot hybridization was carried out (Ausubel et a!., 1991 ). The hybridization was performed by using the Genius Non-
Radioactive Nucleic acid Labeling and Detection System (Boehringer
Mannheim). Genomic DNA was prepared from the wild-type strain of S. griseus, a transformed strain of NRRL B-2682 containing plJ702, and the recombinant strains, SKK307, SKK308, and SKK310. 2 pg of genomic DNA from each strain was transferred to the nitrocellulose membrane using a slot-blot apparatus
(Hoefer). plJ702 was labeled with digoxigenin and used according to the manufacturer's instructions.
46 c. Northern hybridization
RNA w as isolated from exponentially growing Streptomyœs cultures
grown under inducing conditions and used for northern hybridization (Ausubel et
al., 1991). RNAase-free pipet tips (Bio-Rad), disposable 15 ml polypropylene
tubes (Becton Dickinson and Co., Lincoln Park, NJ), and double-distilled water
were used throughout the procedure. Total cellular RNA was prepared by the
method of Kirby (Hopwood etal., 1985) with modifications by Kwak (1996). 10 ml
of an exponentially growing culture of S. griseus (AgooOf 4-5) was harvested by
filtration on a 25 mm diameter, 0.45 pm pore size nitrocellulose membrane
(Schleicher and Schuell). The filter containing the mycelia was immediately
immersed in 10 ml of ice cold Kirby mix (1% w/v sodium-tri-isopropylnaphthalene
sulphate, 6 % w/v sodium 4-amino-salycilate, 6 % v/v phenol, pH 7, in 50 mM
Tris-HCI, pH8.3). After removal of the filter the cells were disrupted at high
pressure at 14,000 psi as described above and the extract was combined with
ice-cold 5 ml phenol-chloroform. The mixture was vigorously vortexed and the
phases were separated by centrifugation at 10,000 x g for 10 min at 4°C. The
aqueous phase was transferred to a fresh tube, and the phenol-chloroform
extraction was repeated until no precipitate could be seen at the interface. The
nucleic acids were precipitated by the addition of 0.1 volume of 4.0 M sodium
acetate, pH 6.0, and an equal volume of isopropanol and held at -20“C for 2 hr.
After collection by centrifugation at 12,000 x g for 15 min, the nucleic acids were dissolved in distilled water. This preparation was reprecipitated as above and
47 dissolved In 180 pi of water and 20 pi of 10X DNAase buffer (0.5 M Tris HCI, pH
7.8, 50 mM MgClg). The DNA was digested with RNAase-free DNAase I (13.5
units, Boehringer Mannheim) at 37°C for 30 min.
The reaction was stopped by the addition of an equal volume of phenol-
chloroform and the RNA was extracted and precipitated as described above. The
RNA in the pellet was dissolved in 100 pi of HgO and quantified by its
absorbance at 260 nm.
Approximately 1 pg of RNA was separated in a 1% agarose gel containing
10% formaldehyde (Ausubel et al., 1991 ) to verify the integrity of the RNA
preparation by confirming the absence of degradation. RNA samples were
stored at -20“C after the addition of 0.1 volume of 4.0 M sodium acetate and 1.0 volume of isopropanol.
To determine the half-life of mRNA, 2 pg/ml of rifampicin was added to
Streptomyœs cultures that were growing exponentially in 1 % CAA medium (Agoo of 4-5); this concentration is sufficient to inhibit transcription (Kendrick, personal communication). Five ml aliquots of the culture were removed at various times after the addition of rifampicin, and RNA was extracted as described above.
48 For northern hybridization analysis, 40 pg of RNA from each strain was
subjected to agarose gel electrophoresis in the presence of 1 0 % formaldehyde
(Ausubel e t al., 1991 ). After transfer of the RNA from the gel to a nitrocellulose
membrane by capillary elution, RNA was fixed by exposing the membrane to UV
light for 5 min by using a transilluminator. The RNA was probed with a 0.7 kb
Mlu\-BamH\ fragment of DNA obtained from plasmid pKK570 (Wu, 1994); this fragment contains the carboxy-terminal coding sequence of hutH^ui^- This DNA fragment was labelled with [o^PjdCTP (3000 Ci/mmol) by using T4 DNA
polymerase provided in the Random Primer Labeling kit (Promega). 500,000 cpm of probe per ml of hybridization solution was used for the hybridization
(Ausubel ef a/., 1991). 10% dextran sulfate and 50% formamide were added to the hybridization buffer to improve the yield of signal. After hybridization at 48°C for 12 hr, the membrane was washed sequentially with 2X SSC (IX SSC contains 0.15 M NaCI, 0.015 M [Naj^citrate) and 0.1% SDS at room temperature, 2X SSC and 0.1% SDS at 48°C and 0.2 X SSC and 0.1% SDS at
55“C for 20 min. The relative intensities of the signals in the northern blot were measured with either a Packard Instant Imager (Packard Instrument Company,
Downers Grove, IL) or the Storm 840 Phosphorimager (Molecular Dynamics,
Sunnyvale, CA).
49 XI. Overexpression of histidase
A 2.5 kb EcoRI /HinDWl fragment of DNA containing hutH from the wild-
type strain was subcloned into the similarly digested expression vector, pT7-7, to
give pKK650. An Nde\ site was created at the hutH translation initiation codon
by PCR with pKK501 (Wu, 1994) a s the template. The DNA primers were
oligonucleotides 168 and 109. The downstream primer started at nt 1991 of the
hutH coding sequence such that the amplified PCR product contained the Mlu\
site unique to hutH. To amplify the fragments a hot start at 95°C for 5 min was followed by thirty cycles consisting of dénaturation at 95“C for 1 min, annealing
at 62°C for 30 sec, and extension at 70°C for 1 min. The amplified fragments were digested with A/del and Mlu\, separated on a 1% agarose gel, and purified from the gel by the phenol freeze-fracture method. hutH was reconstructed by ligating the PCR product to pKK650 digested with Nde\ and Mlu\ to give pKK651.
To overexpress hufHggg, the Nde\~Mlu\ fragment was generated as described above with pKK594 as the template for PCR amplification. This fragment contains hutH^æ and the mutation is present in the NdeUMlul fragment which was used to replace the Nde\-Mlu\ fragment of pKK651 to yield pKK657. To express hutHgas, the Mlu\-BamH\ fragment from pKK629, containing the downstream portion of the hutH from SKK906, was used to replace the sam e fragment from pKK651 to generate pKK655. The presence of the mutations in the plasmids was confirmed by determining the nucleotide sequence.
50 E. coli strain BL21(DE3) containing these plasmids was grown in LB
medium with 80 pg/ml of ampicillin at 30“C to an A 5 0 0 of 0.4. The culture was induced with 0.4 mM IPTG (isopropyl-P-D-thiogalactopyranoside, Sigma). Cells
were harvested after 2 hr of induction and crude extract prepared as described above. The crude extract was analyzed by SDS-PAGE for accumulation of histidase and assayed for histidase activity.
XII. Streptomycin bioassay
To determine the production of streptomycin, a lawn of S. griseus was prepared by plating 10'* spores on SpM agar. Agar plugs from the Streptomyces lawn were removed every 24 hr for 96 hr and placed on a lawn of B. subtilis
ATCC 6633 on nutrient agar. After overnight incubation at 30°C, zones of inhibited growth of S. subtilis indicated the production of streptomycin.
51 CHAPTER 3
RESULTS
I. Characterization of SKK906
A. Enzyme and immunoblot analyses
To study the regulated synthesis of enzymes involved in the dissimilation of L-histidine in S. griseus, mutants unable to utilize L-histidine as a sole nitrogen source were isolated. Kroening isolated Hut' mutants that were unable to grow in minimal medium containing L-histidine as the sole nitrogen source
(Kroening and Kendrick, 1989). To reduce the probability that such mutants were unable to transport L-histidine, the histidine auxotroph SKK832 was used as the parent strain. Thehut-5 mutant strain designated SKK906 was characterized further (Kroening and Kendrick, 1989). SKK906 showed normal urocanase activity but low histidase activity when the cells were grown in a complex medium in the presence of L-histidine. On the basis of his results,
Kroening hypothesized that histidase in S. griseus undergoes reversible inactivation and that SKK906 synthesized an inactive form of histidase (Kroening and Kendrick, 1989).
52 I undertook the study of SKK906 to characterize the mutation and to identify a putative factor required for the activity of histidase. In my hands the crude extract of SKK906 grown in a rich medium did not have any histidase or urocanase activity (Table 5). The lack of histidase activity in the crude extracts could have been due to the inability of the strain to synthesize histidase, the synthesis of inactive histidase, or the rapid degradation of histidase. An immunoblot analysis was performed on a crude extract of SKK906 to begin to distinguish among these possibilities. Proteins from a crude extract of SKK906 grown in rich medium containing 10 mM L-histidine were transferred to a nitrocellulose membrane, and monospecific antibody was used to detect the presence of histidase. An extract prepared from a culture of the wild-type strain of S. griseus contained an immunoreactive protein that co-migrated with purified histidase (Fig. 5), whereas such a protein was not evident in the crude extract from SKK906. The absence of histidase in the immunoblot indicated that histidase in SKK906 either was not synthesized or was rapidly degraded after synthesis.
B. Characterization of the mutation in SKK906
Previous results suggested that the hut-5 mutation might be pleiotropic because SKK906 was not only Hut" but also no longer synthesized the antibiotic streptomycin, which is normally produced by the wild-type strain of S. griseus
(Kendrick and Ensign, 1983). A prototrophic derivative of SKK906, designated
53 Specific activity* Strain Histidase Urocanase
wild-type 2 2 ± 0 . 8 6.7 ±1.3
SKK896 ^ 0 . 1 <0 . 1
SKK906 s 0 . 1 iO . 1
Table 5. Enzyme activities in the wild-type and Hut" strains of S. griseus grown under inducing conditions. ® nmol/min/mg protein; values are the average ± std. dev. for the enzyme activity from at least two extracts assayed in triplicate.
54 FIG. 5. Immunoblot of crude extracts of wild-type and Hut" strains. 15 pg of
protein from crude extracts of cultures grown under inducing
conditions was subjected to SDS-PAGE. The proteins were
transferred to a nitrocellulose membrane, and monospecific
antibodies that recognized purified histidase were used to detect
histidase in the extracts. Lanes: 1, purified histidase; extract
prepared from: 2, SKK906; 3, SKK896; 4, SKK306; 5, SKK821.
55 Figure. 5 SKK910, also failed to produce streptomycin (Kroening and Kendrick, 1989). To determine whether thehut-5 mutation in SKK906 was pleiotropic or to rule out the possibility that L-histidine utilization was linked to streptomycin biosynthesis, a protoplast fusion experiment was performed. Prototrophic recombinant strains were generated by fusing protoplasts of SKK844 (Hut', Lys', Str*) and SKK906
(Hut*, His', Str). Of the 156 prototrophic recombinant progeny examined, only three strains were Hut', Str. analysis indicated that the two mutations leading
to the Hut'and Str phenotypes were not linked (Table 6 ).
C. Complementation studies
The absence of histidase in the immunoblot and results from my enzyme assays suggested that SKK906 might contain a mutation that affected the synthesis of histidase or promoted its rapid degradation. To characterize the mutation that led to the lack of histidase in SKK906, a series of complementation experiments was performed. SKK906 was transformed with pKKIlOO to determine whether could restore histidase activity. Plasmid pKK1100
(Wu, 1994; Fig. 6 ), which contained hutH^ui^ and a partial open reading frame upstream of hutH, restored histidase (71% of the control) and urocanase (93% of the control) activity to SKK906 transformants (Table 7).
If an unlinked mutation in SKK906 was responsible for the inactivation of histidase, then SKK906 transformants containing should have
57 Hut* Hut Total
Str* 1 1 0 16 126 Str 27 3 30 Total 137 19 156
X* =0.087 s a Table 6 . Linkage analysis of the Hut' and Str phenotypes of SKK906, “ Protoplasts of SKK906 (Hut', His', Str) were fused with those of SKK844 (Lys.Str). After regeneration on non- selective medium, prototrophic recombinants were selected by plating on glucose ammonia-minimal medium. These recombinants were analyzed for the segregation of the hut and sfr alleles. Hut*, growth with histidine as the sole nitrogen source; Str*, ability to produce streptomycin during growth on complex medium. FIG. 6 . Plasmids used In transformation studies to determine the recovery
of histldase activity In mutant strains. Cultures of the wild-type
strain or mutant strains containing these plasmids were grown
under Inducing and non-lnducing conditions and assayed for
histldase and urocanase activities. The dark box Indicates the
extent of the upstream open reading frame. The light box Indicates
the extent of hutH. The thin line denotes Intergenic DNA and the
arrow shows the direction of hutH transcription. plJ702 Is a
multicopy vector and Is present at 50 to 100 copies per
chromosome in S. griseus (K.E. Kendrick, personal
communication), and pXE4 Is a low copy vector present at 3 to 4
copies per chromosome (LA. McCue, personal communication).
59 Plasmid Insert Source of insert Vector
pKKHOO Wild-type plJ702
pKK1111 SKK896 plJ702 pKK616 SKK906 plJ702
pKK617 SKK906 pXE4
pKK630 SKK906 plJ702 O) o pKK634 SKK906 pXE4
pKK636 Wild-type pXE4
Figure 6 Recipient strain
Insert* SKK821 SKK896 SKK906 Histidase Urocanase Histidase Urocanase Histidase Urocanase
none 36 ±1 100 ± 7 £l ^ 1 i 1 s i
hutH^2\ 100 ±4 100 ±7 118 ± 6 102 ± 23 71 ± 2 93 ± 19
hutHoQQ 84 ± 6 132 ± 14 25 ± 3 120 ±14 38 ± 2 23 ± 9 Oî hutHgog 34 ±1 1 1 2 ± 9 20 ± 4 84 ±16 s i s i
Table 7. Relative specific activities of histidase and urocanase in transformants, containing plJ702-derived vectors, grown under inducing conditions." "The cultures were grown in glucose-ammonia minimal supplemented with 10 mM L-histidine. The specific activity was measured as nmol/min/mg protein. The values of histidase and urocanase represent the relative rates. The enzyme activities of the wild-type strain containing hutH y^iw-typein trans were set at 100%. The actual specific activities in this strain were 62.9 ± 2.7 nmol/min/mg protein for histidase and 4.4 ± 0.4 nmol/min/mg protein for urocanase. Values are the average ± std. dev. from at least two extracts assayed in triplicate. " hutHs2f (pKK1100); /ïufHaæ (pKK1111); hutH^ (pKK616) remained Hut' unless the inactivating factor was present in limiting amounts.
Since pKK1100 was present in the cell in multiple copies, the restoration of histidase activity could have been caused by either suppression or complementation of the mutation. To distinguish between these two possibilities,
I constructed plasmid pKK636 by subcloning a 2.5 kb Sg/ll fragment of DNA from pKKIlOO, which contains into the SamHI site of the low copy vector, pXE4. pKK636 also restored histidase (89% of the control) and urocanase (55%
of the control) activity to SKK906 (Table 8 ). This result suggested that the recovery of histidase activity in the SKK906 transformant containing was most likely the consequence of complementation rather than suppression of the mutation.
D. Characterization of hutHgœ
Data from the complementation analysis suggested that a mutation may have occurred in the coding or regulatory sequence of hutH in SKK906. To test this hypothesis I cloned thehutH allele from SKK906. A 4.0 kb BamH\ fragment of DNA that contained the hutH allele was isolated from both SKK906 and the wild-type strain by colony hybridization. The restriction pattern of both hutH alleles was identical (Fig. 7), and limited nucleotide sequences of the plasmids confirmed the presence of hutH in both cases. pKK615 contained hutH ^ and pKK618 contained hutH^^^j^^.
