(12) Patent Application Publication (10) Pub. No.: US 2007/0015163 A1 Isogai Et Al

US 2007 OO15163A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/0015163 A1 Isogai et al. (43) Pub. Date: Jan. 18, 2007

(54) NOVEL FULL-LENGTH CDNA Related U.S. Application Data (75) Inventors: Takao Isogai, Ibaraki (JP); Tomoyasu (62) Division of application No. 10/094,749, filed on Mar. Sugiyama, Tokyo (JP); Tetsuji Otsuki, 12, 2002, now Pat. No. 6,979,557. Kisarazu-shi (JP): Ai Wakamatsu, Kisarazu-shi (JP); Hiroyuki Sato, (60) Provisional application No. 60/350,435, filed on Jan. Osaka (JP); Shizuko Ishii, Kisarazu-shi 24, 2002. (JP); Jun-ichi Yamamoto, Kisarazu-shi (30) Foreign Application Priority Data (JP); Yuuko Isono, Kisarazu-shi (JP); Yuri Hio, Chiba (JP); Kaoru Otsuka, Sep. 14, 2001 (JP)...... 2001-328381 Saitama (JP); Keiichi Nagai, Tokyo (JP); Ryotaro Irie, Chiba (JP); Ichiro Publication Classification Tamechika, Osaka (JP): Naohiko Seki, Chiba (JP); Tsutomu Yoshikawa, Chiba (51) Int. Cl. (JP): Motoyuki Otsuka, Tokyo (JP); CI2O I/68 (2006.01) Kenji Nagahari, Tokyo (JP); Yasuhiko C7H 2L/04 (2006.01) Masuho, Tokyo (JP) CI2P 2/06 (2006.01) C07K I4/47 (2007.01) Correspondence Address: C07K 6/18 (2007.01) FOLEY AND LARDNER LLP (52) U.S. Cl...... 435/6; 435/69.1: 435/320.1; SUTE SOO 435/325; 530/350, 530/388.22; 3OOOK STREET NW 536/23.5 WASHINGTON, DC 20007 (US) (57) ABSTRACT Novel full-length cDNAs are provided. 1639 cDNA derived (73) Assignee: RESEARCH ASSOCIATION FOR from human have been isolated. The full-length nucleotide BOTECHNOLOGY sequences of the cDNA and amino acid sequences encoded by the nucleotide sequences have been determined. Because (21) Appl. No.: 11/166,372 the cDNA of the present invention are full-length and contain the translation start site, they provide information (22) Filed: Jun. 27, 2005 useful for analyzing the functions of the polypeptide.

ind NCO 239 Ssp 3277 Sfil 278 Oral 3050 EcoM 396 Scal 29 BSU36 400 Oral 488

bla Small t intron ECOR 796

pME18SFL3 Ahd 2470 Oral 2 Oral 2 Ori HgiE II 216

Ot 1215 Xba 1231 Small 1434 Kpnl 1438 Sac 1444 Patent Application Publication Jan. 18, 2007 US 2007/0015163 A1 Figure l

ind NCO 239 Ssp 3277 Sfi 278 Dra 3050 ECON 396 SCal 29 m BSU36 400 Oral 488

bla Small t intron ECOR 796

Oral 808 pME18SFL3 COR V 816 And 2470 ACC 961 Oral 2 Oral 2

Ot 1215 2 Xbal 1231 Drd 1684 WSmall 1434 Kpn 1438 SaCl 1444 US 2007/0015163 A1 Jan. 18, 2007

NOVEL FULL-LENGTH CONA sequence of a full-length cDNA, and to analyze factors involved in the stability of mRNA that is contained in the FIELD OF THE INVENTION cDNA, or in its regulation of expression at the translation 0001. The present invention relates to polynucleotides stage. Also, since a full-length cDNA contains atg codon, the encoding novel polypeptides, polypeptides encoded by the translation start site, in the 5'-region, it can be translated into polynucleotides, and new uses of these. a protein in a correct frame. Therefore, it is possible to produce a large amount of the protein encoded by the cDNA BACKGROUND OF THE INVENTION or to analyze biological activity of the expressed protein by utilizing an appropriate expression system. Thus, analysis of 0002 Currently, the sequencing projects, the determina a full-length cDNA provides valuable information which tion and analysis of the genomic DNA of various living complements the information from genome sequencing. organisms have been in progress all over the world. The whole genomic sequences of more than 40 species of Also, full-length cDNA clones that can be expressed are prokaryotes, a lower eukaryote, yeast, a multicellular extremely valuable in empirical analysis of gene function eukaryote, C. elegans, and a higher plants, arabidopsis, etc. and in industrial application. are already determined. For human genome, presumably 0007. Therefore, if a novel human full-length cDNA is having 3 billion base pairs, the analysis was advanced under isolated, it can be used for developing medicines for diseases global cooperative organization, and a draft sequence was in which the gene is involved. The protein encoded by the disclosed in 2001. Moreover, all the structures are to be clear gene can be used as a drug by itself. Thus, it has great and to be disclosed in 2002-2003. The aim of the determi significance to obtain a full-length cDNA encoding a novel nation of genomic sequence is to reveal the functions of all human protein. genes and their regulation and to understand living organ 0008. In particular, human secretory proteins or mem isms as a network of interactions between genes, proteins, brane proteins would be useful by itself as a medicine like cells or individuals through deducing the information in a tissue plasminogen activator (TPA), or as a target of medi genome, which is a blueprint of the highly complicated cines like membrane receptors. In addition, genes for signal living organisms. To understand living organisms by utiliz transduction-related proteins (protein kinases, etc.), glyco ing the genomic information from various species is not only protein-related proteins, transcription-related proteins, etc. important as an academic Subject, but also socially signifi are genes whose relationships to human diseases have been cant from the viewpoint of industrial application. elucidated. Moreover, genes for disease-related proteins 0003. However, determination of genomic sequences form a gene group rich in genes whose relationships to itself cannot identify the functions of all genes. For example, human diseases have been elucidated. as for yeast, only the function of approximately half of the 6000 genes, which is predicted based on the genomic 0009. Therefore, it has great significance to isolate novel sequence, was able to be deduced. On the other hand, the full-length cDNA clones of human, only few of which has human genome has been estimated to contain about 30,000 been isolated. Especially, isolation of a novel cDNA clone genes. Further, 100,000 or more types of mRNAs are said to encoding a secretory protein or membrane protein is desired exist when variants produced by alternative splicing are since the protein itself would be useful as a medicine, and taken into consideration. Therefore, it is desirable to estab also the clones potentially include a gene involved in lish "a high throughput analysis system of the gene func diseases. In addition, genes encoding proteins that are tions” which allows us to identify rapidly and efficiently the involved in signal transduction, glycoprotein, transcription, functions of vast amounts of the genes obtained by the or diseases are expected to be useful as target molecules for genomic sequencing. therapy, or as medicines themselves. These genes form a gene group predicted to be strongly involved in diseases. 0004 Many genes in the eukaryotic genome are split by Thus, identification of the full-length cDNA clones encoding introns into multiple exons. Thus, it is difficult to predict those proteins has great significance. correctly the structure of encoded protein solely based on genomic information. In contrast, cDNA, which is produced SUMMARY OF THE INVENTION from mRNA that lacks introns, encodes a protein as a single continuous amino acid sequence and allows us to identify 0010. An objective of the present invention is to provide the primary structure of the protein easily. In human clNA polynucleotides encoding novel polypeptides, polypeptides research, to date, more than three million ESTs (Expression encoded by the polynucleotides, and novel usages of these. Sequence Tags) are publicly available, and the ESTs pre 0011. The inventors have developed a method for effi sumably cover not less than 80% of all human genes. ciently cloning, from a cDNA library having very high 0005 The information of ESTs is utilized for analyzing fullness-ratio, a human full-length cDNA that is predicted to the structure of human genome, or for predicting the exon be a full-length cDNA clone, where the cDNA library is regions of genomic sequences or their expression profile. synthesized by an improved method (WO 01/04286) of the However, many human ESTs have been derived from proxi oligo-capping method (K. Maruyama and S. Sugano, Gene, mal regions to the 3'-end of cDNA, and information around 138: 171-174 (1994): Y. Suzuki et al., Gene, 200: 149-156 the 5'-end of mRNA is extremely little. Among human (1997)). Then, the nucleotide sequences of cDNA clones cDNAs, the number of the corresponding mRNAs whose whose fullness ratio is high, obtained by this method, were encoding full-length protein sequences are deduced is determined mainly from their 5'-ends, and, if required, from approximately 13,000. 3'-ends. 0006. It is possible to identify the transcription start site 0012 Further, representative clones, which were esti of mRNA on the genomic sequence based on the 5'-end mated to be novel and full-length, among the clones US 2007/0015163 A1 Jan. 18, 2007 obtained, were analyzed for their full-length nucleotide capable of being expressed, is not limited to the 5’- and sequences. The determined full-length nucleotide sequences 3'-end sequences of polynucleotide. were analyzed by BLAST homology search of the databases shown below. Because the homology search of the present 0017 Specifically, the present invention relates to a poly invention is carried out based on the information of full nucleotide selected from the group consisting of the follow length cDNAS including the entire coding regions, homol ing (a) to (g): ogy to every part of a polypeptide can be analyzed. Thus, in 0018 (a) a polynucleotide comprising a protein-coding the present invention, the reliability of homology search has region of the nucleotide sequence of any one of SEQID NOS been greatly improved. shown in Table 1: 1 SwissProt (http://www.ebi.ac.uk/ebi docsSwissProt db/ 0019 (b) a polynucleotide encoding a polypeptide com Swisshome.html), prising the amino acid sequence of any one of SEQID NOS 2) GenBank (http://www.ncbi.nlm.nih.gov/web/GenBank), shown in Table 1: 0020 (c) a polynucleotide comprising a nucleotide 3 UniGene (Human) (http://www.ncbi.nlm.nih.gov/Uni sequence encoding a polypeptide comprising the amino acid Gene), and sequence of any one of SEQ ID NOS shown in Table 1, 0013 4 nr (a protein database, which has been con wherein, in said amino acid sequence, one or more amino structed by combining data of coding sequences (CDS) in acids have been substituted, deleted, inserted, and/or added, nucleotide sequences deposited in GenBank, and data of and wherein said nucleotide sequence encodes a polypeptide SwissProt, PDB (http://www.rcsb.org/pdb/index.html), PIR functionally equivalent to a polypeptide comprising the (http://pirgeorgetown.edu/pirwww/pirhome.shtml), and selected amino acid sequence; PRF (http://www.prfor.jp/en/); overlapping sequences have 0021 (d) a polynucleotide hybridizing under stringent been removed.) conditions to a polynucleotide comprising the nucleotide 0014 Further, the gene expression profiles of cDNA sequence of any one of SEQ ID NOS shown in Table 1, clones whose full-length nucleotide sequence had been wherein said nucleotide sequence encodes a polypeptide determined were studied by analyzing the large-scale cDNA functionally equivalent to a polypeptide encoded by the database constructed based on the 5'-end nucleotide selected nucleotide sequence; sequences of cDNAs obtained. In addition to the analysis for the expression profile by computer, the profiles of gene 0022 (e) a polynucleotide comprising a nucleotide expression in living cells were also determined by PCR. The sequence encoding a partial amino acid sequence of a present inventors revealed the usefulness of the genes of the polypeptide encoded by the polynucleotide according to any present invention based on these analysis results. one of (a) to (d); 0015. In the present invention, gene functions were 0023 (f) a polynucleotide comprising a nucleotide revealed by the analysis of expression profiles in silico based sequence having at least 70% identity to the nucleotide on the information of full-length nucleotide sequences. The sequence of (a); and expression profiles used in the expression frequency analysis 0024 (g) a polynucleotide comprising a nucleotide were studied based on the database containing Sufficient sequence having at least 90% identity to the nucleotide amount of fragment sequence data. The expression fre sequence of (a). quency analysis was carried out by referring, for these expression profiles, to the full-length nucleotide sequences 0025 The present invention also relates to a polypeptide of many cDNA clones obtained in the present invention. encoded by the above-mentioned polynucleotide or a partial Thus, a highly reliable analysis can be achieved by referring peptide thereof, an antibody binding to the polypeptide or to the full-length nucleotide sequences of a wide variety of the peptide, and a method for immunologically assaying the genes for the Sufficiently large population for analysis polypeptide or the peptide, which comprises the steps of (expression profiles). Namely, the results of expression contacting the polypeptide or the peptide with the antibody, frequency analysis using the full-length sequences of the and observing the binding between the two. present invention more precisely reflect the gene expression 0026 Furthermore, the present invention features a vec frequency in tissues and cells from which a certain cDNA tor comprising the above-mentioned polynucleotide, a trans library was derived. In other words, the information of formant carrying the polynucleotide or the vector, a trans full-length cDNA nucleotide sequence of the present inven formant carrying the polynucleotide or the vector in an tion made it possible to achieve the highly reliable expres expressible manner, and a method for producing the sion frequency analysis. polypeptide or the peptide, which comprises the steps of culturing the transformant and recovering an expression 0016. The full-length cDNA clones of this invention were product. obtained by the method comprising the steps of 1 prepar ing libraries containing cDNAs with the high fullness ratio 0027. Another feature of the present invention is an by oligo-capping, and 2 assembling 5'-end sequences and oligonucleotide comprising at least 15 nucleotides, said selecting one with the highest probability of completeness in oligonucleotide comprising a nucleotide sequence comple length in the cluster formed (there are many clones longer in mentary to the nucleotide sequence of any one of SEQ ID the 5'-end direction). However, the uses of primers designed NOs: 1 to 1639 or to a complementary strand thereof. This based on the 5’- and 3'-end sequences of polynucleotides oligonucleotide can be used as a primer for synthesizing the provided by the present invention enable readily obtaining above-mentioned polynucleotide or used as a probe for full-length cDNAs without such a special technique. The detecting the polynucleotide. The present invention includes primer, which is designed to be used for obtaining cDNAs an antisense polynucleotide against the polynucleotide or a US 2007/0015163 A1 Jan. 18, 2007 part thereof, and a method for detecting the polynucleotide, logical macromolecules. For example, the Substantially pure which comprises the following steps of protein or polypeptide is at least 75%, 80%, 85%, 95%, or 99% pure by dry weight. Purity can be measured by any a) incubating a target polynucleotide with the oligonucle appropriate standard method known in the art, for example, otide under hybridizable conditions, and by column chromatography, polyacrylamide gel electro b) detecting hybridization of the target polynucleotide with phoresis, or HPLC analysis. the oligonucleotide. 0032 All the cDNAs provided by the present invention 0028 Still another feature of the present invention is a are full-length cDNAs. The “full-length cDNA” herein database of polynucleotides and/or polypeptides, said data means that the cDNA contains the ATG codon, which is the base comprising information on at least one of the nucle start point of translation therein. The untranslated regions otide sequences of SEQID NOs: 1 to 1639 and/or on at least upstream and downstream of the protein-coding region, both one of the amino acid sequences of SEQ ID NOs: 1640 to of which are naturally contained in natural mRNAs, are not 3278. indispensable. It is preferable that the full-length cDNAs of the present invention contain the stop codon. 0029. Herein, “polynucleotide' is defined as a molecule, such as DNA and RNA, in which multiple nucleotides are BRIEF DESCRIPTION OF THE DRAWINGS polymerized. There are no limitations on the number of the polymerized nucleotides. In case that the polymer contains 0033 FIG. 1 shows the restriction map of the vector relatively low number of nucleotides, it is also described as pME18SFL3. an “oligonucleotide', which is included in the “polynucle otide' of the present invention. The polynucleotide or the DETAILED DESCRIPTION OF THE oligonucleotide of the present invention can be a natural or INVENTION chemically synthesized product. Alternatively, it can be 0034 All the clones (1639 clones) of the present inven synthesized using a template polynucleotide by an enzy tion are novel and encode the full-length polypeptides. matic reaction such as PCR. Furthermore, the polynucle Further, all the clones are cDNAs with the high fullness otide of the present invention may be modified chemically. ratio, which were obtained by oligo-capping method, and Moreover, not only a single-strand polynucleotide but also a also clones which are not identical to any of known human double-strand polynucleotide is included in the present mRNAS (namely, novel clones) selected by searching, for invention. In this specification, especially in claims, when the 5'-end sequences, mRNA sequences with the annotation the polynucleotide is described merely as “polynucleotide', of “complete cds' in the GenBank and UniGene databases it means not only a single-strand polynucleotide but also a by using the BLAST homology search S. F. Altschul, W. double-strand polynucleotide. When it means double-strand Gish, W. Miller, E. W. Myers & D. J. Lipman, J. Mol. Biol., polynucleotide, the nucleotide sequence of only one chain is 215: 403-410 (1990); W. Gish & D.J. States, Nature Genet. indicated. However, based on the nucleotide sequence of a 3: 266-272 (1993); they are also clones that were assumed sense chain, the nucleotide sequence of the complementary to have higher fullness ratio among the members in the strand thereof is essentially determined. cluster formed by assembling. Most of the clones assessed 0030. As used herein, an "isolated polynucleotide' is a to have high fullness ratio in the cluster had the nucleotide polynucleotide the structure of which is not identical to that sequences longer in the 5'-end direction. of any naturally occurring polynucleotide or to that of any 0035 All the full-length cDNAs of the present invention fragment of a naturally occurring genomic polynucleotide can be synthesized by a method such as PCR (Current spanning more than three separate genes. The term therefore protocols in Molecular Biology edit. Ausubel et al. (1987) includes, for example, (a) a DNA which has the sequence of Publish. John Wiley & Sons Section 6.1-6.4) using primer part of a naturally occurring genomic DNA molecule in the sets designed based on the 5'-end and 3'-end sequences or genome of the organism in which it naturally occurs; (b) a using primer sets of primers designed based on the 5'-end polynucleotide incorporated into a vector or into the sequences and a primer of oligo dT sequence corresponding genomic DNA of a prokaryote or eukaryote in a manner Such to poly A sequence. Table 1 contains the clone names of that the resulting molecule is not identical to any naturally full-length cDNA of 1639 clones of the present invention, occurring vector or genomic DNA; (c) a separate molecule SEQ ID NOs of the full-length nucleotide sequences, CDS Such as a cDNA, a genomic fragment, a fragment produced portions deduced from the full-length nucleotide sequences, by polymerase chain reaction (PCR), or a restriction frag ment; and (d) a recombinant nucleotide sequence that is part and SEQ ID NOs of the translated amino acids. The posi of a hybrid gene, i.e., a gene encoding a fusion polypeptide. tions of CDS are shown according to the rule of “DDBJ/ Specifically excluded from this definition are polynucle EMBL/GenBank Feature Table Definition” (http://ww otides of DNA molecules present in mixtures of different (i) w.ncbi.nlm.nih.gov/collab/FT/index.html). The Start DNA molecules, (ii) transfected cells, or (iii) cell clones: position number corresponds to the first letter of “ATG’ that e.g., as these occur in a DNA library such as a cDNA or is the nucleotide triplet encoding methionine; the termina genomic DNA library. tion position number corresponds to the third letter of the stop codon. These are indicated being flanked with the mark 0031. The term “substantially pure' as used herein in “. . . . However, with respect to the clones having no stop reference to a given protein or polypeptide means that the codon, the termination position is indicated by the mark"> protein or polypeptide is substantially free from other bio according to the above rule.

US 2007/0015163 A1 Jan. 18, 2007 6

TABLE 1-continued TABLE 1-continued SEQ ID NO. SEQ ID NO. SEQ ID NO. SEQ ID NO. Clone of nucleotide Position of amino acid Clone of nucleotide Position of amino acid l8le Sequence of CDS SeleCe. l8le Sequence of CDS Sequence

DFNES2OOO268O 289 505 . . . 2571 928 FEBRA2OO12270 361 1933 . . . 2238 2OOO DFNES2OOO2920 290 52 . . . 639 929 FEBRA2001 2450 362 S19 . . . 2678 2001 DFNES2OOO33SO 291 33 . . . 1007 930 FEBRA2OO12940 363 69 . . . 575 2002 DFNES2OOO4320 292 1517 . . . 1849 931 FEBRA2OO13S10 364 990 . . . 1313 2003 FCBBF1OOOS98O 293 375 . . . 2141 932 FEBRA2OO14870 365 1567 . . . 1884 2004 FCBBF1000618O 294 1161 . . . 1463 933 FEBRA2OO14920 366 77 . . . 2815 2005 FCBBF1OOO67SO 295 106 . . . 1023 934 FEBRA2OO15840 367 702 . . . 1853 2006 FCBBF1OOO6860 296 S21 . . . 865 935 FEBRA2OO15900 368 1535 . . . 1882 2007 FCBBF1OOO6870 297 410 . . . 1831 936 FEBRA2OO15910 369 246 . . . 617 2008 FCBBF1OOO6910 298 111 . . . 482 937 FEBRA2OO17O60 370 730 . . . 1257 2009 FCBBF1OOO732O 299 1236 . . . 1850 938 FEBRA200171SO 371 391 . . . 2799 2010 FCBBF1OOO76OO 300 68 . . . S23 939 FEBRA2OO17900 372 72 . . . 647 2011 FCBBF2OOOO940 301 249 . . . 2147 940 FEBRA2OO19890 373 497 . . .2239 2012 FCBBF2OOO1OSO 3O2 29.421 941 FEBRA2002O860 374 281 . . . 673 2013 FCBBF2OOO1950 303 1S6S . . . 1888 942 FEBRA20021910 375 1455 . . . 1829 2014 FCBBF2OOO2320 304 921 . . . 2003 943 FEBRA20O2.1940 376 17 . . . 493 2015 FCBBF20002760 305 221 . . . 895 944 FEBRA2OO24290 377 35 . . . 1933 2016 FCBBF2OOOS/60 306 693 . . . 1073 945 FEBRA2OO2442O 378 991 . . . 1614 2017 FCBBF2OOOS910 307 29 . . . .2161 946 FEBRA2OO2S250 379 251 . . . 2164 2018 FCBBF2OOO6770 3O8 265 . . . 600 947 FEBRA20027270 380 10 . . . 930 2019 FCBBF2OOO7330 309 745 ... 1077 948 FEBRA20027830 381 293 . . . 610 2020 FCBBF20008080 310 180 . . . 821 949 FEBRA20O2882O 382 1337 . . . 1678 2021 FCBBF200081SO 311 641 . . . 1762 950 FEBRA20O2897O 383 824 . . . 1303 2022 FCBBF2OOO94OO 312 360 . . . 749 951 FEBRA2OO2908O 384 90 . . . 764 2023 FCBBF2OOO951O 313 218 . . . 1333 952 FEBRA2OO3OS4O 385 292 . . . 993 2O24 FCBBF2OO12110 314 136 . . . 1776 953 FEBRA2003 1550 386 2OOO . . . 23.65 2025 FCBBF20012990 315 758 . . . 11.68 954 FEBRA2OO33O8O 387 399 . . . 749 2026 FCBBF20014800 316 146 . . . 1957 955 FEBRA20034290 388 348 . . . 854 2027 FCBBF2OO1538O 317 3O2 . . . 1246 956 FEBRA20037070 389 1830 . . . .2246 2028 FCBBF2OO1672O 3.18 51 . . . 488 957 FEBRA200411 OO 390 198 . . . 1010 2029 FCBBF2001718O 319 236 . . . S98 958 FEBRA20041910 391 39 . . . 425 2O3O FCBBF2OO172OO 320 2306 . . . 2767 959 FEBRA20042240 392 1373 . . . 1714 2031 FCBBF4.0002820 321 207 . . . 1247 96.O FEBRA20042370 393 S1 . . . 938 2032 FCBBFSOOO2610 322 126 . . . 1634 961 FEBRA20042930 394 2321 . . . .2652 2O33 FEBRA2OOOO3SO 323 724 . . . 1764 962 FEBRA200432SO 395 394 . . . s2294 2O34 BRA2OOOOS30 324 359 . . . 2221 963 FEBRA20043290 396 57 . . . 2984 2035 BRA2OOO1 OSO 325 496 . . . 2355 964 FEBRA2004.4120 397 928. . . . 1263 2O36 BRA2OOO1290 326 872 . . . 1192 96S FEBRA2004.4430 398 192 . . . S39 2037 BRA20003110 327 386 . . . 964 966 FEBRA2004.4900 399 78 . . . 1763 2038 BRA2OOO33OO 328 504 . . . 1881 967 FEBRA20045920 400 344 . . . 1438 2O39 BRA2OOO3770 329 398 . . . 2464 968 FEBRA2004.818O 4O1 86. . . 493 2040 BRA2OOO378O 330 454 . . . 873 969 FEBRA2OOSO140 4O2 727 . . . 2325 2041 BRA2OOO3910 331 728 . . . 2057 970 FEBRA2OOSO790 403 780 . . . 1295 2042 BRA2OOO3970 332 62 . . . 1469 971 FEBRA2OOS2160 404 1055 . . . 1411 2043 BRA2OOO3990 333 845 . . . 2404 972 FEBRA2OOS3770 40S 790 . . . 1197 2044 BRA2OOO4040 334 21 ... 449 973 FEBRA20053800 4O6 213 . . . 521 2045 BRA2OOO41SO 335 836 . . . 2494 974 FEBRA20054270 407 1711 . . . 2058 2046 BRA20004520 336 13 . . . 442 975 FEBRA20057260 4.08 8 . . . 1789 2047 BRA2OOO4540 337 934 . . . 2484 976 FEBRA2005752O 409 13 . . . 48O 2048 BRA2OOO491O 338 417 . . . 1926 977 FEBRA20057780 410 150 . . . 641 2049 BRA2OOOS360 339 254 . . . 1453 978 FEBRA2005788O 411 8 . . . s.31.65 2OSO BRA2OOO6560 340 34 . . . 615 979 FEBRA2005998O 412 1160 . . . 2017 2051 BRA2OOO68OO 341 3O3 . . . 1040 98O FEBRA20060920 413 26 . . . 661 2052 BRA2OOO6900 342 268 . . . 1669 981 FEBRA20061500 414 77 . . . 460 2053 BRA2OOO7330 343 486 . . . 2013 982 FEBRA200627OO 415 32 . . . 778 2O54 BRA2OOO74OO 344 32 . . . 1123 983 FEBRA200631 SO 416 236 . . . S38 2055 BRA2OOO7S70 345 222 . . . 1193 984 FEBRA20063540 417 4O2 . . . 1737 2056 BRA2OOO7710 346 O59 . . . 1361 985 FEBRA20064760 418 340 . . . 2076 2057 BRA2OOO772O 347 267 . . . 689 986 FEBRA2OO66270 419 278 . . . 691 2O58 BRA2OOO7870 348 174 . . . 1788 987 FEBRA2006.6670 420 933 . . . 2496 2059 BRA20008090 349 319 . . . 1621 988 FEBRA20067360 421 60 . . . 1713 2060 BRA2OOO8560 350 SOO . . . 1991 989 FEBRA2OO67930 422 332 . . . 1973 2061 BRA2OOO874O 351 2051 . . . 2368 990 FEBRA2006873O 423 71 . . . 2051 2062 BRA2OOO88OO 352 38 . . . 703 991 FEBRA2006942O 424 231 . . . 1439 2063 BRA2OOO8810 353 377 . . . 1495 992 FEBRA2007O170 425 88 . . . 921 2O64 BRA2OOO9010 3S4 243 . . . 638 993 FEBRA20072OOO 426 47 . . . 206S 206S BRA2OOO9590 355 345 . . . 1677 994 FEBRA2OO72800 427 850 . . . 2335 2066 BRA2OOO972O 356 530 . . . 2140 995 FEBRA2OO74140 428 57 . . . 371 2O67 BRA20010930 357 239 . . . 1249 996 FEBRA2007458O 429 91 . . . 42O 2O68 BRA2OO11330 358 795 . . . 2322 997 FEBRA2007SS10 430 81 . . . 606 2069 BRA2OO11460 359 2219 . . . 26O2 998 FEBRA2007S660 431 960 . . . 2298 2070 FEBRA2OO11970 360 672 ... 1977 999 FEBRA2007622O 432 47 . . . 2S25 2O71

US 2007/0015163 A1 Jan. 18, 2007 12

TABLE 1-continued TABLE 1-continued SEQ ID NO. SEQ ID NO. SEQ ID NO. SEQ ID NO. Clone of nucleotide Position of amino acid Clone of nucleotide Position of amino acid l8le SeleCe. of CDS Sequence l8le SeleCe. of CDS Sequence