62 FIG. 7. Restriction map of pKK615. Thin lines and shaded boxes represent
vector DNA (plJ2925) and S. griseus DNA, respectively. The dark
box indicates the upstream DNA that contains at least one open
reading frame. The light box is hutH. The arrow indicates the
direction of hutH transcription. Abbreviation: B, SamHI; L, Sa/I; M,
Mlul] N, A/col; P. Pvu\; S. Sph\; T. SS/I; V, PvuW.
63 B P VLN P PN N TS \A TN pKK615
hutH coding sequence
I------1 1 kb
Figure 7 Recipient strain SKK821 SKK896 SKK906 Inserf Histldase Urocanase Histidase Urocanase Histidase Urocanase
none 57 ±1 83 ± 10 < 1 < 1 i 1 s 1
^^^^wiW-type 1 0 0 ± 8 100 ± 7 99 ± 5 100 ± 34 89 ±5 55 ±16
hutHgoe A 52 ± 4 34 ± 7 1 9 ± 2 8 6 ± 7 3l s 1
70 ±2 79 ±7 27 ±1 6 i 1 O) hutHgoe B 138 ± 34 l a i
Table 8 . Relative specific activities of transformants, containing pXE4-derived vectors, grown under inducing conditions.* * The cultures were grown in glucose-ammonia minimal medium supplemented with 10 mM L-histidine. The specific activity was measured as nmol/min/mg protein.The values of histidase and urocanase represent the relative rates. The enzyme activities of the wild-type strain containing hutH^^^ in trans were set at 100%. The actual specific activities in this strain were 33.2 ± 2.8 nmol/min/mg protein for histidase and 4.3 ± 0.4 nmol/min/mg protein for urocanase. Values are the average i std. dev. for at least two extracts assayed in triplicate. " /7a/H^„.^pe(pKK636); hutH^ A (pKK634); hutH^ B (pKK617). If the mutation that led to the Huf phenotype of SKK906 was In hutH, then
transfonnants of the mutant strain containing multiple copies of hutHgos in trans
would remain Huf and the wild-type strain containing hutHggg in multiple copies
should not have an elevated level of histidase activity. To test this hypothesis
the 4.0 kb BamHI fragment from pKK615 {hutNggg) was subcloned into the Sg/ll
site of plJ702 to generate pKK616. This plasmid was introduced into the wild-
type strain and the two Huf mutant strains, SKK896 and SKK906. hutHgœ
restored histidase activity (20 % of the control) to SKK896 but not to SKK906
(Table 7). Transformants of the wild-type strain containing hutHgog showed no
increase in histidase activity relative to the wild-type strain grown under inducing
conditions (Table 7). In conjunction with the results of the immunoblot, these
observations suggest that SKK906 contains a mutation that affects the synthesis
or stability of histidase and leads to the absence of histidase in the crude
extract.
To define the mutation in SKK906, the complete nucleotide sequence was
determined by the Sanger dideoxy chain-termination method. Analysis of the
nucleotide sequence revealed that hutHgog contained a single missense mutation that would change the serine residue (TCC) at position 426 to the phenylalanine
(TTC) (Fig. 8 ). Identification of this mutation confirmed my hypothesis that the
mutation in SKK906 was in the coding sequence of hutH. A change from a small, polar residue to a large, hydrophobic residue might be expected to have a
66 FIG. 8 . A, Nucleotide sequence of the region of hutH showing the
missense mutation TCC to TTC in SKK906. Left panel,
right panel, hutH^Qg. The arrow indicates the change in the
nucleotide sequence. B, Amino acid sequence showing the
position of the Ser426Phe. The nucleotide ladder is of the
antisense strand.
67 wild-type SKK906
■>.vh>h^%W».V‘.sV
SJS5S S f ü È*
SMGWSAARK B 430 wild-type TCCATGGGATGGTCCGCCGCCCGCAAA 2124
SKK906 S M GW F A A R K TTC
F igure 8 significant effect on the activity or stability of the protein. Because no protein
was evident in the Immunoblot of the extract from SKK906 (Fig. 5), the absence
of histidase from SKK906 is most likely the consequence of synthesis of a highly
unstable protein that is readily degraded in the cell.
E. Characterization of revertants of SKK906
Results from Kroenings' experiments had suggested that hut-5 mapped at
a locus other than hutH (Kroening and Kendrick, 1989) Three Hut* revertants of
SKK906, SKK301, SKK302, and SKK303, that grew in minimal medium with
L-histidine as the sole nitrogen source were isolated after chemical mutagenesis
(Fig. 9). The histidine auxotrophy served as a useful marker to avoid re-isolation
of the wild-type strain.
To determine whether the revertant strains recovered the same level of
histidase activity as the wild-type strain, crude extracts of cultures of each
revertant strain grown in 2XYT medium supplimented with 10 mM L-histidine were assayed for histidase and urocanase activities. Analysis of extracts
prepared from cultures of SKK303 revealed that the level of histidase activity in this strain resembled that of the wild-type strain throughout the growth of the culture (data not shown). SKK301 and SKK302 exhibited temporally regulated synthesis of histidase. I characterized SKK302 in greater detail.
69 FIG. 9. Procedure to obtain Hut* revertants of SKK906.
70 Isolation of Hut* Revertants of SKK906
SKK906 spores suspended in 1.0 ml of 0.1 M Tris-HCI buffer, pH 7.9
Add 30 Hi EMS and Incubate for 2 hr at 30°C (results In 96% killing)
Wash five times with distilled water; suspend in 1 ml distilled water
Aliquot 0.1 ml to 10 tubes each containing 2.5 ml SpM
Incubate at 30°C for 3-4 days until sporulated
Dilute each spore suspension by 10^ and plate on glucose- histidine minimal medium
Screen for sporulating colonies after 3 days
Figure 9
71 A spectrophotometric assay of histidase activity revealed that the exponentially
growing culture of SKK302 harvested at A 5 0 0 of 4 (22 hr of growth) contained a
low amount of histidase (1.5 ±0.1 nmol min*’ mg’’ protein) (Fig. 10). In contrast,
a crude extract prepared from the wild-type strain harvested at an AsooOf 4
typically had histidase activity of 20 ± 2 nmol min'^ mg’’ protein. A crude extract
prepared from a culture of SKK302 harvested earlier in exponential phase (A 5 0 0
of 1.9) had significantly lower histidase activity (0.2 ± 0.03 nmol min"’ mg’^
protein). The maximal amount of histidase activity in SKK302 (9.6 ±0.1 nmol
min'^ mg’’ protein) was less than 50% of the level seen in the wild-type strain and
was reached when the culture attained an AgooOf 13.6, which corresponds to
early stationary phase. Thus the specific activity of histidase increased from 0.2
± 0.03 to 9.6 ± 0.1 nmol min"’ mg*’ protein whereas during the sam e growth
period the specific activity of histidase in the wild-type strain increased from 15 ±
0.4 to 20 ± 2 nmol min*’mg*’protein.
To determine whether the absence of histidase activity in SKK302 at
early exponential phase was a consequence of the absence of histidase or the
presence of inactive histidase, an immunoblot was performed using a crude extract of SKK302. Cells of SKK302 grown in 2XYTH medium under inducing conditions were harvested at various times during growth, and crude extracts were prepared. Analysis of the immunoblot suggested that the increase in activity of histidase was due to the accumulation of the protein, because the
72 FIG. 10. A, Temporal increase in histidase activity in SKK302. A culture of
SKK302 was grown in 2XYTH medium, and cells were harvested at
various times during exponential growth and early stationary
phase. Cell density was measured as absorbance at 500 nm (•).
The units of histidase activity were nmol/min/mg protein. Values
are the average ± std. dev. of each extract assayed in triplicate (o).
B, Immunoblot of histidase from SKK302 and SKK906. 15 pg of
protein from a crude extract of SKK302 or SKK906 grown in
2XYTH medium was subjected to SDS-PAGE. Proteins were
transferred to a nitrocellulose membrane, and monospecific
antibodies were used to detect histidase. Lanes: 1, purified
histidase; extract prepared from cells of SKK302 grown to: 2, 16 hr
; 3, 18 hr; 4, 24 hr; 5, 28 hr;6 , 30 hr; extract prepared from
SKK906 grown to 7,16 hr; 8 , 22 hr.
73 16 Ç 14 1 E a. c 12 CD o £ o m 10 8 I c 8 o (0 E •fi c o 6 È < 4 2 Î 9 0 16 16 20 22 24 26 28 30 Time (Hr)
SKK302 SKK906
! ? '/Y
Figure 10 intensity of the band comigrating with purified histidase increased in parallel with the increase in activity (Fig. 10). The accumulation of histidase during growth
and the absence of histidase from cells harvested during the mid-exponential
phase of growth suggest that SKK302 contains a second site mutation in a locus that affects the regulation of synthesis of histidase. The growth rate of SKK302 grown in 2XYTH was not significantly different from the wild-type strain. Since I had already identified the mutation in hutH^, further characterization of these revertants was not undertaken.
F. Allele exchange
To determine whether the Hut* phenotype of SKK906 was a consequence of the missense mutation in hutH^ or a second mutation in another chromosomal locus, hutH^ was replaced with by homologous recombination. If there were no other mutation that affects the synthesis or activity of histidase in SKK906, the recombinant strain generated by this procedure would have a histidase level identical to that of the wild-type strain.
SKK906 w as transformed with pKKIlOO and 100 thiostrepton-resistant colonies were selected (Fig. 11 ). After growth of the transformants for three generations in the absence of thiostrepton, the colonies were screened for the recovery of histidase by patching on minimal medium with L-histidine as the sole nitrogen source. Of the 100 colonies, 94 were sensitive to thiostrepton, suggesting that these transformants were cured of the plasmid. Eighty-nine of these
75 FIG. 11. Method for the isolation of recombinant strains by allele exchange.
The detailed protocol to generate the recombinant strain is provided
in the Materials and Methods section.
76 tsr pKKIlOO (PIJ702)
hutH
chromosomal hutH
V
hutH tsr hutH
tsr excised plasmid
hutH
Figure 11
77 thiostrepton-sensitive colonies were also Hut*, growing on minimal medium containing L-histidine as the sole nitrogen source. One Hut* isolate (SKK308) was analyzed in greater detail. SKK308 was auxotrophic for L-histidine, as expected for a strain derived from SKK906. A 322 bp fragment of DNA was amplified from the total genomic DNA of SKK308 by PCR using oligonucleotides
110 (corresponding to nt 2249 - 2231 of hutH) and 149 (corresponding to nt
1927 - 1943 of hutH). This region of DNA contained the hutH mutation in
SKK906. The nucleotide sequence of the fragment from SKK308 was identical to that of the wild-type strain, indicating that this portion of hutH was replaced with plasmid-bome DNA from pKKIIOO.
SKK308 was grown in 1% CAA medium, and a crude extract of the cells was assayed for histidase and urocanase activities (Table 9). SKK308 recovered only partial histidase activity (20% of the wild-type level). The reduced level of histidase activity also corresponded to the lower amount of hutH transcript
(described below) in this strain.
To confirm that there was no residual plasmid in SKK308 that might contribute to the histidase activity, I performed a Southern hybridization analysis on the total genomic DNA isolated from SKK308. plJ702 was the probe used to test for the presence of plasmid DNA. The results of the slot blot experiment showed that there was no plJ702 in SKK308 (Fig. 12). The control lane
78 FIG. 12. Slot-blot analysis of recombinant strains to confirm the absence of
plJ702. Genomic DNA from the indicated strains was denatured
and applied to a nitrocellulose membrane by using a slot blot
apparatus. plJ702 labeled with digoxigenin was used as a probe.
Lanes; 1, SKK307; 2, SKK308; 3, SKK310; 4, SKK311; 5, Control
DNA isolated from the wild-type strain containing plJ702.
79 08
CO
3 1 (O c 3 Control N5 N3 Relative activity*
Recombinant strains Source of hutH Strain background Histidase Urocanase SKK307 wild-type SKK896 46 ± 3 34 ± 7
SKK308 wild-type SKK906 2 1 ± 2 15±0
SKK310 SKK906 wild-type :S1 s i SKK311 SKK896 wild-type s i s i Parent strains
wild-type N/A** N/A 100 ± 4 100 ±17 00 SKK896 N/A N/A s i s i SKK906 N/A N/A s i s i
Table 9. Relative enzyme activities in wild-type and recombinant strains grown under Inducing conditions.
“The cultures were grown in glucose-ammonia minimal medium supplemented with 10 mM L-histidine.The specific activity was measured as nmol/min/mg protein. The values of histidase and urocanase represent the relative rates. The enzyme activities of the wild-type strain were set at 100%. The actual specific activities in this strain were 22.3 ± 0.8 nmol/min/mg protein for histidase and 4.3 ± 0.4 nmol/min/mg protein for urocanase. Values are average ± std. dev. for the enzyme activity for at least two extracts assayed in triplicate. ** not applicable. containing DNA from the wild-type strain transformed with plJ702 showed a positive signal with the labeled probe.
In a parallel experiment the wild-type strain was transformed with pKK616
(hutHgoe), and Huf recombinant strains were isolated. Of 250 transformants, four had lost the ability to grow on minimal medium with L-histidine as the sole nitrogen source. SKK310 contained hufHgœ in an otherwise wild-type background and did not have any histidase activity (Table 9). A comparison of the levels of histidase activity in the two recombinant strains, SKK308 and
SKK310, indicated that the missense mutation in hutHgag led to the complete loss of histidase activity by itself, but SKK906 might have at least one other mutation that results in the low level of histidase activity measured in SKK308. The possibility that the recombination event might also have generated a mutation, absent from SKK906, that led to the reduced level of histidase in SKK308 was not tested.
II. Characterization of SKK896
A. Enzyme and immunoblot analyses
The Huf strain SKK896 was generated by fusing protoplasts of SKK902
(Lys', hut-2) and SKK832 (His ) and selecting for Huf prototrophs (Kroening and
Kendrick, 1989). SKK896 cannot grow in minimal medium containing L-histidine as the sole nitrogen source. A crude extract of SKK896 grovm in a rich medium
82 did not have any histidase or urocanase activity (Table 5), indicating that this
strain had sustained a mutation in a locus that affected the synthesis of histidase
or resulted in the synthesis of an inactive or unstable histidase. To ascertain
whether the lack of histidase activity in SKK896 was a consequence of the
absence of the protein or the synthesis of an inactive enzyme, I performed an
immunoblot on the total protein of a crude extract of SKK896. There was no
detectable histidase protein (Fig. 5); thus the lack of histidase activity in these
extracts was most likely due to the absence of the protein because of either the
lack of synthesis or rapid degradation.
B. Complementation studies
By S1 nuclease protection studies, Wu demonstrated that SKK896 has
approximately 10-fold less hutH transcript than the wild-type strain (Wu, 1994).
To analyze hutH^ further, Wu cloned a 4.0 kb BamHl fragment of DNA from
SKK896 that contained hutHs^ and 2.5 kb of upstream DNA. This fragment was
therefore likely to include the entire upstream open reading frame as well as
additional DNA. He subcloned this fragment into the Bgl\\ site of plJ702 to create
pKK1111 (Wu, 1994). Transformants of SKK896 containing
(pKK1100) showed 117 ± 6 % of histidase activity compared to the control (Wu,
1994) (Table 7). SKK896 transformants containing hutH ^ (pKKI 111) showed
25% of the histidase activity of the control (Wu, 1994) (Table 7). This result
indicated that histidase synthesized from hutHsæ is at least partially functional.
83 To determine whether hutH^ could restore histidase activity to SKK906,1
Introduced pKK1111 Into SKK906. The transformant of SKK906 containing
hutHsashad 38% of the histidase activity of the control (Table 7).