PROST10002460 53 240 . . . 1713 2792 SKMUS1 OOO1240 225 35 . . . s.1069 2864 PROST1000272O S4 14 . . . 689 2793 SKMUS1 OOO1290 226 66 . . . 749 2865 PROST1OOO3430 55 259 . . . 2445 2794 SKMUS10001770 227 2O3 . . . 1276 2866 PROST1OOOS260 56 214 . . . 1591 2.795 SKMUS2OOOO740 228 26 . . . 1135 2867 PROST1OOOS360 57 240 . . . 2477 2796 SKMUS2OOO1170 229 105 . . . 1019 2868 PROST1000S640 58 39 . . . S25 2797 SKMUS2OOO2710 230 17 . . . 1174 2869 PROST2OOOO360 59 S80 . . . 1969 2798 SKMUS2OOO3430 231 163 . . . 861 2870 PROST2OOOOS30 60 439 . . . 1825 2799 SKMUS2OOO36SO 232 32 . . .388 2871 PROST2OOO1760 61 44 . . . 1276 2800 SKMUS2OOO3900 233 135 . . . 1112 2872 PROST20002060 62 O72 . . . 1506 28O1 SKMUS2OOO458O 234 166 . . . s.1905 2873 PROST20002670 63 S47 . . . 897 28O2 SKMUS2O004670 235 141 ... 443 2874 PROST20002730 64 O70 . . . 1477 28O3 SKMUS2OOO468O 236 4 . . . 453 2875 PROST20002740 65 SS7 . . . 1910 2804 SKMUS2OOO7240 237 107 . . . 1120 2876 PROST2OOO32SO 66 96 . . . 965 280S SKMUS2OOO7740 238 66 . . . 1061 2877 PROST2OOO4630 67 495 . . . 815 2806 SKMUS2OOO8470 239 183 . . . 524 2878 PROST2OO17390 68 22. . . SOS 2807 SKMUS2OOO8630 240 294 . . . 1727 2879 PROST20017960 69 401 . . . 1829 28O8 SKMUS2OOO902O 241 396 . . . 1631 288O PROST2001823O 70 89 . . . 1447 2809 SKMUS2OOO9330 242 96 . . . 752 2881 PROST2OO18990 71 2O24 . . . 2953 2810 SKMUS2OOO9450 243 796 . . . 1149 2882 PROST2OO1998O 72 544 . . . 1852 2811 SKMUS2OOO9540 244 93 . . . 1260 2883 PROST2002162O 73 439 . . . 1918 2812 SKMUS2O010O8O 245 210 . . . 839 2884 PROST20O23380 74 1 . . . S59 2813 SKMUS2OO11290 246 16 . . . 1375 2885 PROST20O2S910 75 94 . . . 408 2814 SKMUS2OO11470 247 2SS . . . 968 2886 PROST2002682O 76 411 . . . 1511 2815 SKMUS2OO13640 248 17 . . . 476 2887 PROST2002842O 77 173 . . . 1607 2816 SKMUS2OO14920 249 99 . . . 942 2888 PROST20029600 78 245 . . . 856 2817 SKMUS2OO15010 250 78 . . . 921 2889 PROST20031020 79 2O . . . 1456 2818 SKMUS2OO15430 251 53 . . . 847 2890 PROST20031170 8O 63 . . . 1578 2819 SKMUS2OO1608O 252 45 . . . 1026 2891 PROST200321 OO 81 82 . . . 1671 282O SKMUS2OO16310 253 385 . . . 876 2892 PROST20032320 82 2S37 . . .3004 2821 SKMUS2OO16340 254 274 . . . s.1622 2893 PROST2003302O 83 SSO . . . 1906 2822 SKMUS2OO1662O 255 30 . . . 806 2894 PROST20033O3O 84 247 . . . S67 28.23 SKMUS2OO16680 256 96 . . . 1290 2895 PROST20033380 85 9 . . . 1524 2824 SKMUS2OO16710 257 30 . . . 722 2896 PROST200334OO 86 294 . . . 647 282S SKNMC1OOOOO70 258 26S . . . 1594 2897 PROST2003472O 87 280 . . . 1764 2826 SKNMC1OOOO1 OO 259 296 . . . 694 2898 PROST2003732O 88 001 ... 1414 2827 SKNMC1OOOO190 260 219 . . . 1578 2899 PROST2003922O 89 790 . . . 2416 2828 SKNMC1OOOO290 261 388 . . . 789 2900 PROST2004332O 90 278 . . . 1843 2829 SKNMC1OOO1100 262 405 . . . 920 2901 PROST2004.4160 91 435 . . . 866 2830 SKNMC1OOO1590 263 720 . . . 1991 2902 PROST2004.4810 92 442 . . . 1759 2831 SKNMC1OOO1680 264 187 . . . 1927 2903 PROST2OOS1210 93 405 . . . 1217 2832 SKNMC10002290 26S 798 . . . 24.72 2904 PROST2OOS1430 94 76 . . . S4O 2833 SKNMC1OOO2S10 266 26S . . . 2S6S 2905 PROST20054260 95 S6 . . . 952 2834 SKNMC10002640 267 68 . . . 718 2906 PROST2OOS6040 96 235 . . . 1552 2835 SKNMC2OOOO6SO 268 55 ... 1758 2907 PROST2OOS88OO 97 79 . . . 493 2836 SKNMC2OOOO970 269 340 . . . 2028 2908 PROST200591.90 98 94 . . . 483 2837 SKNMC2OOO2240 270 797 . . . 1939 2909 PROST2005943O 99 475 . . . 1792 2838 SKNMC2OOO3OSO 271 154 . . . s1168 2910 PROST2006 1960 200 7 . . .393 2839 SKNMC2OOO322O 272 351 . . . 1091 2911 PROST200626OO 2O1 45 . . . 2367 2840 SKNMC2OOO3S60 273 69 . . . 650 2912 PROST20064SOO 2O2 46 . . . 466 2841 SKNMC2OOOS930 274 363 . . . 1262 291.3 PROST20067370 2O3 219 . . . 1944 2842 SKNMC2OOO612O 275 1176 . . . 1589 2914 PROST2006988O 204 45 . . . 2252 2843 SKNMC2OO10570 276 79 . . . 2085 2915 PROST2007 2370 205 39 . . . 2256 284.4 SKNMC2OO11130 277 98 . . . 955 2916 PROST20072890 2O6 664 . . . 2632 2845 SKNMC2OO15030 278 1129 . . . 1689 2917 PROST20073170 2O7 66 . . . 1905 2846 SKNMC2OO15SSO 279 463 . . . 1035 2918 PROST20073890 208 O22 . . . 1324 2847 SKNMC2OO15960 28O 74 . . . .3352 2919 PROST2007974O 209 47 . . . S27 2848 SKNSH10OOO860 281 786 . . . 12SO 2920 PROST20085160 210 63 . . . 734 2849 SKNSH10OO1740 282 361 . . . 1458 2921 PROST20094830 211 58 . . . 2328 28SO SKNSH10OO3O10 283 464 . . . 1669 2922 PUAEN1OOOOSTO 212 27 . . . 2220 2851 SKNSH10OO3O8O 284 389 . . . 871 2923 PUAEN10000810 213 318 . . . 2234 2852 SKNSH2OOO1510 285 462 . . . 776 2924 PUAEN1OOO1610 214 582 . . . 3794 2853 SKNSH2OOO1630 286 1087 . . . 1596 2925 PUAEN1OOO322O 215 73 . . . 946 2854 SKNSH2OOO3470 287 390 . . . 863 2926 SALGL1OOOOOSO 216 298 . . . 933 2855 SMINT1 OOOO160 288 158 . . . 1729 2927 SALGL1OOOO470 217 1 . . . 619 2856 SMINT1 OOOO390 289 740 . . . 1045 2928 SALGL1OOOO6SO 218 93 . . . S43 2857 SMINT1 OOOO42O 290 76 . . . .2645 2929 SALGL1OOO1570 219 269 . . . 1282 2858 SMINT1 OOOOS40 291 97 . . . 636 2930 SKMUS1 OOOO140 220 68 . . . 1234 28S9 SMINT1 OOOOS70 292 70 . . . 1545 2931 SKMUS1 OOOO220 221 O2 . . . 1367 2860 SMINT1 OOOO710 293 1763 . . . .2O65 2932 SKMUS1 OOOO640 222 37 . . . 1198. 2861 SMINT1 OOO1OOO 294 27 . . . 470 2933 SKMUS1 OOO1040 223 240 . . . 11 OO 2862 SMINT1 OOO 1030 295 415 . . . 2226 2934 SKMUS1000118O 224 3OO . . . 1076 2863 SMINT1 OOO118O 296 1176 . . . 1487 2935 US 2007/0015163 A1 Jan. 18, 2007 13

SMINT2OOOO18O 297 1466 . . . 1879 2936 TESTI2OOO1770 369 1209 . . . 2447 3008 SMINT2OOOO400 298 243 . . . 548 2937 TESTI2OOO1790 370 154 . . . 747 3009 SMINT2OOO1450 299 11 . . . 718 2938 TESTI2OOO1840 371 16 . . . 1962 3010 SMINT20002270 300 1427 . . . 1819 2939 TESTI2OOO2O70 372 1161 . . . 1631 3011 SMINT20002390 301 517 . . . 885 2940 TESTI2OOO2O8O 373 1784 . . . 2425 3012 SMINT20002770 3O2 22O . . . 1167 2941 TESTI2OOO238O 374 528 . . . 1859 3013 SMINT2OOO3960 303 S . . . 2851 2942 TESTI2OOO2530 375 289 . . . 1071 3O14 SMINT20004OOO 304 408 . . . 899 2943 TESTI2OOO3560 376 654 . . . 1013 3015 SMINT20005450 305 1001 . . . 1387 2944 TESTI2OOO3720 377 578 . . . 1144 3O16 SMINT2OOOSS80 306 17OO . . . 2029 2945 TESTI2OOO43SO 378 97 . . . 726 3017 SPLEN10000490 307 27 . . . 1364 2946 TESTI2OOO462O 379 916 . . . 1833 3.018 S 10000910 3O8 742 . . . 1347 2947 TESTI2OOO5200 380 192 . . . 1379 3019 S 10001430 309 165 . . . 695 2948 TESTI20005910 381 30 . . . 1469 3020 S 2OOOO2OO 310 1974 . . . 2282 2949 TESTI2OOO6OOO 382 645 . . . 1682 3021 S 2OOOO470 311 1030 . . . 1S60 2950 TESTI2OOO6270 383 72 . . . .2174 3022 SPLEN2OOOO720 312 808 . . . 1842 2.951 TESTI2OOO6710 384 334 . . . 645 3O23 SPLEN2OOO1340 313 61 ... 1146 2952 TESTI2OOO69SO 385 68 . . . .2012 3024 SPLEN2OOO1970 314 414... 1310 2953 TESTI2OOO6990 386 134 . . . 21 SS 3025 SPLEN2OOO242O 315 661 . . . 1191. 2954 TESTI2O007070 387 56 . . . 1084 3026 S 2OOO2430 316 344 . . . 763 2955 TESTI2OOO762O 388 125 . . .961 3027 S 2OOO2670 317 638 . . . s.3316 2956 TESTI2OOO7840 389 36 . . .3281 3028 SPLEN2OOO27OO 3.18 69 . . . 440 2957 TESTI2OOO8190 390 820 . . . 1236 3O29 SPLEN2OOO31OO 319 OO1 . . . 1321 2958 TESTI2O008300 391 323 . . . 1186 3O3O SPLEN2OOO3570 320 928. . . . 2322 2959 TESTI2OOO8490 392 59 . . . 1333 3O31 SPLEN2OOO4430 321 SO9 . . . 817 2960 TESTI2OOO8830 393 1131 . . . 1718 3O32 S 20004960 322 792. . . 2175 2961 TESTI2OOO9090 394 562 . . . 894 3O33 SPLEN2OOOS410 323 2... 824 2962 TESTI2OOO951O 395 225 . . . 1115 3O34 STOMA1 OOOO470 324 35 . . . S33 2963 TESTI2OOO9700 396 84 . . . 1628 3035 STOMA1 OOOOS2O 325 790 . . . 21.70 2964 TESTI2O010O8O 397 1565 . . . .2060 3O36 STOMA1 OOO1170 326 96 . . . 1818 296S TESTI2OO10490 398 730 . . . 2349 3037 STOMA1 OOO1330 327 410 . . . 1858 2966 TESTI2OO1082O 399 1609 . . . 1926 3O38 STOMA1 OOO1860 328 364 . . . 1476 2967 TESTI2OO11340 400 243 . . . 1346 3O39 STOMA2OOOO32O 329 943 . . . 1278 2968 TESTI2OO11410 401 425 . . . 2725 3040 STOMA2OOOO88O 330 825 . . . 2286 2969 TESTI2OO11800 402 228 . . . 1178 3O41 STOMA2OOO1210 331 96 . . . 1458 2970 TESTI2OO12370 403 257 . . . 2071 3O42 STOMA2OOO1880 332 O68 . . . 1757 2971 TESTI2OO12690 404 660 . . . 2603 3O43 STOMA2OOO2S70 333 429 . . . 746 2972 TESTI2OO13060 40S 125 . . . 427 3044 STOMA20002890 334 87 . . . 801 2973 TESTI2OO13300 406 22. . . .2563 3O45 STOMA2OOO3960 335 591 . . . 1748 2974 TESTI2OO13450 407 187 . . . 1917 3O46 STOMA2000478O 336 29 . . . SS4 2975 TESTI2OO13520 408 334 . . . 759 3047 STOMA2000482O 337 206 . . . 1228 2976 TESTI2OO1412O 409 185 . . . 1384 3048 SYNOV10OO1280 338 11 . . . 2084 2977 TESTI2OO14200 410 214 . . . 1299 3O49 SYNOV10OO1640 339 206 . . . 1033 2978 TESTI2OO15110 411 61 . . . 2058 3050 SYNOV2OOO1770 340 359 . . . 673 2979 TESTI2OO15120 412 S65 . . . 1287 3051 SYNOV20002910 341 O85 . . . 17SO 298O TESTI2OO15560 413 400 . . . 1326 3052 SYNOV2OOO82OO 342 461 . . . .2203 2981 TESTI2OO15930 414 1157 . . . 1468 3053 SYNOV2001 O140 343 72 . . . 458 2982 TESTI2OO16210 415 1121 . . . 1474 3054 SYNOV2OO11440 344 275 . . . 1468 2983 TESTI2OO16610 416 280 . . . 3345 3055 SYNOV20013740 345 47 . . . 1472 2984 TESTI2OO166SO 417 2190 . . . 2549 30S6 SYNOV2OO14510 346 89 . . .982 2985 TESTI2OO16710 418 1071 . . . 2003 3057 SYNOV2OO14570 347 488 . . . 1811 2986 TESTI2OO1758O 419 143 . . . 676 3058 SYNOV2OO16480 348 32 . . . 656 2987 TESTI2OO17660 420 317 . . . 652 3059 TESTI1 OOOO230 349 101 . . . 1415 2988 TESTI2OO1792O 421 84 . . . 890 3060 TESTI1 OOOO2SO 350 67 . . . 2032 2989 TESTI2OO181SO 422 815 . . . 1993 3061 TESTI1 OOOO42O 351 75 . . . 1863 2990 TESTI2OO18260 423 31 O . . . 1113 3062 OOOOS10 352 75 . . . 2297 2991 TESTI2OO1827O 424 19 . . . 1899 3063 OOOOSSO 353 46 . . . 1185 2992 TESTI2OO18290 425 337 . . . 21.56 3.064 OOOO640 3S4 O6 . . . 1950 2993 TESTI2OO1852O 426 46. . . 2211 306S OOOO700 355 225 . . . 2042 2994 TESTI2OO1862O 427 1355 . . . 1729 3066 OOOO960 356 274 . . . 978 2995 TESTI2OO18690 428 1178 . . . 2425 3067 OOO12SO 357 O27 . . . 1641 2996 TESTI2OO18790 429 481 . . . 1821 3068 OOO1270 358 208 . . . 1581 2997 TESTI2OO1898O 430 146 . . . 559 3069 OOO1310 359 38 . . . 1549 2998 TESTI2OO195OO 431 126 . . . 1403 3070 OOO1380 360 732 . . . 1868 2999 TESTI2OO1968O 432 1168 . . . 1509 3071 OOO1630 361 249 . . . 1298 3OOO TESTI2OO1991 O 433 345 . . . 1601 3072 OOO1680 362 134 . . . 1390 3OO1 TESTI2OO2OO2O 434 1547 . . . s.1884 3073 OOO1790 363 1577 . . . 1936 30O2 TESTI2OO2O480 435 2SS . . . S69 3.074 OOO1910 364 935 . . . 1786 3003 TESTI20020570 436 217 . . . 1317 3075 2OOOO18O 365 234 . . . 563 3004 TESTI2O020810 437 194 . . . 1498 3076 2OOOO440 366 166 . . . 2238 3005 TESTI2OO2O900 438 81 . . . 1547 3.077 2OOO1200 367 664 . . . 1059 3006 TESTI2O021050 439 68 . . . 2689 3078 2OOO1540 368 230 . . . 1684 3007 TESTI2OO21490 440 45 . . . 1814 3079 US 2007/0015163 A1 Jan. 18, 2007 14

20022230 441 205 . . . 783 3O8O TESTI2OO42430 513 1227 . . . 1535 3152 2002.2450 442 59 . . . 1333 3O81 TESTI2OO42870 S14 1697 . . . 2263 3153 20022S10 443 97 . . . 2217 3082 TESTI2OO429SO 515 187 . . . 1887 3154 20022560 444 17 . . . 24.94 3O83 TESTI2004712O S16 112 . . . 10O2 3155 20022640 445 260 . . . 913 3O84 TESTI2OO4929O 517 4O2 . . . 1226 3156 20022940 446 41 ... 469 3O85 TESTI2OO4982O S18 157 . . . 1875 3157 20023610 447 365 . . . 949 3O86 TESTI2OO49940 519 SO . . . SSO 3158 20023690 448 336 . . . 1160 3O87 TESTI2O051550 52O 79 . . . SO1 3159 200241SO 449 400 . . . 108O 3O88 TESTI2OOS268O 521 60 . . . 1247 3160 2002.4230 450 125 . . . 1339 3O89 TESTI2O053960 522 4O2 . . . 2522 31 61 20024610 451 181 . . . 1605 3090 TESTI2OOS408O 523 108 . . . 929 3.162 200246SO 452 45 . . . 1829 3091 TESTI2OOS4920 524 137 . . . S68 31.63 20024670 453 1375 . . . 1845 3092 TESTI2O055840 525 210... 1214 3164 2002.498O 454 261 . . . 1889 3093 TESTI2OO56900 526 124 . . . 1788 316S 20O2S160 455 133 . . . 1164 3094 TESTI2O057310 527 287 . . . .1853 3166 20O2S440 456 293 . . . 1819 3095 TESTI2O05742O 528 164 . . . 1636 3167 20O2S800 457 60 . . . 1022 3.096 TESTI2OOS86OO 529 430 . . . 1167 31.68 2002632O 458 31 . . . 414 3097 TESTI2OO6238O 530 719 . . . 1567 3169 20026760 459 830 . . . 1663 3098 TESTI2O062550 531 511 . . . 837 3170 2002698O 460 212 . . . 1354 3.099 TESTI2OO642SO 532 537 . . . 1436 3171 20027OOO 461 22. . . S73 31OO TESTI2OO64830 533 373 . . . 1614 3172 20027070 462 88 . . . 1410 3101 TESTI2OO6572O 534 222. .. 644 3173 20027290 463 158 . . . 1333 3102 TESTI2OO67740 535 382 . . . 1239 3174 20027890 464 104 . . . s.1506 3103 TESTI2OO68660 536 87 . . . 1337 3175 20O28060 465 1596 . . . 1970 3104 TESTI2OO6872O 537 378 . . . 1331 3176 200284.00 466 740 . . . 1066 3105 TESTI2OO6978O 538 31 O . . . 639 3177 20O28660 467 1111 . . . 1995 3106 TESTI2O069790 539 887 . . . 1189 31.78 2002912O 468 295 . . . 1920 3107 TESTI2007 1830 S4O 352 . . . 1176 3179 20O296SO 469 391 . . . 1446 3.108 TESTI2O073580 541 3 . . . 1394 318O 2003OOSO 470 21 . . . 800 3109 TESTI2OO74O2O S42 1097 . . . 1426 3181 2003O370 471 271 . . . 1368 31.10 TESTI2OO74640 543 204. . . c.1824 3182 20O30590 472 1028 . . . 1474 3111 TESTI2OO74660 544 124 . . . 1683 31.83 20030710 473 88 . . . 666 3112 TESTI2OO74800 545 81 . . . 2000 31.84 20030740 474 85 . . . 2055 31.13 TESTI20076130 S46 122. . . .2107 3.185 20031090 475 28 . . . .2O34 3114 TESTI2OO774.90 547 852. . . 1598 3186 20031170 476 188 . . . 1660 3115 TESTI2OO775OO S48 391 . . . 1722 31.87 2003.1300 477 157 . . . 2004 31.16 TESTI2OO78140 549 897 . . . 1400 3.188 2003 1520 478 150 . . . 1862 3117 TESTI2OO78640 550 287 . . . 802 31.89 20031930 479 474 . . . 1010 31.18 TESTI20078670 551 318 . . . 1952 3190 20031960 480 32 . . . s.1839 3119 TESTI2OO7872O 552 92 . . . 1309 3.191 20O3228O 481 189 . . . 560 312O TESTI2OO7951O 553 824 . . .3025 3.192 20032550 482 242 . . . 670 3121 TESTI2O080200 554 153 . . . 2429 31.93 20032800 483 1445 . . . 1873 3122 TESTI2008O330 555 72 . . . 497 3.194 20O32990 484 49. . . 411 3.123 TESTI2O081390 556 118 . . . 1839 3195 200332SO 485 98 . . . 2041 3124 TESTI20081440 557 147 . . . S45 3196 20033270 486 48 . . . 722 3125 TESTI2O082340 558 931 . . . 1419 31.97 20033540 487 311 . . . 1930 3126 TESTI2O082400 559 409 . . . 834 31.98 20033560 488 193 . . . 1296 3127 TESTI20083430 S60 157 . . . 2979 31.99 20033760 489 294 . . . 659 3128 TESTI2O083870 S61 31 . . . SS2 3200 20O34130 490 109. . . . 2444 3129 TESTI2OO844OO S62 1749 . . . 2078 32O1 20O3418O 491 1113 . . . 1484 3130 TESTI2O086570 563 246 . . . 1289 32O2 20O34190 492 120 . . . 1520 3131 TESTI2O087740 S64 14 . . . 1900 32O3 20O3498O 493 26S . . . 1185 3132 TESTI2OO88470 565 362 ... 757 3204 20O3S120 494 321 . . . 2585 3133 TESTI2O136910 566 1667 . . . 2026 3205 20O3S410 495 735 . . . 1208 3134 TESTI2O13832O 567 98 . . . 1060 32O6 20035510 496 734 . . . 1741 3135 TESTI2O140360 568 831. . . . 1349 32O7 20035740 497 41 . . . 1651 3136 TESTI2O1774OO 569 70 . . . 1584 3208 20O3S800 498 1263 . . . 1583 3137 TESTI3000002O 570 97 . . . 1914 3209 20035890 499 206 . . . 1507 3138 THYMU1OOOOO2O 571 286 . . . 1131 3210 200362SO 500 45 . . . 2216 3139 THYMU1OOOO32O 572 1299 . . . 1691 3211 20036490 5O1 88 . . . 459 3140 THYMU1OOOO830 573 1169 . . . 1936 3212 20037270 502 33 . . . 1391 3141 THYMU1OOO1OSO 574 632 . . . 934 3213 20O37810 503 128 . . . 520 3142 THYMU1OOO1760 575 1 . . . 492 3214 20038940 SO4 1166 . . . 1630 3143 THYMU10002910 576 1598 . . . 2026 3215 20O39140 505 73 . . . 1530 3.144 THYMU1OOO3290 577 22. . . 534 3216 20039980 SO6 2 . . . 514 3.145 THYMU10003590 578 743 . . . 2005 3217 2004OOOO 507 291 . . . 881 3.146 THYMU1OOO3660 579 1749 . . . 2084 3.218 2004O310 SO8 126 . . . 1463 3147 THYMU1000382O S8O 1242 . . . 1601 3219 20041110 509 143 . . . SO2 3148 THYMU10004590 581 594 . . . 1142 3220 20041220 510 33 . . . 1703 3149 THYMU10004730 582 421. . . . 735 3221 20042070 511 95 . . . 1903 3150 THYMU10004910 583 3.01 . . . 1119 3222 20042290 512 647 . . . 1711 3151 THYMU10005270 S84 1706 . . . 2057 3223 US 2007/0015163 A1 Jan. 18, 2007

Molecular Biology, Ausubel et al. edit, (1987) John Wiley & TABLE 1-continued Sons, Section 6.1-6.4). In designing a primer based on the 5'-end sequence, the primer is designed so as that, in SEQ ID NO. SEQ ID NO. principle, the amplification products will include the trans Clone of nucleotide Position of amino acid lation start site. Accordingly, for example, when the 5'-end l8le SeleCe. of CDS Sequence primer is designed based on the nucleotide sequence of 5' THYMU1000558O 585 896 . . . 1819 3224 THYMU2OOO1400 S86 42 . . . 410 3225 untranslated region (5' UTR), any part of the 5'-end, which THYMU2OOO2360 587 2 . . .385 3226 ensures the specificity to the cDNA of interest, can be THYMU20003170 S88 703 . . . 1041 3227 selected as the primer. THYMU2OOO3690 589 328 . . . 1782 3228 TRACEH10OOO18O 590 63 . . . 1205 3229 0038. When synthesizing a full-length cDNA, the target TRACEH10OOO3OO 591 384 . . . 902 3230 nucleotide sequence to be amplified can extend to several TRACEH10OOOS70 592 722. . . 1039 3231 thousand bp in some clNA. However, it is possible to TRACEH10OOO630 593 431 . . . 1372 3232 TRACEH10OOO740 594 80 . . . 1672 3233 amplify Such a long nucleotides by using Such as LA PCR TRACEH10OO1OOO 595 81 . . . 660 3234 (Long and Accurate PCR). It is advantageous to use LAPCR TRACEH10OO1060 596 744 . . . 1121 3235 when synthesizing long DNA. In LA PCR, in which a TRACEH10OO12SO 597 21 . . . 1610 3236 special DNA polymerase having 3'->5' exonuclease activity TRACEH10OO1400 598 266 . . . 622 3237 TRACEH2OOOO150 599 3O3 ... 1755 3238 is used, misincorporated nucleotides can be removed. TRACEH2OOOO790 600 47 . . .385 3239 Accordingly, accurate synthesis of the complementary TRACEH2OOO1850 6O1 9 . . . 7SO 3240 Strand can be achieved even with a long nucleotide TRACEH2OOO1960 6O2 44 . . .974 3241 sequence. By using LAPCR, it is reported that amplification TRACEH2OOO23SO 603 123 . . . 1437 3242 TRACEH2OOO2370 604 97 . . . 1471 3243 of a nucleotide with 20 kb longer can be achieved under TRACEH2OOO2SOO 60S 2O . . . 1682 3244 desirable conditions (Takeshi Hayashi (1996) Jikken-Igaku TRACEH2OOO2890 606 895 . . . 2022 3.245 Bessatsu, “Advanced Technologies in PCR' Youdo-sha). TRACEH2OOO3930 607 403 . . . s2562 3246 TRACEH2OOO4110 608 SO . . . 1844 3247 0039. A template DNA for synthesizing the full-length TRACEH2OOO42OO 609 80 . . . .2895 3248 cDNA of the present invention can be obtained by using TRACEH2OOO4610 610 498 . . . 2084 3249 TRACEH2OOO472O 611 435 . . . 1940 3250 cDNA libraries that are prepared by various methods. The TRACEH2OOO4960 612 15 . . . 1842 3251 full-length cDNA clones of the present invention are clones TRACEH2OOO4970 613 O83 . . . 1517 3252 with high probability of completeness in length, which were TRACEH2OOO66SO 614 208 . . . 1866 3253 obtained by the method comprising the steps of 1 prepar TRACEH2OOO67SO 615 232 . . . 1200 3254 ing libraries containing cDNAs with the very high fullness TRACEH2OOO7670 616 147 . . . 1452 3255 TRACEH2OOO7800 617 492 . . . 1937 32S6 ratio by oligo-capping, and 2 assembling the 5'-end TRACEH2OOO8940 618 701 . . . 1957 3257 sequences and selecting one with the highest probability of TRACEH2OOO898O 619 350 . . . 661 3258 completeness in length in the cluster formed (there are many TRACEH2OOO9260 62O 75 . . . 770 3259 TRACEH2OOO9440 621 879 . . . 1235 3260 clones longer in the 5'-end direction). TRACEH2OO11920 622 530 . . . s2O34 3261 0040. However, the uses of primers designed based on TRACEH2OO12890 623 143 . . . 715 3262 TRACEH2OO13950 624 1697 . . . 26O2 3263 the full-length nucleotide sequences provided by the present TRACEH2OO14000 625 1626 . . . 1949 3264 invention enable easily obtaining full-length cDNAs without TRACEH2OO15920 626 569 . . . 877 326S Such a special technique. TRACEH2OO16O70 627 484 . . . 1176 3266 UMVEN1OOO1220 628 698 . . . 1339 3267 0041) The problem with the cDNA libraries prepared by UMVEN2OOO1330 629 164. . . 2242 3268 the known methods or commercially available is that mRNA UTERU10000770 630 2074 . . . 2418 3269 UTERU1OOOO960 631 952 . . . 1593 3270 contained in the libraries has very low fullness ratio. Thus, UTERU1OOO1600 632 527 . . . 1747 3271 it is difficult to screen full-length cDNA clone directly from UTERU1OOO1920 633 112 . . . 474 3272 the library using ordinary cloning methods. The present UTERU2OOOO470 634 1691 . . . .2197 3273 invention has revealed a nucleotide sequence of novel UTERU2OOO3380 635 130 . . . 816 3274 full-length cDNA. If a full-length nucleotide sequence is UTERU2OOO3930 636 514 . . . 1101 3275 UTERU2OOO48SO 637 385 . . . 732 3.276 provided, it is possible to synthesize a target full-length UTERU2OOOS410 638 432 . . . 800 3.277 cDNA by using enzymatic reactions such as PCR. In par UTERU2OOOS690 639 217 . . . 1899 3278 ticular, a full-length-enriched cDNA library, synthesized by methods such as oligo-capping, is desirable to synthesize a full-length cDNA with more reliability. 0.036 Namely, primers used to synthesize polynucle otides can be designed based on the nucleotide sequences of 0042. The 5'-end sequence of the full-length cDNA polynucleotides of the present invention shown in SEQ ID clones of the invention can be used to isolate the regulatory NOs in the above Table 1. When one intends to synthesize element of transcription including the promoter on the full-length cDNAs, an oligo dT primer can be used as the genome. A rough draft of the human genome (analysis of 3'-end primer. The length of the primers is usually 15-100 human genomic sequence with lower accuracy), which bp, and favorably between 15-35 bp. In case of LA PCR, covers 90% of the genome, has been reported (Nature, Vol. which is described below, the primer length of 25-35bp may 409,814-823, 2001), and by the year 2003, analysis of the provide a good result. entire human genomic sequence is going to be finished. However, it is hard to analyze with software the transcription 0037. A method to design a primer that enables a specific start sites on the human genome, in which long introns exist. amplification based on the aimed nucleotide sequence is By contrast, it is easy to specify the transcription start site on known to those skilled in the art (Current Protocols in the genomic sequence using the nucleotide sequence which US 2007/0015163 A1 Jan. 18, 2007