Because the vector In these experiments exists In multiple copies, It was
possible that the recovery of histidase activity In SKK896 containing pKK1100 or
pKKI 111 was the consequence of suppression of the mutation rather than
complementation. To distinguish between these possibilities, I examined the
effect of pKK636 In SKK896. pKK636 contains subcloned In the low
copy vector, pXE4. This strain recovered 99% of the histidase activity compared
to the control. Indicating that complemented the mutation In SKK896
(Table 9). Transformants of SKK896 containing pKK616 {hutHaœ in a multicopy
vector) recovered 20% of the histidase activity of the wild-type strain (Table 7,
8 ), despite the fact thathuthia^ contains a mutation that contributes to the Huf
phenotype of SKK906.
The restoration of histidase activity to SKK896 transformants containing pKKI 111 or pKK616, despite of the mutation In the structural gene, was surprising. Because both of these plasmids contained approximately 2.5 kb of
DNA upstream of the hutH transcription start site. It was possible that the upstream region of DNA contributed to the histidase activity In these transformants. To determine whether the open reading frame upstream of hutH
84 was responsible for the restoration of histidase activity in SKK896 transformants,
I deleted portions of this upstream region and determined the effect on the
restoration of the Hut* phenotype. pKK630 is a derivative of pKK616 that
contains the complete upstream Orf and partial hutH corresponding to the N-
terminal coding sequence (Fig. 6 ). pKK634 is also derived from pKK616, and
was generated to resemble pKK636 such that the open reading frame upstream
of hutH ^ was truncated (Fig. 6 ). SKK896 transformed with pKK634 regained
2 0 % of the control level of histidase, which is comparable to the activity
recovered in SKK896 transformants containing pKK617 (4.0 kb hutH ^ in pXE4).
On the other hand, transformants of SKK896 containing pKK630 did not have
any histidase activity. These results confirmed that the recovery of histidase
activity in SKK896 transformants required multiple copies of hutH^ and was not
influenced by the Orf upstream of hutH.
To determine whether the presence of multiple copies of DNA upstream of
the hutH transcription start site contributed to histidase activity in SKK896 transformants, various extents, of this region were introduced in multiple copies
into SKK896 to determine their effect on hutH expression. Plasmids pKK1101, pKK1102, pKK641, and pKK647 (described in detail in Fig. 22), containing DNA sequences of various lengths upstream of the hutH transcription start site, were introduced into SKK896, and a crude extract of each transformant grown under inducing and non-inducing conditions was analyzed for histidase activity.
85 Histidase activity was not detected in any of these transformants (data not shown), indicating that the recovery of histidase in the SKK896 transformant required the complete hutH gene from the wild-type or mutant strain. These results also implied that the mutation in SKK896 might lie in the hutH coding sequence. In addition, the complementation studies suggested that the mutation in hutH^ affected the activity of histidase since hutH^se restored partial histidase activity to SKK896 and SKK906 transformants. The nucleotide sequence of hufHgge revealed a single missense mutation that would change the aspartate residue at position 223 (GAC) to asparagine (AAC) (Fig. 13). The nucleotide sequence extending 730 nt upstream of the transcription start site of hutH^aB contained no additional mutation, suggesting that a c/s-acting mutation was not responsible for the absence of histidase.
C. Characterization of recombinant strains
To determine whether the mutation in hufHggg alone was responsible for the Hut* phenotype of this strain, hutHgga was replaced with the wild-type allele by homologous recombination (Fig. 11). pKKIlOO was introduced into SKK896, and 100 thiostrepton-resistant transformants were selected. These transformants were grown in a medium without thiostrepton for three passages. After the third passage all of the colonies had become sensitive to thiostrepton. 96% of the recombinant strains were Hut* and grew on minimal medium containing
L-histidine as the sole nitrogen source.
86 FIG. 13. A, Nucleotide sequence of the region of hutH showing the
missense mutation GAC to AAC in SKK896. Left panel, hutH^ia.type',
right panel, hutHgae- The arrow indicates the change in the
nucleotide. B, Amino acid sequence showing the relative position
of the Asp223Asn change. The sequence ladder is of the antisense
strand in each case. This sequence was generated by the fmol
method.
87 wild-type SKK896
00 00
Y T A D T A A221
B wild-type TACACCTCGGCCGACATCACCGCGGCC 1515
SKK896 S A N I A A AAC
Figure 13 One isolate, SKK307, was selected for further study. Southern hybridization with
plJ702 as a probe revealed that there was no residual plasmid present in the
total DNA isolated from SKK307 (Fig. 12). To conclusively show that the
recombinant strain did indeed contain I amplified a 412 bp fragment
from genomic DNA of SKK307 by PCR using oligonucleotides 146
(corresponding to nt 1138 -1155) and 148 (corresponding to nt 1550-1534) and
determined the nucleotide sequence. The sequence confirmed that SKK307
contained hutH^^a^. A crude extract of SKK307 grown under inducing
conditions in a rich medium contained 43 ± 3% of the control level of histidase
activity (Table 9).
In a parallel experiment I transformed the wild-type strain with pKK1111
to replace with hufHggg and screened the transformants for
thiostrepton-sensitive colonies. I obtained one Huf isolate (SKK311 ) after
screening 300 colonies. The sequence of hutH was identical to that of hutH^ ,
indicating the exchange of hutH alleles. A comparison of the enzyme activities of the two recombinant strains, SKK307 and SKK311, suggested that hutH^<^ generates a defective histidase and when present in single copy leads to a Huf phenotype.
89 III. Analysis of hutH transcript in the wild-type and mutant strains
Because Wu's (1994) results suggesteed that SKK896 might produce
10-fold lower hutH transcript compared to that of the wild-type strain, I
determined the amount of the hutH transcript in the Huf strains, SKK896 and
SKK906 and the recombinant strains, SKK307, SKK308, and SKK311. To
determine whether the absence of histidase in the mutant strains was a
consequence of the absence of hutH transcript, RNA was isolated from
exponentially growing cultures of the two strains under inducing conditions, and the level of hutH transcript was determined by northern hybridization. The
membrane containing RNA from the mutant strains and the wild-type strain was probed with a 0.7 kb Mlu\-BamH\ fragment corresponding to the C-terminal coding sequence of hutH^j^^. The level of hutH transcript in SKK896 was
10% of that of the wild-type strain (Fig. 14). Likewise, in SKK906 the hutH transcript amounted to only 14% of the level in the wild-type strain (Fig. 14). My result is in accordance with Wu‘ s observation from comparisons of the level of hutH transcript in SKK896 and the wild-type strain by SI nuclease protection studies (Wu, 1994). The lower amount of hutH transcript in the mutant strains could be a consequence of a second mutation that maps elsewhere in the chromosome or the point mutation identified in the hutH coding sequence. If the missense mutation in hutH^^^ contributed to the lower amount of hutH transcript in SKK896, then SKK311, containing hutH^^ in a wild-type background, should also have a lower level of hutH transcript. The recombinant strain SKK311
90 FIG. 14. Northern blot of the hutH transcript in the wild-type and mutant
strains. RNA isolated from exponentially growing cultures of the
wild-type strain and the two mutant strains was separated on a
formaldehyde agarose gel and transferred to a nitrocellulose
membrane. The RNA on the membrane was probed with a 0.7 kb
Mlu\/BamH\ fragment isolated from pKK570 that contained the
carboxy-terminal coding sequence of hutH. Lanes; RNA isolated
from 1 , wild-type strain; 2, SKK896; 3, SKK906.
91 Figure 14 contained only 8 % of the hutH transcript detected In the wlld-type strain (Fig.
15). This result suggests that the missense mutation, hutH^, leads to an unstable transcript even though the mutation does not Introduce a stop codon or frame shift. The possibility that SKK896 has a second mutation In a locus that affects the synthesis of histidase in this strain Is unlikely because of the equally low level of hutH transcript In SKK311. The amount of transcript In the Hut* recombinant strain containing hutH^,,^^ In an SKK896 background (SKK307) was 74% of that In the wlld-type strain (Fig. 15), suggesting that the missense mutation that results In the synthesis of Asp223Asn histidase Is sufficient to confer a low level of hutH transcript.
IV. Overexpression and characterization of recombinant histidase
A. Enzyme and Immunoblot analyses
To obtain higher expression of histidase from S. griseus and to characterize the mutant forms of histidase from SKK896 and SKK906, I first cloned hutH^i^^ Into the expression system pT7-7 to generate pKK651. The mutant alleles were constructed as depicted In Fig. 16. All of the plasmids were
Introduced Into E. coli BL21(DE3) for Induction. By this strategy I could determine the effect of each mutation on histidase activity and stability. On the basis of the specific activity of histidase In the crude extract compared to that of the purified histidase (Wu et al, 1992), approximately 4% of the total protein present In extracts of the E. coli strain containing was histidase
93 FIG. 15. Northern blot comparing the amount of hutH transcript in the wild-
type and recombinant strains. RNA isolated from exponentially
growing cultures of the wild-type strain and the recombinant strains
was separated on a formaldehyde agarose gel and transferred to a
nitrocellulose membrane. The RNA on the membrane was probed
with a 0.7 kb Mlu\/BamH\ fragment isolated from pKK570 that
contained the carboxy-terminal coding sequence of hutH. Lanes:
RNA isolated from 1, wild-type strain; 2, SKK308; 3, SKK307; 4,
SKK311.
94 s
Figure 15 FIG. 16. Construction of plasmids to express wild-type and mutant histidase
from S. griseus in E. co//BL21(DE3). The relative positions of the
muatations in hutH^a^ and MufHgggare indicated by • and x,
respectively.
96 1.0 kb N d e : I M luT = o from wild-type (pT 7-7)
1.0 kb ndàimt WlvT From SKK896
0.7 kb Mi uX ■ ■ ■ m i BamKt V V From SKK906
pKK655 \ OKK65 ( P T 7 - 7 ) /,
Figure 16
97 (Fig. 17). Histidase expressed from or from/7i/fH896 was hysteretic
(Fig. 18). This observation suggested that the hysteretic nature of streptomycete
histidase is an inherent characteristic and does not require an additional factor
from streptomycetes. Another possibility is that E. coli also produces a factor that
can activate hysteretic histidase. The activity of histidase synthesized from
pKK651 and pKK657 was comparable (Table 10), and histidase was present at
similar amounts in both extracts (data not shown). This result was consistent
with the results of my other experiments that suggested that hutH^ in trans
could restore histidase activity to SKK896 and SKK906. This observation also
indicates that the activity or stability of Asp223Asn histidase from SKK896 was
not significantly affected in E. coll.
The histidase synthesized from hutH^ was not active, indicating that the
Ser426Phe histidase was inactive or unstable. An immunoblot of the
recombinant histidases synthesized in E. coli showed that a band that co migrated with pure histidase was present in all of the lanes containing crude extracts from the E. coli cultures described above (Fig. 19). Histidase was absent from the crude extract of the E. coli transformant containing only the vector. In the sample containing histidase from pKK655 {hutHgoe), a second immunoreactive protein having an apparent M, of approximately 14 kDa was predominant in the immunoblot (Fig. 19), This polypeptide most likely corresponds to a histidase degradation product.
98 FIG. 17. Accumulation of histidase directed by T7 RNA polymerase.
Cultures of BL21 (DE3) carrying the indicated plasmids were grown
in LB medium containing 80 pg ampicillin per ml. Synthesis of T7
RNA polymerase w as induced by 0.4 mM IPTG once the culture
reached an Ag^ of 0.4. Lanes: 1, molecular weight markers; 2,
purified histidase; 3, extract of BL21(DE3) containing wild-type
hutH 0.5 hr prior to induction; 4,1.0 hr after induction; 5, 2.0 hr
after induction; 6 , 3.0 hr after induction; 7, extract of BL21(DE3)
containing pT7-7 without insert 0.5 hr prior to induction; 8 ,1 .0 hr
after induction; 9, 2.0 hr after induction; 10, 3.0 hr after induction.
99 Marker 1 (kDa) 6 7 8 9 10
o o
Figure 17 FIG. 18. Hysteretic histidase from S. griseus synthesized in E. coli. A crude
extract of E. coli BL21(DE3) containing pKK651, grown in LB + 80
pg/ml of ampicillin and induced with IPTG, was prepared in 50 mM
K2 HPO4 buffer, pH 7.2. The extract was assayed for histidase
activity under standard conditions.
101 4
3
2
1
0 0 2 4 6 8 10
Time (min.)
Figure 18
102 FIG. 19. Immunoblots of crude extracts of E. coli BL21 (DE3) containing
overexpressed histidase. E. coli transformants containing the
indicated plasmids were grown in LB at 30° C to Agoo of 0.4 and
induced with IPTG for 2 hr prior to harvesting the cells. An extract
was prepared from each culture, and 5 pg of protein from each
extract was transferred to a nitrocellulose membrane. Monospecific
antibodies were used to detect histidase in the extracts. Lanes: 1,
purified histidase: 2, pT7-7 with no insert; 3, wild-type histidase; 4,
Ser426Phe histidase; 5, Asp223Asn histidase.
103 native HutH
2
degraded HutH ***** *****i^pp^
V
Figure 19 Plasm id Source of hutH Activity^ pKK651 SKK821 836 ± 84 pKK655 SKK896 742 ± 36
pKK657 SKK906 s 1
— pT7-7 5 1
Table 10. Histidase activity in E coli BL21(DE3) extracts containing wild-type or mutant histidase.
“ nmol/min/mg protein. Values are average ± std. dev. of at least three extracts assayed in triplicate.
105 This result indicates that the Ser426Phe histidase from SKK906 has a
pronounced effect on the stability and activity of the protein.
B. Kinetic studies of overexpressed histidase
Transformants of Huf mutant strains with hutHegs in trans contained only
partial histidase activity compared to the control. This result suggested that the
mutation in hutHggs led to the synthesis of a partially active histidase. To
determine the effect of Asp223Asn histidase on activity, I determined the
apparent K^, of the Asp223Asn histidase and wild-type histidase in crude
extracts prepared from E. coli. The apparent of wild-type histidase, 0.6 mM, is
in agreement with the previously reported values (Kroening and Kendrick, 1987;
White and Kendrick, 1993) (Fig. 20). However, the apparent K^ of the
Asp223Asn histidase synthesized from pKK657 was three-fold higher (1 . 8 mM;
Fig. 20). This result suggested that Asp223Asn might alter the specificity of the
mutant enzyme for the substrate.
To determine whether the Asp223Asn mutation affected the thermostability of the enzyme, the kinetics of thermal resistance was determined.
Preliminary experiments indicated that the mutant enzyme was sensitive to incubation at 70°C whereas the wild-type histidase was highly thermostable. My results indicated that the Asp223Asn histidase was significantly less stable at
70“C than was wild-type histidase. After 40 min at 70°C the wild-type histidase
106 FIG. 20. Kinetics of histidase overexpressed in E. coli BL21 (DE3).
Lineweaver-Burk plot of histidase from a crude extract of E. coli
containing or hufHgge#, wild-type histidase; the linear
regression equation for the plot is y= 0.95x + 1.98 (r^ =0.9841 ) and
o, Asp223Asn histidase; the linear regression equation for the plot
is y= 0.71 X + 0.43 (r^= 0.9927).
107 CL O)
3 -2 -1 0 1 2 3 4 5 6 7 8 9 10
1/[S] (mM L-histidine)'^
Figure 20
108 retained 95% of its maximal activity, whereas Asp223Asn histidase retained only
35% of its maximal activity (Fig. 21). The loss of histidase activity encoded by hutHgae could be fit to an exponential decay equation and showed a half-life of
43 min. The altered K^, and reduced thermostability of Asp223Asn histidase might explain why only partial activity was recovered in transformants of Huf strains of S. griseus containing hutHgag in trans.