includes the 5'-end of the full-length cDNA clone of the similar property to that of the original amino acid. For present invention, and thus it is easy to obtain the genomic example, Ala, Val, Leu, Ile, Pro, Met, Phe and Trp are region involved in transcription regulation, which includes assumed to have similar properties to one another because the promoter that is contained in the upstream of the they are all classified into a group of non-polar amino acids. transcription start site. Similarly, Substitution can be performed among non-charged 0043. The polypeptide encoded by the full-length cDNA amino acid Such as Gly, Ser, Thr, Cys, Tyr, ASn, and Gln, of the invention can be prepared as a recombinant polypep acidic amino acids such as Asp and Glu, and basic amino tide or as a natural polypeptide. For example, the recombi acids such as LyS, Arg, and His. nant polypeptide can be prepared by inserting the polynucle 0048. In addition, polypeptides functionally equivalent to otide encoding the polypeptide of the invention into a vector, the polypeptides of the present invention can be isolated by introducing the vector into an appropriate host cell and using techniques of hybridization or gene amplification purifying the polypeptide expressed within the transformed known to those skilled in the art. Specifically, using the host cell, as described below. In contrast, the natural hybridization technique (Current Protocols in Molecular polypeptide can be prepared, for example, by utilizing an Biology, edit, Ausubel et al., (1987) John Wiley & Sons, affinity column to which an antibody against the polypeptide Section 6.3-6.4)), those skilled in the art can usually isolate of the invention (Current Protocols in Molecular Biology a polynucleotide highly homologous to the polynucleotide (1987) Ausubel et al. edit, John Wiley & Sons, Section encoding the polypeptide identified in the present Example 16.1-16.19) is attached. The antibody used for affinity puri based on the identified nucleotide sequence (Table 1) or a fication may be either a polyclonal antibody, or a mono portion thereof and obtain the functionally equivalent clonal antibody. Alternatively, in vitro translation (See, for polypeptide from the isolated polynucleotide. The present example, “On the fidelity of mRNA translation in the invention include polypeptides encoded by the polynucle nuclease-treated rabbit reticulocyte lysate system.” Dasso otides hybridizing with the polynucleotides encoding the M. C., and Jackson R. J. (1989) Nucleic Acids Res. 17: polypeptides identified in the present Example, as long as 3129-3144) may be used for preparing the polypeptide of the the polypeptides are functionally equivalent to the polypep invention. tides identified in the present Example. Organisms from 0044 Polypeptides functionally equivalent to the which the functionally equivalent polypeptides are isolated polypeptides of the present invention can be prepared based are illustrated by vertebrates such as human, mouse, rat, on the activities, which were clarified in the above-men rabbit, pig and bovine, but are not limited to these animals. tioned manner, of the polypeptides of the present invention. 0049 Washing conditions of hybridization for the isola Using the biological activity possessed by the polypeptide of tion of polynucleotides encoding the functionally equivalent the invention as an index, it is possible to verify whether or polypeptides are usually “1xSSC, 0.1% SDS, 37°C.'; more not a particular polypeptide is functionally equivalent to the stringent conditions are “0.5xSSC, 0.1% SDS, 42°C.'; and polypeptide of the invention by examining whether or not still more stringent conditions are “0.1xSSC, 0.1% SDS, 65° the polypeptide has said activity. C.'. Alternatively, the following conditions can be given as hybridization conditions of the present invention. Namely, 0045 Polypeptides functionally equivalent to the conditions in which the hybridization is done at “6xSSC, polypeptides of the present invention can be prepared by 40% Formamide, 25°C., and the washing at “1xSSC, 55° those skilled in the art, for example, by using a method for C. can be given. More preferable conditions are those in introducing mutations into an amino acid sequence of a which the hybridization is done at “6xSSC, 40% Forma polypeptide (for example, site-directed mutagenesis (Cur mide, 37° C.”, and the washing at “0.2xSSC, 55° C.”. Even rent Protocols in Molecular Biology, edit, Ausubel et al., more preferable are those in which the hybridization is done (1987) John Wiley & Sons, Section 8.1-8.5) Besides, such at “6xSSC, 50% Formamide, 37° C., and the washing at polypeptides can be generated by spontaneous mutations. “0.1xSSC, 62° C.'. The more stringent the conditions of The present invention also includes a polypeptide compris hybridization are, the more frequently the polynucleotides ing the amino acid sequence shown in Table 1 in which one highly homologous to the probe sequence are isolated. or more amino acids are Substituted, deleted, inserted, and/or Therefore, it is preferable to conduct hybridization under added, as long as the polypeptides have the equivalent stringent conditions. Examples of stringent conditions in the functions to those of the polypeptides identified in the present invention are, washing conditions of "0.5xSSC, present Examples described later. 0.1% SDS, 42° C., or alternatively, hybridization condi 0046) There are no limitations on the number and sites of tions of “6xSSC, 40% Formamide, 37°C., and the washing amino acid mutations, as long as the polypeptides maintain at “0.2xSSC, 55° C.”. the functions thereof. The number of mutations typically 0050. One skilled in the art can suitably select various corresponds to 30% or less, or 20% or less, or 10% or less, conditions, such as dilution ratios of SSC, formamide con preferably 5% or less, or 3% or less of the total amino acids, centrations, and temperatures to accomplish a similar strin more preferably 2% or less or 1% or less of the total amino gency. acids. Alternatively, herein, Substitution of one or more 0051. However, the above-mentioned combinations of amino acids includes Substitution of several amino acids. As SSC, SDS and temperature conditions are indicated just as used herein, the term “several amino acids’ means, for examples. Those skilled in the art can select the hybridiza example, 5 amino acids, preferably 4 or 3 amino acids, more tion conditions with similar stringency to those mentioned preferably 2 amino acids, and further preferably 1 amino above by properly combining the above-mentioned or other acid. factors (for example, probe concentration, probe length and 0047. From the viewpoint of maintaining the polypeptide duration of hybridization reaction) that determines the strin function, it is preferable that a Substituted amino acid has a gency of hybridization. US 2007/0015163 A1 Jan. 18, 2007

0.052 The amino acid sequences of polypeptides isolated 0057. Furthermore, polynucleotides of the present inven by using the hybridization techniques usually have high tion include an antisense polynucleotide for Suppressing the identity to those of the polypeptides of the present invention, expression of a polypeptide of the invention, which com which are shown in Table 1. The present invention encom prises an amino acid sequence of SEQ ID NOS shown in passes a polynucleotide comprising a nucleotide sequence Table 1. To exert an antisense effect, an antisense polynucle that has a high identity to the nucleotide sequence of claim otide has at least 15bp or more, for example 50 bp or more, 1 (a). Furthermore, the present invention encompasses a preferably 100 bp or more, and more preferably 500 bp or peptide, or polypeptide comprising an amino acid sequence more, and usually has 3000 bp or less, and preferably 2000 that has a high identity to the amino acid sequence encoded bp or less. Antisense polynucleotides can be used in the gene by the polynucleotide of claim 1 (b). The term “high therapy of diseases caused by abnormalities of the polypep identity” indicates sequence identity of at least 40% or more; tides of the invention (abnormal function or abnormal preferably 60% or more; and more preferably 70% or more. expression). An antisense polynucleotide can be prepared, Alternatively, more preferable is identity of 90% or more, or for example, by the phosphorothioate method (“Physico 93% or more, or 95% or more, furthermore, 97% or more, chemical properties of phosphorothioate oligodeoxynucle or 99% or more. The identity can be determined by using the otides.” Stein (1988) Nucleic Acids Res. 16: 3209-3221) BLAST search algorithm. based on the sequence information of polynucleotide encod ing a polypeptide of the invention (for example, the nucle 0053 As used herein, “percent identity” of amino acid sequences or nucleic acids is determined using the algorithm otide sequences of SEQ ID NO: 1 to 1639). BLAST of Karlin and Altschul (Proc. Natl. Acad. Sci. USA 0058. The polynucleotides or antisense polynucleotides 90:5873-5877, 1993). Such an algorithm is incorporated into of the present invention can be used in, for example, gene the BLASTN and BLASTX programs of Altschul et al. (J. therapy. AS target diseases, for example, cancers or various Mol. Biol. 215:403-410, 1990). BLAST nucleotide searches inflammatory diseases may be preferable. These molecules are performed with the BLASTN program, for example, can be used for gene therapy, for example, by administrating score=100, wordlength=12. BLAST protein searches are them to patients by the in vivo or ex vivo method using virus performed with the BLASTX program, for example, score= vectors such as retrovirus vectors, adenovirus vectors, and 50, wordlength=3. When utilizing BLAST and Gapped adeno-related virus vectors, or non-virus vectors such as BLAST programs, the default parameters of the respective liposomes. programs are used. See http://www.ncbi.nlm.nih.gov. 0059) The present invention also includes a partial pep 0054 With the gene amplification technique (PCR) (Cur tide of the polypeptides of the invention. The partial peptide rent Protocols in Molecular Biology, edit, Ausubel et al., comprises a polypeptide generated as a result that a signal (1987) John Wiley & Sons, Section 6.1-6.4)) using primers peptide has been removed from a secretory protein. If the designed based on the nucleotide sequence (Table 1) or a polypeptide of the present invention has an activity as a portion thereof identified in the present Example, it is receptor or a ligand, the partial peptide may function as a possible to isolate a polynucleotide fragment highly homolo competitive inhibitor of the polypeptide and may bind to the gous to the polynucleotide sequence or a portion thereof and receptor (or ligand). In addition, the present invention to obtain functionally equivalent polypeptide to a particular includes an antigen peptide for raising antibodies. For the polypeptide identified in the present Example based on the peptides to be specific for the polypeptide of the invention, isolated polynucleotide fragment. the peptides comprise at least 7 amino acids, preferably 8 amino acids or more, more preferably 9 amino acids or 0.055 The present invention also provides a polynucle more, and even more preferably 10 amino acids or more. otide containing at least 15 nucleotides complementary to a The peptide can be used for preparing antibodies against the polynucleotide comprising a nucleotide sequence of SEQID polypeptide of the invention, or competitive inhibitors of NOs shown in Table 1 or the complementary strand thereof. them, and also screening for a receptor that binds to the Herein, the term “complementary strand is defined as one polypeptide of the invention. The partial peptides of the strand of a double strand DNA composed of A:T and G:C invention can be produced, for example, by genetic engi base pair to the other strand. Also, “complementary' is neering methods, known methods for synthesizing peptides, defined as not only those completely matching within a or digesting the polypeptide of the invention with an appro continuous region of at least 15 nucleotides, but also having priate peptidase. a identity of at least 70%, favorably 80% or higher, more favorably 90% or higher, and most favorably 95% or higher 0060. The present invention also relates to a vector into within that region. The identity may be determined using the which a polynucleotide of the invention is inserted. The vector of the invention is not limited as long as it contains algorithm described herein. the inserted polynucleotide stably. For example, if E. coli is 0056 Such a polynucleotide includes probes and primers used as a host, vectors such as pBluescript vector (Strat used for the detection and amplification of a polynucleotide agene) are preferable as a cloning vector. To produce the encoding the inventive polypeptide. When used as a primer, polypeptide of the invention, expression vectors are espe the polynucleotide usually comprises 15 to 100 bp, and cially useful. Any expression vector can be used as long as preferably of 15 to 35 bp. When used as a probe, the it is capable of expressing the polypeptide in vitro, in E. coli, polynucleotide comprises the whole or a part of the in cultured cells, or in vivo. For example, pBEST vector sequence of a polynucleotide of the invention, and com (Promega) is preferable for in vitro expression, pFT vector prises at least 15bp. When used as primers, such polynucle (Invitrogen) for E. coli, pME 18S-FL3 vector (GenBank otides are complementary at the 3'-end, and restriction Accession No. AB009864) for cultured cells, and pME18S enzyme recognition sequences or tags can be added to the vector (Mol. Cell. Biol. (1988) 8: 466-472) for in vivo 5'-end. expression. To insert the polynucleotide of the invention, US 2007/0015163 A1 Jan. 18, 2007 ligation utilizing restriction sites can be performed accord sequencing. Especially, in the case where expression of the ing to the standard method (Current Protocols in Molecular mRNA of the present invention varies according to a specific Biology (1987) Ausubel et al. edit, John Wiley & Sons, disease, analysis of the amount of expression of the mRNA Section 11.4-11.11). using the polynucleotide of the present invention as a probe 0061 Recently, the technique of GATEWAYTM system or a primer enables detection and diagnosis of the disease. (Invitrogen), which is an expression vector construction 0066. The present invention also relates to antibodies that system for polypeptide expression, has been developed bind to the polypeptide of the invention. There are no (Experimental Medicine, Vol. 18, No. 19 (December), limitations in the form of the antibodies of the invention. p2716-2717, 2000). This system includes two types of They include polyclonal antibodies, monoclonal antibodies, site-specific recombinases (BPCLONASETM and LRCLO or their portions that can bind to an antigen. They also NASETM) derived from lambda phage and uses BP CLO include antibodies of all classes. Furthermore, special anti NASETM-specific recombination sites for an Entry Vector bodies such as humanized antibodies and chimeric antibod and LR CLONASETM-specific recombination sites for a ies are also included. Destination Vector, which may comprise a tag useful for 0067. The polyclonal antibody of the invention can be polypeptide purification. With this system, an expression obtained according to the standard method by Synthesizing vector can be obtained by using homologous recombination. an oligopeptide corresponding to the amino acid sequence 0062 First, a polynucleotide fragment of interest is and immunizing rabbits with the peptide (Current Protocols inserted into the entry vector using the first recombination. in Molecular Biology (1987) Ausubel et al. edit, John Wiley Then, the secondary recombination is allowed to take place & Sons, Section 11.12-11.13). The monoclonal antibody of between the entry vector, where the polynucleotide fragment the invention can be obtained according to the standard of interest has been inserted, and the destination vector. method by purifying the polypeptide expressed in E. coli, Thus, the expression vector can be prepared rapidly and immunizing mice with the polypeptide, and producing a highly efficiently. With the above-mentioned typical method hybridoma cell by fusing the spleen cells and myeloma cells using restriction enzyme and ligase reactions, the step of (Current Protocols in Molecular Biology (1987) Ausubel et expression vector construction and expression of polypep al. edit, John Wiley & Sons, Section 11.4-11.11). tide of interest takes about 7 to 10 days. However, with the GATEWAYTM system, the polypeptide of interest can be 0068 The antibody binding to the polypeptide of the expressed and prepared in only 3 to 4 days. Thus, the system present invention can be used for purification of the ensures a high-throughput functional analysis for expressed polypeptide of the invention, and also for detection and/or polypeptides (http://biotech.nikkeibp.co.jp/netlink/lto/gate diagnosis of the abnormalities of the expression and struc way/). ture of the polypeptide. Specifically, polypeptides can be extracted, for example, from tissues, blood, or cells, and the 0063. The present invention also relates to a transformant polypeptide of the invention is detected by Western blotting, carrying the vector of the invention. Any cell can be used as immunoprecipitation, or ELISA, etc. for the above purpose. a host into which the vector of the invention is inserted, and various kinds of host cells can be used depending on the 0069. Furthermore, the antibody binding to the polypep purposes. For strong expression of the polypeptide in tide of the present invention can be utilized for treating the eukaryotic cells, COS cells or CHO cells can be used, for diseases that associates with the polypeptide of the inven example. tion. If the antibodies are used for treating patients, human antibodies, humanized antibodies, or chimeric antibodies are 0064 Introduction of the vector into host cells can be preferable in terms of their low antigenicity. The human performed, for example, by calcium phosphate precipitation antibodies can be prepared by immunizing a mouse whose method, electroporation method (Current Protocols in immune system is replaced with that of human (e.g., see Molecular Biology (1987) Ausubel et al. edit, John Wiley & "Functional transplant of megabase human immunoglobulin Sons, Section 9.1-9.9), lipofectamine method (GIBCO loci recapitulates human antibody response in mice' Men BRL), or microinjection method, etc. dez, M. J. et al. (1997) Nat. Genet. 15: 146-156). The 0065. Further, a polynucleotide containing at least 15 humanized antibodies can be prepared by recombination of nucleotides comprising a nucleotide sequence of any one of the hypervariable region of a monoclonal antibody (Methods the polynucleotides comprising the nucleotide sequences of in Enzymology (1991) 203:99-121). SEQID NOS shown in Table 1 or the complementary strand 0070 The use of the amino acid sequences of the thereof can be used not only as a primer for synthesizing polypeptides encoded by the cDNAs of the present invention full-length cDNAS but also for testing and diagnosing the enables predicting that the polypeptides have the following abnormalities of the polypeptide encoded by the full-length functions. It can be predict, from the results of homology cDNA of the present invention. For example, by utilizing search of SwissProt, GenBank, UniGene, or nr., that these polymerase chain reaction (genomic DNA-PCR, or RT polypeptides have Such functions. Specifically, for instance, PCR) using the polynucleotide of the invention as a primer, as shown in Examples, searching for a known gene or polynucleotide encoding the polypeptide of the invention polypeptide that is homologous to the partial sequence of the can be amplified. It is also possible to obtain the regulatory full-length cDNA of the invention (1639 clone) and referring region of expression in the 5'-upstream by using PCR or the function of the gene and of the polypeptide encoded by hybridization since the transcription start site within the the gene make it possible to predict the function of the genomic sequence can be easily specified based on the polypeptide encoded by the cDNA of the invention. In this 5'-end sequence of the full-length cDNA. The obtained way, each of 892 clones out of the 1639 full-length cDNA genomic region can be used for detection and/or diagnosis of clones of the invention was predicted to encode a polypep the abnormality of the sequence by RFLP analysis, SSCP, or tide that was classified into the following categories. US 2007/0015163 A1 Jan. 18, 2007

0071) Secretory and/or membrane protein (439 clones) 0087 GenBank, Swiss-Prot, UniGene and nr databases were searched for homologies of the full-length nucleotide 0072) Glycoprotein-related protein (87 clones) sequences of the 1639 clones (see Example 6). The amino 0073) Signal transduction-related protein (46 clones) acid sequences deduced from the full-length nucleotide sequences were searched for functional domains by PSORT, 0074) Transcription-related protein (140 clones) SOSUI and Pfam. Prediction of functions of polypeptides 0075) Disease-related protein (219 clones) encoded by the clones and the categorization thereof were performed based on these results obtained. The categoriza 0076) Enzyme and/or metabolism-related protein (168 tion was carried out by the following method. clones) 0088 1. Firstly, the cDNA clones were classified into the 0.077 Cell division- and/or cell proliferation-related pro above-mentioned 14 functional categories based on the tein (23 clones) results of annotation-based categorization (using the key 0078 Cytoskeleton-related protein (60 clones) words in the case of Swiss-Prot hit data; using Definition or Reference information in the case of GenBank, UniGene, or 0079 Nuclear protein and/or RNA synthesis-related pro nr hit data), and the signal sequence search of the deduced tein (59 clones) ORFs by PSORT and the transmembrane region search by 0080 Protein synthesis- and/or transport-related protein SOSUI. (24 clones) 0089 2 Secondly, clones which had been unassignable 0081 Cellular defense-related protein (6 clones) to the categories by the method of 1 were searched for functional domains and/or motifs by Pfam. Based on the 0082 Development and/or differentiation-related protein results, the clones were additionally classified into the (19 clones) above-mentioned 14 types of categories when they had a functional domain and/or motif assignable to any one of the 0083) DNA- and/or RNA-binding protein (158 clones) categories. 0084 ATP- and/or GTP-binding protein (63 clones) 0090 The following 439 clones presumably belong to 0085. The functions of the polypeptides encoded by the secretory and/or membrane proteins. cDNAs of the present invention can be predicted by assess ing the presence of signal sequence, transmembrane region, 0091 3NB6910000180, 3NB6910000850, nuclear translocation signal, glycosylation signal, phospho 3NB6920000290, 3NB6920003300, 3NB6920005450, rylation site, and Zinc finger motif, SH3 domain, etc. in the 3NB6920010020, ADRGL10000180, ADRGL10001600, amino acid sequences. The programs, PSORT (Nakai K. ADRGL20003230, BGGI120010970, BNGH410000340, and Kanehisa M. (1992) Genomics 14: 897-911), SOSUI BNGH410001040, BNGH410001180, BNGH410001370, (Hirokawa T. et al. (1998) Bioinformatics 14: 378-379) BNGH410001980, BRACE 10000730, BRACE10001690, (Mitsui Knowledge Industry), and MEMSAT (Jones D. T., BRACE20002800, BRACE20007180, BRACE2001 0650, Taylor W. R., and Thornton J. M. (1994) Biochemistry 33: BRACE20011170, BRACE20011430, BRACE20013400, 3038-3049) can be used to predict the existence of the signal BRACE20013520, BRACE20014230, BRACE20014530, sequence or transmembrane region. Alternatively, a partial BRACE20014920, BRACE20015080, BRACE20018590, amino acid sequence of the polypeptide is fused with BRACE20022270, BRACE20024680, BRACE20026350, another polypeptide such as GFP, the fusion polypeptide is BRACE20026850, BRACE20030780, BRACE20031100, transfected into cultured cells, and the localization is ana BRACE20034490, BRACE20071380, BRACE2007 1970, lyzed to predict the function of the original polypeptide. BRACE20072810, BRACE20074010, BRACE2007.4470, BRACE20075020, BRACE20075380, BRACE20076410, 0.086 Based on the determined nucleotide sequences of BRACE20076630, BRACE20076850, BRACE20077610, the full-length cDNAs obtained in the present invention, it BRACE20077640, BRACE20077980, BRACE20078680, is possible to predict more detailed functions of the polypep BRACE20079530, BRACE20084430, BRACE20086550, tides encoded by the cDNA clones, for example, by search BRACE20089600, BRACE2009 1880, BRAWH10000010, ing the databases such as GenBank, Swiss-Prot, UniGene, BRAWH10000370, BRAWH10000940, and nr for homologies of the cDNAs; or by searching the BRAWH10001620, BRAWH10001800, amino acid sequences deduced from the full-length cDNAs BRAWH20001090, BRAWH20004430, for signal sequences by using software programs such as BRAWH20006970, BRAWH20009840, PSORT, for transmembrane regions by using software pro BRAWH2001 1290, BRAWH20011410, BRAWH20011660, grams such as SOSUI or for motifs by using software BRAWH20014380, BRAWH20014840, programs such as Pfam (http://www.sanger.ac.uk/Software/ BRAWH20015030, BRAWH20036930, Pfam/index.shtml) and PROSITE (http://www.expasy.ch/ BRAWH20038320, BRAWH2004.0950, prosite?). As a matter of course, the functions are often BRAWH20052250, BRAWH20059980, predictable by using partial sequence information (prefer BRAWH20087060, BRAWH20092610, CD34C20000510, ably 300 nucleotides or more) instead of the full-length CTONG20013660, CTONG20015330, CTONG20028160, nucleotide sequences. However, the result of the prediction CTONG20037820, CTONG20047160, DFNES20003350, by using partial nucleotide sequence does not always agree FCBBF10006180, FCBBF10006750, FCBBF20005910, with the result obtained by using full-length nucleotide FCBBF20007330, FCBBF20008150, FCBBF20009400, sequence, and thus, it is needless to say that the prediction FCBBF20015380, FEBRA20003780, FEBRA20004040, of function is preferably performed based on the full-length FEBRA20004150, FEBRA20004520, FEBRA20004910, nucleotide sequences. FEBRA20006560, FEBRA20006900, FEBRA20007330, US 2007/0015163 A1 Jan. 18, 2007 20

FEBRA20008090, FEBRA20008800, FEBRA20010930, NTONG10000980, NTONG10002140, NTONG10002570, FEBRA20012270, FEBRA2001 2450, FEBRA20012940, NTONG20002650, NTONG20004920, NTONG20008000, FEBRA20013510, FEBRA20014870, FEBRA20014920, NTONG20012220, OCBBF10000420, OCBBF20002310, FEBRA20015840, FEBRA20020860, FEBRA20021910, OCBBF20009980, OCBBF20012100, PANCR10000210, FEBRA20025250, FEBRA2003 1550, FEBRA20037070, PLACE50000670, PLACE50000680, PLACE50001050, FEBRA20041100, FEBRA20041910, FEBRA20057780, PLACE50001130, PLACE60012810, PLACE60018860, FEBRA20063150, FEBRA20066670, FEBRA20067930, PLACE6002.0160, PLACE60020840, PLACE60026990, HCASM10000610, HCASM20002020, HEART20000990, PLACE60037050, PLACE60037450, PLACE60043960, HEART20004920, HHDPC20000950, HLUNG10000240, PLACE60044540, PLACE60047380, PLACE60049930, PLACE60050290, PROST10002200, PROST10002720, HLUNG10000370, HLUNG10001100, HLUNG20001160, PROST10005260, PROST10005360, PROST20000360, HLUNG2000 1250, HLUNG20001420, HLUNG20001760, PROST20026820, PROST20029600, PROST20032320, HLUNG20002550, HSYRA20003470, HSYRA20006290, PROST20033020, PROST20039220, PROST20044160, HSYRA20008280, HSYRA20011030, HSYRA20013320, PROST20051430, PROST20054260, PROST20058800, HSYRA20014200, HSYRA20015800, IMR3210000440, PROST200591.90, PROST20059430, PROST20069.880, IMR3210001580, IMR3210002660, IMR3220007750, PROST20072370, PROST20073890, PUAEN10000570, IMR3220008590, IMR3220009840, IMR3220014350, PUAEN10003220, SALGL10001570, SKMUS20007740, KIDNE10000080, KIDNE10001040, KIDNE10001430, SKNMC10000190, SKNMC10000290, SKNMC10002290, KIDNE20000700, KIDNE20000850, KIDNE20001670, SKNMC10002510, SKNMC20011130, SKNMC20015030, KIDNE20003150, KIDNE20003300, KIDNE20003490, SMINT10000160, SMINT10000420, SMINT10000570, KIDNE20004220, KIDNE20005170, KIDNE20005190, SMINT10001180, SMINT20000180, SMINT20002770, KIDNE20033050, KIDNE20033570, KIDNE200394.10, SPLEN10000910, SPLEN20001340, SPLEN20002430, KIDNE20042620, KIDNE20042950, KIDNE2004.4110, SPLEN20002700, SPLEN20003100, SPLEN20004960, KIDNE2004.8280, KIDNE20049810, KIDNE20054000, STOMA10000520, STOMA10001170, STOMA20000320, KIDNE20054770, KIDNE20060530, KIDNE20060620, STOMA20002570, SYNOV20001770, SYNOV20016480, KIDNE20063530, KIDNE20063760, KIDNE20066520, TESTI10000420, TESTI10000960, TESTI10001270, KIDNE20067600, KIDNE2007 1860, KIDNE20073520, TESTI10001380, TESTI20001770, TESTI20006000, KIDNE20074220, KIDNE20075690, LIVER10000580, TESTI20007620, TESTI20008830, TESTI20009090, LIVER10000670, LIVER10001040, LIVER10001110, TESTI2000.9700, TESTI20011340, TESTI2001.2370, LIVER10001750, LIVER10005420, LIVER20004160, TESTI20013520, TESTI20014200, TESTI20016210, MAMGL10000320, MAMGL10001840, TESTI20016710, TESTI20018520, TESTI20018620, MESAN10000350, MESAN10001470, MESAN10001800, TESTI20020020, TESTI20020810, TESTI20022510, MESAN20001490, NB9N420000420, NHNPC20002060, TESTI20024230, TESTI20024650, TESTI20024670, NT2NE10000230, NT2NE10000830, NT2NE10001630, TESTI20025800, TESTI20026320, TESTI20026980, NT2NE20003270, NT2NE20003920, NT2NE20004550, TESTI20027000, TESTI20027070, TESTI20028660, NT2NE20004700, NT2NE20005500, NT2NE2001 2470, TESTI20030370, TESTI20031930, TESTI20034.190, NT2NE20014350, NT2NE20016260, NT2NE20034080, TESTI20036490, TESTI20039980, TESTI20042870, NT2NE20047160, NT2NE20055170, NT2NE20057200, TESTI20047120, TESTI20049940, TESTI20056900, NT2RI20005970, NT2RI2000.9740, NT2RI20010100, TESTI20057420, TESTI20058600, TESTI20067740, NT2RI20014490, NT2RI20015400, NT2RI20015950, TESTI20069780, TESTI20074800, TESTI20077490, NT2RI20016570, NT2RI20018660, NT2RI20020220, TESTI20079510, TESTI20080200, TESTI20081440, NT2RI20021520, NT2RI20022430, NT2RI20022520, TESTI20087740, TESTI20088470, TESTI20136910, NT2RI20025300, NT2RI2003.01.10, NT2RI20030510, THYMU10000830, THYMU10001760, NT2RI2003 1540, NT2RI20033010, NT2RI20033830, THYMU10003290, THYMU10003820, NT2RI20036780, NT2RI20042840, NT2RI2004.4420, THYMU10005580, TRACH10000630, TRACH10001000, NT2RI20049850, NT2RI20050870, NT2RI20051500, TRACH10001400, TRACH20001850, TRACH20001960, NT2RI20066820, NT2RI20068250, NT2RI20070480, TRACH20004200, TRACH20004960, TRACH2000.6650, NT2RI20070840, NT2RI20073030, NT2RI20074980, TRACH20007670, TRACH20008980, TRACH20015920, NT2RI20077540, NT2RI20078270, NT2RI20080500, UMVEN20001330, UTERU10000770, UTERU10000960, NT2RI20081880, NT2RI20084810, NT2RI20085980, UTERU10001920, UTERU20000470, UTERU20003930, NT2RI20089420, NT2RI20092890, NT2RI20094.060, UTERU2OOO4850 NT2RP60000320, NT2RP60000390, NT2RP60001090, NT2RP70000690, NT2RP70002380, NT2RP70002590, 0092. The following 87 clones presumably belong to NT2RP70003640, NT2RP70011660, NT2RP70015910, glycoprotein-related proteins. NT2RP70021510, NT2RP70023760, NT2RP70023790, 0093) BNGH410000340, BNGH410001180, NT2RP700261.90, NT2RP700298.20, NT2RP70040800, BRACE20014920, BRACE20015080, BRACE20018590, NT2RP70043730, NT2RP70047900, NT2RP70049250, BRACE20024680, BRACE20026350, BRACE20031100, NT2RP70055200, NT2RP70064080, NT2RP7007 1540, BRACE2007.4470, BRAWH10000370, BRAWH20001090, NT2RP7007 1770, NT2RP70073810, NT2RP70074220, BRAWH20011660, BRAWH20014840, NT2RP70075040, NT2RP70076170, NT2RP70079250, BRAWH20059980, CD34C20000510, CTONG20013660, NT2RP70079750, NT2RP70081330, NT2RP70081370, CTONG20028160, CTONG20037820, FCBBF20007330, NT2RP70083150, NT2RP700.85500, NT2RP70090120, FEBRA20007330, FEBRA20008800, FEBRA20014920, NT2RP700.91490, NT2RP700.91680, NT2RP70092360, FEBRA20015840, FEBRA20057780, HEART20005060, NT2RP700.93220, NT2RP700.93730, NT2RP70094290, HLUNG10001100, HLUNG20002550, HSYRA20013320, NT2RP700.94810, NT2RP700.94980, NT2RP700.95070, IMR3210002660, IMR3220007750, IMR3220013320, US 2007/0015163 A1 Jan. 18, 2007 21