V. Negative regulation of hutH expression
Previously we reported that the expression of hutH and hutU is subject to negative regulation by a mechanism that involves DMA between 67 and 176 nt upstream of the hutH coding sequence (Wu et ai, 1995). This conclusion was drawn on the basis of the recovery of histidase activity in cultures of transformants of the wild-type strain grown under non-inducing conditions. When present in multiple copies in trans, this region of DMA may sequester a negative regulatory factor, thereby partially derepressing the expression of hutH and hutU under non-inducing conditions. To identify the precise region of DNA that served as a potential binding site for a regulatory factor, I performed a repressor titration experiment using fragments of various lengths corresponding to the region upstream of the hutH transcription initiation site. By PCR amplification S. Palmer isolated four fragments of DNA corresponding to -35 to -110, +1 to -110, -35 to
-176, and +1 to -176, with respect to the hutH transcription initiation site. I subcloned these fragments into the SamHI site of the multicopy vector plJ702 to
109 FIG. 21. Thermostability of wild-type and Asp223Asn histidase expressed
in E. CO//. A crude extract of E. coH containing overexpressed
histidase was incubated at 70°C, and at various times aliquots
were removed and assayed for histidase activity. The values are
calculated as the average ± std. dev. of at least two extracts
assayed in triplicate. Typically the maximal activity of the wild-type
histidase in these crude extracts was 346 ±16 nmol/min/mg protein
(•), and the maximal activity of the Asp223Asn histidase in these
crude extracts was 644.5 ± 50 nmol/min/mg protein (o). Since the
amount of total histidase varied in the crude extract the higher
specific activity of mutant histidase may not reflect the true specific
activity of a purified Asp223Asn histidase.
110 100.0 I 5 I I • wild-type o SKK896
25.0 0 10 20 30 40 50 Time at70°C (min)
Figure 21
111 generate pKK645 (-35 to -110), pKK646 (+1 to -110), pKK647 (-35 to -176), and
pKK648 (+1 to -176) (Fig. 22), and Introduced each Into the wlld-type strain.
Histidase and urocanase activities were higher In cultures of the transformants
that were grown under non-lnducing conditions and contained fragments
extending upstream of -67. Histidase activities measured In these transformants
were comparable (Fig. 22), Indicating that region of DNA spanning -35 to -110
bp upstream of the transcription Initiation site of hutH was sufficient to confer the
observed derepression of hutH expression. A comparison of enzyme activity
suggests that the region of DNA between -110 and -67 Is critical for the binding
of the putative repressor molecule.
Transformants of SKK896 containing pKK1100 grown In non-lnducing
conditions contained a very high level of histidase compared to the control (up to
617% of the control: Table 11 and 12; Wu, 1994). The reason for the high level,
constitutive synthesis of histidase In this transformant could be because of a
mutation In SKK896 that eliminated negative regulation of the synthesis of
histidase, or the plasmid sustained a mutation during transformation, or the
plasmid copy number was very high In this strain. A culture of SKK307 that contained hutH^,^^ In an SKK896 background did not have the high level of histidase activity under non-lnducing conditions. This result suggested that the abnormal histidase activity In the SKK896 transformant was most likely not due to a mutation In a second locus that affected the negative regulation of hutH
112 FIG. 22. Negative regulation of histidase expression. Each insert was
subcloned into the Bg!\\ site of the multicopy vector plJ702 and
introduced into wild-type S. griseus. The boxes show the extent of
upstream sequence present in the insert. The cultures were grown
in glutamate minimal medium. Enzyme activity is expressed as
nmol/min/mg protein. Values are average ± std. dev. of two extracts
assayed in triplicate.
113 Activity
Insert (extent of upstream DNA) Plasmid Histidase Urocanase
None PIJ702 0.4 ±0.07 0.1
-67 + 1 +88 pKK1101 0.4 ± 0.2 0.2 ±0.06
-176 + 1 +88
pKK1102 1.2 ± 0.2 0 . 6 ±0.07
pKK645 2.0 ±0.5 1.3 ±0.2
pKK646 1.3 ± 0.2 1.2 ± 0.7
-176 -35 pKK647 2.0 ± 0 . 8 1.2 ± 0.7
Figure 22 Recipient Strain SKK821 SKK896 Insert*’ Histidase Urocanase Histidase Urocanase
none 30 5l ^ 1 ^ 1 100 ±14 100 ± 5 619 ± 32 120 ±37 hUtHggç 105 ±13 61 ± 15 55 ± 12 121 ± 19 en hUtHgog 79 ±17 30 ± 9 58 ±11 159 ± 19
Table 11. Relative specific activities of histidase and urocanase in transformants, containing plJ702-derived vectors, grown under non-inducing conditions."
“ The cultures were grown in glutamate minimal medium. The specific activity was measured as nmol/min/mg protein. The values of histidase and urocanase represent the relative rates. The enzyme activities of the wild-type strain containing wild-type hutH in trans were set at 100%. The actual specific activities in this strain were 13 ± 2 nmol/min/mg protein for histidase and 0.4 ± 0.5 nmol/min/mg protein for urocanase. Values are the average ± std. dev. for the enzyme activity from at least two extracts assayed in triplicate. " /)u/H^,d.,ype(pKK1100): /7u/Ha96(pKK1111); (pKK616). Recipient Strain
Insert** SKK821 SKK896 Histidase Urocanase Histidase Urocanase
None 7 ± 2 ^ 1 < 1 3l
1 0 0 ± 1 1 ht/fWwild-lyp6 100 ± 9 85 ± 4 76 ±4
hutHgog A 20 ± 4 ^ 1 2 2 ± 2 62 ± 1
hutHgog B 42 ±14 ^ 1 25 ± 4 5l O) Table 12. Relative specific activities of histidase and urocanase in transformants, containing pXE4-derived vector, grown under non-inducing conditions.®
“ The cultures were grown in glutamate minimal medium. The specific activity was measured as nmol/min/mg protein. The values of histidase and urocanase represent the relative rates. The enzyme activities of the wild-type strain containing wild-type hutH In trans were set at 100%. The actual specific activities in this strain were 5.5 ± 0.6 nmol/min/mg protein for histidase and 2.1 ± 0.2 nmol/min/mg protein for urocanase. Values are average ± std. dev. for the enzyme activity from at least two extracts assayed in triplicate. " /}ufH^„.^(pKK636): hutH ^A {pKK634); hutH^B (pKK617). expression in SKK896. To rule out the possibility that the plasmid-bome hutH^^ typ, might contain an additional mutation, pKK1100 was isolated from a SKK896 transformant and reintroduced into the wild-type strain. The wild-type strain containing pKKIlOO that was isolated from the SKK896 transformant did not
have a high level of histidase activity in the absence of the inducer. Thus the
likely reason for the elevated level of histidase in the SKK896 transformant was due to either a difference in plasmid copy number or a second site mutation in a regulatory region in the chromosome of SKK896. Because there was no mutation in the DNA 1 kb upstream of transcription initiation site of hutH^, the reason for the high level of histidase activity is most likely due to the difference in plasmid copy number.
117 CHAPTER 4
DISCUSSION
I. Characterization of SKK906
S. griseus SKK906 is Hut* and does not produce the antibiotic
streptomycin (Kroening and Kendrick, 1989). A prototrophic derivative of
SKK906, SKK910 (Kroening and Kendrick, 1989), also did not produce streptomycin. From this result Kroening hypothesized that the hut mutation and the sfr mutation in SKK906 may be linked. Only three of 156 prototrophic recombinant progeny obtained after protoplast fusion of SKK906 (Huf, His*,Str) with SKK844 (Hut*, Lys‘, Str*) were Huf and Str. Statistical analysis of the data indicated that the Huf and Str mutations were not linked. Thus SKK906 incurred at least two distinct mutations, one that prevents L-hlstldine utilization and the other that prevents the production of streptomycin.
A crude extract of SKK906 grown in a rich medium containing L-histidine lacked histidase and urocanase activities. The simultaneous loss of histidase and urocanase activities suggested that SKK906 contained a mutation that was either in a regulatory region that prevented the induction of the L-histidine
118 utilization pathway or in hutH as a consequence of which the inducer was not
synthesized. An immunoblot of a crude extract of SKK906 revealed that the
lack of histidase activity in this strain was due to the absence of the protein. The
absence of histidase in SKK906 could be because of the inability to synthesize
histidase, or rapid degradation of histidase in the cell. Because SKK906 is auxotrophic for L-histidine, it is unlikely that the Huf phenotype of this strain was
due to the inability to transport L-histidine. In S. typhimurium the histidine
permease is composed of a periplasmic histdine-binding protein (HisJ) and a membrane-bound complex composed of three proteins, HisQ, HisM, and HisP.
During transport HisJ binds histidine with high affinity and then interacts with the
QMP complex resulting in the translocation of L-histidine (Wolf et al., 1994,
Hecht et al., 1996). However the possibility that S.griseus contains more than one perm ease each with a different affinity for the substrate cannot be ruled out.
The results of the complementation studies suggest that the mutation in
SKK906 most likely lay within the 2.5 kb fragment of DNA that contains both hutH and the partial open reading frame upstream of hutH. Plasmid-bome
introduced into SKK906 either in a high copy vector (pKKIlOO) or a low copy vector (pKK636) restored histidase activity. hutHgas 'm multiple copies
(pKKI 111) also restored histidase activity to SKK906, although the level of histidase activity observed was only 20% of the control. hutH^ did not restore histidase activity to SKK9G6 even when present in multiple copies.
119 Because my evidence suggested that hutH^ contains a mutation, I reasoned that the mutation may be either in the promoter region to reduce the transcription of hutH or in the hutH structural gene. The nucleotide sequence of hutHsos revealed that hufHgœ contains a single missense mutation that changes the serine residue (TCC) to a phenylalanine (TTC) residue (Ser426Phe). The sequence of DNA extending 1 kb upstream of the transcription initiation site was identical to hufH,^kMyp* Thus the lack of histidase in SKK906 was not a consequence of a mutation in the upstream regulatory region.
The change from a small polar residue to a large hydrophobic residue would be expected to affect the stability or activity of the protein. Ser426Phe histidase was not active and was highly unstable when overexpressed in E. coli.
An immunoblot performed on a crude extract of E. coli containing hutHgoe clearly showed a protein of about 14 kOa that is most likely a degradation product of histidase. Because the histidase protein was overexpressed, I could easily visualize the degradation product in the £. coli extract. The absence of histidase or a degradation product in the immunoblot of a crude extract prepared from
SKK906 might be a consequence of either the low level of histidase when hutH is present at single copy, or a relatively insensitive preparation of monospecific antibodies. The preparation of monospecific antibodies was necessitated because Mycobacterium tuberculosis y/^as used as an adjuvant while generating the anti-histidase antibodies (Kendrick, personal communication). Presumably
120 because M. tuberculosis Is phylogenetically closely related to Streptomyces, the
antiserum cross-reacted with several proteins in the extract. Perhaps the use of
a more sensitive immunoassay system instead of the colorimetric assay or a
better preparation of antibodies will enable the detection of inactive and unstable
histidase in SKK906. An alternative would be to examine the synthesis of
histidase in a transformant of S. griseus that contains hutH^ in multiple copies.
Studies of histidase from P. putida (Hernandez and Phillips, 1994) and rat
(Taylor and Mclnnes,1994) have shown that a conserved serine residue is
probably converted to a dehydroalanine residue and is implicated in the catalytic
mechanism. In S. griseus histidase Ser146, which corresponds to serines 143 of
P. putida and 254 of rat histidase, is most likely the precursor of the
dehydroalanine residue (Fig.3). The amino acid alignment of three bacterial
histidases and four eukaryotic histidases as well as thirty five phenylalanine
ammonia-lyases revealed that Ser426 is not conserved, whereas four other
serine residues corresponding to Seri 15, Seri 46, Ser396, and Ser422 of S.
griseus histidase are conserved. However, the amino acids
GIU4 i 8 AspHisValSerMet4 2 3 , located just N-terminal to Ser426, are highly
conserved, not only in histidases but also in phenyalanine ammonia-lyases.
Thus Ser426 is in the vicinity of a region that might have an important role in the
catalytic activity or conformation of these ammonia-lyases.
121 In S. griseus the amino acid prior to Ser426 is Trp, therefore it is plausible
that Ser426 is exposed on the surface of histidase and normally interacts with
the adjacent Trp. In the mutant where Phe is substituted for Ser426, the
resulting hydrophobic patch may initiate a conformational change that results in
a highly unstable protein. It is interesting to note that in Caenorhabditis elegans
the amino acid residue corresponding to Ser426 is Phe, and the amino acid prior
to Phe426 is Gly. This observation suggests that in this region of histidase a
small, polar amino acid and a large, hydrophobic amino acid might interact or
may be necessary to avoid steric interference.
The reduction in activity of an enzyme as a result of an amino acid
substitution might be a consequence of a change in the secondary structure of
the protein. Proteins fold in a manner such that the free energy is minimized,
commonly leading to well packed hydrophobic interiors and hydrophilic exteriors
(Warshel, 1978). For a protein to be maximally active, the active site cleft might
contain charged and polar amino acids that are sequestered from water, or the
enzyme might have exposed hydrophobic patches, which might compromise the stability of the protein (Schoicht at a/., 1995). The stability-function hypothesis predicts that when an amino acid residue that is important for the function of an enzyme is changed, the activity might be reduced but there might be a concomitant increase in the stability of the folded protein because the residues that often contribute to the catalysis or ligand binding might not be optimal for
122 stability (Schoichtet al., 1995). When the conserved serine residues Ser223,
SerSOS and Ser533 of rat histidase were changed to alanine, the activities of the
mutant histidases ranged from 5 1% to 75% of the wild-type activity (Taylor and
Mclnnes, 1994). On the basis of the stability-function hypothesis, it is possible
that some of the Ser to Ala changes in rat histidase led to the synthesis of a
more stable but less active histidase. When Seri 17 of lysozyme was changed to
Phe, the enzyme became more thermostable but less active (Anderson et a!.,
1993). The authors ascertained that the observed increase in stability by
substitution of Seri 17 by Phe was caused by the loss of a hydrogen bond
between the y-hydroxyl of the Ser and the side chain of Asnl 32.
In the absence of structural data for histidase, it is impossible to determine the mechanism that causes the instability of Ser426Phe histidase.
Data obtained from enzyme analyses and immunoblots suggest that Ser426Phe affects both the stability and activity of the protein. These observations illustrate that differences in the ability of the remainder of the protein to adapt to changes in primary structure are likely to affect the stability of the protein (Anderson et a/.,
1993)
The level of histidase activity of the Hut* recombinant strain, SKK308, which contains in the SKK906 background, was 21 % of that in the wild-type strain. The reduced level of histidase in SKK308 might be a
123 consequence of either a second mutation in SKK906 that affects the synthesis of histidase or the introduction of a mutation during the recombination event. A comparison of the level of histidase activity in SKK308 and SKK310 showed that
Ser426Phe is sufficient to confer a Huf phenotype. Northern hybridization of
RNA isolated from SKK906 revealed that the amount of hutH transcript was only
14% of the amount in the wild-type strain. The nucleotide sequence of DNA 1 kb upstream of the transcription start site of hutH^ is identical to that of the wild- type strain; thus there is no c/s-acting mutation in this region of the DNA that causes the reduced expression of hutHgoe^ Streptomyces DNA averages 80% go in the coding sequence thus the prefered codons are likely to be those that contain a g or c in the third position. The TCC to TTC muation does not result in the formation of a rare codon the translation of which might be limited by the cognate tRNA synthetases. On the basis of these observations I speculate that either the mutation TCC to TTC causes the transcript to be unstable, or there is a mutation in another locus that affects transcription of hutH in SKK906.
The lower level of histidase in SKK308 and the correponding low level of hutH transcript in this strain cannot be explained easily. The possibility that
SKK308 has acquired a spontaneous mutation separate from that in SKK906 that results in the decreased level of hutH transcript cannot be ruled out. To conclusively determine the effect of the missense mutation on histidase activity, future experiments could include site-directed mutagenesis of hutH^^a^^ to
124 create the missense mutation TCC to TTC. The wild-type strain containing this mutant allele should have the phenotype of SKK906 if this mutation is simultaneously responsible for the instability of histidase and the low level of transcript.