KIDNE2004.4110, KIDNE20063760, KIDNE20067600, NT2RP60001000, NT2RP60001270, NT2RP70002710, KIDNE20073520, LIVER20000370, MESAN10000350, NT2RP70008120, NT2RP70018560, NT2RP70024500, NT2NE10000830, NT2NE10001850, NT2NE20003270, NT2RP70032030, NT2RP70036290, NT2RP70042040, NT2NE20016260, NT2RI20018660, NT2RI20025300, NT2RP70045410, NT2RP70046560, NT2RP70055130, NT2RI20036780, NT2RI20077540, NT2RI20080500, NT2RP70061620, NT2RP70062960, NT2RP70064900, NT2RI20085980, NT2RI20089420, NT2RI20092890, NT2RP700.69860, NT2RP70075370, NT2RP70085570, NT2RP70000690, NT2RP70004770, NT2RP70055200, NT2RP70087200, NT2RP700901.90, NTONG20003340, NT2RP70081370, NT2RP70083150, NT2RP700.91490, NTONG20003630, NTONG20015500, OCBBF20011010, NT2RP70092360, NT2RP700.94980, NTONG10002140, OCBBF2001 1240, OCBBF20015860, PEBLM20002480, OCBBF20002310, OCBBF20002770, PLACE50000680, PEBLM20002700, PEBLM20003080, PEBLM20003950, PLACE50001130, PLACE60018860, PLACE60044540, PLACE60002050, PLACE60005550, PLACE60021510, PROST20018230, PROST20032320, PROST20073890, PLACE60030380, PROST20018230, PROST20031170, SALGL10001570, SKNMC20015030, SMINT10000160, PROST20073170, PUAEN10001610, SALGL10000650, SMINT20002770, SPLEN20001340, TESTI10001270, SKMUS10000640, SKMUS20014920, SKNMC20000650, TESTI10001380, TESTI20001770, TESTI20024230, SKNMC20002240, SKNMC20003560, SMINT10001000, TESTI20027070, TESTI20036490, TESTI20039980, SMINT20005450, SPLEN20000200, SPLEN20000720, TESTI20056900, TESTI20057420, TESTI20079510, SYNOV20010140, SYNOV20013740, SYNOV20014510, THYMU10001760, TRACH10000740, TRACH10001250, TESTI10000550, TESTI20001200, TESTI20007070, TRACH20004200, UTERU20000470 TESTI20010490, TESTI20015560, TESTI20018150, TESTI20018790, TESTI20021490, TESTI20026760, 0094. The following 46 clones presumably belong to TESTI20027890, TESTI20030710, TESTI20034130, signal transduction-related proteins. TESTI20042290, TESTI20053960, TESTI20074640, O095 ADRGL20000740, ASTRO10000180, TESTI20074660, TESTI20078640, THYMU10004590, BRACE20005770, BRACE20022020, BRACE20027360, TRACH20000790, TRACH20002370, TRACH20009440, BRACE20027920, BRAWH20006860, CTONG20005890, UTERU1OOO16OO FEBRA20000350, HHDPC20000550, IMR3220003020, 0098. The following 219 clones presumably belong to KIDNE20033730, KIDNE20040840, KIDNE20053360, disease-related proteins. KIDNE20062990, NT2RI20033440, NT2RI20058110, 0099 ADRGL10000020, ADRGL10001600, NT2RI20062100, NT2RI20073840, NT2RP70006240, ADRGL20000740, ASTRO20004170, BGGI120006840, NT2RP70043960, NT2RP70046870, NT2RP70061880, BGGI120010970, BGGI120017140, BNGH410001770, NT2RP70072520, NT2RP70081440, NT2RP700.93700, BNGH420005320, BRACE 10001870, BRACE20006980, NTONG10001820, PEBLM20004790, PLACE60026680, BRACE20007180, BRACE2001.4550, BRACE20018550, PROST20033400, PROST20043320, SKMUS10000220, BRACE20018590, BRACE20027550, BRACE20027720, SKMUS20016680, SPLEN20003570, TESTI20001540, BRACE20076850, BRACE20086550, BRAWH10000020, TESTI20005910, TESTI20022560, TESTI20024980, BRAWH10001640, BRAWH20001770, TESTI20029120, TESTI20034980, TESTI20049820, BRAWH20005030, BRAWH20005220, TESTI20055840, THYMU10003590, THYMU20003690, BRAWH20006330, BRAWH20006860, TRACH20002500, TRACH20002890 BRAWH20009840, BRAWH20011660, CD34C20000510, 0096. The following 140 clones presumably belong to CTONG20005890, CTONG20019110, CTONG20024180, transcription-related proteins. CTONG20025580, CTONG20037820, CTONG20055530, FCBBF20000940, FCBBF20009510, FCBBF40002820, O097) 3NB6920010220, 3NB6920015110, FEBRA20001050, FEBRA20003990, FEBRA20004150, 3NB6920015570, ADRGL10000650, BGGI120006840, FEBRA20004540, FEBRA2000.9720, FEBRA20010930, BGGI120006930, BGGI120017140, BNGH410000800, FEBRA20011460, FEBRA20050790, FEBRA20057880, BNGH420005320, BRACE 10000930, BRACE20014.550, FEBRA20064760, FEBRA20067930, FEBRA20070170, BRACE20018550, BRACE20020910, BRACE20024090, FEBRA20075510, FEBRA20075660, HCASM20002140, BRACE2007 1740, BRAWH10000020, BRAWH10001640, HEART20004480, HLUNG10001050, HLUNG20000680, BRAWH10001680, BRAWH20006330, HSYRA10001370, HSYRA20006400, HSYRA20013320, BRAWH20009010, CTONG20025580, CTONG20028200, HSYRA20016310, IMR3210000440, IMR3220007910, FCBBF10005980, FCBBF20000940, FCBBF200095.10, KIDNE10001040, KIDNE20003150, KIDNE20033730, FCBBF50002610, FEBRA20003970, FEBRA20003990, KIDNE20042950, KIDNE2004.4110, KIDNE20050420, FEBRA20004540, FEBRA2000.9720, FEBRA20011460, KIDNE20059080, KIDNE20063760, KIDNE20078110, FEBRA20017150, FEBRA20050140, FEBRA20064760, LIVER10002300, LIVER100.04330, LIVER20000330, FEBRA20067360, FEBRA20069420, FEBRA20072800, LIVER20000370, MAMGL10001780, MESAN10001800, HLUNG10000760, HLUNG20000680, HSYRA10001370, MESAN20002910, MESAN20005010, NB9N410001350, HSYRA20016310, IMR3210002420, IMR3220007420, NHNPC10000840, NHNPC20002120, NT2NE10000730, KIDNE20000510, KIDNE20039940, KIDNE20061490, NT2NE20002990, NT2NE20003690, NT2NE20005170, KIDNE20078110, NESOP10000870, NHNPC10001 240, NT2NE20005360, NT2NE20006580, NT2NE20008090, NHNPC20002120, NT2NE20002590, NT2NE20008090, NT2NE20013720, NT2NE20016340, NT2NE20055170, NT2RI20003410, NT2RI20004120, NT2RI20004210, NT2RI20004120, NT2RI20004210, NT2RI20010910, NT2RI20010830, NT2RI20018460, NT2RI20025410, NT2RI2001.4500, NT2RI20020410, NT2RI20029580, NT2RI20025850, NT2RI20060710, NT2RI20067350, NT2RI2003 1540, NT2RI20033440, NT2RI20041900, NT2RI20071330, NT2RI20074390, NT2RI20078790, NT2RI20056470, NT2RI20057230, NT2RI20067030, NT2RI20087140, NT2RI20090650, NT2RI20092.150, NT2RI20070960, NT2RI20074980, NT2RI20077540, US 2007/0015163 A1 Jan. 18, 2007 22

NT2RI20080500, NT2RI20083960, NT2RI20084810, KIDNE20078100, LIVER10000670, LIVER10002300, NT2RI20092.150, NT2RI20092890, NT2RP60000350, MAMGL10001780, MESAN20002910, MESAN20005010, NT2RP60001000, NT2RP6000 1230, NT2RP70000690, NT2NE10000730, NT2NE10001850, NT2NE20002140, NT2RP70004250, NT2RP70028750, NT2RP70029060, NT2NE20003270, NT2NE20003690, NT2NE20005860, NT2RP70032030, NT2RP70036290, NT2RP70042600, NT2NE20013720, NT2NE20016340, NT2NE20016660, NT2RP70046560, NT2RP70049250, NT2RP70055020, NT2RI10000480, NT2RI20010100, NT2RI20015400, NT2RP70062960, NT2RP70063040, NT2RP70065270, NT2RI20020220, NT2RI20025300, NT2RI20033010, NT2RP700.69860, NT2RP7007 1770, NT2RP70073810, NT2RI20036780, NT2RI20037510, NT2RI20051500, NT2RP70074220, NT2RP70075370, NT2RP70079250, NT2RI2006.8550, NT2RI20073840, NT2RI20074980, NT2RP70081440, NT2RP70090120, NT2RP700901.90, NT2RI20084810, NT2RI20087910, NT2RP70004770, NT2RP700.93220, NT2RP700.94980, NTONG10002460, NT2RP70006240, NT2RP70011660, NT2RP700261.90, NTONG20003630, NTONG20015500, OCBBF10001180, NT2RP70062960, NT2RP70072520, NT2RP70076100, OCBBF20008240, PEBLM10000340, PEBLM20002480, NT2RP70081440, NT2RP70084.060, NT2RP70085570, PEBLM20003080, PEBLM20003950, PLACE50000800, NT2RP70093700, NTONG10001820, OCBBF20008240, PLACE60002050, PLACE60003790, PLACE60014.430, OCBBF20012100, OCBBF20014080, OCBBF20014940, PROST10001670, PROST10005360, PROST20002730, PANCR10000210, PEBLM20004790, PLACE50001050, PROST20032320, PROST20033400, PROST20062600, PLACE50001130, PLACE60003790, PLACE60012810, PROST20072890, PROST20073890, PROST20085160, PLACE60018860, PLACE60044540, PROST20031170, SALGL10001570, SKMUS10000140, SKMUS10001180, PROST20032320, PROST20033400, PROST20051210, SKMUS10001290, SKMUS20000740, SKMUS20003900, PROST20064500, SKMUS10001290, SKMUS10001770, SKMUS20007240, SKMUS20016340, SKNMC10002510, SKMUS20000740, SKMUS20007240, SKMUS20008630, SKNMC20000650, SKNMC20003220, SMINT10000420, SKMUS20009330, SKMUS2001 1290, SKNSH10001740, SMINT10000570, SMINT10001000, SMINT10001030, SKNSH20003470, SMINT10000160, SPLEN20001340, SMINT20004000, SPLEN10001430, SPLEN20001970, STOMA10001860, STOMA20001210, STOMA20004820, STOMA20000880, STOMA20003960, SYNOV20013740, SYNOV20016480, TESTI10000700, TESTI10001380, SYNOV20014510, SYNOV20016480, TESTI10001270, TESTI20001540, TESTI20005910, TESTI20012690, TESTI10001310, TESTI20001200, TESTI20001770, TESTI20018270, TESTI20022560, TESTI20027070, TESTI20002530, TESTI20006000, TESTI20006990, TESTI20029120, TESTI20034.190, TESTI20034980, TESTI20007620, TESTI20008830, TESTI20011800, TESTI20040000, TESTI20042070, TESTI20042950, TESTI20012690, TESTI20015120, TESTI20018520, TESTI20047120, TESTI20049820, TESTI20138320, TESTI20018790, TESTI20021490, TESTI20025160, TESTI20140360, TESTI30000020, THYMU10000830, TESTI20027070, TESTI20027290, TESTI20029120, THYMU10004910, THYMU20003170, TESTI20033250, TESTI20049820, TESTI20053960, THYMU20003690, TRACH20000150, TRACH20004720, TESTI20068660, TESTI2007 1830, TESTI20074640, TRACH20004970, TRACH20009260, UTERU10000960 TESTI20079510, TESTI20086570, TESTI20140360, THYMU10000830, THYMU10001760, 0102) The following 23 clones presumably belong to the THYMU10003590, THYMU10004910, TRACH20002370, category of cell division- and/or cell proliferation-related UTERU10000960, UTERU20000470 proteins. 0100. The following 168 clones presumably belong to the 0103) BGGI120001610, BRACE20027550, category of enzymes and/or metabolism-related proteins. BRACE20076850, BRAWH20005030, BRAWH20005220, 0101 3NB6920002810, ADRGL10001600, FEBRA20075660, HCASM20002140, HLUNG10000640, ADRGL10001650, BGGI120005330, BNGH410000340, IMR3220009730, NT2NE20003840, NT2RI20006850, BNGH410001770, BRACE 10000420, BRACE20015080, NT2RI20041900, NT2RI20058110, NTONG10002460, BRACE20022020, BRACE20024680, BRACE20026850, NTONG20008780, SKMUS20016340, SKNMC20003220, BRACE20027360, BRACE20027720, BRACE20027920, SPLEN10001430, TESTI10001680, TESTI20001840, BRACE20071380, BRACE20084430, BRAWH20001770, TESTI20021050, TESTI20035120, TESTI20057310 BRAWH20006510, BRAWH20006860, 0.104) The following 60 clones presumably belong to the BRAWH20009840, BRAWH20011660, category of cytoskeleton-related proteins. BRAWH20014180, BRAWH20014840, BRAWH2003.6890, BRAWH20059980, 01.05 ADRGL10000020, BRACE20006980, BRAWH20069890, BRAWH2008.9560, CTONG20013660, BRACE20008.850, BRACE20027960, BRACE2007.4470, CTONG20019110, DFNES20002120, FCBBF20007330, BRACE20076630, BRACE20078820, BRACE20093070, FCBBF20015380, FEBRA20000350, FEBRA20001290, BRAWH20000480, BRAWH20066220, CTONG2001.9550, FEBRA20003110, FEBRA20024420, FEBRA20041100, CTONG20028160, CTONG20055530, DFNES20002680, FEBRA20045920, FEBRA20050790, FEBRA20052160, FCBBF20005910, FEBRA20007720, FEBRA20008810, FEBRA20062700, FEBRA20063150, HEART20000350, FEBRA20034290, FEBRA20043290, FEBRA20072000, HHDPC20000550, HHDPC20004550, HLUNG10001050, HEART20004480, HEART20005200, HLUNG10001100, HLUNG20002550, HSYRA10001680, HSYRA20005100, HSYRA20006050, IMR3220007910, KIDNE20040840, HSYRA20015740, IMR3220008380, IMR32200091.90, KIDNE20052960, NT2RI20014090, NT2RI20032220, IMR3220012180, IMR3220013170, KIDNE20000410, NT2RI20058510, NT2RI20090660, NT2RP70000690, KIDNE20003490, KIDNE20004220, KIDNE20005130, NT2RP70004250, NT2RP70028750, NT2RP70042600, KIDNE20033050, KIDNE20040840, KIDNE20046810, NT2RP70049250, NT2RP70074220, NTONG20009660, KIDNE20056290, KIDNE20060530, KIDNE20063760, OCBBF20011760, OCBBF20015280, PEBLM10000680, KIDNE20068800, KIDNE20073280, KIDNE20073520, PROST10001670, PROST20033380, TESTI10000420, US 2007/0015163 A1 Jan. 18, 2007

TESTI10000510, TESTI20003560, TESTI20004350, BGGI120006840, BGGI120006930, BNGH410000800, TESTI20006000, TESTI20006990, TESTI20008490, BNGH420005320, BRACE2001.4550, BRACE20020910, TESTI20008830, TESTI20011410, TESTI20015110, BRACE20024090, BRACE20024780, BRACE2007 1740, TESTI20016610, TESTI20020570, TESTI20024230, BRAWH10001640, BRAWH10001680, TESTI20031090, TESTI20031170, TESTI20039140, BRAWH20000340, BRAWH20006330, TESTI2007872O BRAWH20009010, BRAWH20014180, 0106 The following 59 clones presumably belong to the BRAWH20069890, CTONG20025580, CTONG20028200, category of nuclear proteins and/or RNA synthesis-related D3OST20001840, FCBBF10005980, FCBBF200095.10, proteins. FCBBF50002610, FEBRA20003970, FEBRA20003990, FEBRA20004540, FEBRA20008560, FEBRA2000.9720, 01.07 3NB6920002810, 3NB6920015280, FEBRA20017150, FEBRA20017900, FEBRA20050140, BGGI120005440, BRACE10001150, BRACE20024780, FEBRA20064760, FEBRA20067360, FEBRA20069420, BRACE20027550, BRAWH20005030, BRAWH20014180, FEBRA20072800, HEART20003090, HLUNG10000760, BRAWH20069890, CTONG20024180, FEBRA20001290, HSYRA10001370, HSYRA20016310, IMR3210002420, FEBRA20075660, HEART20003090, HLUNG10000640, IMR3220007420, IMR3220008630, KIDNE20000510, HSYRA10001680, HSYRA20005100, IMR3220008.630, KIDNE20039940, KIDNE20061490, KIDNE20078110, IMR3220012180, MAMGL10001780, NT2NE10001850, NESOP10000870, NHNPC10000840, NHNPC10001240, NT2NE20002140, NT2NE20003840, NT2NE20016660, NHNPC20002120, NT2NE20002590, NT2NE20003840, NT2NE20054410, NT2RI20002820, NT2RI20006850, NT2NE20008090, NT2NE20016660, NT2NE20054410, NT2RI20010910, NT2RI20025540, NT2RI20041900, NT2RI20003410, NT2RI20004210, NT2RI20006850, NT2RI20053350, NT2RI20057230, NT2RI20060720, NT2RI20010830, NT2RI20010910, NT2RI20025410, NT2RI20067030, NT2RI20068550, NT2RI20078840, NT2RI20025850, NT2RI20057230, NT2RI20060710, NT2RI20087490, NT2RP70004770, NT2RP70013060, NT2RI20067350, NT2RI20071330, NT2RI20074390, NT2RP70076430, NTONG20008780, PEBLM10000340, NT2RI20078790, NT2RI20078840, NT2RI20087140, PLACE50000580, PLACE60003790, PROST20001760, NT2RI20087490, NT2RI20090650, NT2RP60001000, PROST20062600, SKMUS10000220, SKMUS20016340, NT2RP6000 1270, NT2RP70002710, NT2RP70008120, SKNMC20003220, SPLEN10001430, SPLEN20001970, NT2RP70013060, NT2RP70018560, NT2RP70024500, TESTI10001680, TESTI20002530, TESTI20007840, NT2RP70032030, NT2RP70042040, NT2RP70045410, TESTI20021050, TESTI20029120, TESTI20035120, NT2RP70046560, NT2RP70055130, NT2RP70061620, TESTI20057310, TRACH20003930, TRACH20012890 NT2RP70062960, NT2RP70064900, NT2RP70069860, NT2RP70075370, NT2RP70081670, NT2RP70085570, 0108. The following 24 clones presumably belong to the NT2RP70087200, NT2RP700901.90, NTONG20003340, category of protein synthesis- and/or protein transport-re NTONG20008780, NTONG20015500, OCBBF20011010, lated proteins. OCBBF20015860, PEBLM10000340, PEBLM20001120, 0109 BRACE20078680, FEBRA20075510, PEBLM20002700, PEBLM20003080, PLACE60002050, IMR3220008380, KIDNE20005190, KIDNE20050420, PLACE60005550, PLACE60021510, PLACE60030380, MESAN20002910, NB9N410001350, NT2NE20005360, PROST20001760, PROST20003250, PROST20018230, NT2RI20032050, NT2RI20032220, NT2RP70000760, PROST20031170, PROST20062600, PROST20073170, NT2RP70076430, NT2RP70093940, OCBBF20008240, SALGL10000650, SKMUS10000640, SKMUS20014920, PLACE50000580, PROST20000530, SKMUS20000740, SKMUS20016340, SKNMC20000650, SKNMC20002240, SKMUS20008.630, TESTI20007840, TESTI20015120, SKNMC20003220, SKNMC20003560, SMINT10001000, TESTI20018690, TESTI20078720, THYMU10005580, SMINT20005450, SPLEN10001430, SPLEN20000200, UMVEN2OOO1330 SPLEN20000720, SPLEN20001970, SYNOV20010140, SYNOV20013740, SYNOV20014510, TESTI10000550, 0110. The following 6 clones presumably belong to the TESTI20001200, TESTI20007070, TESTI20010490, category of cellular defense-related proteins. TESTI20013450, TESTI20015560, TESTI20018150, BRACE20014.550, NT2RI20037510, NT2RI20053350, TESTI20021050, TESTI20021490, TESTI20026760, NT2RP70029060, NT2RP70062960, PLACE50001700 TESTI20027890, TESTI20030710, TESTI20033270, TESTI20034130, TESTI20035120, TESTI20053960, 0111. The following 19 clones presumably belong to the TESTI20074640, TESTI20074660, TESTI20078640, category of development and/or differentiation-related pro THYMU10004590, TRACH20000790, TRACH20002370, teins. TRACH20009440, TRACH20012890, UTERU10001600 O112 BGGI120006930, CTONG20028200, 0115 The following 63 clones presumably belong to the FCBBF50002610, FEBRA20014920, FEBRA20017150, category of ATP- and/or GTP-binding proteins. FEBRA20060920, MAMGL10001820, NESOP10000870, 0116 3.NB6920002810, BNGH410000390, NHNPC10001240, NT2RI20078790, NT2RP70008120, BRACE20022020, BRACE20028120, BRACE20071380, NT2RP70018560, NT2RP70045410, OCBBF20002770, BRAWH20000480, BRAWH20006860, SALGL10000650, SMINT10001000, TESTI10000550, BRAWH20066220, CTONG20013200, DFNES20002680, TESTI20026760, TESTI20078140 FEBRA20043290, FEBRA20052160, FEBRA20072000, 0113. The following 158 clones presumably belong to the FEBRA20075510, HHDPC20000550, HLUNG20001160, category of DNA- and/or RNA-binding proteins. HSYRA10001680, HSYRA20005100, HSYRA20006050, KIDNE20040840, MAMGL10001780, MESAN20002910, 0114 3.NB6920002810, 3NB6920010220, NB9N410001350, NT2NE20003690, NT2NE20005170, 3NB6920015110, 3NB6920015570, ADRGL10000650, NT2NE20016660, NT2NE20055170, NT2RI2006.8550, US 2007/0015163 A1 Jan. 18, 2007 24

NT2RI20073840, NT2RP70004250, NT2RP70011660, TESTI20013300, TESTI2003 1520, TESTI20036250, NT2RP70029060, NT2RP70036290, NT2RP70042600, TESTI20037810, TESTI20064830, TESTI20083,870, NT2RP70046870, NT2RP70062960, NT2RP70081370, TRACH20006750, TRACH20016070 NT2RP70081440, NT2RP700.93700, OCBBF20008240, 0.124. The 43 clones shown above are clones which were OCBBF20015280, PEBLM20004790, PLACE50001700, predicted to highly possibly belong to the category of PLACE60003790, PROST20018990, PROST20033400, SKMUS20008.630, SMINT10000420, TESTI20001540, enzyme and/or metabolism-related protein based on the TESTI20003560, TESTI20005910, TESTI20006950, result of domain search by Pfam. TESTI20006990, TESTI20008490, TESTI20015110, TESTI20016610, TESTI20022560, TESTI20029120, 0.125 The 1 clone shown above is a clone which was TESTI20034980, TESTI20042290, TESTI20047120, predicted to highly possibly belong to the category of cell TESTI20049820, TESTI20057310 division and/or cell proliferation-related protein based on the 0117. Among the clones other than the ones shown result of domain search by Pfam. above, NTONG10001300 is a clone which was predicted to highly possibly belong to the category of Secretory protein BRACE20083800, KIDNE20004970 and/or membrane protein based on the result of domain 0.126 The 2 clones shown above are clones which were search by Pfam. predicted to highly possibly belong to the category of cytoskeleton-related protein based on the result of domain FEBRA20017060, NT2RI20066790, SMINT10000710 search by Pfam. 0118. The three clones shown above are clones which O127 3NB6920009120, 3NB692001.4710, were predicted to highly possibly belong to the category of BRACE10001660, BRACE20083,850, BRAWH20004760, glycoprotein-related protein based on the result of domain BRAWH20012030, BRAWH20064500, CTONG20011390, search by Pfam. CTONG20018200, FEBRA20007870, FEBRA20043250, 0119 BRACE20080970, BRACE20092.120, HCASM20003070, HHDPC20003150, NT2RI10000270, BRAWH10001300, FEBRA20019890, KIDNE2003 1850, NT2RI20036950, NT2RI20053680, NT2RI20072540, KIDNE20060140, MESAN20000920, NB9N410000470, NT2RI20083360, NT2RP700 12310, NT2RP70030550, NT2RI2007 1480, NT2RI20078910, NT2RP7008.8550, NT2RP7003.6470, OCBBF20013070, OCBBF20015270, NTONG20016120, OCBBF10000910, PROST20094830, PLACE60046630, PROST10003430, PROST20067370, SKNSH10003010, SPLEN20002670, TESTI20031960, SKMUS10001040, SKNMC20000970, SKNMC20015960, TESTI20036250, TESTI20037810, TESTI20083870, TESTI20030050, TESTI20032280, TESTI20033540, TESTI2O177400 TESTI20035890, TESTI20068720, TRACH20004110 0120) The 21 clones shown above are clones which were 0128. The 34 clones shown above are clones which were predicted to highly possibly belong to the category of signal predicted to highly possibly belong to the category of DNA transduction-related protein based on the result of domain and/or RNA-binding protein based on the result of domain search by Pfam. search by Pfam. 0121] 3NB6920009120, 3NB692001.4710, BRACE10001660, BRACE20083,850, BRAWH20004760, 0129. The 1 clone shown above is a clone which was BRAWH20012030, CTONG20011390, CTONG20018200, predicted to highly possibly belong to the category of ATP FEBRA20007870, FEBRA20043250, HHDPC20003150, and/or GTP-binding proteins based on the result of domain NT2RI10000270, NT2RI20036950, NT2RI20053680, search by Pfam. NT2RI20072540, NT2RI20083360, NT2RP70030550, OCBBF20013070, OCBBF20015270, PLACE60046630, 0130. The 185 clones shown below are clones which PROST10003430, PROST20067370, SKMUS10001040, were unassignable to any of the above-mentioned catego SKNMC20015960, TESTI20030050, TESTI20033540, ries, but have been predicted to have some functions based TESTI20035890, TESTI20068720, TRACH20004110 on homology search using their full-length nucleotide sequences and motif search in their estimated ORFs. 0122) The 29 clones shown above are clones which were predicted to highly possibly belong to the category of 0131) 3NB6910001160, ASTRO20004170, transcription-related protein based on the result of domain BNGH410000030, BNGH410001900, BRACE20005250, search by Pfam. BRACE20014770, BRACE20016730, BRACE20017370, BRACE20024310, BRACE20028960, BRACE20077840, 0123 BNGH410001900, BRACE20080970, BRACE20083850, BRAWH20003230, BRAWH20009440, BRACE20092120, BRAWH20093600, FEBRA20003770, BRAWH20076050, CTONG20018200, CTONG20027210, FEBRA20024290, HLUNG10000990, KIDNE20004030, CTONG20064.490, DFNES20004320, FCBBF10006870, MESAN20000920, NB9N42000 1040, NT2NE10000140, FCBBF20002760, FCBBF20012110, FEBRA20000530, NT2NE20001740, NT2RI20050610, NT2RI20055640, FEBRA20005360, FEBRA20007570, FEBRA20011330, NT2RI20072540, NT2RI20074690, NT2RP60000860, FEBRA20019890, FEBRA20030540, FEBRA20043250, NT2RP7003.6470, NT2RP70036800, NT2RP70072210, FEBRA20044900, FEBRA20048180, FEBRA20053800, NT2RP70074060, NT2RP70084870, NTONG10001300, FEBRA20068730, FEBRA20070170, HCASM10000210, NTONG10002640, NTONG20016120, OCBBF10000910, HCASM20005360, HHDPC20001150, HHDPC20001490, OCBBF10001190, OCBBF20007190, SKMUS20001170, HLUNG10000990, HSYRA10001190, HSYRA20001350, SKMUS20016620, SKNMC20000970, SKNMC20015960, HSYRA20006400, IMR3220002230, IMR322001.4910, SYNOV10001280, TESTI20002380, TESTI20006270, KIDNE10001520, KIDNE20003750, KIDNE20004970, US 2007/0015163 A1 Jan. 18, 2007

KIDNE20005740, KIDNE2003.1850, KIDNE20043440, 0.134. The biological activities of respective polypeptides KIDNE20056760, KIDNE20059080, KIDNE20060140, can be analyzed by the methods as shown below. KIDNE20060300, KIDNE20067750, LIVER10000790, LIVER10004330, MESAN10001010, MESAN20000920, Secretory Protein, Transmembrane Protein: NB9N410000470, NB9N42000 1040, NB9N420004950, 0135 “Ion Channels' (Ed., R. H. Ashley, 1995) of “The NT2NE10000180, NT2NE10000630, NT2NE20013370, Practical Approach Series” (IRL PRESS), NT2NE20016970, NT2NE20035690, NT2NE20053710, NT2RI2000.6690, NT2RI20013420, NT2RI20013850, 0.136) “Growth Factors” (Eds. I. McKay, I. Leigh, 1993), NT2RI20015190, NT2RI20016210, NT2RI20022700, 0137) “Extracellular Matrix” (Eds., M. A. Haralson, J. R. NT2RI20025170, NT2RI20029260, NT2RI20029580, Hassell, 1995); NT2RI20043040, NT2RI20061830, NT2RI20064120, Glycoprotein-Related Protein: NT2RI20065060, NT2RI20074690, NT2RI20077230, NT2RI20082210, NT2RI20083960, NT2RI20088120, 0138 “Glycobiology” (Eds., M. Fukuda, A. Kobata, NT2RP60000080, NT2RP60000350, NT2RP60000720, 1993) of “The Practical Approach Series” (IRL PRESS), NT2RP60000860, NT2RP70009060, NT2RP70010800, 0.139 “Glycoprotein Analysis in Biomedicine” (Ed., NT2RP70022430, NT2RP70028290, NT2RP70033040, Elizabeth F. Hounsell, 1993) of “Method in Molecular NT2RP70036320, NT2RP70036800, NT2RP70042330, Biology” (Humana Press) series; NT2RP70049.150, NT2RP70052050, NT2RP70055020, NT2RP70063040, NT2RP70072210, NT2RP70084410, Signal Transduction-Related Protein: NT2RP70084870, NTONG10000520, NTONG10001230, 0140 “Signal Transduction” (Ed., G. Milligan, 1992) of NTONG10001300, OCBBF10001220, OCBBF20007190, “The Practical Approach Series” (IRL PRESS), OCBBF20011400, OCBBF20014020, OCBBF20014940, PEBLM10001440, PEBLM20002130, PLACE50000370, 0141) “Protein Phosphorylation” (Ed., D. G. Hardie, PLACE50000800, PLACE60014430, PLACE60024190, 1993), or “Signal Transduction Protocols' (Eds. David A. PLACE60033990, PLACE60038500, PLACE60043970, Kendall, Stephen J. Hill, 1995) of “Method in Molecular PLACE60044640, PROST20023380, PROST20034720, Biology” (Humana Press) series; PROST20067370, PROST20079740, SALGL10000470, Transcription-Related Protein: SKMUS10000140, SKMUS10001040, SKMUS10001180, SKMUS20001170, SKMUS20003650, SKMUS20003900, 0.142 “Gene Transcription” (Eds. B. D. Hames, S. J. SKMUS20004580, SKMUS20009020, SKMUS2000.9540, Higgins, 1993) of “The Practical Approach Series” (IRL SKMUS20010080, SKMUS20011470, SKMUS20015430, PRESS), SKMUS20016620, SKNMC20000970, SKNMC20015960, 0.143 “Transcription Factors' (Ed., D. S. Latchman, SMINT10001030, SMINT20001450, SMINT20003960, 1993); Enzyme and/or metabolism-related protein: SMINT20004000, SPLEN20002670, SYNOV10001280, SYNOV20002910, SYNOV20008200, TESTI10000250, 0144) “Enzyme Assays” (Eds., ROBERT EISENTHAL TESTI10000640, TESTI10001310, TESTI10001910, and MICHAEL J. DANSON, 1992) of “The Practical Approach Series” (IRL PRESS); Cell division and/or cell TESTI20000440, TESTI20002070, TESTI20002080, proliferation-related protein: TESTI20014120, TESTI20016650, TESTI20022230, TESTI20022940, TESTI20024610, TESTI20027290, 0145 “Cell Growth, Differentiation and Senescence” TESTI20030050, TESTI20030590, TESTI20030740, (Ed., GEORGE STUDZINSKI, 2000) of “The Practical TESTI20035510, TESTI20035740, TESTI20041220, Approach Series” (IRL PRESS): TESTI20052680, TESTI20054080, TESTI20064830, TESTI20065720, TESTI20068660, TESTI2007 1830, Cytoskeleton-Related Protein: TESTI20078670, TESTI20083870, THYMU10000020, 0146 “Cytoskeleton: Signalling and Cell Regulation' THYMU10002910, TRACH10000300, TRACH20006750, (Eds. KERMIT L. CARRAWAY and CAROLIE A. TRACH20007800, TRACH20008940, TRACH20013950 CAROTHERS CARRAWAY, 2000) of “The Practical 0132) Further, the reason is that a polypeptide does not Approach Series” (IRL PRESS), always belong solely to a single category of the above 0147 “Cytoskeleton Methods and Protocols” (Ed., described functional categories, and therefore, a polypeptide Gavin, Ray H., 2000) of “Method in Molecular Biology” may belong to any of the predicted functional categories. (Humana Press) series; Nuclear protein and/or RNA synthe Besides, additional functions can be found for the clones sis-related protein: classified into these functional categories by further analy SCS. 0148 “Nuclear Receptors” (Ed., DIDIER PICARD, 1999) of “The Practical Approach Series” (IRL PRESS), 0133. Since the polypeptide encoded by clones of the invention contains full-length amino acid sequence, it is 0149) “RNA Processing” (Eds., STEPHEN J. HIGGINS possible to analyze its biological activity, and its effect on and B. DAVID HAMES, 1994): cellular conditions such as cell proliferation and differen Protein Synthesis and/or Transport-Related Protein: tiation by expressing the polypeptide as a recombinant polypeptide using an appropriate expression system, inject O150 “Membrane Transport” (Ed., STEPHEN A. ing the recombinant into the cell, or raising a specific BALDWIN, 2000) of “The Practical Approach Series” (IRL antibody against the polypeptide. PRESS), US 2007/0015163 A1 Jan. 18, 2007 26

0151) “Protein Synthesis Methods and Protocols” (Eds. deposited in the Online Mendelian Inheritance in Man Martin, Robin, 1998) of “Method in Molecular Biology” (OMIM) (http://www.ncbi.nlm.nih.gov/Omim/), which is (Humana Press) series: the human gene and disease database described later. Cellular Defense-Related Protein: 0.163 The clone predicted to belong to the category of enzyme and/or metabolism-related protein means a clone 0152 “DNA Repair Protocols” (Henderson, Daryl S., having hit data with some annotation, Such as metabolism, 1999) of “Method in Molecular Biology” (Humana Press) oxidoreductase, E. C. No. (Enzyme commission number), series, etc., Suggesting that the clone encodes an enzyme and/or 0153 “Chaperonin Protocols” (Eds. Schneider, Chris metabolism-related protein. tine, 2000); Development and/or differentiation-related pro 0164. The clone predicted to belong to the category of tein: cell division and/or cell proliferation-related protein means 0154) “Developmental Biology Protocols” (Eds., ROB a clone having hit data with some annotation, such as cell ERT EISENTHAL and MICHAEL J. DANSON, 1992) of division, cell cycle, mitosis, chromosomal protein, cell “Method in Molecular Biology' (Humana Press) series: growth, apoptosis, etc., Suggesting that the clone encodes a DNA- and/or RNA-Binding Protein: cell division and/or cell proliferation-related protein. 0.165. The clone predicted to belong to the category of 0155 “DNA-Protein Interactions Principles and Proto cytoskeleton-related protein means a clone having hit data cols” (Eds. Kneale, G. Geoff, 1994) of “Method in Molecu with some annotation, such as structural protein, cytoskel lar Biology' (Humana Press) series, eton, actin-binding, microtubles, etc., Suggesting that the 0156 “RNA-Protein Interaction Protocols' (Eds. clone encodes a cytoskeleton-related protein. Haynes, Susan R., 1999); 0166 The clone predicted to belong to the category of ATP- and/or GTP-Binding Protein: nuclear protein and/or RNA synthesis-related protein means a clone having hit data with Some annotation, Such as 0157 “Signal Transduction Protocols” (Eds. David A. nuclear protein, RNA splicing, RNA processing, RNA heli Kendall, Stephen J. Hill, 1995) of “Method in Molecular case, polyadenylation, etc., Suggesting that the clone Biology” (Humana Press) series. encodes a nuclear protein and/or RNA synthesis-related 0158. In the categorization, the clone predicted to belong protein. to the category of Secretory and/or membrane protein means 0.167 The clone predicted to belong to the category of a clone having hit data with Some annotation, Such as growth protein synthesis and/or transport-related protein means a factor, cytokine, hormone, signal, transmembrane, mem clone having hit data with some annotation, such as trans brane, extracellular matrix, receptor, G-protein coupled lation regulation, protein biosynthesis, amino-acid biosyn receptor, ionic channel, Voltage-gated channel, calcium thesis, ribosomal protein, protein transport, signal recogni channel, cell adhesion, collagen, connective tissue, etc., tion particle, etc., Suggesting that the clone encodes a protein Suggesting that it was a secretory or membrane protein, or a synthesis and/or transport-related protein. clone in which the presence of nucleotide sequence encod ing a signal sequence or transmembrane region was Sug 0.168. The clone predicted to belong to the category of gested by the results of PSORT and SOSUI analyses for cellular defense-related protein means a clone having hit deduced ORF. data with some annotation, such as heat shock, DNA repair, 0159. The clone predicted to belong to the category of DNA damage, etc., Suggesting that the clone encodes a glycoprotein-related protein means a clone having hit data cellular defense-related protein. with Some annotation, such as glycoprotein, Suggesting that 0169. The clone predicted to belong to the category of the clone encodes a glycoprotein-related protein. development and/or differentiation-related proteins means a clone having hit data with some annotation, such as devel 0160 The clone predicted to belong to the category of opmental protein, etc., Suggesting that the clone encodes a signal transduction-related protein means a clone having hit development and/or differentiation-related protein. data with some annotation, Such as serine/threonine-protein kinase, tyrosine-protein kinase, SH3 domain, SH2 domain, 0170 The clone predicted to belong to the category of etc., Suggesting that the clone encodes a signal transduction DNA- and/or RNA-binding protein means a clone having hit related protein. data with some annotation, such as DNA-binding, RNA binding, etc. 0161 The clone predicted to belong to the category of transcription-related protein means a clone having hit data 0171 The clone predicted to belong to the category of with some annotation, such as transcription regulation, Zinc ATP- and/or GTP-binding protein means a clone having hit finger, homeobox, etc., Suggesting that the clone encodes a data with some annotation, such as ATP-binding, GTP transcription-related protein. binding, etc. 0162 The clone predicted to belong to the category of 0.172. As to a protein involved in a disease, it is possible disease-related protein means a clone having hit data with to perform a functional analysis as described above, but also Some annotation, Such as disease mutation, syndrome, etc., possible to analyze correlation between the expression or the Suggesting that the clone encodes a disease-related protein, activity of the protein and a certain disease by using a or a clone whose full-length nucleotide sequence has hit data specific antibody that is obtained by using expressed protein. for Swiss-Prot, GenBank, UniGene, or nr., where the hit data Alternatively, it is possible to utilize the database OMIM, corresponds to genes or polypeptides which have been which is a database of human genes and diseases, to analyze US 2007/0015163 A1 Jan. 18, 2007 27 the protein. Further, new information is constantly being * 192340, *308230, *600322, *605359, *600046, *300090, deposited in the OMIM database. Therefore, it is possible for 106160, *600041, #262500, *605563, * 150390, *158106, one skilled in the art to find a new relationship between a * 182590, #103580, *104610, #173900, *134797, * 143890, particular disease and a gene of the present invention in the #145980, *306900, *308700, *176300, *227500, *137350, most up-to-date database. The proteins involved in diseases #154700, *138079, *600760, *107730, *142410, *147670, are useful for developing a diagnostic marker or medicines * 124092, *590050, *152760, *600509, *605646, *201910, for regulation of their expression and activity, or as a target *227600, *152790, *300200, *300300, 300800, *138160, of gene therapy. * 107741, * 120150, *601199, * 120180, *120160, *176730, * 133170, *122560, *107300, *137241, * 120140, *101000, 0173 Also, as for a secretory protein, membrane protein, * 1934.00, *217000, *272800, *600937, #201710, *600377, signal transduction-related protein, glycoprotein-related ii. 174800, *106100, H.274600, *173350, H1771 70, *147620 protein, or transcription-related protein, etc., search of the *214500. *131244. 2020. *120120. *60.1007. *191160. OMIM with the following keywords resulted in the finding * 147470, *603372. *60.0733, *252800, *190160, *138040 that the proteins are involved in many diseases (the result of * 158070. *16215. #125700. #130070. * 11381 1. *603355. the OMIM search for secrete and membrane proteins is *171060. *136435. #184700. *603732. *190180. *164008. shown below). Also, association between proteins associ- *186590. *120220, *6043.12. *152200. *138130. *605085. ated to signal transduction or transcription and diseases is *605353. *600840. #166210. kiss545. 3.207.750. *173360. reported in “Transcription Factor Research-1999 (Fujii, *601933. #194050. *153450. *138850. 3.253.200. *307030, Tamura, Morohashi, Kageyama, and Satake edit (1999) is 714s 600s, 860026,826oso. 847sso. 6008 Jikken-Igaku Zoukan, Vol. 17, No. 3), and “Gene Medicine' #204000, #227810, *23.2200 *188826. *232800. *161561. (1999) Vol. 3, No. 2). When cancer is used as an example, #166200, *1884.00, *153620, *182099, *218040, #265800, as described in "Biology of Cancer" (S. Matsubara, 1992) of 172400 hit,7200 17680s. 21600, #214700 i7640. Life Science series (Shokabo), many proteins are involved *152780, *600633, *601771, *301500, *6054.02, *601922, in cancers, which include enzyme and/or metabolism-related *307800, *147892. * 147720, 312O60, H52OOOO, * 147660 proteins, cytoskeleton-related proteins, cell division and/or *106150. *602358. 807270. *601769. 8147440. *6045.58. cell proliferation-related proteins as well as secretory pro- *131530. *600270. *601610. *603692. *603401. *600423. teins, membrane proteins, signal transduction-related pro- *601604. *603345. #125853. *602843. *142640. *603044. teins, glycoprotein-related proteins, transcription-related *605740. 134830. 602779. 130660. 13919. 137035. proteins. As clearly seen by the above example, it is evident *600761. *601340. *600823. *107740. *130160, *600877. that not only disease-related proteins but also secretory c 60510. *6009 45. * 1300so. *600957. #130050. *605580. proteins, membrane proteins, signal transduction-related *11844 4. *6O1124. * 12 4020 122470 s * 1 20700. *60320i. proteins, glycoprotein-related proteins, transcription-related * 137216. *60185. * 1389 45, *218030, *600839, #240600, proteins, etc. are often involved in diseases, and thus they #262400, #162300, *162330, *188450, #265850, *263200, can be useful targets in the field of medical industry. * 162641, *300159, *601038, #191390, *201810, *601398, 0.174. The result of the OMIM search for secretory and *602384, * 131240, *602423, * 139392, * 142703, *602663, membrane proteins is shown below, in which the keywords, *232700, *602682, #602722, *602730, *600734, * 188540, * 182452, *601538, *603061, * 146880, *603140, *603160, 0175 (1) secretion protein, * 142704, #252650, *182280, *125255, *603252, #131750 0176 (2) membrane protein, * 182139, * 182100, #259420, #261100, *603493, *601745 * 182098, *603795, * 123812, *600264, * 147940, *180246 0177 (3) channel, and * 180245, * 118888, #604284, * 168450, *118455, *604398 0178 (4) extracellular matrix were used. *604433, *601919, *118445, *600031, *604961, *605032, *605033, * 171050, #171300, *131243, * 109160, *605254, 0179 Shown in the search result are only the accession 274900, #171400, *600042, * 151670, *184600, *605470, numbers in the OMIM. Using the number, data showing the *605546, * 176760, *602008, * 102200, *605720, *600732, relationship between a disease and a gene or protein can be *605901 seen. The OMIM data has been renewed everyday. 2) Membrane Protein 1) Secretion Protein 1489 entries found, searching for “membrane protein' 354 entries found, searching for “secretion protein' 0181 * 130500, *605704, *305360, *153330, *173610, 0180 *604667, * 104760, *176860, *151675, * 1393.20, *109270, *170995, *170993, * 104776, *602333, *309060 * 1074.00, *604029, *118910, #200100, *176880, *603850, *605703, * 120920, *605943, *602690, *159430, *600897, * 147572, *604028, * 179513, * 125950, *139250, *246700, *133090, *601178, *602413, *602003, *604405, *605940, *600946, *600560, *602926, 185860, *605083, *603215, *603237, * 109280, *600378, *602173, * 107776, *602334 *602421, * 157147, * 179512, *600174, * 109270, *604710, *602335, * 125305, *601134, *309845, *605731, * 154045 * 138120, *179510, *600998, * 179509, * 170280, *179511, *603241, *603718, *600594, *603214, * 185881, *603657, *600626, *603831, *601489, *154545, * 179490, *603826, *600182, *603177, *605331, *601476, *605456, *601 114, * 122559, *603216, * 102720, *147290, *164160, *603062, *605190, *600723, *603904, * 136950, *300222, *602879 *112262, *602672, *605435, *605322, * 131230, *601652, * 185880, *605348, *300096, *602257, * 177070, *310200, *603166, *601746, *601591, * 179508, #160900, *104311, *603062, *603344, *600039, *602977, *300100, *128240, *600759, * 147545, * 167805, #104300, *167770, #219700, *600959, *600322, *227400, *186945, *600946, *602534, * 168470, *601684, *602049, *601146, *605227, *602434, *602048, * 182900, *601097, *600267, *602625, *136430, *602534, * 114840, *603489, *604323, * 107470, *600753, *602421, *601047, * 107450, *143450, *603141, * 184756 *600768, * 118825, *600564, *604252, * 173120, *134370, *164730, *159440, *154050, *600579, *312080, *604202,

US 2007/0015163 A1 Jan. 18, 2007 30

*600845, *605080, *600580, *602872, *602106, *176264, * 165380, *182888, *600491, * 146650, *146640, *600564, *603953, *605722, *300110, *138252, *604111, *602717, *600596, *600616, *600700, *600742, * 138297, * 182889 *602420, *600570, 600844, *603493, *600932, *605716 * 154705, *600930, *301870, *153619, *601050, *601090, *138254, *603652, *300138, *605410, *176268, *605214, *601105, * 165070, *305370, *135820, *130660, *310300, *605696, *300334, *604660, *176256, *605879, *603749, *601492, * 128240, *601587, #126600, *601636, *600119 *603583, *602345, *604661, *603787, 603313, *602982 *601692, *601728, * 125485, 601858, *601915, *602048 *604337, *600846, *604662, *300328, *300281, *602566 * 175100, *602108, * 121010, *600245, * 120470, *120328 *602836, *604003, *603788, *603651, *602421, * 107777, * 120325, *602264, * 120280, *602366, *600309, *602402, #1772.00, *100725, #219700, *100690, *100710, #160800 *602415, *602428, *602453, *602505, #166210, *602600, #603830, #183086, *600509, #220400, #601144, * 173910 *602941, *603005, *603196, 603209, *603221, *603234 *180902, *605692, #264350, #160900, #145600, #255700 *603319, * 120250, *120210, *120120, *603489, *603551, *602076, *603061, *601313, *154275, #604233, *604532, * 118938, *603799, *603842, *603924, *603963, *604042, #108500, #121201, #170400, *300225, * 121014, *139311 *604063, *604149, *604160, *601028, *604467, *604510, #125800, #160120, *118503, 601439, #141500, #168300 *604592, * 116930, *116806, *601284, *604724, *604806 *304040, #601887, #256450, *186945, *154276, #300009, *604807, *604808, * 107269, *605007, *605008, *605009 #216900, *600040, *601014, *601042, *602512, *601383, *600214, *600076, *605174, *605175, *605292, *605343, *605445, *602368, *603831, #117000, *601218, * 108745, *605351, #600204, *605497, *605546, *605587, *605623, *605248, #177735, #173900, *601212, * 182139, *601059, *600211, *605702, * 103320 *600039, *601485, * 180903, *186360, *603319, #600101 *118509, *600109, #121200, *600170, *604187, *176975, 0.184 In addition to these, the various keywords shown in *137163, #310468, #263800, #262300, *603750, *600229, the above-mentioned categorization or others can be used *124030, *602251, #603829, *137143, #145500, *600669, for the OMIM search and the result may suggest the involve * 147450, *154050, *603353, *600516, *601157, *600855, ment thereof in diseases. *601154, *602522, *249210, *600968, #252650, *171060 0185. Further, the use of nucleotide sequences of cDNAs *600919, * 156490, #259700, #601678, *601764, #310500 of the present invention enables analyzing the expression *131244, *300041, * 121011, * 125950, *114180, *602974, frequency of genes corresponding to the cDNAS. In addi *600637, *113730, *118504, *605145, *604669, *118800 tion, functions of the genes can be predicted based on the *121013, *121015, * 138491, *600421, * 104610, *604045, information obtained by the expression frequency analysis. *604594, *131230, *605487, *138247, *600467, #602485, 0186 There are several methods for analyzing the *602481, * 138251, *137192, *602403, 600851, *277900 expression levels of genes involved in diseases. Differences *603785, *603152, *603199, *603475, #168600, #272120 in gene expression levels between diseased and normal *170280, *603852, #241200, *603053, *600465, #603034, tissues are studied by the analytical methods using, for *142461, *164920, *137164, *600884, *600442, * 123885, example, Northern hybridization, RT-PCR DNA microar *604001, *600232, *232200, *171050, *602103, *602014, ray, etc. (Experimental Medicine, Vol. 17, No. 8, 980-1056 *300211, *600983, *602887, *604415, *604418, *3.00242, (1999); Cell Engineering (additional volume) DNA Microar #300071, *604471, *600837, 168350, *118511, 193007, ray and Advanced PCR Methods, Muramatsu & Nawa *600300, *604654, #601820, *180297, *600046, *603853, (eds.), Shujunsya (2000)). By computer analysis, in addition *604678, *604693, #604772, *118508, *603855, *605204, to these analysis methods, the nucleotide sequences of #254210, *182099, * 182307, #130600, *601109, * 114080 expressed genes can be compared to analyze the expression *3001.03, * 182860, *605438, *601129, *603964, *600019, frequency. For example, there is a database called “BODY *516060, #185000, *138079, * 104210, *605818, *603418, MAP: gene clones are extracted at random from cDNA *305990, *305450 libraries of various tissues and/or cells, and the clones 4) Extracellular Matrix homologous to one another are assigned to a single cluster based on the information of nucleotide sequence homology 218 entries found, searching for “extracellular matrix' at the 3'-end; genes are classified into any clusters, and the 0183) *605912, *603479, *602201, *604633, *601418 numbers of clones in the respective clusters are compared to *601548, *115437, * 154870, *600754, *602261, *602285 gain the information on expression frequency (http://body *602262, * 134797, * 120361, *604629, *604871, *603321, map.ims.u-tokyo.ac.jp/). *603320, *601807, #154700, *116935, * 185261, * 120360, 0187. When explicit difference in the expression levels *185250, *605470, *603767, *253700, *190180, *128239 between diseased tissues and normal tissues is observed for *308700, *276901, * 193300, *120324, * 188826, *602109 a gene by these analytical methods, it can be conclude that * 155760, *600514, *600261, #177170, *600536, * 147557, the gene is closely involved in a disease or disorder. Instead #116920, *150240, *601313, * 120140, 601614, *605158, of diseased tissues, when gene expression is explicitly *120150, *120180, #200610, *605127, * 1934.00, *192240, #173900, *152200, #136900, *135821, #130070, *120320, different between normal cells and cells reproducing dis *120220, *112260, *310200, *600900, *600262, *605670, ease-associated specific features, it can be concluded that the *600985, * 179590, #245150, *602574, *601463, 183850 gene is closely involved in a disease or disorder. *601211, *604241, *600758, * 186745, *604710, *602369 0188 From the 1639 clones whose full-length nucleotide *602090, *190182, * 192975, *602178, *230740, *600065 sequences had been revealed, genes involved in particular *601652, * 158106, * 190181, * 156790, #158810, *193210, pathology or functions were selected by the use of databases * 155120, *192977, * 193065, #226700, *187380, *231050, shown below (see Example 7: “Expression frequency analy * 182120, *188060, *186355, 163200, *164010, #156550 sis in silico'). The database used in the analyses of the * 151510, *150370, *253800, *156225, * 150325, #194050, present invention contains nucleotide sequences of 770.546 * 150290, *216550, *147620, *600215, *222600, *147559 clones, and the population of the database is large enough for US 2007/0015163 A1 Jan. 18, 2007

the analysis. The sequence information in the database was tiation (stimulation by retinoic acid (RA) or growth inhibitor obtained by selecting cDNA clones at random from cDNA treatment after RA stimulation) in cultured cells of a neural libraries derived from the various tissues and cells shown in strain, NT2. The result of comparative analysis of cDNA Example 1 and determining the 5'-end sequences thereof. libraries derived from undifferentiated NT2 cells (NT2RM) 0189 Then, the nucleotide sequences of respective and the cells subjected to the differentiation treatment clones in this database were categorized (clustered) based on (NT2RP, NT2RI or NT2NE) showed that the genes whose the nucleotide sequence homology determined with a search expression levels were different between the two were 500 program; the number of clones belonging to every cluster of clones indicated in Table 4. These genes are neurological each library was determined and normalized; thus, the ratio disease-related genes. of a certain gene in a cDNA library was determined. This Cancer-Related Genes analysis provided the information of the expression fre quency of a gene in a tissue or cell that is the Source of the 0.195. It has been assumed that, distinct from normal cDNA library. tissues, cancer tissues express a distinct set of genes, and thus the expression thereof can contribute to the carcino 0190. Then, in order to analyze the expression of genes genesis in tissues and cells. Thus, genes whose expression corresponding to the nucleotide sequences of cDNAs of the patterns in cancer tissues are different from those in normal present invention in tissues and cells, the libraries from the tissues are cancer-related genes. Search was carried out for tissues or cells, which had been used in the large-scale the genes whose expression levels in cancer tissues were cDNA analyses, were taken as Subjects to compare the different from those in normal tissues. expression levels between different tissues or cells. Namely, the expression frequency was analyzed by comparing the 0196. The result of comparative analysis of cDNA librar previously normalized values between tissues or cells from ies derived from breast tumor (TBAES) and normal breast which 600 or more cDNA clones whose nucleotide (BEAST) showed that the genes whose expression levels sequences had been analyzed were derived. The result of this were different between the two were 11 clones indicated in analysis showed that the cDNA clones corresponded to the Table 5. genes involved in the pathology and functions, which are 0197) The result of comparative analysis of cDNA librar indicated below. Each value in Tables 3 to 39 indicated ies derived cervical tumor (TCERX) and normal cervical below represents a relative expression frequency; the higher duct (CERVX) showed that the genes whose expression the value, the higher the expression level. levels were different between the two were 10 clones indi Osteoporosis-Related Genes cated in Table 6. 0191 Osteoporosis is a pathology in which bones are 0198 The result of comparative analysis of cDNA librar easily broken owing to overall decrease in components of ies derived from colon tumor (TCOLN) and normal colon bone. The onset correlates to the balance between the (COLON) showed that the genes whose expression levels functions of osteoblast producing bone and osteoclast were different between the two were 5 clones indicated in absorbing bone, namely bone metabolism. Thus, the genes Table 7. involved in the increase of osteoclasts differentiating from precursor cells of monocyte/macrophage line (Molecular 0199 The result of comparative analysis of cDNA librar Medicine 38. 642-648. (2001)) are genes involved in bone ies derived from esophageal tumor (TESOP) and normal metabolism involved in osteoporosis. esophagus (NESOP) showed that the genes whose expres sion levels were different between the two were 5 clones 0192 A nucleotide sequence information-based analysis indicated in Table 8. was carried out to identify the genes whose expression frequencies are higher or lower in CD34+ cell (cell express 0200. The result of comparative analysis of cDNA librar ing a glycoprotein CD34) treated with the osteoclast differ ies derived from kidney tumor (TKIDN) and normal kidney entiation factor (Molecular Medicine 38. 642-648. (2001)) (KIDNE) showed that the genes whose expression levels than in the untreated CD34+ cell, which is the precursor cell were different between the two were 205 clones indicated in of monocyte/macrophage line. The result of comparative Table 9. analysis for the frequency between the cDNA libraries 0201 The result of comparative analysis of cDNA librar prepared from the RNA of CD34+ cells (CD34C) and from ies derived from liver tumor (TLIVE) and normal liver the RNA of CD34+ cells treated with the osteoclast differ (LIVER) showed that the genes whose expression levels entiation factor (D30ST, D60ST or D90ST) showed that the were different between the two were 35 clones indicated in genes whose expression levels were different between the Table 10. two were 41 clones indicated in Table 3. These clones are involved in osteoporosis. 0202 The result of comparative analysis of cDNA librar ies derived from lung tumor (TLUNG) and normal lung Genes Involved in Neural Cell Differentiation (HLUNG) showed that the genes whose expression levels 0193 Genes involved in neural cell differentiation are were different between the two were 62 clones indicated in useful for treating neurological diseases. Genes with varying Table 11. expression levels in response to induction of cellular differ entiation in neural cells are thought to be involved in 0203 The result of comparative analysis of cDNA librar neurological diseases. ies derived from ovary tumor (TOVER) and normal ovary (NOVER) showed the genes whose expression levels were 0194 A survey was performed for genes whose expres different between the two were 7 clones indicated in Table sion levels are varied in response to induction of differen 12. US 2007/0015163 A1 Jan. 18, 2007 32