The restoration of histidase activity in the Hut*revertants of SKK906 might have been due to intergenic suppression or intragenic suppression.
Measurement of the level of histidase activity in SKK301 and SKK302 revealed that the mutation that suppressed hut-5 also resulted in the growth phase- dependent synthesis of histidase. The immunoblot of the crude extract of
SKK302 grown in a rich medium clearly demonstrated the accumulation of histidase protein during growth, in contrast to the wild-type strain. Thus the increase in the amount of histidase correlates with the increase in activity.
Hood et al. (1991 ) analyzed the promoter region of the tryptophan biosynthetic {trp) operon of S. œelicolor A3{2) and suggested that this operon was regulated in a growth phase-dependent manner. The researchers used the low-copy xylE promoter-probe vector, plJ2842, to study expression of trpB ( encoding tryptophan synthase), a gene required for tryptophan biosynthesis, and observed no promoter activity when cells were in lag phase or early exponential phase. When the cells reached mid-exponential phase, the promoter was activated, and it was inactivated when the cells entered stationary phase. On the
125 basis of these and other results the authors hypothesized that in streptomycetes
amino acid metabolism is not regulated by feed-back repression but rather by a
growth phase-dependent mechanism. The authors concluded that in
Streptomyces the biosynthesis and utilization of amino acids are closely linked
to the growth phase of the culture. These studies are problematic however,
because xylE promoter-probe vectors are unreliable for the study of regulation of
gene expression in streptomycetes, since there is frequently a low constitutive
level of XylE present when xylE is expressed in Streptomyces and the
expression of xylE does not necessarily reflect the activity of the fused promoter
(Wu, 1994; Kendrick, personal communication). In light of this observation, the studies regarding the growth phase-dependent regulation of trpB expression must be interpreted with caution.
The synthesis of histidase in B. subtilis is dependent on the growth phase of the culture and is influenced by amino acid availability (Atkinson at ai, 1993).
W hen B. subtilis enters stationary phase, the expression of the hut operon is derepressed. The authors suggested that L-histidine uptake was reduced in exponentially growing cultures because the synthesis of histidine permease was reduced. Considering the growth phase-dependent changes in the activity of histidine perm ease of S. subtilis, it is tempting to speculate that a parallel situation may exist in S. griseus. Because SKK302 had a maximum of 50% of the wild-type level of histidase activity, the reversion event only partially suppressed
126 the Huf phenotype caused by hutH^. To learn why hutH is growth phase- dependent in SKK302, key experiments would include determining the DNA sequence of hutH^ to determine whether the suppressor mutation maps to hutH, or identifying the gene responsible for the temporal synthesis of histidase by generating Hut* transformants of SKK906 by shot-gun cloning of DNA from
SKK302.
II. Characterization of SKK896
The Huf strain SKK896 did not contain any histidase or urocanase activity. An immunoblot of a crude extract prepared from this strain also did not show any histidase. The absence of histidase protein in the crude extract suggested that either hutH was not expressed, or histidase was rapidly degraded upon synthesis. To characterize this strain in greater detail, Wu
(1994) isolated a 4.0 kb BamHl fragment from SKK896 genomic DNA that contained hutH^gs and 2.5 kb of upstream DNA. Transformants of SKK896 containing hutHggg in multiple copies were Hut*, although the level of histidase was only 25% of that of the wild-type strain. By using SI nuclease protection studies, Wu observed that SKK896 contains 10-fold lower hutH transcript than the wild-type strain. These results led Wu to conclude that the mutation in
SKK896 does not lie in hutH but is more likely to be in a locus that is required for the expression of hutH (Wu, 1994).
127 However the nucleotide sequence extending 300 bp upstream of the
transcription initiation site of hufHgggwas identical to that of the wild-type strain
(Wu. 1994).
SKK906 transformed with hutH^ recovered 38% of the histidase activity
of the control strain. Because hutH^^ only partially restored histidase activity to
the mutant strains, it was possibile that hufHggg contained a mutation that
resulted in the synthesis of a partially active histidase. Consistent with this
interpretation, the nucleotide sequence of hutH^ showed a point mutation that
changed aspartate at position 223 (GAG) to asparagine (AAC), Asp223Asn. The
amino acid alignment of six histidases and 35 phenylalanine ammonia-lyases
revealed that Asp223 is not a conserved residue (Appendix 1 ).
In agreement with the results of Wu (1994), my northern analysis of RNA
from SKK896 showed that hutH transcript was present at 10% of the wild-type
level. Since the nucleotide sequence of the DNA extending 1 kb upstream of the
transcription initiation site in SKK896 is identical to that of the wild-type strain, it
is unlikely that a c/s-acting mutation causes the reduced amount of hutH
transcript in this strain. Preliminary studies of the stability of hutH mRNA in the
wild-type strain suggest that the half-life of hutH^i,^^ mRNA is between 3 and 6
min whereas the transcript of hutH ^ is much less stable. Thus the lower amount of hutH transcript in SKK896 may be caused by the missense mutation.
128 The similarly the reduced amount of hutH transcript in SKK311, which contains hutHsae in an otherwise wild-type background, argues that the mutation in hutHaae causes the transcript to be unstable. The GAC to AAC muation does not result in the formation of a rare codon the translation of which might be limited by the cognate tRNA synthetases. These observations suggest a mechanism by which the stability of a transcript is influenced by a missense mutation in the structural gene.
In prokaryotes a reduced steady-state level of transcript could be the consequence of the failure to initiate transcription, the rapid turnover of the transcript, or the premature termination of the transcript (Belasco and
Higgins, 1988; Ruteshouer and Richardson, 1989; McLaren etal., 1991;
Richardson, 1991). Because the nucleotide sequence 1 kb upstream of hufHggg was identical to that of the wild-type strain, the possibility that a c/s-active mutation led to decreased expression is unlikely. DNA extending 100 nt downstream of hutNgga, including the hairpin stucture that correponds to the site of transcript termination, also did not contain a mutation. Therefore the possibility of degradation of the message by 3’-to-5' exoribonucleolytic activity is also not likely. The GAC to AAC mutation does not appear to create an endonucleolytic site that leads to the rapid degradation of the message. A consensus sequence for RNase E site was deduced on the basis of compiled sequences of RNAse E sites (Fritsch etal., 1995). The consensus sequence
129 (G/A)AUU(A/U) is not generated by the mutation ruling out the possibility that
hutHaas sequence contains an endonucleolytic site that leads to the decay of the
hutH transcript. In the absence of consensus sequences for endonucleolytic
cleavage sites for mRNA degradation in Streptomyces, it is difficult to predict the
consequence of the mutation that might make the transcript more susceptible to
decay.
The termination of transcription in prokaryotes occurs either by a protein
factor, Rho, or by spontaneous termination at intrinsic sites by RNA polymerase
(Ruteshouer and Richardson, 1989). It is possible that the point mutation causes
the RNA to fold in a manner that resembles a Rho-independent termination
sequence thereby causing premature termination. However, I did not discern any
obvious change in the secondary structure of hutHaga mRNA in the vicinity of the
mutation that might result in the formation of a secondary structure different from
that of the wild-type transcript.
An alternative scenario is that translation of the mutant transcript stalls as
a consequence of misfolding of the protein. The stalling would not be due to the
ribosomes reaching a rare codon. This might lead to the accumulation of
untranslated mRNA which might be recognized by Rho and lead to transcription
termination (Richardson, 1991; Opperman and Richardson, 1994). Intragenic termination of transcription can occur as a consequence of ribosomes that stall
130 upon encountering a stop codon or when the cell experiences amino acid starvation (Richardson, 1991). A comparison of the length of transcript obtained by in vitro transcription analysis in the presence and absence of Rho might be able to distinguish between these possibilities. If the premature truncation of the transcript is Rho-dependent, then transcripts obtained in vitro in the absence of
Rho should be longer than the transcripts obtained when Rho is present. Two requirements for this hypothesis are that the missense mutation leads to stalling of the ribosome and the mutation creates a site in the mRNA termed rut, to which
Rho can bind, rut sequences in E. coli comprise single stranded RNA that is rich in cytidine residues. This sequence may differ in high gc organisims like
Streptomyces. Since a consensus sequence for a rut site is not well defined, sequences that can serve as rut sites may not be very stringent (Richardson,
1991 ). In the absence of either a stop codon or amino acid starvation I hypothesize that the ribosome may stall during translation of hufHggg transcription because the nascent polypeptide encounters difficulty in folding after the Asn is incorporated. This explanation may also account for the low level of hutH transcript in SKK906, where it is much more likely that the protein is undergoing misfolding as a consequence of the point mutation.
To conclusively determine whether the GAC to AAC change results in the lower amount of hutH transcript, future experiments might include site directed mutagenesis of chromosomal hutH^^^^^ to generate hutH^ and determination
131 of amount of the hutH transcript in the culture. This will permit the analysis of the effect of the mutation on the stability of the transcript in a wild-type background.
The recovery of histidase in SKK896 transformants containing multiple copies of hutHgf^ was surprising because my results had indicated that the protein synthesized from hutH^ is highly unstable and therefore inactive. Since plasmids that contain either no hutH (pKK641 and pKK647) or partial hutH
(pKK630) failed to restore histidase activity to SKK896, it appears that the recovery of histidase activity in SKK896 requires the complete hutH coding sequence. A second possible explanation for the recovery of histidase activity in transformants of SKK896 containing pKK616 might be homogenotization of the plasmid-borne /jüfHgœWith the chromosomal hutHgæ so that transformants would contain multiple copies othutH^^ McCue etal. (1996) reported that transformants of bald mutants containing multiple copies of nrsA (which encodes a negative regulator of sporulation in S. griseus) sporulated as a consequence of suppression. When nrsA containing a frameshift mutation was present in multiple copies, 5% of the transformants sporulated. Further analysis showed that the latter sporulation was a consequence of a recombination event akin to marker exchange as a result of which the wild-typenrsA allele became plasmid- borne (McCue etal., 1996). On the basis of these observations I speculate that the recovery of histidase activity in SKK896 transformants containing hutHg^ is due to transformants in which a recombination event has occurred such that
132 hutHgoB becomes plasmid-bome and thus present in multiple copies. This
hypothesis Is consistent with my observation that hutHgag In multiple copies restores partial histldase actlvltry to SKK896.
The analysis of histldase activity In the recombinant strains, SKK307 and
SKK311, suggests that the missense mutation In hutHggg Is sufficient to generate a Hut' phenotype. The specific activity of Asp223Asn histldase synthesized In E coli was comparable to that of wild-type histldase. However, the differences observed In apparent and stability of the Asp223Asn histldase at 70°C compared to the wild-type histldase may be significant In S. griseus. The subtle differences In kinetic behavior observed with the Asp223Asn histldase and the wild-type histldase synthesized In £ coli suggest that the mutation might have a more drastic effect on the enzyme produced In S. griseus. As one possibility, the mutation may affect not only enzymatic activity but also message stability In
S. griseus but not In £ coli.
Although there is no precedent for a missense mutation contributing to transcript Instability, several researchers have shown that a change of Asp to
Asn can have a significant effect on protein function. A change from a negatively charged amino acid to a neutral amino acid might affect the folding of the protein, thereby affecting the catalytic efficiency of an enzyme. The effect of a similar mutation on substrate specificity of £ coli adenylosuccinate synthetase
133 (AMPase) was reported by Kang et at. (1994). AMPase catalyzes a reversible reaction with GTP or IMP in the presence of Mg^* to form adenylosuccinate,
GDP, and inorganic phosphate. Using as the criterion, the authors demonstrated that when Asp333 is changed to Asn, the enzyme can utilize XTP
(xanthosine 5'-triphosphate) as substrate, but the activity toward the natural substrate, GTP, is reduced (Kang et a/., 1994). Similarly, when Asp129 in the C- terminal region of GInR (a negative regulator of glutamine synthetase) from B. subtilis was changed to Asn, the protein failed to repress the synthesis of glutamine synthetase. The authors speculated that the Asp129Asn mutation results in altered sensitivity of the GInR protein to normal effector molecules required for the repression of glutamine synthetase under conditions of nitrogen excess (Schreier and Rostokowski, 1995). Thus the higher K^, of Asp223Asn histldase might be significant and suggests that Asp223 in Streptomyces histldase might be important for substrate specificity.
III. Overexpression of histldase in E. coli
Histldase from S. griseus synthesized in E. coli is hysteretic. This observation implies that either the hysteretic behavior ofStreptomyces histldase is an inherent characteristic of the enzyme or that a factor that can activate hysteretic histldase is also present in E. coli. A protein that can convert the hysteretic form of histldase to a linear form has been partially purified from S. griseus (White, unpublished). The availability of the hysteretic histldase, which is
134 highly stable in phosphate buffer, permits a convenient assay for the purification of the activating factor from an extract of S. griseus. Future studies can ascertain whether the activation ofStreptomyces histldase under physiological conditions requires factors different from those necessary for the activation observed in
vitro. Purification of the histidase-activating factor will help us understand more about the physiological significance of hysteresis in the regulation of histldase activity in streptomycetes. Further studies can include alteration of amino acids that might be involved in the hysteresis of the enzyme.
Studies of the nature of hysteresis and factors that control hysteresis will help us identify novel regulatory mechanisms that are involved in the activity of catabolic enzymes in Streptomyces.
IV. Negative regulation of hutH expression
The recovery of histldase activity in extracts of S. griseus transformants containing plasmids pKK645, pKK646, pKK647, and pKK1102 grown under non inducing conditions extended previous evidence that the expression of both histldase and urocanase in S. griseus is under the control of a negative regulatory factor. The presence of multiple copies of the DNA upstream of the hutH transcription start site in trans appears to sequester a factor that represses the expression of histldase under non-inducing conditions (Wu et al., 1994). My data indicate that the region of DNA encompassing 35 to 110 nt upstream of the transcription start site is sufficient for this effect. Wu suggested that the inverted
135 repeat centered at -67 of hutH (relative to the coding sequence and transcript initiation site) may be involved in the negative regulation of expression of histldase (Wu et al., 1994). A similar situation exists in Pseudomonas
(Consevage and Phillips, 1990) and enteric bacteria (Nieukwoop eta!., 1984;
Osuna at a/., 1991 ), where the expression of hutH is negatively controlled by
HutC. In P. putida the repressor binds to a 40 bp region between -10 to -50 relative to the transcription initiation site for hutU (Consevage and Phillips,
1990). The repressor isolated from P. putida is 62% similar to the hutC repressor present in K. aerogenes (Allison and Phillips, 1990).
The expression of S. griseus histldase is similar to that in the Gram- negative bacteria and unlike that in B. subtilis, where the expression of histldase is governed by a positive regulatory factor (Oda et al., 1993). To identify the repressor molecule involved in the regulation of hutH expression in S. griseus, the fragment present in pKK646 can be utilized to isolate the factor by a gel mobility shift assay. The purified repressor from S. griseus will allow the determination of its similarity to those of other bacteria. According to the results of this study and experiments conducted by Wu (1994), there is evidence that the expression of hutH and hutU might be controlled by the same regulatory factor. By DNA-binding studies we can determine whether the repressor of hutH also controls the expression of hutU in S. griseus once hutU is isolated.
136 LITERATURE CITED
Allison, S.L., and A T. Phillips. 1990. Nucleotide sequence of the gene encoding the repressor for the histidine utilization genes of Pseudomonas putida. J. Bacteriol. 172:5470-5476.
Anderson, D.E., J.E. Hurley, H. Nicholson, W.A. Baase, and B.W. Matthews. 1993. Hydrophobic core repacking and aromatic-aromatic interaction in the thermostable mutant of T4 lysozyme Seri 17-Phe. Prot. Science 2:1285-1290.