0204 The result of comparative analysis of cDNA librar by PCR. For example, the band intensities can be deter ies derived from stomach tumor (TSTOM) and normal mined by ethidium bromide staining. With RI-labeled or stomach (STOMA) showed that the genes whose expression fluorescently labeled primers, the RI signal or fluorescence levels were different between the two were 41 clones indi intensity can be assayed for the quantity of labeled ampli cated in Table 13. fication products. Alternatively, the quantity of amplification products can also be determined by measuring the RI signal 0205 The result of comparative analysis of cDNA librar or the fluorescence intensity from the RI-labeled or fluores ies derived from uterine tumor (TUTER) and normal uterus cently labeled probe hybridizing to the products. The assay (UTERU) showed that the genes whose expression levels results thus obtained are compared and then the clones were different between the two were 94 clones indicated in exhibiting differences in the expression levels can be Table 14. selected. 0206. The result of comparative analysis of cDNA librar 0215. There are some quantitative PCR methods: a PCR ies derived from tongue cancer (CTONG) and normal method using internal standards; a competitive PCR, in tongue (NTONG) showed that the genes whose expression which the quantification is achieved by adding, to a sample, levels were different between the two were 178 clones a dilution series of a known quantity of a template RNA and indicated in Table 15. by comparing the quantity of an amplification product 0207. These genes are involved in cancers. derived from the RNA of interest with the quantity of an amplification product derived from the template RNA. 0208 Further, there is a method to search for genes These methods overcome the problems of errors in the involved in development and differentiation, which is the amount of amplification products among tubes and of the expression frequency analysis in which the expression levels plateau effect. ATAC-PCR (Adaptor-tagged competitive of genes are compared between developing and/or differen PCR) is a method of competitive PCR which is practiced by tiating tissues and/or cells and adult tissues and/or cells. The using multiple adapters of different sizes attached to a gene genes involved in tissue development and/or differentiation whose 3'-end nucleotide sequence has previously been deter are genes participating in tissue construction and expression mined. The ratio of expression frequency of a single mRNA of function, and thus are useful genes, which are available species from a number of tissues (cells) can be assayed in a for regenerative medicine aiming at convenient regeneration single step (Nucleic Acids Research 1997. 25(22): 4694 of injured tissues. 4696; “DNA Micro-array and Advanced PCR Techniques”, 0209. By using the information of gene expression fre Cell Technology, supplement, Eds. Muramatsu and Nawa quency gained from the database of 5'-end nucleotide (Shujunsha, 2000): 104-112). sequences described above, genes involved in development 0216) If it is observed, by using these analytical methods, or differentiation of particular tissues were selected from the that the expression levels of genes are evidently varied 1639 clones whose full-length nucleotide sequence had been during major cellular events (such as differentiation and revealed (see Example 7). apoptosis), the genes are involved in the cellular events and 0210. The result of comparative analysis of cDNA librar accordingly are candidates for disease- and/or disorder ies derived from fetal brain (FCBBF, FEBRA or OCBBF) related genes. Further, genes exhibiting tissue-specific and adult brain (BRACE, BRALZ, BRAMY, BRAWH, expression are genes playing important parts in the tissue BRCAN, BRCOC, BRHIP, BRSSN, BRSTN or BRTHA) functions and, therefore, can be candidates for genes showed that the genes whose expression levels were differ involved in diseases and/or disorders affecting the tissues. ent between the two were 745 clones indicated in Tables 16 to 36. 0217 For example, inflammation is an important biologi cal response that is known to be involved in various dis 0211 The result of comparative analysis of cDNA librar eases. The representative inflammation-inducing factors ies derived from fetal heart (FEHRT) and adult heart include TNF-C. (Tumor Necrosis Factor-alpha), LPS (HEART) showed that the genes whose expression levels (Lipopolysaccharides), etc. Many genes have been identified were different between the two were 54 clones indicated in as genes located downstream of the TNF-C. or LPS stimu Table 37. lation. The respective stimulations are transduced through independent pathways of signaling cascade. There exists 0212. The result of comparative analysis of cDNA librar another signaling cascade for both stimulations, wherein ies derived from fetal kidney (FEKID) and adult kidney NF-kB is a common transducing molecule shared by the two (KIDNE) showed that the genes whose expression levels stimulations (Cell 1995, 80:529-532). It has also been were different between the two were 145 clones indicated in revealed that many inflammation-related genes, including Table 38. IL-2, IL-6 and G-CSF, are varied in the expression levels 0213 The result of comparative analysis of cDNA librar thereof in response to the signal through the common ies derived from fetal lung (FELNG) and adult lung pathway (Trends Genet. 1999, 15(6): 229-235). It is (HLUNG) showed that the genes whose expression levels assumed that genes whose expression levels are varied in were different between the two were 63 clones indicated in response to the stimulation of TNF-C. or LPS also participate Table 39. These genes are involved in regeneration of tissues in inflammation. and/or cells. 0218. Further, the infection of Helicobacter pylori to the 0214) The expression frequency or the like can be ana gastric epithelia is known to cause gastritis and gastroduode lyzed by PCR based on the nucleotide sequences of cDNAs nal ulcer (Mebio 2000, Jul., 17(7): 16-33). Thus, the genes of the present invention. There are some known methods for whose expression levels are altered depending on co-cultur comparing the quantities of amplification products obtained ing cells with Helicobacter pylori may be involved in US 2007/0015163 A1 Jan. 18, 2007

gastritis and gastroduodenal ulcer. A recent study has Sug cellular conditions such as growth and differentiation, it can gested that Helicobacter pylori strongly activates the NF-kB be used for developing medicines as follows. The polypep pathway, via the TRAF2/6-IKKB pathway, namely, via the tide or antibody provided by the invention is injected into a same pathway shared by TNF-C. (Gastroenterology 2000, certain kind of cells by microinjection. Then, using the cells, 119: 97-108). it is possible to screen low molecular weight compounds, 0219 THP-1 cell, which is a human monocyte cell line, etc. by measuring the change in the cellular conditions, or was cultured in the presence of TNF-C. (Tumor Necrosis the activation or inhibition of a particular gene. The screen Factor-alpha) or LPS (Lipopolysaccharides). The genes ing can be performed as follows. whose expression levels were altered owing to the presence 0226 First, the polypeptide is expressed and purified as of the agent were searched for, and the result showed that the recombinant. The purified polypeptide is microinjected into clones whose expression levels were increased owing to the cells Such as various cell lines, or primary culture cells, and presence of TNF-C. were ADRGL10000180, the cellular change Such as growth and differentiation can be BRACE20030780, BRACE20077640, BRACE20083850, examined. Alternatively, the induction of genes whose BRAWH20004430, FCBBF10006180, FEBRA20003780, expression is known to be involved in a particular change of FEBRA20006800, FEBRA20012940, FEBRA20015840, cellular conditions may be detected by the amount of mRNA HEART20004480, HLUNG10000370, HLUNG20001160, or polypeptide. Alternatively, the amount of intracellular HSYRA20013320, IMR3220008380, KIDNE10001520, molecules (low molecular weight compounds, etc.) that is KIDNE2004.0540, KIDNE20061490, KIDNE20062990, changed by the function of the gene product (polypeptide) NT2NE10001630, NT2NE20003920, NT2NE20005500, which is known to be involved in a particular change of NT2RI2001.4500, NT2RI20016570, NT2RI20078270, cellular conditions may be detected. The compounds to be NT2RI20083360, NTONG10002570, PUAEN10003220, screened (both low and high molecular compounds are SKNMC10000290, STOMA20002570, TESTI20011340, acceptable) can be added to the culture media and assessed UTERU2OOO4850. for their activity by measuring the change of the cellular 0220. On the other hand, the clones whose expression conditions. levels were decreased owing to the presence of TNF-C. were 0227. Instead of microinjection, cell lines introduced BRACE20013400, BRACE2009 1880, HEART20005060, with the gene obtained in the invention can be used for the HLUNG20001760, IMR3220008590, NT2NE10001850, screening. If the gene product is turn out to be involved in NT2RI20018660, NT2RI20053350, NT2RI20070480, a particular change in the cellular conditions, the change of PLACE60047380, STOMA20002890, SYNOV20001770, the product can be used as a measurement for screening. TRACH2OOO196O. Once a compound is screened out which can activate or 0221) Further, the clones whose expression levels were inhibit the function of the polypeptide of the invention, it can increased owing to the presence of LPS were be applied for developing medicines. FCBBF10006180, FEBRA20015840, HLUNG10000370, 0228) If the polypeptide encoded by the cDNA of the HLUNG20001160, HSYRA20013320, KIDNE2004.0540, present invention is a secretory protein, membrane protein, KIDNE20061490, NT2NE10001630, NT2NE20003920, or protein involved in signal transduction, glycoprotein, NT2NE20005500, NT2RI2001.4500, NT2RI20016570, transcription, or diseases, it can be used in functional assays NT2RI20078270, NTONG10002570, PUAEN10003220, for developing medicines. STOMA20002570, TESTI20011340. On the other hand, the 0229. In case of a membrane protein, it is most likely to clones whose expression levels were decreased owing to the be a polypeptide that functions as a receptor or ligand on the presence of LPS Were BRACE20013400, cell surface. Therefore, it is possible to reveal a new rela BRACE2009 1880, HEART20005060, HLUNG20001760, tionship between a ligand and receptor by Screening the NT2RI20070480, UMVEN20001330. membrane protein of the invention based on the binding 0222. These clones are involved in inflammation. activity with the known ligand or receptor. Screening can be 0223 MKN45, which is a gastric cancer cell line, was performed according to the known methods. co-cultured with Helicobacter pylori. The genes whose 0230 For example, a ligand against the polypeptide of expression levels were altered owing to the presence of the invention can be screened in the following manner. Helicobacter pylori were searched for, and the result showed Namely, a ligand that binds to a specific polypeptide can be that the clones whose expression levels were increased screened by a method comprising the steps of: (a) contacting owing to the presence of Helicobacter pylori were a test sample with the polypeptide of the invention or a BRACE10001590, BRACE20079530, BRAWH10001620, partial peptide thereof, or cells expressing these, and (b) FEBRA20006800, KIDNE20003490, KIDNE2004.0540, selecting a test sample that binds to said polypeptide, said KIDNE20050420, NT2NE10001850, STOMA20002890, partial peptide, or said cells. SYNOV20001770, TESTI10000550, UTERU20004850. 0231. On the other hand, for example, screening using On the other hand, the clones whose expression levels were cells expressing the polypeptide of the present invention that decreased owing to the presence of Helicobacter pylori were is a receptor protein can also be performed as follows. It is BRACE20034490, BRACE20077640, BRACE20083850, possible to screen receptors that is capable of binding to a KIDNE20005170, LIVER20000330, NT2RP60000390, specific polypeptide by using procedures (a) attaching the NTONG10000980, UMVEN20001330. sample cells to the polypeptide of the invention or its partial 0224. These clones are involved in gastritis or gas peptide, and (b) selecting cells that can bind to the said troduodenal ulcer. polypeptide or its partial peptide. 0225. For example, if the polypeptide encoded by the 0232. In a following screening as an example, first the cDNA of the present invention is a regulatory factor of polypeptide of the invention is expressed, and the recombi US 2007/0015163 A1 Jan. 18, 2007 34 nant polypeptide is purified. Next, the purified polypeptide a novel factor that regulates cellular conditions by adding is labeled, binding assay is performed using a various cell the secretory protein of the invention to a certain kind of cell, lines or primary cultured cells, and cells that are expressing and performing a screening by utilizing the cellular changes a receptor are selected (Growth and differentiation factors in growth or differentiation, or activation of a particular and their receptors, Shin-Seikagaku Jikken Kouza Vol. 7 gene. (1991) Honjyo, Arai, Taniguchi, and Muramatsu edit, p 0239). The screening can be performed, for example, as 203-236, Tokyo-Kagaku-Doujin). A polypeptide of the follows. First, the polypeptide of the invention is expressed invention can be labeled with RI such as '‘I, and enzyme and purified in a recombinant form. Then, the purified (alkaline phosphatase etc.). polypeptide is added to a various kind of cell lines or 0233 Alternatively, a polypeptide of the invention may primary cultured cells, and the change in the cell growth and be used without labeling and then detected by using a differentiation is monitored. The induction of a particular labeled antibody against the polypeptide. The cells that are gene that is known to be involved in a certain cellular change selected by the above Screening methods, which express a is detected by the amounts of mRNA and polypeptide. receptor of the polypeptide of the invention, can be used for Alternatively, the amount of an intracellular molecule (low the further screening of an agonists or antagonists of the said molecular-weight compounds, etc.) that is changed by the receptor. function of a gene product (polypeptide) that is known to function in a certain cellular change is used for the detection. 0234. Once the ligand binding to the polypeptide of the 0240 Once the screening reveals that the polypeptide of invention, the receptor of the polypeptide of the invention or the invention can regulate cellular conditions or the func the cells expressing the receptor are obtained by Screening, tions, it is possible to apply the polypeptide as a pharma it is possible to screen a compound that binds to the ligand and receptor. Also it is possible to screen a compound that ceutical and diagnostic medicine for related diseases by can inhibit both bindings (agonists or antagonists of the itself or by altering a part of it into an appropriate compo receptor, for example) by utilizing the binding activities. sition. 0241 As is above described for membrane proteins, the 0235. When the polypeptide of the invention is a recep secretory protein provided by the invention may be used to tor, the screening method comprises the steps of (a) con explore a novelligand-receptor interaction using a screening tacting the polypeptide of the invention or cells expressing based on the binding activity to a known ligand or receptor. the polypeptide of the invention with the ligand, in the A similar method can be used to identify an agonist or presence of a test sample, (b) detecting the binding activity antagonist. The resulting compounds obtained by the meth between said polypeptide or cells expressing said polypep ods can be a candidate of a compound that can inhibit the tide and the ligand, and (c) selecting a compound that interaction between the polypeptide of the invention and an reduces said binding activity when compared to the activity interacting molecule (including a receptor). The compounds in the absence of the test sample. Furthermore, when the may be able to use as a preventive, therapeutic, and diag polypeptide of the invention is a ligand, the screening nostic medicine for the diseases, in which the polypeptide method comprises the steps of (a) contacting the polypeptide may play a certain role. of the invention with its receptor or cells expressing the 0242 Proteins involved in signal transduction or tran receptor in the presence of samples, (b) detecting the binding Scription may be a factor that affects a certain polypeptide or activity between the polypeptide and its receptor or the cells gene in response to intracellular/extracellular stimuli. It is expressing the receptor, and (c) selecting a compound that possible to find out a novel factor that can affect a polypep can potentially reduce the binding activity compared to the tide or gene by expressing the polypeptide provided by the activity in the absence of the sample. invention in a certain types of cells, and performing a 0236 Samples to screen include cell extracts, expressed screening utilizing the activation of a certain intracellular products from a gene library, synthesized low molecular polypeptide or gene. compound, synthesized peptide, and natural compounds, for 0243 The screening may be performed as follows. First, example, but are not construed to be listed here. A compound a transformed cell line expressing the polypeptide is that is isolated by the above screening using a binding obtained. Then, the transformed cell line and the untrans activity of the polypeptide of the invention can also be used formed original cell line are compared for the changes in the as a sample. expression of a certain gene by detecting the amount of its mRNA or polypeptide. Alternatively, the amount of an 0237. A compound isolated by the screening may be a intracellular molecule (low molecular weight compounds, candidate to be an agonist or an antagonist of the receptor of etc.) that is changed by the function of a certain gene product the polypeptide. By utilizing an assay that monitors a change (polypeptide) may be used for the detection. Furthermore, in the intracellular signaling such as phosphorylation which the change of the expression of a certain gene can be results from reduction of the binding between the polypep detected by introducing a fusion gene that comprises a tide and its receptor, it is possible to identify whether the regulatory region of the gene and a marker gene (luciferase, obtained compound is an agonist or antagonist of the recep B-galactosidase, etc.) into a cell, expressing the polypeptide tor. Also, the compound may be a candidate of a molecule provided by the invention into the cell, and estimating the that can inhibit the interaction between the polypeptide and activity of a marker gene product (polypeptide). its associated proteins (including a receptor) in vivo. Such compounds can be used for developing drugs for precaution 0244 If the polypeptide or gene of the invention is involved in diseases, it is possible to Screen a gene or or cures of a disease in which the polypeptide is involved. compound that can regulate its expression and/or activity 0238) Secretory proteins may regulate cellular conditions either directly or indirectly by utilizing the polypeptide of such as growth and differentiation. It is possible to find out the present invention. US 2007/0015163 A1 Jan. 18, 2007

0245 For example, the polypeptide of the invention is proteins are useful in the medicinal industry as a diagnostic expressed and purified as a recombinant polypeptide. Then, marker of the related disease or a target of gene therapy. the polypeptide or gene that interacts with the polypeptide of 0252 Compounds isolated as mentioned above can be the invention is purified, and screened based on the binding. administered patients as it is, or after formulated into a Alternatively, the screening can be performed by adding pharmaceutical composition according to the known meth with a compound of a candidate of the inhibitor added in ods. For example, a pharmaceutically acceptable carrier or advance and monitoring the change of binding activity. In vehicle, specifically sterilized water, Saline, plant oil, emul another method, a transcription regulatory region locating in sifier, or Suspending agent can be mixed with the compounds the 5'-upstream of the gene encoding the polypeptide of the appropriately. The pharmaceutical compositions can be invention that is capable of regulating the expression of administered to patients by a method known to those skilled other genes is obtained, and fused with a marker gene. The in the art, such as intraarterial, intravenous, or Subcutaneous fusion is introduced into a cell, and the cell is added with injections. The dosage may vary depending on the weight or compounds to explore a regulatory factor of the expression age of a patient, or the method of administration, but those of the said gene. skilled in the art can choose an appropriate dosage properly. 0246 The compound obtained by the screening can be If the compound is encoded by polynucleotide, the poly used for developing pharmaceutical and diagnostic medi nucleotide can be cloned into a vector for gene therapy, and cines for the diseases in which the polypeptide of the present used for gene therapy. The dosage of the polynucleotide and invention is involved. Similarly, if the regulatory factor the method of its administration may vary depending on the obtained in the screening is turn out to be a polypeptide, weight or age of a patient, or the symptoms, but those skilled compounds that can newly affect the expression or activity in the art can choose properly. of the polypeptide may be used as a medicine for the 0253) The present invention further relates to databases diseases in which the polypeptide of the invention is comprising at least a sequence of polynucleotide and/or involved. polypeptide, or a medium recorded in Such databases, 0247 If the polypeptide of the invention has an enzy selected from the sequence data of the nucleotide and/or the matic activity, regardless as to whether it is a secretory amino acids indicated in Table 1. The term “database' means protein, membrane protein, or proteins involved in signal a set of accumulated information as machine-searchable and transduction, glycoprotein, transcription, or diseases, a readable information of nucleotide sequence. The databases screening may be performed by adding a compound to the of the present invention comprise at least one of the novel polypeptide of the invention and monitoring the change of nucleotide sequences of polynucleotides provided by the the compound. The enzymatic activity may also be utilized present invention. The databases of the present invention can to screen a compound that can inhibit the activity of the consist of only the sequence data of the novel polynucle polypeptide. otides provided by the present invention or can comprise other information on nucleotide sequences of known full 0248. In a screening given as an example, the polypeptide length cDNAs or ESTs. The databases of the present inven of the invention is expressed and the recombinant polypep tion can be comprised of not only the information on the tide is purified. Then, compounds are contacted with the nucleotide sequences but also the information on the gene purified polypeptide, and the amount of the compound and functions revealed by the present invention. Additional the reaction products is examined. Alternatively, compounds information Such as names of DNA clones carrying the that are candidates of an inhibitor are pretreated, then a full-length cDNAs can be recorded or linked together with compound (substrate) that can react with the purified the sequence data in the databases. polypeptide is added, and the amount of the Substrate and the 0254 The database of the present invention is useful for reaction products is examined. gaining complete gene sequence information from partial 0249. The compounds obtained in the screening may be sequence information of a gene of interest. The database of used as a medicine for diseases in which the polypeptide of the present invention comprises nucleotide sequence infor the invention is involved. Also they can be applied for tests mation of full-length cDNAS. Consequently, by comparing that examine whether the polypeptide of the invention the information in this database with the nucleotide functions normally in vivo. sequence of a partial gene fragment yielded by differential display method or Subtraction method, the information on 0250 Whether the secretory protein, membrane protein, the full-length nucleotide sequence of interest can be gained signal transduction-related protein, glycoprotein-related from the sequence of the partial fragment as a starting clue. protein, or transcription-related protein of the present inven tion is a novel protein involved in diseases or not is 0255 The sequence information of the full-length determined in another method than described above, by cDNAs constituting the database of the present invention obtaining a specific antibody against the polypeptide of the contains not only the information on the complete sequences invention, and examining the relationship between the but also extra information on expression frequency of the expression or activity of the polypeptide and a certain genes as well as homology of the genes to known genes and known polypeptides. Thus the extra information facilitates disease. In an alternative way, it may be analyzed referred to rapid functional analyses of partial gene fragments. Further, the methods in “Molecular Diagnosis of Genetic Diseases” the information on human genes is accumulated in the (Elles R. edit, (1996) in the series of “Method in Molecular database of the present invention, and therefore, the database Biology” (Humana Press). is useful for isolating a human homologue of a gene origi 0251 Proteins involved in diseases are targets of screen nating from other species. The human homologue can be ing as mentioned, and thus are very useful in developing isolated based on the nucleotide sequence of the gene from drugs which regulate their expression and activity. Also, the the original species. US 2007/0015163 A1 Jan. 18, 2007 36

0256 At present, information on a wide variety of gene 0262 The library names and the origins are indicated fragments can be obtained by differential display method below in the order of “Library name: Origin'. When a and Subtraction method. In general, these gene fragments are library was prepared by the subtraction method, the item is utilized as tools for isolating the full-length sequences followed by a description of how to prepare the subtracted thereof. When the gene fragment corresponds to an already library. known gene, the full-length sequence is easily obtained by comparing the partial sequence with the information in known databases. However, when there exists no informa NTONG: Normal tongue: tion corresponding to the partial sequence of interest in the known databases, cDNA cloning should be carried out for CTONG: Tongue cancer; the full-length cDNA. It is often difficult to obtain the FCBBF: Fetal brain; full-length nucleotide sequence using the partial sequence information as an initial clue. If the full-length of the gene OCBBF: Fetal brain; is not available, the amino acid sequence of the polypeptide PLACE: Placenta; encoded by the gene remains unidentified. Thus the database of the present invention can contribute to the identification SYNOV: Synovial membrane tissue (from rheumatioid of full-length cDNAS corresponding to gene fragments, arthritis). which cannot be revealed by using databases of known genes. 0257 The present invention has provided 1639 poly BNGH4: H4 cells (ATCC #HTB-148); nucleotides. AS has not yet proceeded the isolation of IMR32: IMR32 cells (ATCC #CCL-127); full-length cDNA within the human, the invention has great significance. It is known that secretory proteins, membrane SKNMC: SK-N-MC cells (ATCC #HTB-10): proteins, signal transduction-related proteins, glycoprotein related proteins, transcription-related proteins, and so on are 3NB69: NB69 cells (RCB #RCB0480); involved in many diseases. The genes and proteins involved BGGI1: GI1 cells (RCB #RCB0763); in diseases are useful for developing a diagnostic marker or medicines for regulation of their expression and activity, or NB9N4: NB9 cells (RCB #RCB0477); as a target of gene therapy. SKNSH: SK-N-SH cells (RCB #RCB0426); 0258. In particular, cDNA assumed to encode secretory NT2RM: NT2 cells (STARATAGENE #204101): proteins, which were provided by this invention, are very important for the industry since the encoded proteins them NT2RP: NT2 cells treated with retinoic acid (RA) for 5 selves are expected to be useful as pharmaceutical agents weeks to induce the differentiation; and many disease-related genes may be included in them. In NT2RI: NT2 cells treated with RA for 5 weeks to induce the addition, membrane proteins, signal transduction-related differentiation, followed by the treatment with the growth proteins, transcription-related proteins, disease-related pro inhibitor for 2 weeks; teins, and genes encoding them can be used as indicators for diseases, etc. These cDNA are also very important for the NT2NE: NT2 cells were treated with RA and the growth industry, which are expected to regulate the activity or inhibitor for the neuronal differentiation, and the resultant expression of the encoded protein to treat diseases, etc. neurons were concentrated and harvested (NT2 Neuron); 0259 Any patents, patent applications, and publications 0263. NTISM: NT2 cells (STARATAGENE #204101) cited herein are incorporated by reference. were treated with RA for weeks to induce the differentiation, and then treated with the growth inhibitor for 2 weeks: 0260 The invention is illustrated more specifically with mRNA was prepared from the cells and a cDNA library was reference to the following examples, but is not to be con constructed from the mRNA; the cDNAs of the library strued as being limited thereto. whose nucleotide sequences were shared by those of mRNAs from undifferentiated NT2 cells were subtracted by EXAMPLE 1. using a Subtract Kit (Invitrogen if K4320-01); the subtracted library (NT2RI-NT2RM) was provided by this procedure. Preparation of cDNA Library by Oligo-Capping 0264. RCB indicates that the cell was provided by the (1) Extraction and Purchase of mRNA Cell Bank, RIKENGENE BANK, The Institute of Physical 0261) Total RNAs as mRNA sources were extracted from and Chemical Research; ATCC indicates that the cell was human tissues (shown below) by the method as described in provided by American Type Culture Collection. the reference (J. Sambrook, E. F. Fritsch & T. Maniatis, Molecular Cloning Second edition, Cold Spring harbor Laboratory Press, 1989). Further, by the method as ASTRO: Normal human astrocyte NHA5732, Takara Shuzo described in the reference (J. Sambrook, E. F. Fritsch & T. #CC2565; Maniatis, Molecular Cloning Second edition, Cold Spring harbor Laboratory Press, 1989), total RNAs as mRNA DFNES: Normal human dermal fibroblast (neonatal skin); Sources were extracted from human culture cells and human NHDF-Neo NHDF2564, Takara Shuzo #CC2509; primary culture cells (shown below) which had been culti MESAN: Normal human mesangial cell NHMC56046-2, vated by the methods described in the catalogs. Takara Shuzo #CC2559: US 2007/0015163 A1 Jan. 18, 2007 37

NHNPC: Normal human neural progenitor cell NHNP5958, TCERX: Cervix (Tumor), CLONTECH #64010-1: Takara Shuzo #CC2599; TCOLN: Colon (Tumor), CLONTECH #64014-1; PEBLM: Normal human peripheral blood mononuclear cell HPBMC5939, Takara Shuzo #CC2702: TESTI: Testis, CLONTECH #64027-1; HSYRA: Human synoviocyte HS-RA (from rheumatioid THYMU: Thymus, CLONTECH #64028-1; arthritis), Toyobo #T404K-05; TLUNG: Lung (Tumor), CLONTECH #64013-1; PUAEN: Normal human pulmonary artery endothelial cells, TOVAR: Ovary (Tumor), CLONTECH #64011-1; Toyobo #T302K-05; TRACH: Trachea, CLONTECH #64091-1; UMVEN: Normal human umbilical vein endothelial cell HUVEC, Toyobo #T200K-05; TUTER: Uterus (Tumor), CLONTECH #64008-1; HCASM: Normal human coronary artery smooth muscle UTERU: Uterus, CLONTECH #64029-1; cell HCASMC, Toyobo #T305K-05; ADIPS: Adipose, Invitrogen #D6005-01; HCHON: Normal human chondrocyte HC, Toyobo BLADE: Bladder, Invitrogen #D6020-01; #T402K-05; BRALZ: Cerebral cortex from an Alzheimer patient (Brain, HHDPC: Normal human dermal papilla cell HDPC, Toyobo cortex, Alzheimer), Invitrogen if D6830-01; #THPCK-001; CERVX: Cervix, Invitrogen #D6047-01; CD34C: CD34+ cells (AllCells, LLC #CB14435M); COLON: Colon, Invitrogen #D6050-0; D3OST: CD34+ cells treated with the osteoclast differen tiation factor (ODF) for 3 days to induce the differentiation; NESOP. Esophagus, Invitrogen #D6060-01; D6OST: CD34+ cells treated with ODF for 6 days to induce PERIC: Pericardium, Invitrogen #D6105-01; the differentiation; RECTM: Rectum, Invitrogen #D6110-01; D90ST: CD34+ cells treated with ODF for 9 days to induce TESOP. Esophageal (Tumor), Invitrogen #D6860-01; the differentiation. TKIDN: Kidney (Tumor), Invitrogen #D6870-01; 0265). Then, total RNAs extracted from the following human tissues were purchased and used as mRNA sources. TLIVE: Liver (Tumor), Invitrogen #D6880-01; The library names and the origins are indicated below in the TSTOM: Stomach (Tumor), Invitrogen #D6920-01; order of “Library name: Origin'. When a library was pre pared by the subtraction method, the item is followed by a BEAST: Adult breast, STARATAGENE #735044: description of how to prepare the subtracted library. FEHRT: Fetal heart, STARATAGENE #738012: FELNG: Fetal lung, STARATAGENE #738020; ADRGL: Adrenal gland, CLONTECH #64016-1: NOVAR: Adult ovary, STARATAGENE #735260: BRACE: Brain (cerebellum), CLONTECH #64035-1; BRASW: subtracted library (BRALZ-BRAWH). BRAWH: Whole brain, CLONTECH #64020-1: 0266. A cDNA library was constructed from mRNA FEBRA: Fetal brain, CLONTECH #64019-1; prepared from tissues of cerebral cortex obtained from an Alzheimer patient BRALZ: Cerebral cortex from an Alzhe FELIV: Fetal liver, CLONTECH #64018-1; imer patient (Brain, cortex, Alzheimer), Invitrogen if D6830 HEART: Heart, CLONTECH #64025-1; 01: the cDNAs of this library whose nucleotide sequences were shared by those of mRNAs from whole brain tissue HLUNG: Lung, CLONTECH #64023-1; BRAWH: Whole brain, CLONTECH #64020-1 were sub KIDNE: Kidney, CLONTECH #64030-1; tracted by using a Subtract Kit (Invitrogen if K4320-01). LIVER: Liver, CLONTECH #64022-1: 0267 Further, mRNAs extracted and purified as poly A(+) RNAs from the human tissues shown below were MAMGL: Mammary Gland, CLONTECH #64037-1; purchased. A cDNA library was prepared from an RNA PANCR: Pancreas, CLONTECH #64031-1; mixture in which the poly A(+)RNA from each tissue had been combined with poly A(-) RNA. The poly A(-) RNA PROST: Prostate, CLONTECH #64038-1: was prepared by removing poly A(+)RNA from the total SALGL: Salivary Gland, CLONTECH #64026-1; RNA of whole brain tissue (CLONTECH #64020-1) by using oligo dT cellulose. The library names and the origins SKMUS: Skeletal Muscle, CLONTECH #64033-1; are indicated below in the order of “Library name: Origin”. SMINT: Small Intestine, CLONTECH #64039-1;

BRCOC: Brain (corpus callosum), CLONTECH #6577-1: removal, were carried out using the oligo-cap linker (SEQ BRHIP: Brain (hippocampus), CLONTECH #6578-1; ID NO: 3279) and oligo dT primer (SEQID NO:3280), as described in WO 01/04286. Then, the single-stranded cDNA BRSSN: Brain (substantia nigra), CLONTECH #6580-1; was converted to a double-stranded cDNA by PCR (poly BRSTN: Brain (subthalamic nucleus), CLONTECH #6581 merase chain reaction) using 5' (SEQ ID NO: 3281) and 3 1; (SEQ ID NO: 3282) PCR primers, and then digested with Sfil. Then, a fraction of cDNA fragments, typically 2-kb or BRTHA: Brain (thalamus), CLONTECH #6582-1. longer (3-kb or longer in some cases), was unidirectionally (2) Preparation of cDNA Library cloned into a DraIII-digested pME18SFL3 vector (FIG. 1) 0268 cDNA library was prepared from each RNA by the (GenBank AB009864, Expression vector); the cDNA library improved method (WO 01/04286) of oligo capping M. was thus prepared. Maruyama and S. Sugano, Gene, 138: 171-174 (1994). A series of procedures, BAP (Bacterial Alkaline Phosphatase) 0269. The names of cDNA libraries, which were used in treatment, TAP (Tobacco Acid Pyrophosphatase) treatment, the analysis of full-length cDNA sequences, and their ori RNA ligation, first strand cDNA synthesis and RNA gins are shown in Table 2.