Atkinson, M.R., L.V. Wray, Jr., and S.H. Fisher. 1990. Regulation of histidine and proline degradation enzymes by amino acid availability in Bacillus subtilis. J. Bacteriol. 172:4758-4764.
Atkinson, R.M., L.V. Wray, Jr, and S.H. Fisher. 1993. Activation of the Bacillus subtilis hut operon at the onset of stationary phase in nutrient sporulation medium results primarily from the relief of amino acid repression of histidine transport. J. Bacteriol. 175:4282-4289.
Ausubel, F.M., A. Brent, R E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl. 1990. Current Protocols in Molecular Biology. Wiley-lnterscience, New York.
Babcock, M.J., and K.E. Kendrick. 1988. Cloning of DNA involved in sporulation ot Streptomyces griseus. J. Bacteriol. 170:2802-2808.
Bascaran, V., C. Hardisson, and A. Braha. 1989. Regulation of nitrogen catabolic enzymes in Streptomyces clavuligerus. J. Gen. Microbiol. 135:2465- 2474.
Belasco, J.G., and C.F. Higgins. 1988. Mechanisms for mRNA decay in bacteria: a perspective. Gene 72:15-23.
Bormann, C., S.H. Mattern, P. Fiedler, and N.J. Zahner. 1989. Isolation of Streptomyces tendae mutants with an altered nikkomycin spectrum. J. Antibiot. 42:913-918.
137 Brana, A.F., N. Paiva, and A.L Demain. 1986. Pathways and regulation of ammonium assimilation in Streptomyces clavuligerus. J. Gen. Microbiol. 132:1305-13017.
Brill, W.J., and 8 . Magasanik. 1969. Genetic and metabolic control of histldase and urocanase in S. typtiimurium strain 15-59. J. Biol. Chem. 244:5392-5402.
Chasin, L.A., and B. Magasanik. 1968. Induction and repression of the histidine- degrading enzymes of Bacillus subtilis. J. Biol. Chem. 243:5165-5178.
Consevage, M.W., and A.T. Phillips. 1985. Presence and quantity of dehydroalanine in histidine ammonia-lyase from Pseudomonas putida. Biochemistry. 24:301-308.
Consevage, M.W., R.D. Porter, and A.T. Phillips. 1985. Cloning and expression in Escherichia coli of histidine utilization genes from Pseudomonas putida. J. Bacteriol. 162:138-146.
Consevage, M.W., and A.T. Phillips. 1990. Sequence analysis of the hutH gene encoding histidine ammonia-lyase in Pseudomonas putida. J. Bacteriol. 172:2224-2229.
Coote, J.G., and H. Hassall. 1973. The degradation of L-histidine, imidazolyl-L- lactate and imidazolylpropionate by Pseudomonas testosteroni. Biochem. J. 132:409-422.
Dhanam, M., and A.N. Radhakrishnan. 1974. Purification and properties of histidine ammonia-lyase from monkey liver. Ind. J. Biochem. & Biophys. 11:1-6.
Fisher, S.H., K. Rohrer, and A.E. Ferson. 1996. Role of CodY in regulation of the Bacillus subtilis hut operon. J. Bacteriol. 178:3779-3784.
Fisher, S.H., M.A. Strauch, M R. Atkinson, and L.V. Wray, Jr. 1994. Modulation of Bacillus subtilis catabolite repression by transition state regulatory protein AbrB. J. Bacteriol. 176:1903-19012.
Forchhammer, K., W. Lienfelder, K. Boesmiller, B. Vepreck, and A. Bock. 1990. Selenocysteine synthase from E. coli. Nucleotide sequence of the gene (se/A) and purification of the protein. J. Biol. Chem. 266:6318-6323.
Frieden, C. 1979. Slow transitions and hysteretic behavior in enzymes. Ann. Rev. Biochem. 48:471-489.
Frieden, C. 1970. Kinetic aspects of regulation of metabolic processes: the hysteretic enzyme concept. J. Biol. Chem. 245:5788-5799.
138 Fritsch J., R. Rothfuchs, R. Rauhut, and G. Klug. 1995. Identification of an mRNA element promoting rate-limiting cleavage of the polycistronic p af mRNA in Rhodobacter capsulatus by an enzyme similar to RNase E. Mol. Microbiol. 15:1017-1029.
Furuta, T., H. Takahashi, and Y. Ksuya. 1991. Reversible reaction via carbanion intermediate in the elimination of ammonia from L-histidine catalysed by histidine ammonia-lyase. J. Chromatogr. 562:363-368.
Furuta, T., H. Takahashi, H. Shibasaki, and Y. Kasuya. 1992. Reversible stepwise mechanism involving a carbanion intermediate in the elimination of ammonia from L-histidine catalyzed by histidine ammonia-lyase. J. Biol. Chem. 267:12600-12605.
Givot, I.L., and R.H. Abeles. 1970. Mammalian histidine ammonia-lyase. J. Biol. Chem. 245:3271-3273.
Givot, I.L., and R.H. Abeles. 1970. Mammalian histidine ammonia lyase. In vivo inactivation and presence of an electrophilic center at the active site. J. Biol. Chem. 245:3271-3273.
Givot, I.L., T.A. Smith, and R.H. Abeles. 1969. Studies of the mechanism of action and the structure of the electrophilic center of histidine ammonia lyase. J. Biol. Chem. 244:6341-6353.
Hagen, D C., S.L Gerson, and B. Magasanik. 1975. Isolation of super-repressor mutants in the histidine utilization system of Salmonella typhimurium. J. Bacteriol. 121:583-593.
Hagen, D.C., and B. Magasenik. 1976. Deoxyribonucleic acid-binding studies on the hut repressor and muatnt forms of the hut repressor of Salmonella typhimurium. J. Bacteriol 127:837-847.
Havir, E.A., and KR. Hanson. 1975. L-phenylalanine ammonia-lyase (maize, potato, and Rhodotorula glutinis). Studies of the prosthetic group with nitromethane. Biochem. 14:1620-1626.
Hecht K, S. Zhang., T. Klopotowski, and G. F. Ames. 1996. D-histidine utilization in Salmonella typhimurium is controlled by the leucine-responsive regulatory protein (Lrp). J. Bacteriol. 178: 327-331.
Hernandez, D., J.G. Stroh, and Phillips A T. 1993. Identification of Ser’*” as the site of modification in the active site of histidine ammonia-lyase. Arch. Biochem. Biophys. 307:126-132.
139 Hodgins, O.S. 1975. Yeast phenylalanine ammonia-lyase. J. Biol. Chem. 246:2977-2985.
Hood, D.W., R. Heidstra, U.K. Swoboda, and D.A. Hodgson. 1992. Molecular genetic analysis of proline and tryptophan biosynthesis in Streptomyœs coe/zcotor A3(2): interaction between primary and secondary metabolism - a review. Gene 115:5-12.
Hopwood, D.A., M.J. Bibb, K.F. Chater, T. Kieser, C.J. Bruton, H.M. Kieser, D.J. Lydiate, C.P. Smith, J.M. Ward, and H. Schrempf. 1985. Genetic Manipulation of Streptomyœs. A Laboratory Manual. The John Innes Foundation, Norwich, Great Britain.
Hu, L., S.L. Allison, and A T. Phillips. 1989. Identification of multiple repressor recognition sites in the hut system of Pseudomonas putida. J. Bacteriol. 171:4189-4195.
Hu, L., and A T. Phillips. 1988. Organization and multiple regulation of histidine utilization genes in Pseudomonas putida. J. Bacteriol. 170:4272-4279.
Huff, J.P. 1991. Rapid isolation and purification of DNA from agarose gels: the phenol-freeze-fracture method. BioTechniques 10:724.
Kafatos, C F., C.W. Jones, and A. Estratiadis. 1979. Determination of nucleic acid sequence homologies and relative concentrations by a blot hybridization procedure. Nucl. Acids Res. 7:1541-1552.
Kauri, T., I. Ahonkhai, M. Desjardins, and D.J. Kushner. 1993. Histidase activity of the halophilic archaebacteriumHaloferax volcanii. Microbios 245:245-249.
Kendrick, K. E. 1979. Histidine Dissimilation in Streptomyœs œelicolor, Ph.D. Dissertation. University of California, Davis.
Kendrick, K.E., and M L. Wheelis. 1982. Histidine dissimilation in Streptomyces coelicolor. J. Gen. Microbiol. 128:2029-2040.
Kimhi, Y., and B. Magasanik. 1970. Genetic basis of histidine degradation in Bacillus subtilis. J. Biol. Chem. 25:3545-3548.
Klee, C.B. 1974. Stereospecific irreversible inhibition of histidine ammonia-lyase by L-cysteine. Biochemistry 13:4501-4507.
Klee, C.B. 1971. Histidine ammonia-lyase {Pseudomonas). Meth. Enzymol. 178:69-73.
140 Kroening, T A., and K.E. Kendrick. 1989. Cascading regulation of histidase activity in Streptomyces griseus. J. Bacteriol. 171:1100-1105.
Kroening, T.A., and K.E. Kendrick. 1987. In vivo regulation of histidine ammonia- lyase activity from Streptomyces griseus. J. Bacteriol. 169:823-829.
Kwak J. 1995. Characterization of nonsporulating mutants of Streptomyces griseus, Ph.D. Dissertation. Ohio State University.
Langer, M., A. Lieber, and J. Retey. 1994. Histidine ammonia-lyase mutant S143C is posttranslationally converted into fully active wild-type enzyme. Evidence for serine 143 to be the precursor of active site dehydroalanine. Biochemistry 33:14034-14038.
Langer, M., A. Pauling, and J. Retey. 1995. The role of dehydroalanine in catalysis by histidine ammonia-lyase. Angew. Chem. Int. Ed. Engl. 13:1464- 1465.
Langer, M., G. Reck, J. Reed, and J. Retey. 1994. Identification of serine-143 as the most likely precursor of dehydroalanine in the active site of histidine ammonia-lyase. A study of the overexpressed enzyme by site-directed mutagenesis. Biochemistry 33: 6462-6467.
Lieu W. and J.N. Hansen. 1992. Enhancement of the chemical and antimicrobial properties of subtil in by site-directed mutagenesis. J. Biol. Chem. 267: 25078- 25085.
Lounes, A., A. Lebrihi, C. Benslimane, G. Lefebvre, and P. Germain. 1995. Regulation of valine catabolism by ammonium in Streptomyces ambofaciens, producer of spiramycin. Can. J. Microbiol. 41:800-808.
Magasanik, B. 1978. Regulation in the fJt/f system, p. 373-387. In Miller, J.H., and W.S. Reznikoff, (ed.). The Operon. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
Magasanik, B., E. Kaminskas, and Y. Kimhi. 1971. Histidase (histidine ammonia- lyase) {Bacillus subtilis). Meth. Enzymol. 17B:47-50.
Maniatis, T., E.F. Fritsch, and J. Sambrook. 1982. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.
McCue, L.A., J. Kwak, J. Wang, and K.E. Kendrick. 1996. Analysis of a gene that suppresses the morphological defect of bald mutants of Streptomyces griseus. J. Bacteriol. 178:2867-2875.
141 McLaren, R.S., S.F. Newbury, G.S.C. Dance, H.C. Causton, and C.F. Higgins. 1991. mRNA degradation by processive 3'-5' exoribonucleases in vitro and the implications for prokaryotic mRNA decay in vivo. J. Mol. Biol. 221:81 -95.
Meiss, H.K., W.J. Brill, and B. Magasanik. 1969. Genetic control of histidine degradation in Salmonella typhimunum, strain LT-2. J. Biol. Chem. 244:5382- 5391.
Mouttet, C., F. Fouchier, J. Nari, and J. Richard. 1974. Subunit interaction and transient kinetics. Eur. J. Biochem. 49:5-20.
Nguyen, L.T., KT. Nguyen, J. Kopecky, P. Nova, J. Novotna , and V. Behai. 1995. Purification and characterization of a novel valine dehydrogenase from Streptomyces aureofaciens. Biochim, Biophys.Acta 1251:186-190.
Nguyen, T.L., K.T. Nguyen, J. Spizek, and V. Behai. 1995. The tylosin producer, Streptomyces fradiae contains a second valine dehydrogenase. Microbiology 141:1139-1145.
Nieuwkoop, A.J., S.A. Baldauf, M E S. Hudspeth, and R.A. Bender. 1988. bidirectional promoter in the hut{P) region of the histidine utilization (hut) opérons from Klebsiella aerogenes. J. Bacteriol. 170:2240-2246.
Nieuwkoop, A.J., S.A. Boylan, and R.A. Bender. 1984. Regulation of hutUH operon expression by the catabolite gene activator protein-cyclic AMP complex in Klebsiella aerogenes. J. Bacteriol. 159:934-939.
Oda, M., T. Katagai, D. Tomura, H. Shoun, T. Hoshino, and K. Furukawa. 1992. Analysis of the transcirptional activity of the hut promoter in Bacillus subtilis and identification of a c/s-activating regulatory region associated with catabolite repression downstream from the site of transcription. Mol. Microbiol. 6:2573- 2582.
Oda, M., A. Sugishita, and K Furukawa. 1988. Cloning and nucleotide sequences of histidase and regulatory genes in the Bacillus subtilis hut operon and positive regulation of the operon. J. Bacteriol. 170:3199-3205.
Olmsted, J.B. 1986. Analysis of cytoskeletal structure using blot-purified monospecific antibodies. Meth. Enzymol. 134:467-472.
Opperman, T., and J.P. Richardson. 1994. Phylogenetic analysis of sequences from diverse bacteria with homology to the Escherichia coll rho gene. J. Bacteriol. 176:5033-5043.
142 Osuna, R., J.K. Brian, and R.A. Bender. 1994. Rôles of catabolite activator protein sites centered at -81.5 and -41.5 in the activation of Klebsiella aerogenes histidine utilization operon hutUH. J. Bacteriol. 176:5513-5524.
Osuna, R., A. Schwacha, and R.A. Bender. 1994. Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis. J. Bacteriol. 176:5525-5529.
Osuna, R., and R.A. Bender. 1991. Klebsiella aerogenes catabolite gene activator protein and the gene encoding it {crp). J. Bacteriol. 173:6626-6631.
Osuna, R., S.A. Boylan, and R.A. Bender. 1991. In vitro transcription of the histidine utilization (hutUH) operon from Klebsiella aerogenes. J. Bacteriol. 173:116-123.
Peterkofsky, A. 1962. The mechanism of action of histidase: amino-enzyme formation and partial reactions. J. Biol. Chem. 237:787-795.
Portis, A.R., Jr. 1990. Rubisco activase. Biochim. Biophys. Acta 1015:15-28.
Richardson, J.P. 1991. Preventing the synthesis of unused transcripts by Rho factor. Cell 64:1047-1049.
Richardson, J.P. 1993. Transcription termination. Crit. Rev. Biochem. Mol. Biol. 28:1-30.
Robinson, P.S., V.J. Streusand, J.M. Chatfield, and A.R. Portis, Jr. 1988. Purification and assay of rubisco activase from leaves. Plant Physiol. 88:1008- 1014.
Robinson, S.P., and A.R. Portis, Jr. 1989. Ribulose-1,5-bisphosphate carboxylase/oxygenase activase protein prevents the in vitro decline in activity of ribulose- 1 ,5-bisphosphate carboxylase/oxygenase. Plant Physiol. 90:968-971.
Roos, U., S. Mattern, H. Schrempf, and C. Bormann. 1992. Histidine aminotransferase activity in Streptomyœs tendae and its correlation with nikkomycin production. FEMS Microbiol. Lett. 97:185-190.
Ruteshouser, G.E., and J.P. Richardson. 1989. Identification and characterization of transcription termination sites in the Escherichia coli lacZ gene. J. Mol. Biol. 208:23-43.
Sambrook, J., T. Maniatis, and Fritsch. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.
143 Schlumbohm W., T. Stein, C. Ullrich, J. vater, M. Krause, M.A. Maraheil, V. Kruft, and B.Wittmann-Liebold. 1991. An active site serine is involved in the covalent substrate amino acid binding at each reaction center of gramicidin 8 Synthetase. J. Biol.Chem. 266:23135-23141.
Schreier, H.J., and C.A. Rostokowski. 1995. Bacillus subtilis gInR mutants defective in regulation. Gene 161:51-56.
Schwacha, A., and R.A. Bender. 1993. The nac (nitrogen assimilation control) gene from Klebsiella aerogenes. J. Bacteriol. 175:2107-2115.
Schwacha, A., and R.A. Bender. 1990. Nucleotide sequence of the gene encoding the repressor for the histidine utilization genes of Klebsiella aerogenes. J. Bacteriol. 172:5477-5481.
Schwacha, A., and R.A. Bender. 1993. The product of the Klebsiella aerogenes nac (nitrogen assimilation control) gene is sufficient for activation of the hut opérons and repression of the gdh operon. J. Bacteriol. 175:2116-2124.
Shibatani, T., T. Kakimoto, and I. Chibata. 1975. Crystalline L-histidine ammonia-lyase ot Achromobacter liquidum. Crystallization and enzymic properties. Eur. J. Biochem. 55:263-269.
Shoichet, B.K., A.B. Walter, K Ryota, and B.W. Matthews. 1995. A relationship between protein stability and protein function. Proc. Natl. Acad. Sci.U.S.A 92:
Smith, T.A., F.H. Cordelle, and R.H. Abeles. 1967. Inactivation of histidine deaminase by carbonyl reagents. Arch. Biochem. Biophys. 120:724-725.
Suchi, M., N. Harada, Y. Wada, and Y. Takagi. 1993. Molecular cloning of a cDNA encoding human histidase. Biochim. Biophys. Acta 1216:293-295.
Suchi, M., H. Sano, H. Mizuno, and Y. Wada. 1995. Molecular cloning and structural characterization of the human histidase gene (HAL). Genomics 29:98- 104.
Tang, L., Y. Zhang, and C.R. Hutchinson. 1994. Amino acid catabolism and antibiotic synthesis: valine is a source for macrolide biosynthesis in Streptomyces ambofaciens and Streptomyces fradiae. J. Bacteriol. 176:6107- 6119.
Taylor, R.G., M.A. Lambert, E. Sexsmith, S.J. Sadler, P.N. Ray, D.J. Mahuran, and R.R. Mclnnes. 1990. Cloning and expression of rat histidase. Homology to two bacterial histidases and four phenylalanine ammonia-lyases. J. Biol. Chem. 265:18192-18199.
144 Warshel, A., F. Sussman, and J. Hwang. 1988. Evaluation of catalytic free energies in genetically modified proteins. J. Mol. Biol. 201:139-159.
White, P.J., and K.E. Kendrick. 1993. Inactivation of histidine ammonia-lyase from Streptomyces griseus by dicarbonyl reagents. Biochim. Biophys. Acta. 1163:273-279.
Wolf A., E.W. Shaw, K Nikaido, and G. F. Ames. 1994 The histidine-binding protein undergoes conformational changes in the absence of ligand as analyzed with conformation-specific monoclonal antibodies. J. Biol. Chem. 269: 23051 - 23058.
Wray, L.V., Jr., and S.H. Fisher. 1994. Analysis of Bacillus subtilis hut operorx expression indicates that histidine-dependent induction is mediated primarily by transcriptional antitermination and that amino acid repression is mediated by two mechanisms: Regulation of transcription initiation and inhibition of histidine transport. J. Bacteriol. 176:5466-5477.
Wray, L.V., Jr., and S.H. Fisher. 1988. Cloning and nucleotide sequence of the Streptomyces coelicolor gene encoding glutamine synthetase. Gene 71:247-256.
Wu, P-C. 1994. Cloning, nucleotide sequence determination, and transcriptional analysis of the histidase structural gene from Streptomyces griseus, Ph.D. Dissertation. Ohio State University.
Wu, P.-C., T.A. Kroening, P.J. White, and KE. Kendrick. 1992. Histidine ammonia-lyase from Streptomyces griseus. Gene 115:19-25.
Wu, P.-C., T.A. Kroening, P.J. White, and K.E. Kendrick. 1992. Purification of histidase from Streptomyces griseus and nucleotide sequence of the hutH structural gene. J. Bacteriol. 174:1647-1655.
Wu, P.-C., K.V. Srinivasan, and K.E. Kendrick. 1995. Regulated expression of the histidase structural gene in Streptomyces griseus. J. Bacteriol. 177:854-857.
145 Appendix A
Alignment of Histidases and Phenylalanine Ammonia-lyases
146 FIG. 23. Alignment of deduced amino acid sequences from seven histidases
and the consensus sequence of phenylalanine ammonia-lyase. O,
conserved serine residues; ★, Asp223 of S. griseus histidase;
Ser426 of S. griseus histidase.
147 1 50 Mouse MPRYTVHVRG EWLAVPC..Q DGKLTVGWLG REAVRRYMKN KPDNGGFTSV Rat MPRYTVHVRG EWLAVPC..Q DGKLSVGWLG REAVRRYMKN KPDNGGFTSV Human MPRYTVHVRG EWLAVPC..Q DAQLTVGWLG REAVRRYIKN KPDNGGFTSV C, elegans .MRLQVQIGT ECVWPCKPD DTIHAVAKKS VEKLRRLRPK L PL ADD Y. . . B. s u b t i l i s P. p u tid a S. g riseu s PAL Consensus
51 100 Mouse DEVQFLVHRC KGLGLLDNED ELEVALEDNE F V E W ...... Rat DEVRFLVRRC KGLGLLDNED LLEVALEDNE F V E W ...... Human DDAHFLVRRC KGLGLLDNED RLEVALENNE F V E W ...... C. elegans FEVRRT VGNSLLDPED LVSDVLKDSD FIIVAASVEE TEDAKEAKKQ B. subtilis 00 P. p u tid a S. g riseu s PAL .METVG AAITANNGNQ AGSYCVTGAG NANNISVSGA Consensus
101 150 Mouse ..lEGDVMSP DFIPSQPEGV FLYSK YREPEKYIAL DGDSLSTEDL Rat ..lEGDVMSP DFIPSQPEGV FLYSK YREPEKYIAL DGDSLSTEDL Human ..lEGDAMSP DFIPSQPEGV YLYSK YREPEKYIEL DGDRLTTEDL C. elegans EEIDNARAEI EKIDNRRRKV SFADSLAPMV LAPPTKLLIL DGNSLLPEDL B. subtilis ...... MVTL DGSSLTTADV P. p u tid a ...... TELTL KPGTLTLAQL S. g riseu s ...... MDMHTVW GTSGTTAEDV PAL DPLNWGVAAE ALPTTKGSHL DEVKRMVAEY RKPWKLV. . GGETLTISQV Consensus
Figure 23 cont. Figure 23, cont.
151 200 Mouse VNLGKGR... ..YKIKLTSI AEKK.VQQSR EVIDSIIKER TWYGITTGF Rat VNLGKGH... ..YKIKLTSI AEKK.VQQSR EVIDSIIKER TWYGITTGF Human VNLGKGR... ..YKIKLTPT AEKR.VQKSR EVIDSIIKEKTWYGITTGF C. elegans VRCEKGE... ..CAIQLSME SEDR.IRKAR TFLEKIASEH RAVYGVTTGF B. subtilis ARVLFDF... ..EEAAASEE SMER.VKKSR AAVERIVRDE KTIYGINTGF P. p u tid a RAIHAAP... ..VRLQLDAS AAPA.IDASV ACVEQIIAED RTAYGINTGF S. g riseu s VAVARHG... ..ARVELSAA AVEA.LAAAR LIVDALAAKPEPVYGVSTGF PAL AAIAAHDDGC KGVKVELDSE SARAGVKASS DWVMDSMNKG TDSYGVTTGF Consensus
201 250 Mouse GKFARTVIPA NKLQELQVNLVR...... SHSS GVGKPLSPER Rat GKFARTVIPANKLQELQVNLVR...... SHSS GVGKPLSPER Human GKFARTVIPI NKLQELQVNL VR ...... SHSS GVGKPLSPER C, elegans GTFSNVTIPP EKLKKLQLNL IR...... GYGEPLAPNR B. subtilis GKFSDVLIQKEDSAALQLNL IL...... SHAC GVGDPFPECV P. p u tid a GLLASTRIAS HDLENLQRSLVL ...... SHAA GIGAPLDDDL S. g riseu s GALASRHIGT ELRAQLQRNI A^R...... SHAA GMGPRVEREV PAL G..ATSHRRT KQGGALQKEL IRFLNAGIFG NGTESSALGR GLEHTLPHSA Consensus — — — — — — —
251 300 Mouse CRMLLALRIN VLAKGYSGIS LETLKQVIEA FNASCLSYVP EKGTVGASGD Rat CRMLLALRIN VLAKGYSGIS LETLKQVIEV FNASCLSYVP EKGTVGASGD Human CRMLLALRIN VLAKGYSGIS LETLKQVIEM FNASCLPYVP EKGTVGASGD C. elegans ARMLLALRIN ILAKGHSGIS VENIKKMIAA FNAFCVSYVP QQGTVGCSGD B. subtilis SRAMLLLRAN ALLKGFSGVR AELIEQLLAF LNKRVHPVIP QQGSLGASGD P. p u tid a VRLIMVLKIN SLSRGFSGIR RKVIDALIAL VNAEVYPHIP LKGSVGASGD S. g riseu s VRALMFLRLK TVASGHTGVR PEVAQTMADV LNAGITPWH EYGSLGCSGD PAL TRAAMLVRIN TLLQGYSGIR FEILEAITKL LNHNITPCLP LRGTITASGD Consensus — — — — ^ — — ——G SGD o
cont, Figure 23, cont.
301 350 Mouse LAPLSHLALG LIGEGK. .MWSPKSGWA DAKYVLEAHG LKP..IVLKP Rat LAPLSHLALG LIGEGK. .MWSPKSGWA DAKYVLEAHG LKP..IVLKP Human LAPLSHLALG LVGEGK. .MWSPKSGWA DAKYVLEAHG LKP..VILKP C. elegans LCPLAHLALG LLGEGK. .MWSPTTGWQ PADWLKKNN LEP..LELGP B. s u b t i l i s LAPLSHLALA LIGQGE. .VFF.EGERM PAMTGLKKAG IQP..VTLTS P. p u tid a LAPLATMSLV LLGEGK. .ARY.KGQWL SATEALAVAG LEP..LTLAA S. g riseu s LAPLSHCALT LMGEGE. .AEGPDGTVR PAGELLAAHG lAP..VELRE PAL LVPLSYIAGL LTGRPNSKAV WHGPNGEIL NAKEAFKLAG IDGGFFELQP Consensus L—PL—————
351 400 Mouse KEGLALINGT QMITSLGCEA LERASAIARQ ADIVAALTLE VLKGTTKAFD Rat KEGLALINGT QMITSLGCEA VERASAIARQ ADIVAALTLE VLKGTTKAFD en o Human KEGLALINGT QMITSLGCEA VERASAIARQ ADIVAALTLE VLKGTTKAFD C. elegans KEGLALINGT QMVTALGAYT LERAHNIARQ ADVIAALSLD VLKGTTRAYD B. s u b t i l i s KEGLALINGT QAMTAMGWA YIEAEKLAYQ TERIASLTIE GLQGIIDAFD P. p u tid a KEGLALLNGT QASTAYALRG LFYAEDLYAA AIACGGLSVE AVLGSRSPFD S. g riseu s KEGLALLNGT DGMLGMLVMA LADLRNLYTS ADITAALSLE ALLGTDKVLA PAL KEGLALVNGT AVGSGLASMV LFEANILAVL SEVLSAIFAE VMQGKPEFTD Consensus KEGLAL-NGT G------★
401 450 Mouse TDIHAV.RPH RGQIEVAFRF RSLLDSDHHP S. ....EIAE SHRFCDRVQD Rat TDIHAV.RPH RGQIEVAFRF RSLLDSDHHP S. ....EIAE SHRFCDRVQD Human TDIHAL.RPHRGQIEVAFRF RSLLDSDHHP S. ....EIAE SHRFCDRVQD C. elegans PDIHRI.RPH RGQNLSALRL RALLHSEANP S. ___ QIAE SHRNCTKVQD B. subtilis EDIHLA.RGY QEQIDVAERI RFYLSDSGLT T. ___ SQGE .... LRVQD P. p u tid a ARIHEA.RGQRGQIDTAACF RDLLGDS... S. ___ EVSL SHKNCDKVQD S. g riseu s PELHAI.RPH PGQGVSADNM SRVLAGSGLT G. ___ HHQD D...APRVQD PAL HLTHKLTKHH PGQIEAAAIM EHILDGSSYV KAAKKLHEMD PLQKIPKQDR Consensus ------
Contd. Figure 23 Contd,
451 500 Mouse AYTLRCCPQV HGV.VNDTIA FVKDIITTEL NSATDNPMVF ASRGETISGG Rat AYTLRCCPQV HGV.VNDTIA FVKDIITTEL NSATDNPMVF ASRGETISGG Human AYTLRCCPQV HGV.VNDTIA FVKNIITTEL NSATDNPMVF ANRGETVSGG C. elegans AYTLRCVPQV HGV.VHDTIE FVREIITTEM NSATDNPLVF ADREEIISGG B. s u b t i l i s AYSLRCIPQV HGA.TWQTLG YVKEKLEIEM NAATDNPLIF NDGDKVISGG P. p u tid a PYSLRCQPQV MGA.CLTQLR QAAEVLGIEA NAVSDNPLVF AAEGDVISGG S. g riseu s AYSVRCAPQV NGA.GRDTLD HAALVAGREL ASSVDNPWL PO.GRVESNG PAL YAALRTSPQW LGPQISEVIR ASTKSIEREI NSVNDNPLID VSRNKALHGG Consensus R— PQ— DNP--
501 550 Mouse NFHGEYPAKA LDY.LAIGVH ELAAISERRI ERLCNPSLS. ELPAFLVA.. Rat NFHGEYPAKA LDY.LAIGVH ELAAISERRI ERLCNPSLS. ELPAFLVA.. Cfl Human NFHGEYPAKA LDY.LAIGIH ELAAISERRI ERLCNPSLS. ELPAFLVA.. C. elegans NFHGEYPAKA LDF.LAIAVA ELAQMSERRL ERLVNKELS. GLPTFLTP.. B. subtilis NFHGQPIAFA MDF.LKIAIS ELANIAERRI ERLVNPQLN. DLPPFLSP.. P. p u tid a NFHAEPVAMA ADN.LALAIA EIGSLSERRI SLMMDKHMS. QLPPFLVE.. S, g riseu s NFHGAPVAYV LDF.LAIVAA DLGSICERRT DRLLDKNRSH GLPPFLAD.. PAL NFQGTPIGVS MDNTLRLAIA SIGKLMFAQF SELVNDFYNN GLPSNLSAGR Consensus —L P—L——
551 600 Mouse EGGLNSGFMI AHCTAAALVS ESKALCHPSS VDSLSTSAAT EDHVSMGGWA Rat EGGLNSGFMI AHCTAAALVS ESKALCHPSS VDSLSTSAAT EDHVSMGGWA Human EGGLNSGFMI AHCTAAALVS ENKALCHPSS VDSLSTSAAT EDHVSMGGWA C. elegans DGGLNSGFMT VQLCAASLVS ENKVLCHPSS VDSIPTSCNQ EDHVSMGGFA B. subtilis HPGLQSGAMI MQYAAASLVS ENKTLAHPAS VDSIPSSANQ EDHVSMGTIA P. p u tid a NGGVNSGFMI AQVTAAALAS ENKALSHPHS VDSLPTSANQ EDHVSMAPAA S. g riseu s DAGVDSGLMI AQYTQAALVS EMKRLAVPAS ADSIPSSAMQ EDHVSMGWSA PAL NPSLDYGFKG AEIAMASYCS ELQYLANPVT NHVQSAEQHN QDVNSLGLIS Consensus ——— — — A———jS E---L— P— o O 4
Contd, Figure 23 Contd.