TABLE 2 Library Type Origin, etc. 3NB69 Culture cell NB69 cells (RCB #RCB0480) ADRGL Tissue Adrenal gland (CLONTECH #64O16-1) ASTRO Primary Normal Human Astrocyte NHA5732 (Takara Shuzo #CC2565) culture cel BGGI1 Culture ce GI1 cells (RCB #RCBO763) BNGH4 Culture ce H4 cells (ATCC #HTB-148) BRACE Tissue Brain, cerebellum (CLONTECH #64035-1) BRAWH Tissue Brain, whole (CLONTECH #64020-1) CD34C Primary CD34+ cells (AllCells, LLC #CB14435M) CI Ce CTONG Tissue Tongue, Cancer D3OST Primary CD34+ cells (ODF induction for 3 days) CI Ce DFNES Primary Normal Human Dermal Fibroblasts (Neonatal Skin); NHDF-Neo CI Ce NHDF2564 (Takara Shuzo #CC2509) FCBBF Tissue Brain, Fetal FEBRA Tissue Brain, Fetal (CLONTECH #64019-1) HCASM Primary Human coronary artery smooth muscle cells HCASMC CI Ce (Toyobo #T305K-05) HEART Tissue Heart (CLONTECH #64025-1) HHDPC Primary Human dermal papilla cells HDPC (Toyobo #THPCK-001) CI Ce HLUNG Tissue Lung (CLONTECH #64023-1) HSYRA Primary Human synoviocytes from rheumatioid arthritis HS-RA(Toyobo CI Ce #T404K-05) MR32 Culture cell IMR32 cells (ATCC #CCL-127) KIDNE Tissue Kidney (CLONTECH #64030-1) LIVER Tissue Liver (CLONTECH #64022-1) MAMGL Tissue Mammary Gland (CLONTECH #64037-1) MESAN Primary Normal human mesangial cells NHMC56046-2 (Takara Shuzo culture cell #CC2559) NB9N4 Culture cell NB9 cells (RCB #RCB0477) NESOP Tissue Esophagus (Invitrogen #D6060-01) NHNPC Primary Normal human neural progenitor cells NHNP5958 (Takara culture cel Shuzo #CC2599) Culture cell NT2 cells concentrated after differentiation (NT2 Neuron) Culture cell NT2 cells treated by growth inhibitor for 2 weeks after RA induction for 5 weeks NT2RP Culture cell NT2 cells treated by RA for 5 weeks NTONG Tissue Tongue OCBBF Tissue Brain, Fetal PANCR Tissue Pancreas (CLONTECH #64031-1) PEBLM Primary Human peripheral blood mononuclear cells HPBMC5939 culture cel (Takara Shuzo #CC2702) PLAC Tissue Placenta PROST Tissue Prostate (CLONTECH #64038-1) PUAEN Primary Human pulmonary artery endothelial cells (Toyobo HT302K-05) culture cel SALG Tissue Salivary Gland (CLONTECH #64026-1) SKMUS Tissue Skeletal Muscle (CLONTECH #64033-1) SKNMC Culture cell SK-N-MC cells (ATCC #HTB-10) SKNSH Culture cell SK-N-SH cells (RCB #RCB0426) SMINT Small Intestine (CLONTECH #64039-1) US 2007/0015163 A1 Jan. 18, 2007 39

TABLE 2-continued Library Type Origin, etc. SPLEN Tissue Spleen (CLONTECH #64034-1) STOMA Tissue Stomach (CLONTECH #64090-1) SYNOW Tissue Synovial membrane tissue from rheumatioid arthritis TESTI Tissue Testis (CLONTECH #64027-1) THYMU Tissue Thymus (CLONTECH #64028-1) TRACH Tissue Trachea (CLONTECH #64091-1) UMVEN Primary Human umbilical vein endothelial cells HUVEC (Toyobo culture cell #T20OK-05) UTERU Tissue Uterus (CLONTECH #64029-1)

0270. The cDNA library with the high fullness ratio (the EXAMPLE 2 fullness ratio of 5'-end, which was calculated for each cDNA library by using the protein coding region found in known Sequencing Analysis of cDNA Ends and Selection mRNA species as an index, was 90% in average) prepared of Full-Length Clones by the improved oligo-capping method was constructed by using a eukaryotic expression vector pME 18SFL3. The 0273 With respect to the plasmid DNAs of clones vector contains SRC. promoter and SV40 small t intron in the obtained from each cDNA library, the 5'-end nucleotide upstream of the cloning site, and SV40 polyA added signal sequences of the cDNAs were determined in a DNA sequence site in the downstream. As the cloning site of sequencer (ABI PRISM 3700, PE Biosystems), after pME 18SFL3 has asymmetrical DraIII sites, and the ends of sequencing reaction was conducted by using a DNA cDNA fragments contain Sfil sites complementary to the sequencing reagent (Dye Terminator Cycle Sequencing FS DraII sites, the cloned cDNA fragments can be inserted into Ready Reaction Kit, dRhodamine Terminator Cycle the downstream of the SRC. promoter unidirectionally. Sequencing FS Ready Reaction Kit or BigDye Terminator Therefore, clones containing full-length cDNA can be Cycle Sequencing FS Ready Reaction Kit, PE Biosystems) expressed transiently by introducing the obtained plasmid according to the manual. A database was constructed using directly into COS cells, etc. Thus, the clones can be analyzed the data obtained. very easily in terms of the proteins that are the gene products 0274 For the analyzed 5'-end sequences of cDNA clones, of the clones, or in terms of the biological activities of the the data with the annotation of “complete cds' in the proteins. GenBank and UniGene were searched by BLAST homology search. When identical to certain human mRNA sequences, (3) Assessment of the 5'-End Completeness of Clones such cDNA clones were excluded. Then, clustering was Derived from the cDNA Library Prepared by Oligo-Capping carried out. When the identity was 90% or higher, and the 0271) With respect to the plasmid DNAs of clones length of consensus sequence was 50 base pairs or longer, derived from the libraries, the nucleotide sequences of the cDNA clones were assumed to belong to an identical cDNA 5'-ends (3'-ends as well in some cases) were deter cluster, and thus clustered. cDNA clones longer in the 5' mined in a DNA sequencer (ABI PRISM 3700, PE Biosys direction were selected from the members belonging to a tems), after sequencing reaction was conducted by using a cluster; if required, the 3'-end sequences of the selected DNA sequencing reagent (BigDye Terminator Cycle clones were determined by the same analysis method as used Sequencing FS Ready Reaction Kit, PE Biosystems) accord to determine the 5'-end sequences. The data of the end ing to the manual. A database was constructed based on the sequences obtained were analyzed, and then the clones obtained data. forming a sequence contig at 5'- and 3'-ends were excluded. Further, as mentioned above, the data was analyzed again by 0272. The 5'-end completeness of about 770,000 clones BLAST homology search; when identical to certain human derived from the human cDNA libraries prepared by the mRNA sequences (including sequences patented and improved oligo-capping method was determined by the applied for), the cDNA clones were excluded. Thus, the following method. The clones whose 5'-end sequences were cDNAs clones to be analyzed for their nucleotide sequence consistent with those of known human mRNA in the public database were judged to be “full-length' if they had a longer were obtained. 5'-end sequence than that of the known human mRNA; or EXAMPLE 3 even though the 5'-end sequence was shorter, if it contained the translation initiation codon it was judged to have the Analysis of the Full-Length Nucleotide Sequences “full-length” sequence. Clones which did not contain the translation initiation codon were judged to be “not-full 0275. The full-length nucleotide sequences of the length. The fullness ratio (the number of full-length selected clones were determined. The nucleotide sequence clones)/(the number of full-length and not-full-length determination was mainly performed by primer walking clones)) at the 5'-end of the cDNA clones was determined by method comprising the dideoxy terminator method using comparing with known human mRNA. As a result, the custom-made synthetic DNA primers. Namely, the nucle fullness ratio of the 5'-ends was 90%. The result indicates otide sequences of the DNAs were determined in a that the fullness ratio at the 5'-end sequence was extremely sequencer from PE BioSystems, after sequencing reaction high in the human cINA clones obtained by the oligo was carried out with a DNA sequencing reagent from the capping method. same Supplier using the custom-made synthetic DNA prim US 2007/0015163 A1 Jan. 18, 2007 40 ers according to the manual. A part of the clones were 0280 The search results obtained with the respective analyzed with a DNA sequencer from Licor. programs are shown below. 0276 Further, the nucleotide sequences of a part of the 0281. The clones whose deduced amino acid sequences clones were determined by the shotgun method where the were detected to have the signal sequences by PSORT are as plasmids containing the cDNAs were digested at random follows. were used, instead of the use of custom-made primers, by the same method in the DNA sequencer. The full-length nucle 0282 ADRGL10001600, BGGI120010970, otide sequences were finally determined by completely BNGH410001180, BNGH410001370, BRACE10001690, assembling the partial nucleotide sequences obtained by the BRACE20010650, BRACE20014920, BRACE20079530, above method. BRACE20086550, BRACE20089600, BRAWH20004430, BRAWH2004.0950, BRAWH20052250, 0277. Then, the regions translatable to proteins were BRAWH20092610, CD34C20000510, CTONG20028160, deduced from the determined full-length nucleotide FEBRA20003780, FEBRA20004150, FEBRA20006900, sequences, and thereby the amino acid sequences were FEBRA20008090, FEBRA20012270, FEBRA20015840, determined. SEQ ID NOS corresponding to the respective FEBRA20020860, FEBRA20021910, FEBRA20037070, sequences are shown in Table 1. HHDPC20000950, HLUNG10000240, HLUNG2000 1250, HSYRA20003470, HSYRA20014200, IMR3210001580, EXAMPLE 4 IMR3220007750, IMR3220008590, KIDNE10001430, KIDNE20001670, KIDNE20003300, KIDNE20042620, Functional Prediction by Homology Search KIDNE20054000, KIDNE20060530, KIDNE20066520, 0278 For the determined nucleotide sequences, Gen LIVER10005420, MAMGL10000320, NHNPC20002060, Bank, SwissProt, UniGene, and nr were searched by NT2NE10001630, NT2NE20016260, NT2NE20055170, BLAST. The clones exhibiting higher homology, which NT2RI2000.9740, NT2RI20015400, NT2RI2003.01.10, were convenient to predict their functions based on the NT2RI20042840, NT2RI20053350, NT2RI20070840, nucleotide sequences and deduced amino acid sequences, NT2RI20073030, NT2RI20074980, NT2RI20078270, were selected based on the BLAST search hit data whose P NT2RI20092890, NT2RP70015910, NT2RP70021510, value or Evalue was 10' or lower and for which the length NT2RP70029820, NT2RP70047900, NT2RP70074220, of consensus sequencexhomology=30 or higher in the amino NT2RP70079250, NT2RP70091680, NT2RP70094290, acid database search. Further, from them, representative NT2RP70094980, NT2RP700.95070, NTONG10000980, clones were selected, which are shown as Homology Search NTONG10002140, NTONG10002570, OCBBF10000420, Result Data in the last part herein. Accordingly, the data PANCR10000210, PLACE60020840, PLACE60026990, shown herein are merely the representative data, and the PLACE60043960, PLACE60049930, PLACE60050290, molecule exhibiting homology to each clone is not limited PROST10005260, PROST10005360, PROST20000360, thereto. Further, with respect to a part of clones, the BLAST PROST20029600, PROST20044160, PROST20054260, search hit data that did not meet the criteria as described PROST20058800, SMINT10000160, SPLEN10000910, above are not shown herein. SPLEN20001340, STOMA20002570, TESTI20026320, TESTI20026980, TESTI20027070, TESTI20028660, EXAMPLE 5 TESTI20042870, TESTI20049940, THYMU10000830, UTERU10001920, UTERU20003930, UTERU20004850 Search for Signal Sequence, Transmembrane 0283 The clones whose deduced amino acid sequences Domain and Other Functional Domains in the were detected to have the transmembrane domains by Deduced Amino Acid Sequences SOSUI are as follows. Numerals indicate the numbers of transmembrane domains detected in the deduced amino acid 0279. With respect to the amino acid sequences deduced from the full-length nucleotide sequences, the prediction sequences. Of the search result, the clone name and the was made for the presence of signal sequence at the amino number of transmembrane domains are demarcated by a terminus, the presence of transmembrane domain, and the double slash mark (//). presence of functional protein domains (motifs). The signal 0284) 3NB6910000180/4, 3NB6910000850/1, sequence at the amino terminus was searched for by PSORT 3NB6920000290/2, 3NB6920003300/5, K. Nakai & M. Kanehisa, Genomics, 14: 897-911 (1992): 3NB6920005450/2, ADRGL10000180/71, the transmembrane domain, by SOSUIT. Hirokawa et al., ADRGL10001600/71, ADRGL20003230/2, Bioinformatics, 14: 378-379 (1998) (Mitsui Knowledge BGGI120010970/1, BNGH410000800/2, Industry); the function domain, by Pfam (http://ww BNGH410001040//2, BNGH410001370/1, w.sanger.ac.uk/Software/Pfam/index.shtml). The amino acid BNGH410001980/11, BRACE20007180/1, sequence in which the signal sequence at the amino terminus BRACE20010650/1, BRACE20011170/2, or transmembrane domain had been predicted to be present BRACE20013400/2, BRACE20013520/2, by PSORT or SOSUI were assumed to be a secretory or BRACE20014230/2, BRACE20014530/1, membrane protein. Further, when the amino acid sequence BRACE20014920/1, BRACE20018590/1, hit a certain functional domain by the Pfam functional BRACE20022270/1, BRACE20026850/1, domain search, the protein function can be predicted based BRACE20030780/3, BRACE20031100/10, on the hit data, for example, by referring to the function BRACE20034490/2, BRACE20071380/3, categories on the PROSITE (http://www.expasy.ch/cgi-bin/ BRACE2007 1970/1, BRACE20072810/2, prosite-list.pl). In addition, the functional domain search can BRACE20075020/1, BRACE20075380/3, also be carried out on the PROSITE. BRACE20076410/1, BRACE20076850/1, US 2007/0015163 A1 Jan. 18, 2007 41

BRACE20077610/2, BRACE20077640//2, NT2RI20033830/2, NT2RI20036780/1, BRACE20077980/1, BRACE20086550/1, NT2RI2004.4420/1, NT2RI20049850//2, BRACE20089600/1, BRACE20091880/1, NT2RI20050870/8, NT2RI20051500/1, BRAWH10000010/1, BRAWH10000370/1, NT2RI20066820/1, NT2RI20068250/11, BRAWH10000940/1, BRAWH10001620/1, NT2RI20070480/1, NT2RI20077540/4, BRAWH10001800/1, BRAWH20004.430/8, NT2RI20078790/1, NT2RI20081880/3, BRAWH20006970/71, BRAWH2001 1290/4, NT2RI20085980/3, NT2RI20092890/2, BRAWH20014380/2, BRAWH20015030/2, NT2RI2009.4060/4, NT2RP60000320/10, BRAWH20036930?/1, BRAWH20038320/2, NT2RP60000390/1, NT2RP60001090/1, BRAWH2005998.0/1, BRAWH20087060/1, NT2RP70002380/4, NT2RP70002590//5, BRAWH200926.10/3, CD34C20000510/1, NT2RP70003640/1, NT2RP70004770/4, CTONG20015330/1, CTONG200281 60/2, NT2RP70006240/1, NT2RP70011660/11, CTONG20037820/1, CTONG20047160/4, NT2RP70015910/2, NT2RP70021510/1, FCBBF10006180/3, FCBBF10006750/2, NT2RP70023790/2, NT2RP70026190/1, FCBBF20005910/1, FCBBF20009400/3, NT2RP70043730/3, NT2RP70047900/2, FCBBF20015380/5, FEBRA20004040//2, NT2RP70049250/1, NT2RP70064080/3, FEBRA20004150/3, FEBRA20004520/3, NT2RP7007 1540/12, NT2RP7007 1770/13, FEBRA20004910/2, FEBRA20006560/3, NT2RP70072520/2, NT2RP70073810//3, FEBRA20008800/1, FEBRA20010930//7, NT2RP70075040/4, NT2RP70076170//2, FEBRA2001 2450/3, FEBRA20012940/1, NT2RP70079750/2, NT2RP70081330/2, FEBRA20013510/2, FEBRA20014870/71, NT2RP70081370/8, NT2RP700.85500/2, FEBRA2001584.0//2, FEBRA20020860/2, NT2RP70090120/10, NT2RP700.91490/3, FEBRA20021910/1, FEBRA2003 1550/2, NT2RP700.93220/11, NT2RP700.93730/1, FEBRA20041910/1, FEBRA20063150/1, NT2RP70094.290/1, NT2RP700.94810/12, FEBRA20066670/2, HCASM10000610/2, NT2RP70094980/3, NTONG10002570/2, HCASM20002020/1, HEART20000990/1, NTONG20002650/4, NTONG20004920/1, HEART20004920/2, HHDPC20000950/2, NTONG20008000/1, NTONG 20012220/1, HLUNG10000370/2, HLUNG20001160/1, OCBBF20002310/2, OCBBF2000998.0/1, HLUNG20001420/12, HLUNG20001760/2, OCBBF20012100/2, PLACE50000670/1, HSYRA20003470/1, HSYRA20008280/1, PLACE50001050/1, PLACE60005550//2, HSYRA20011030/1, HSYRA20015800/2, PLACE60012810/2, PLACE60018860//7, IMR3210000440/1, IMR3210001580/2, PLACE6002.0160/1, PLACE60020840/6, IMR3210002660/6, IMR3220008590/1, PLACE60037050/1, PLACE60037450/1, IMR322000984.0/2, KIDNE10001040/1, PLACE60047380/1, PLACE60049930?/1, KIDNE10001430/1, KIDNE20000700/1, PLACE60050290/1, PROST10002200/2, KIDNE20000850/1, KIDNE20001670/7, PROST10002720/71, PROST10005360/1, KIDNE20003150/1, KIDNE20003300//7, PROST20000360/1, PROST20001760/4, KIDNE20003490//4, KIDNE20004220/1, PROST20029600/2, PROST20033020/1, KIDNE20005170/7, KIDNE20033050/2, PROST20039220/3, PROST20044160/1, KIDNE20033570/1, KIDNE20039410//5, PROST20051430/1, PROST20054260//5, KIDNE2004.4110/3, KIDNE2004.8280/12, PROST20059190/3, PROST20059.430/3, KIDNE20049810/2, KIDNE20054770/12, PROST20069.880/1, PROST20072370/1, KIDNE20060530/2, KIDNE20060620/2, PUAEN10000570/1, PUAEN10001610/1, KIDNE20063530/1, KIDNE20066520/2, PUAEN10003220/1, SKMUS20007740/1, KIDNE20067600/1, KIDNE2007 1860/1, SKNMC10000190/1, SKNMC10000290/1, KIDNE20074220/1, KIDNE20075690//5, SKNMC10002290/2, SKNMC10002510/8, LIVER10000580/3, LIVER10000670/1, SMINT10000160/2, SMINT10000420/8, LIVER1000104.0/2, LIVER10001110/1, SMINT10000570/2, SMINT10001180/1, LIVER10001750/1, LIVER20004160/1, SMINT20000180/2, SMINT20002770/3, MAMGL10001780/1, MAMGL10001840//2, SPLEN20001340/1, SPLEN20002430/1, MESAN10001470/1, MESAN10001800//7, SPLEN20002700/1, SPLEN20003100/1, MESAN20001490/2, NB9N420000420/1, SPLEN20004960/2, STOMA 10000520/2, NHNPC20002060/2, NT2NE10000230/1, STOMA10001170/1, STOMA20000320/1, NT2NE10001850/6, NT2NE20003920/1, STOMA20002570/3, SYNOV20001770/2, NT2NE20004550/1, NT2NE20004700/1, TESTI10000420/1, TESTI10000960/1, TESTI20006000// NT2NE20005500/1, NT2NE20012470/2, 1 TESTI20009090/1, TESTI2000.9700//7, NT2NE20014350/1, NT2NE20016260/4, TESTI20011340//5, TESTI20012370/1, TESTI20013520// NT2NE20034080/2, NT2NE20047160/1, 4 TESTI20014200//9, TESTI20016210/2, NT2NE20055170/3, NT2NE20057200/1, TESTI20016710/1, TESTI20018620/2, TESTI20020020// NT2RI20005970/7, NT2RI20014490/11, 2 TESTI20020810/8, TESTI200225.10/3, NT2RI20016570/2, NT2RI20018460/71, TESTI20024670/2, TESTI20025800/2, TESTI20026980// NT2RI20018660/2, NT2RI20021520//7, 2 TESTI20027000/1, TESTI20030370/1, NT2RI20022430/4, NT2RI20022520/3, TESTI20031930, 1, TESTI20042870/3, TESTI20047120// NT2RI2003.01.10/1, NT2RI20030510/2, 5, TESTI2004994.0//2, TESTI20057420/1, US 2007/0015163 A1 Jan. 18, 2007 42

TESTI20058600/76, TESTI20067740//2, TESTI20069780// ASTRO10000180/WD domain, G-beta repeat/WD 3, TESTI20074800//5, TESTI20077490//4, domain, G-beta repeat/WD domain, G-beta repeat/WD TESTI200795.10/3, TESTI20080200//7, TESTI20081440// domain, G-beta repeat 1. TESTI20087740//2, TESTI20088470/2, TESTI20136910/1, THYMU10001760/1, ASTRO20000950/SNAP-25 family THYMU10003290/1, THYMU10003820//4, ASTRO20004170//Ribonuclease T2 family THYMU10005580/4, TRACH10000630/3, TRACH10001000/1, TRACH10001400/1, 0287 BGGI120005330/IMP dehydrogenase/GMP TRACH20001850/2, TRACH20001960/2, reductase N terminus/CBS domain/CBS domain//Dihydro TRACH20004960/2, TRACH2000.6650/11, orotate dehydrogenase/Histidine biosynthesis protein// TRACH20007670/2, TRACH20008980/2, FMN-dependent dehydrogenase/Conserved region in TRACH20015920/2, UMVEN20001330/2, glutamate synthase/IMP dehydrogenase/GMP reductase C UTERU 1000077O//2 terminus 0285) The Names of clones whose deduced amino acid BGGI120005440/Importin beta binding domain sequences were detected to have functional domains with BGGI120006840/Sir2 family Pfam, and the name of hit functional domains areas follows. The search result is indicated as "clone name?/functional BGGI120006930?/Collagen triple helix repeat (20 copies)// domain name'. When the clone has multiple hit functional SAM domain (Sterile alpha motif) domains, they are listed and demarcated by a double slash BGGI120010970//F5/8 type C domain/Laminin G domain// mark (//). When the clone has multiple hits of an identical Laminin G domain/Fibrinogen beta and gamma chains, functional domain, each is listed without abridgment. C-terminal globular domain 3NB6910000180/ FTS-N domain//UBA domain BGGI12001714.0//KRAB box//Zinc finger, C2H2 type/ Zinc finger, C2H2 type/Zinc finger, C2H2 type?/Zinc finger, 3NB6910001160/FSTART domain C2H2 type/Zinc finger, C2H2 type/Transcription factor 3NB6910001290//KRAB box S-II (TFIIS)//Zinc finger, C2H2 type/Zinc finger, C2H2 type 3NB6910001730//RI01/ZK632.3/MJ0444 family BNGH410000290/SPRY domain 3. NB692.0002810//DEAD/DEAH box helicase?/Helicases C onserved C-terminal domain BNGH410000340//Prolyl oligopeptidase family/Phospho lipase/Carboxylesterase 3NB6920009120//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 BNGH410001040//Eukaryotic protein kinase domain type/Frataxin-like domain 0288 BNGH410001180//Low-density lipoprotein recep 3NB6920010020//Regulator of G protein signaling domain tor domain class A//Low-density lipoprotein receptor domain class A/Low-density lipoprotein receptor domain 3NB6920014330//Domain of unknown function class A/WAP-type (Whey Acidic Protein) four-disulfide core/Low-density lipoprotein receptor domain class 3NB692001.4710//DNA binding domain with preference for A/Low-density lipoprotein receptor domain class A//Low A/T rich regions/Zinc finger, C2H2 type density lipoprotein receptor domain class A/Low-density 3NB6920015110//RNA recognition motif. (a.k.a. RRM, lipoprotein receptor domain class A//long chain Scorpion RBD, or RNP domain)//RNA recognition motif. (a.k.a. toxins/Chitin binding Peritrophin-A domain//Low-density RRM, RBD, or RNP domain) lipoprotein receptor repeat class B//Low-density lipoprotein receptor repeat class B//Low-density lipoprotein receptor 0286 3.NB6920015570//KRAB box//Zinc finger, C2H2 repeat class B//Low-density lipoprotein receptor repeat class type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc B//Low-density lipoprotein receptor repeat class B finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 BNGH410001370//Filamin/ABP280 repeat. type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc 0289 BNGH410001770/IMP dehydrogenase/GMP finger, C2H2 type reductase N terminus/CBS domain/CBS domain//Dihydro ADRGL10000020//BTB/POZ domain//Kelch motif Kelch orotate dehydrogenase/Histidine biosynthesis protein// motif FMN-dependent dehydrogenase/Conserved region in glutamate synthase/IMP dehydrogenase/GMP reductase C ADRGL10000650/Zinc finger, C2H2 type/Zinc finger, terminus C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc BNGH410001900//Viral (Superfamily 1) RNA helicase finger, C2H2 type BNGH410001980//POT family/Bacteriorhodopsin/Sugar ADRGL10001600/Cytochrome P450/Cytochrome P450 (and other) transporter ADRGL10001650/Urease?/Chlorohydrolase/Dihydrooro BNGH420005320/SCAN domain//KRAB box//Zinc finger, C2H2 type/GATA zinc finger//Zinc finger, C2H2 type/Zinc tase-like finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, ADRGL20000740//Dockerin domain type I/RhoGAP C2H2 type/Transcription factor S-II (TFIIS)//Zinc finger, domain C2H2 type US 2007/0015163 A1 Jan. 18, 2007