601 650 Mouse ARKALRWEH VEQVLAIELL AACQGIEFL. .RPLKTTTPL EKVYDL.. Rat ARKALRVIEH VEQVLAIELL AACQGIEFL. .RPLKTTTPL EKVYDL.. Human ARKALRVIEH VEQVLAIELL AACQGIEFL. .RPLKTTTPL EKVYDL.. C. elegans ARKALTWEH VEAVLAMELL AACQGIEFL. .KPLISTAPL HKIYQL.. B. s u b t i l i s ARHAYQVIAN TRRVIAIEAI CALQAVEYR. .GIEHAASYT KQLFQE.. P. p u tid a GKRLWEMAEN TRGVPAIEWL GACQGLDLR. .KGLKTSAKL EKARQA.. S. g riseu s ARKLRTAVDN LARIVAVELY AATRAIELRA AEGLTPAPAS EAWAA. . PAL SRKTAEAVDI LKLMSSTFLV ALCQAIDLRH LEENLKNTVK NTVSQVAKRT Consensus
651 700 Mouse VRSWR.PWI KDRFMAPDIE AAHRLLLDQK VWE.VAAPYI EKYRMEHIPE Rat VRSWR.PWI KDRFMAPDIE AAHRLLLDQK VWE.VAAPYI EKYRMEHIPE Human VRSWR.PWI KDRFMAPDIE AAHRLLLEQK VWE.VAAPYI EKYRMEHIPE K C. elegans VRSVAP.PLN EDRYMKPEID AVLEMIRENR IWE.AVLPHL ETLEAMEELD B. subtilis MRKWP.SIQ QDRVFSYDIE RLTDWLKKES L...IPDHQN KELRGMNI. . P. p u tid a LRSEVA.HYD RDRFFAPDIE KAVELLAKGS LTGLLPAGVL PSL...... S. g rise u s LRAAGAEGPG PDRFLAPDLA AADTFVREGR LVAAVEPVTG PLA...... PAL LTTGVNGELH PSRFCEKDL. . .LKWDREY VFAYIDDPCS ATYPLMQKLR Consensus ------—R------
701 750 Mouse SRPLSPTAFS LESLRKNSAT IPESDDL...... Rat SRPLSPTAFS LESLRKNSAT IPESDDL...... Human SRPLSPTAFS LQFLHKKSTK IPESEDL...... C. elegans PDALRQFTKT PTGIVQDRSM IPISDDEESI E ...... B. s u b t i l i s ...... P. p u tid a ...... S. g riseu s ...... PAL QVLSLVEHAL VNGESEKNVN TSIFQKIAAF EEELKALLPK EVRESARAAF Consensus ------
Contd. Figure 23 Contd.
751 800 Mouse ...... Rat...... Human ...... C. elegans ...... B. s u b t il is ...... P. p u tid a ...... S. griseus ...... PAL ENGNPAIPNR IKECRSYPLY KFVREELGVK ARRTELLTGE KVRSPGEEYD Consensus ------
801 850 Mouse ...... Rat ...... Human ...... C. elegans ...... a B. s u b t i l i s ...... P. putida ...... S. g riseu s ...... PAL KVFTAMCQGK IIDPLLECLK EWNGALAHSE INPLPICPLY NDCYDLSPRM Consensus ------
851 865 Mouse Rat Human C. elegans B. subtilis P. p u tid a S. g riseu s PAL LLLMLLFSDP EFDWS Consensus APPENDIX B
Identification of the inducer of hut enzymes in S. griseus
154 Identification of the inducer of hut enzymes in S.griseus.
The hutH.itsr strain, SKK306, was generated by integrating pKK779
containing an internal fragment of hutH into the chromosome of the wild-type
strain of S. griseus (JohnWang). SKK306 cannot utilize L-histidine as a sole
source of nitrogen and a crude extract of this strain prepared from a culture
grown under inducing conditions does not have any histidase (Fig. 5). To
determine whether urocanate can induce the hut enzymes in S. griseus, SKK306 was grown in glutamate minimal medium in the presence or absence of 10 mM
urocanate and a crude extract of the culture was assayed for urocanase activity.
The culture grown in the presence of urocanate contained urocanase (Table 13).
Urocanase activity was not detected in cultures containing 10 mM L-histidine.
These results suggest that in S. griseus urocanate, but not L- histidine, is the inducer of the hut enzymes. When urocanate is the sole nitrogen source, a culture of the wild-type strain contains 25% of the histidase activity of a culture grown in the presence of L-histidine (Kendrick, 1979; Kroening and Kendrick,
1987). The lower amount of histidase might be a consequence of inefficient transport of urocanate in S. griseus (Kendrick, 1979). These experiments suggest that induction of hut enzymes in S. griseus is mediated by urocanate, as in the enteric bacteria and Pseudomonas.
155 Growth medium Inducer Activity Minimal with 1% casein none 1.49 ± 0.25 hydrolysate Minimal withi % casein urocanate 6.37 ± 0.35 hydrolysate
Glutamate minimal none ^ 0 . 1 medium Glutamate minimal urocanate 6.45 ± 0.74 medium
Glutamate minimal L-histidine 5 0 . 1 medium
Table 13. Urocanase activity of strain SKK306 in the presence and absence of inducer *.
® The specific activity was measured as nmol/min/mg protein. Values shown are the average ± std. dev. of at least two extracts assayed in triplicate.
156 APPENDIX C
Kinetic studies of Pseudomonas histidase
157 Kinetic studies of Pseudomonas histidase
Histidase from Pseudomonas has different kinetic properties compared to histidase from Streptomyces. The K^, of Pseudomonas histidase for L- histidine was 5.8 mM compared to 0.6 mM for streptomyces histidase (White and
Kendrick, 1993). Histidinol phosphate is a competetive inhibitor of Streptomyces histidase and Pseudomonas histidase. The K, of Pseudomonas histidase for histidinol phosphate was also determined. The K, pseudomonad histidase
(Sigma) was 19 mM (Fig. 24), which was 70 fold higher than the K, of
Streptomyces histidase (0.27mM; White and Kendrick, 1993) for histidinol phosphate.
FIG. 24. Lineweaver-burke plot of histidase activity at various
concentrations of histidinol phosphate. Histidinol phosphate was
included in thereaction at (•) 0 mM, (linear regression equation as
y=0.063 + 0.175x (r^=0.9975)); (■) 25mM, (linear regression
equation was y=0.061 + 0.175x (1^=0.9825)); (0) 50 mM,( linear
regression equation was y=0.053 + 0.225x(r^=0.9985)); and (V)100
mM, (linear regression equation was y=0.056 + 0.26x (r^=0.9985)).
Theactivity of histidase was measured in nmol/min/mg protein. The
assay conditions were according to the protocol of Consevage and
Phillips (1985). Inset: plot to determine K, of histidinol phosphate
for histidase ( linear regression equation was y=0.49 + 1 34x and r^
=0.9986)
158 0.8 0.084 0.082 0.080 0.7 O.OS8
0.056 0.6 0.054 0.062
0.5 histidinol phosphate (mM) O) 0.4
0.3
0.2
-0.4 - 0.2 0.0 0.2 0.4 0.6 0.8 1.0 -1 1/[S] (mM L-histidine)
Figure 24
159 APPENDIX D
Maps of plasmid vectors used in this study
160 FIG. 25. Circular map of plJ702. This Streptomyces vector contains the
tyrosinase genes {melC1 and melC2) for white/brown color
detection and the thiostrepton resistance gene (ter) for antibiotic
selection. This high copy vector is a derivative of pU101
(Hopwood et ai, 1985).
161 Bamlü.,\ \,Xhol .Fspl
4806,5c/I. rep .fic/1,812
4538,5/?AI., 4373,B«/nJ/ pIJ702 melCl 4137,&rri[ "P®
melCz
3244,5 c /I c/a I /V a n EcoBW
Figure 25
162 FIG. 26. Circular map of pXE4. This vector contains a bifunctional plasmid
containing the C 0 IEI origin of replication and the SCP2 replicon to
maintain 1-2 copies per chromosome in Streptomyœs. The
plasmid also contains tsr (thiostrepton resistance) for selection in
Streptomyœs and amp (ampicillin resistance) for selection in £.
coli.
163 16520,5/7/11. 5amHI,355 15855,/V«n.
Replication
Pvwn,3750 p X £4 17090 bps 12105,5/7/11/ 12010,5acI / A f 1,5320 11535,X&al‘ tsrR / - Stability £coRI,6125 PvuU,6m Bgin,7595
Figure 26
164 FIG. 27. Circular map of plJ2925. This E. coli vector contains the a-
peptide of (3-galactosidase and the ampicillin resistance gene
(amp). The vector plJ2925, derived from pUC19, contains
additional restriction sites in the polylinker region.
165 N d el,m .B gm Iffindm iSp/ii P s e l Sa/I Xbaî BamiS. 2617,y4û?II _Xma\ [Kpnl i;Sacl lEcoBî I Bgm polylinker PU2925 2686 bps Sapl Afim 1784, Cm I; Bsal
Figure 27
166 FIG. 28. Circular map of pT7-7. pT7-7 is a cloning vector that contains a T7
promoter and is used to express streptomyœs gene by using T7
RNA polymerase. The vector contains a 17 promoter, amp
(ampicillin resistance gene), and the C 0 IEI origin of replication.
pT7-7 has a strong ribosome-binding site (rbs) and start codon
(ATG) upstream of the polylinker sequence.
167 S ^ Q l
S to m a l
rbs
P T 7
ColEl
Figure 28
168 APPENDIX E
List of plasmids constructed in this study
169 Source of Source of Skteof Ends of Ends of pKKNo. V«MBtor Organism ONA insert Insert Insert Vector Notes . ' S. griseus The direction ot hutH transcription 615 pUC18 SKK906 genomic hutH 4.0 kb BamHt BamHI Is towards the Hindi!! site S. griseus The direction of hutH transcription is 616 PIJ7G2 SKK906 PKK615 hum 4.0 kb BamHI Bamhi opposite the mel promoter in the S. griseus 617 pXE4 SKK906 PKK615 hutH 4.0 kb BamHI BamHI
S. griseus the direction of hutH transcription is 618 pU18 NRRL B-2682 genomic hutH 4.0 kb BamHI BamHI towards the HIndW site o S. griseus same insert as pKK618 but in opposite 619 PUC18 NRRL B-2682 PKK618 hutH 4.0 kb BamHI BamHI orientation
S. griseus The direction of hufH transcription is 623 PIJ702 NRRL B-2682 PKK618 hutH 4.0 kb BamHI BamHI towards the me! promoter.
S. griseus 628 pXE4 NRRL B-2682 PKK618 hutH 4.0 kb BamHI BamHI S. griseus 629 PIJ2925 SKK906 PKK615 hutH 4.0 kb BamHI BamHI S. griseus A 1.0 kb SpH! fragment was deleted 630 PIJ702 SKK906 PKK616 hutH 3.0 kb BamHI from PKK616
Table 14. List of plasmids constructed in this study. Contd. ( '4 '' $Durco of Source Of S k e o f Endoof Ends of p K K m Vector ûraenleffi ONA kieert Inseif Insert Vector N otes ' ':r \
EcoRI This fragment was amplified by PCR s.griseus and EcoRI and corresponds to upstream hutH 631 PUC18 SKK906 PKK615 hutH 0.35 kb Xbal and Xbalfrom SKK906
pKK631 1.8 kb EcoRl-MscI fragment from S.griseus and pKK629 was replaced witfi 0.3Skb 632 PU2925 SKK9G6 PKK629 hutH 2.5 kb EcoRI EcoRI EcoRI -Msd fragment from pKK631
S.griseus EcoR-Hi EcoRI- the direction of W M transcription is 633 PIJ2925 NRRL B-2682 pKKSOI hutH 3.5 kb ndlll HindIII towards the hindlll site of polylinker S. griseus 634 pXE4 SKK906 PKK632 hutH 2.5 kb Bglll BamHI
S.griseus 636 pXE4 NRRL B-2682 PKK633 hutH 2.5 kb BamHI BamHI
S.griseus EcoRI- EcoRI-B 639 pDH5 NRRL B-2682 PKK5Q1 hutH 2.5 kb BamHI amHI A 1.4 kb aph fragmnet was inserted at S. griseus EcoRI EcoRI the mlul site after filling In the ends 640 pDHS NRRL B-2682 PKK639 hutH 3.9 kb BamHI BamHI with klenow
the fragment corresponds to -35 to S.griseus -110 bp upstream of hutH 641 PIJ2925 NRRL B-2682 genomic hutH 76 bp Bglll Bglll transcription start site Contd. $o«irceof Source of Steoof enH eof Rods of pKK«IO. Vector O m a n W ONA ftteert Ineeit Vector N otÉks The fragment corresponds to +1 to s . griseus -110 bp upstream of hutH 642 PIJ2925 NRRL B-2682 Genomic hutH 110 bp Bglll Bglll transcription start site the fragment corresponds to -35 to S. griseus -173 bp upstream ot hutH 643 PIJ2925 NRRL B-2682 genomic hutH 140 bp Bglll Bglll transcription start site the fragment corresponds to -173 to S. griseus +149 bp with respect to hutH 644 PIJ2925 NRRL B-2682 genomic hutH 320 bp Bglll Bglll transcription start site.
S. griseus io 645 PIJ702 NRRL B-2682 PKK641 hutH 76 bp Bglll Bglll
S. griseus 646 PIJ702 NRRL B-2682 PKK642 hutH 110 bp Bglll Bglll
S. griseus 647 PIJ702 NRRL B-2682 PKK643 hutH 140 bp Bglll Bglll
S. griseus 648 PIJ702 NRRL B-2682 PKK644 hutH 320 bp Bglll Bglll
S. griseus EcoRI-B EcoRI-B 650 PT7-7 NRRL B-2682 PKK501 hutH 2.5 kb amHI amHI
Contd. . Î ' j 'S Source of Source of Sixeof Emdeof Ends of pKKNo, Vdctor OmanW DMA lUCOff )n$ort Vector Not#» . ' S'ff»
The ONA upstream of hutH transcription start site was eiiminated by replacing 2.0 Kb EcoR\-MliA S.griseus Ndel-Ba Ndel-Ba fragment with a 1.0 kb Nde\-MliA PCR 651 PT7-7 NRRL B-2682 PKK650 hutH 1.5 kb mHI mHI amplified fragment
S. griseus Mlul 652 PIJ2925 NRRL B-2682 PKK501 hutH 2.5 kb AphI (blunt)
S.griseus the 1.4 kb aph fragment Is inserted 653 PÜ702 NRRL B-2682 PKK652 hutH 4.0 kb Bglll Bglll into the Mlul site of hutH w pKK651 a 0.7 kb Mlu] BamH\ fragment was S. griseus and Mlul Mlul excised from pKK629 and ligated to 655 PT7-7 NRRL B-2682 PKK629 hutH 1.5 kb BamHi BamHi similarly digested pKK202 the 1.0 kb A/del Mlu\ fragment from PKK594 pKK651 was replaced with Ndel M/ul S.griseus and Ndel Ndel fragment from pKK594 that was 657 PT7-7 SKK896 PKK651 hutH 1.5 kb BamHI BamHI 1 amplified by PCR