BRACE 10000420/Fatty acid desaturase//Protein phos BRACE2007 6630//PH domain phatase 2C BRACE20080970//Phosphofructokinase BRACE 10000930//Zinc finger, C3HC4 type (RING fin ger)/(TRAF-type zinc finger?/TRAF-type zinc finger// BRACE20083800//Fibronectin type III domain MATH domain BRACE20083850//bZIP transcription factor/Homeobox BRACE 10001150//DNA gyrase/topoisomerase IV, subunit associated leucine Zipper A/Nucleosome assembly protein (NAP) BRACE20084430//Thioredoxin?/Thioredoxin BRACE 10001660//Zinc finger, C2H2 type BRACE2O092.1207/3'-5' exonuclease/Adenylylsulfate BRACE20002800/IQ calmodulin-binding motif kinase//Protein of unknown function DUF82 BRACE20005650/ATP synthase ab C terminal BRACE20093610//Bacterial type II secretion system pro tein BRACE20006980/Ank repeat/Ank repeat/Ank repeat/ Ank repeat/Ank repeat/Ank repeat BRAWH10000940/Rieske [2Fe-2S domain/Phosphoglu cose isomerase/FAD binding domain/Pyridine nucleotide BRACE20007180/Calcitonin/CGRP/IAPP family disulphide oxidoreductase//Phytoene dehydrogenase related BRACE20008.850/Zinc finger, C3HC4 type (RING finger) enzyme BRAWH10OO1300//PH domainHARhoGAP domain/Tro BRACE2001 0650//F-box domain. pomyosins BRACE20013750//Hepatitis C virus non-structural protein NS4a BRAWH10001620/alpha/beta hydrolase fold BRACE20014920//Protein-tyrosine phosphatase BRAWH10001640//KRAB box/ENV polyprotein (coat polyprotein) BRACE2001855.0/Ank repeat/Ank repeat/Ank repeat/ Ank repeat/Ank repeat BRAWH10001680//Homeobox domain BRACE20018590/Transmembrane 4 family BRAWH20000480/Transposase/Kinesin motor domain BRACE20019440//Protein of unknown function DUF82 BRAWH20001770/Serine hydroxymethyltransferase BRACE20020910//Zinc finger, C3HC4 type (RING fin BRAWH20003230/Wiskott Aldrich syndrome homology ger)//Zinc finger, C3HC4 type (RING finger)//E7 protein, region 2 Early protein//B-box zinc finger. BRAWH20004.430/Lectin (probable mannose binding)// BRACE20022020//Eukaryotic protein kinase domain Surfactant associated polypeptide BRACE20024090//Homeobox domain BRAWH20004760//Zinc finger, C2H2 type/Zinc finger, C2H2 type BRACE20024680/Similarity to lectin domain of ricin beta chain, 3 copies. BRAWH20006330//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 BRACE20026850//short chain dehydrogenase type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc BRACE20027720/Metallo-beta-lactamase superfamily finger, C2H2 type/Zinc finger, C2H2 type BRACE20027920?/FGGY family of carbohydrate kinases BRAWH2OOO651OFFHMGL-like BRACE2002812O//Ras family/ADP-ribosylation factor BRAWH20006860/Eukaryotic protein kinase domain/Pro family tein kinase C terminal domain BRACE20031100//Domain of unknown function DUF20// BRAWH2000984.0/Cytochrome P450 Patched family BRAWH20011660/Glycosyl hydrolases family 35 0290 BRACE2007 1740//KRAB box//Zinc finger, C2H2 BRAWH20012030/Phorbol esters/diacylglycerol binding type/Transcription factor S-II (TFIIS)//Zinc finger, C2H2 domain (C1 domain)//Zinc finger, C3HC4 type (RING fin type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc ger)//PHD-finger finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 BRAWH20014180//Adenosine-deaminase (editase) domain type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc BRAWH20014610//TS-N domain//UBA domain finger, C2H2 type/Zinc finger, C2H2 type BRAWH2001484.0/Glycosyltransferases/Similarity to lec BRACE20074010//EF hand//EF hand/Mitochondrial car rier proteins/Mitochondrial carrier proteins/Mitochondrial tin domain of ricin beta-chain, 3 copies. carrier proteins BRAWH2003.6890//Protein phosphatase 2C BRACE2007.4470//Cadherin domain/Cadherin domain// BRAWH2005998.0/CUB domain/Low-density lipoprotein Glutathione peroxidases/Cadherin domain receptor domain class A/CUB domain/Low-density lipo protein receptor domain class A/FZ domain BRACE20076410/Sushi domain (SCR repeat)/Sushi domain (SCR repeat)//Sushi domain (SCR repeat) BRAWH20060440/PPR repeat US 2007/0015163 A1 Jan. 18, 2007 44

BRAWH20064.500//Nuclear transition protein 2//HMG finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, (high mobility group) box C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/AN1-like Zinc finger//Zinc finger, C2H2 type/Zinc BRAWH20076.050//Keratin, high sulfur B2 protein finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, BRAWH2008.9560/Poly-adenylate binding protein, unique C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type domain.//Magnesium chelatase, subunit ChII//Uncharacter ized protein family UPF0034//KE2 family protein/Formin FCBBF10006870/Corticotropin-releasing factor family Homology 2 Domain FCBBF2000094.0//Homeobox domain BRAWH20093600/Family 4 glycosyl hydrolase FCBBF2OOO232OFFT-box CD34C20000510//Glycosyl hydrolases family 18/Glycosyl FCBBF20002760//Kelch motif//Kelch motif//Kelch motif hydrolases family 18/Chitin binding Peritrophin-A domain FCBBF20005910/Adenylate kinase/Viral (Superfamily 1) CTONG20005890/DNA gyrase/topoisomerase IV, subunit RNA helicase?/TPR Domain//TPR Domain A/PDZ domain (Also known as DHR or GLGF)./PDZ FCBBF20008150/LIM domain containing proteins/LIM domain (Also known as DHR or GLGF). domain containing proteins/LIM domain containing pro CTONG20011390//Prokaryotic dkSA/traRC4-type zinc fin teins ger/Hepatitis C virus non-structural protein NS2 FCBBF200095.10//KRAB box//Zinc finger, C2H2 type/ CTONG 2001 3200//Uncharacterized protein family Zinc finger, C2H2 type/Zinc finger, C2H2 type//PHD UPFOO20 finger//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc CTONG20018200//PHD-finger//PHD-finger/PWWP finger, C2H2 type/Zinc finger, C2H2 type domain/SET domain FCBBF20012110/Myc amino-terminal region 0291 CTONG2001955.0//Spectrin repeat//Xylose FCBBF20015380/GNS1/SUR4 family isomerase/Spectrin repeat/Spectrin repeat/Spectrin repeat/Flagellar hook-associated protein 2//Adhesin lipo FCBBF20016720//Domain of unknown function DUF94 protein/Spectrin repeat/Spectrin repeat/Protein of FCBBF40002820//Electron transfer flavoprotein beta sub unknown function DUF118//Spectrin repeat/Bacterial unit flagellin N-terminus/Spectrin repeat/Spectrin repeat/Spec 0294 FCBBF50002610//Zinc finger, C2H2 type/Zinc trin repeat/Caulimovirus movement protein/Spectrin finger, C2H2 type/Zinc finger, C2H2 type//PHD-finger// repeat Zinc finger, C2H2 type/Zinc finger, C2H2 type/Transcrip CTONG20025580//Zinc finger, C2H2 type/Zinc finger, tion factor S-II (TFIIS)//Zinc finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, C2H2 type/PHD-finger//Zinc fin C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 ger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc type/Zinc finger, C2H2 type finger, C2H2 type/Zinc finger, C2H2 type CTONG 20028030//Domain of unknown function DUF19// FEBRA20000530//BTB/POZ domain//Kelch motif (Kelch Ribosomal protein S18 motif (Kelch motifi/Kelch motif (Kelch motif CTONG20O281 607/Cadherin domain?/Cadherin domain// FEBRA200010507/TPR Domain/FTPR Domain//TPR Cadherin domain/Cadherin domain/Cadherin cytoplasmic Domain/TPR Domain/PPR repeat/TPR Domain region FEBRA20003770//Ank repeat/Iron/manganese superoxide CTONG20028200//Papain family cysteine protease/E2 dismutases (SODM)//Ras association (RalGDS/AF-6) (early) protein, N terminal//T-box domain/FERM domain (Band 4.1 family) CTONG20037820//Neurotransmitter-gated ion-channel/ 0295) FEBRA20003970//Zinc finger, C2H2 type/Zinc Neurotransmitter-gated ion-channel finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 CTONG 20047160/FPCI domain/Latrophilin/CL-1-like type/Zinc finger, C2H2 type/Transcription factor S-II GPS domain (TFIIS)//Zinc finger, C2H2 type/Zinc finger, C2H2 type/7 0292 CTONG20055530/Ank repeat/Ank repeat/Ank Zinc finger, C2H2 type/TRAF-type zinc finger//Zinc finger, repeat/Ank repeat/Ank repeat/Ank repeat/Pyridoxal-de C2H2 type pendent decarboxylase conserved domain/Ank repeat/Ank FEBRA20003990//Zinc finger, C2H2 type/Zinc finger, repeat/Ank repeat/Ank repeat/Ank repeat/Ank repeat/ C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 Ank repeat/Ank repeat/Ank repeat type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc CTONG 20064.490/IPCI domain D3OST20001840//RNA finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, recognition motif. (a.k.a. RRM, RBD, or RNP domain) C2H2 type DFNES20002120//Queuine tRNA-ribosyltransferase FEBRA200041507/STAS domain 0296 FEBRA20004540//Zinc finger, C2H2 type/Zinc DFNES20002680//Protozoan/cyanobacterial globin/KE2 finger, C2H2 type?/BolA-like protein//Zinc finger, C2H2 family protein//Adhesin lipoprotein type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc 0293 FCBBF10005980//KRAB box//Zinc finger, C2H2 finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc C2H2 type/Transcription factor S-II (TFIIS)//Zinc finger, US 2007/0015163 A1 Jan. 18, 2007

C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 0300 FEBRA20050140//Zinc finger, C2H2 type/Zinc type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, finger, C2H2 type/Zinc finger, C2H2 type C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc FEBRA20005360/Cystatin domain finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, FEBRA20007330//EF hand//EF hand C2H2 type/Zinc finger, C2H2 type FEBRA20007870//Zinc finger, C2H2 type/Zinc finger, FEBRA20050790//Protein-tyrosine phosphatase/Dual C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 specificity phosphatase, catalytic domain type/Zinc finger, C2H2 type FEBRA20057260//TBC domain FEBRA20008560//Importin beta binding domain/Arma FEBRA2005788.0//PDZ domain (Also known as DHR or dillo/beta-catenin-like repeats GLGF). FEBRA2000881.0//Actin FEBRA20060920//DIX domain 0297 FEBRA20009720//KRAB box//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc FEBRA20062700//haloacid dehalogenase-like hydrolase finger, C2H2 type/Zinc finger, C2H2 type/BolA-like pro 0301 FEBRA20064760//Zinc finger, C2H2 type/Zinc tein//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/DM DNA binding C2H2 type/Zinc finger, C2H2 type domain//Zinc finger, C2H2 type/Zinc finger, C2H2 type?/ Zinc finger, C2H2 type/Zinc finger, C2H2 type?/Zinc finger, FEBRA20011330/Trypsin and protease inhibitors//PCI C2H2 type/GATA zinc finger//Zinc finger, C2H2 type/Zinc domain finger, C2H2 type/Zinc finger, C2H2 type//PHD-finger// FEBRA20011460/7SCAN domain Zinc finger, C2H2 type/Zinc finger, C2H2 type/Transcrip tion factor S-II (TFIIS)//Zinc finger, C2H2 type?/Zinc finger, 0298 FEBRA20012450/Leucine rich repeat N-terminal C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type domain/Leucine Rich Repeat/Leucine Rich Repeat/Leu cine Rich Repeat/Leucine Rich Repeat/Leucine Rich FEBRA20066670/Transthyretin precursor (formerly preal Repeat/Leucine Rich Repeat/Leucine Rich Repeat/Leu bumin) cine rich repeat C-terminal domain//Immunoglobulin FEBRA20067360//KRAB box//Zinc finger, C2H2 type/ domain//Fibronectin type III domain Zinc finger, C2H2 type/Zinc finger, C2H2 type?/Zinc finger, FEBRA20014920/S-adenosylmethionine synthetase C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc FEBRA2001584.0//EGF-like domain//EGF-like domain// finger, C2H2 type EGF-like domain//EGF-like domain//EB module?/EGF-like domain//EGF-like domain 0302 FEBRA20069420//KRAB box//Zinc finger, C2H2 type/Ribosomal protein L37e/Zinc finger, C2H2 type/Zinc FEBRA20017060//Immunoglobulin domain finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, 0299 FEBRA20017150/Zinc finger, C3HC4 type C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 (RING finger)//Zinc finger, C3HC4 type (RING finger)// type/Zinc finger, C2H2 type/Zinc finger, C2H2 type Insulin-like growth factor binding proteins/B-box zinc fin FEBRA20070170//PX domain ger//CONSTANS family Zinc finger//B-box zinc finger// Putative zinc finger in N-recognin//Fibronectin type III FEBRA20072000/7TPR Domain/FTPR Domain//TPR domain//SPRY domain Domain//TPR Domain/7TPR Domain//TPR Domain FEBRA20019890//PH domain/Putative GTP-ase activating FEBRA20075510//Ras family protein for Arf7/Ank repeat/Ank repeat HCASM20002140/Cyclin FEBRA20024290//RNA polymerase alpha subunit HCASM20003070//RNA recognition motif. (a.k.a. RRM, FEBRA20024.420//GMC oxidoreductases RBD, or RNP domain) FEBRA20025250//TBC domain HEART20004110/POT family FEBRA20034290/CAP-Gly domain HEART20005060/Occludin/ELL family//K-box region FEBRA20043250/Ank repeat/Ank repeat/Ank repeat/ HEART20005680//Nerve growth factor family Ank repeat/Ank repeat/Homeobox associated leucine Zip HHDPC20000550//Viral (Superfamily 1) RNA helicase/ per NB-ARC domain//Adenylate kinase/Adenylate kinase FEBRA20043290//Myosin tail/lactate/malate dehydroge HHDPC20000950//Extracellular link domain/Lectin nase/Troponin//Domain present in Hsp70 regulators/Inter C-type domain leukin-6/G-CSF/MGF family/Myosin tail HHDPC20001150/Collagen triple helix repeat (20 copies)// FEBRA20044900//Pou domain N-terminal to homeobox C1q domain domain/Spectrin repeat/Spectrin repeat HHDPC20001490//UBA domain/Integrase Zinc binding FEBRA20045920//Glycoprotease family domain//IBR domain/IBR domain US 2007/0015163 A1 Jan. 18, 2007 46

HHDPC20003150/Zn-finger in Ran binding protein and IMR321.0002420//KRAB box//Zinc finger, C2H2 type/Zinc others.//Zinc knuckle finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 HHDPC20004550/FERM domain (Band 4.1 family) type/Zinc finger, C2H2 type HHDPC20004560/2S seed storage family IMR321.0002660/Cation efflux family HHDPC20004620//FAD binding domain IMR3220002230/FHA domain/HIT family HLUNG10000240/Transforming growth factor beta like IMR3220003020/Src homology domain 2 domain IMR3220007420//Zinc finger, C2H2 type HLUNG10000370/7TPR Domain/FTPR Domain/FTPR Domain//TPR Domain IMR3220007750//Nerve growth factor family//Kazal-type serine protease inhibitor domain/Thyroglobulin type-1 HLUNG10000760//HMG (high mobility group) box repeat/EF hand//Immunoglobulin domain/Immunoglobu HLUNG10000990/Adenosylmethionine decarboxylase lin domain 0303 HLUNG20000680/KRAB box//Zinc finger, C2H2 IMR3220008380/Formyl transferase type/Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD IMR3220009190/Influenza Matrix protein (M1)//metal finger//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc lopeptidase family M24 finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type IMR322000973.0//Kinesin motor domain HLUNG20001420/REV protein (anti-repression trans-acti IMR3220012.180//tRNA pseudouridine synthase vator protein)//Bacteriorhodopsin?/Photosystem II reaction IMR3220013170//Dual specificity phosphatase, catalytic centre T protein/Sugar (and other) transporter?/FecCD domain transport family KIDNE1000 1040/Myb-like DNA-binding domain/Apoli HLUNG20001760/Transthyretin precursor (formerly preal poprotein A1/A4/E family/Thymidylate kinase/SNAP-25 bumin) family/Syntaxin HLUNG20002550/Trypsin KIDNE20000410/Aminotransferases class-II pyridoxal phosphate HSYRA10001190/TBC domain 0305 KIDNE20000510//Zinc finger, C2H2 type/Zinc 0304 HSYRA10001370//KRAB box//Zinc finger, C2H2 finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, type/Zinc finger, C2H2 type//Zinc finger, C2H2 type//PHD C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 finger//Zinc finger, C2H2 type/Zinc finger, C2H2 type?/ type/AN1-like Zinc finger//Zinc finger, C2H2 type/Zinc BolA-like protein//Zinc finger, C2H2 type/Zinc finger, finger, C2H2 type/PHD-finger//Zinc finger, C2H2 type?/ C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 Zinc finger, C2H2 type/Zinc finger, C2H2 type?/Zinc finger, type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type C2H2 type KIDNE20001670/Sugar (and other) transporter HSYRA10001680//DEAD/DEAH box helicase KIDNE20003150/Major intrinsic protein HSYRA10001780/Alpha-2-macroglobulin family N-termi nal region KIDNE20003300//DnaJ domain HSYRA2OOO135OFFF-box domain.//Kelch motif (Kelch KIDNE20003490//Ubiquitin family/Viral matrix protein// motif (Kelch motif Src homology domain 2//Acyltransferase HSYRA20005100//UVrD/REP helicase KIDNE20003750/C2 domain HSYRA20013320/Insulin-like growth factor binding pro KIDNE200040307/RNA helicase teins/Thyroglobulin type-1 repeat KIDNE20004970//Kinesin motor domain//K-box region HSYRA2001.4760//von Willebrand factor type A domain KIDNE20005130/Aminotransferases class-III pyridoxal HSYRA2001 5740/Glucosamine-6-phosphate isomerase phosphate/Aminotransferases class-III pyridoxal-phosphate KIDNE20005170/Uncharacterized membrane protein fam HSYRA2001 6210//HesB-like domain ily UPF0013 HSYRA20016310//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/PHD-finger//Zinc fin KIDNE20031850//Ras association (RalGDS/AF-6) domain ger, C2H2 type//Phorbol esters/diacylglycerol binding KIDNE200330507/Amidase/Amidase domain (C1 domain)//Zinc finger, C2H2 type KIDNE200337307/SH3 domain? (RhoGEF domain//PH IMR3210000440/ATP1G1/PLM/MATS family//Eukaryotic domain protein kinase domain KIDNE2003994.0//DNA gyrase/topoisomerase IV, subunit IMR3210001580//Extracellular link domain/Lectin C-type A/SCAN domain//Zinc finger, C2H2 type?/Zinc finger, domain C2H2 type US 2007/0015163 A1 Jan. 18, 2007 47

KIDNE20040840//Eukaryotic protein kinase domain/Phos LIVER20000330/Peptidase family M1//K+ channel tet phoribulokinase/Myosin head (motor domain)//Myosin ramerisation domain head (motor domain) LIVER20000370/Immunoglobulin domain/Immunoglobu KIDNE20043440//Ribosomal protein L36 lin domain//Immunoglobulin domain KIDNE2004.4110//Viral methyltransferase/V-type ATPase MAMGL10000560//K-box region MAMGL10001780/Lu 116 kDa subunit family menal portion of Cytochrome b559, alpha (gene psbE) KIDNE200468.10/Dienelactone hydrolase family Subunit. KIDNE2004.8280/Amino acid permease?/Sodium MAMGL10001820//DIX domain :neurotransmitter symporter family MESAN10000350//Neurohypophysial hormones, C-termi KIDNE20050420//Herpesvirus UL25 family/Beige/ nal Domain BEACH domain//WD domain, G-beta repeat//WD domain, MESAN10001800/Sterol O-acyltransferase G-beta repeat/WD domain, G-beta repeat//WD domain, MESAN20000920/SAM domain (Sterile alpha motif)// G-beta repeat/WD domain, G-beta repeat/AN1-like Zinc PDZ domain (Also known as DHR or GLGF)./Phosphati finger//FYVE Zinc finger dylinositol 3- and 4-kinases KIDNE20052960?/Actin MESAN2OOO5O1 OF/PWWP domain KIDNE20054770/Transmembrane amino acid transporter NB9N410000470//WD domain, G-beta repeat/WD protein/Ion transport protein/Amino acid permease domain, G-beta repeat/WD domain, G-beta repeat/WD KIDNE20056290/Acetyltransferase (GNAT) family domain, G-beta repeat KIDNE20056760/Calponin homology (CH) domain NB9N410001350//lactate/malate dehydrogenase/Ras fam ily KIDNE20059080/Armadillo/beta-catenin-like repeats/Ar madillo/beta-catenin-like repeats/Armadillo/beta-catenin NB9N42000 1040//Na+/K+ ATPase C-terminus like repeats NHNPC1000084.0//RNA recognition motif. (a.k.a. RRM, KIDNE20060140//WD domain, G-beta repeat/WD RBD, or RNP domain)//RNA recognition motif. (a.k.a. domain, G-beta repeat/WD domain, G-beta repeat/WD RRM, RBD, or RNP domain) domain, G-beta repeat/WD domain, G-beta repeat NHNPC20002060//DnaJ domain KIDNE20060300//MutT-like domain 0306 NHNPC20002120//Zinc finger, C2H2 type/Zinc KIDNE20060530/Glycosyl transferase family 8 finger, C2H2 type/Zinc finger, C2H2 type//Putative zinc finger in N-recognin//Zinc finger, C2H2 type/Zinc finger, KIDNE20061490/ISPRY domain C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 KIDNE20062480/Scorpion short toxins type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, KIDNE200629907/PH domain C2H2 type KIDNE2006652O//Bacterial extracellular solute-binding NT2NE1 OOOO140/7Zinc knuckle?/Nucleotidyltransferase proteins, family 5 domain//Zinc knuckle KIDNE20067600//Immunoglobulin domain//Immunoglo NT2NE10000730/Leucine Rich Repeat/Leucine Rich bulin domain Repeat/Leucine Rich Repeat KIDNE2OO7352O//WW domain NT2NE10000830/7 transmembrane receptor (rhodopsin family) KIDNE20075690//PMP-22/EMP/MP20/Claudin family KIDNE20078100//Ribosomal protein L15/Integrase core NT2NE10001850//Divalent cation transporter/TPR domain/fdUTPase Domain//TPR Domain/7TPR Domain//TPR Domain/7TPR Domain//TPR Domain/7TPR Domain//TPR Domain/7TPR KIDNE20078110//KRAB box//Zinc finger, C2H2 type/ Domain//TPR Domain Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/PHD-finger//Zinc finger, C2H2 type NT2NE20001740//RNA pseudouridylate synthase NT2NE20002140//Rhodanese-like domain//Protein-ty LIVER10000670//Urocanase rosine phosphatase/Dual specificity phosphatase, catalytic LIVER1000 1040/AMP-binding enzyme domain LIVER10002300//Respiratory-chain NADH dehydrogenase NT2NE20002590//Zinc finger, C2H2 type/Zinc finger, 51 Kd Subunit C2H2 type?/Zinc finger, C2H2 type/TRAF-type zinc fin LIVER10004330/Cyclic nucleotide-binding domain/Glu ger//Zinc finger, C2H2 type tathione S-transferases.//Uncharacterized protein family NT2NE20003690/Carbamoyl-phosphate synthase UPFOO28 (CPSase) LIVER10005420//Bowman-Birk serine protease inhibitor NT2NE2000384077TPR Domain/FTPR Domain/FTPR family Domain US 2007/0015163 A1 Jan. 18, 2007 48

NT2NE20005360//Ribosomal protein S2 finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, NT2NE20005500//Retroviral aspartyl protease/Retroviral C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 aspartyl protease type/Zinc finger, C2H2 type NT2NE20006580//Zinc finger, C3HC4 type (RING finger)// NT2RI20014090//ROK family/Spectrin repeat/Tropomyo ICE-like protease (caspase) p10 domain/SPRY domain sins/Spectrin repeat/Spectrin repeat NT2NE20007630//Matrix protein (MA), p.15 NT2RI2001.4500/Xylose isomerase 0307 NT2NE20008090//KRAB box//Zinc finger, C2H2 NT2RI2OO15400//TPR Domain type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc NT2RI20015950//Keratin, high sulfur B2 protein finger, C2H2 type/Zinc finger, C2H2 type//PHD-finger// Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, NT2RI20016210//Bacterial regulatory proteins, luxR family C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 NT2RI20016570//DnaJ central domain (4 repeats) type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc NT2RI20018460/7Clutamine synthetase/Notch (DSL) finger, C2H2 type domain//Notch (DSL) domain NT2NE2OO13370/ESPRY domain NT2RI20018660/Immunoglobulin domain/SPRY domain NT2NE20013720/Tryptophan synthase alpha chain/Ribu lose-phosphate 3 epimerase family/Indole-3-glycerol phos NT2RI20020220/Phosphatidylinositol-specific phospholi phate synthases pase C, X domain NT2NE20016260//7 transmembrane receptor (rhodopsin NT2RI20025170/PDZ domain (Also known as DHR or family) GLGF)./PDZ domain (Also known as DHR or GLGF). NT2NE20016660//DEAD/DEAH box helicase NT2RI20025300/Ubiquitin family 0310 NT2RI20025410//Zinc finger, C2H2 type/Zinc NT2NE20034080//EGF-like domain/Laminin EGF-like finger, C2H2 type//Putative zinc finger in N-recognin//Zinc (Domains III and V) finger, C2H2 type/Zinc finger, C2H2 type/Transcription NT2NE20047160/Glycosyl transferase family 8 factor S-II (TFIIS)//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zn-finger in ubiquitin-hydrolases and other pro NT2NE20053710/Ank repeat teins/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc NT2NE20057200//Ubiquitin-conjugating finger, C2H2 type/Zinc finger, C2H2 type mismatch repair proteins, mutS family NT2RI2OO25540, FTPR Domain//TPR Domain//TPR NT2RI10000270//Zinc finger C-x8-C-x5-C-X3-H type (and Domain similar). NT2RI20025850/mN domain/imjC domain NT2RI10000480//Dual specificity phosphatase, catalytic NT2RI2002958.0//C2 domain/C2 domain domain 0308 NT2RI20003410//Zinc finger, C2H2 type/Zinc NT2RI2002.9700//EF hand//EF hand finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, NT2RI2003.01.10//Immunoglobulin domain C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc NT2RI2003 1540/Interleukin-6/G-CSF/MGF family finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, NT2RI20032050/Armadillo/beta-catenin-like repeats/Ar C2H2 type/Zinc finger, C2H2 type/DM DNA binding madillo/beta-catenin-like repeats domain//Zinc finger, C2H2 type/Zinc finger, C2H2 type?/ NT2RI20033440/PDZ domain (Also known as DHR or Zinc finger, C2H2 type//PHD-finger//Zinc finger, C2H2 type GLGF). NT2RI20004120//ENTH domain//DNA polymerase (viral) NT2RI20036780/Subtilase family//Proprotein convertase C-terminal domain P-domain NT2RI20004210//KRAB box//Zinc finger, C2H2 type/Zinc 0311 NT2RI20036950/Leucine Rich Repeat/Leucine finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, Rich Repeat/Leucine Rich Repeat/Leucine Rich Repeat// C2H2 type/Zinc finger, C2H2 type Leucine Rich Repeat/Leucine Rich Repeat/Insulin/IGF/ NT2RI2OOO6690//Plant thionins Relaxin family/Ribosomal RNA adenine dimethylases// NT2RI20006850/Collagen triple helix repeat (20 copies)// SAM domain (Sterile alpha motif)/TFIIE alpha subunit/7 Histone-like transcription factor (CBF/NF-Y) and archaeal Zinc finger, C3HC4 type (RING finger) histone NT2RI20037510/Formamidopyrimidine-DNA glycosylase NT2RI20010100/Carboxylesterases/Carboxylesterases NT2RI20046060//K+ channel tetramerisation domain 0309 NT2RI20010830//KRAB box//Zinc finger, C2H2 NT2RI2004985.0//Domain of unknown function type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, NT2RI20050610/Peptidase family M1 C2H2 type/Zinc finger, C2H2 type/Transcription factor NT2RI20050870//Voltage gated chloride channels/Xan S-II (TFIIS)//Zinc finger, C2H2 type/Zinc finger, C2H2 thine/uracil permeases family/Sulfate transporter family// type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc STAS domain US 2007/0015163 A1 Jan. 18, 2007 49

NT2RI20051500/Sialyltransferase family/Photosynthetic NT2RI20074980/FZ domain/Zinc carboxypeptidase/Zinc reaction center protein carboxypeptidase NT2RI20053680//Zinc finger, C2H2 type NT2RI20078270/Acyl-CoA oxidase NT2RI20055640//Glutathione S-transferases.//Protein of NT2RI2007884.0//Homeobox domain/Bacterial regulatory unknown function DUF61//Glutathione S-transferases. proteins, crp family/Site-specific recombinases/Bacterial NT2RI20056470//bZIP transcription factor/Transposase/ regulatory proteins, luxR family bZIP transcription factor/Outer membrane efflux protein// NT2RI20078910//WD domain, G-beta repeat/WD domain, Intermediate filament proteins G-beta repeat/WD domain, G-beta repeat/WD domain, NT2RI20058110/Guanine nucleotide exchange factor for G-beta repeat/WD domain, G-beta repeat Ras-like GTPases; N-terminal motifi/RasGEF domain NT2RI20080500//Immunoglobul in domain//Immunoglo NT2RI20060710//Zinc finger, C2H2 type/Zinc finger, bul in domain/Immunoglobulin domain//Immunoglobulin C2H2 type?/Zinc finger, C2H2 type/TRAF-type zinc fin domain//Immunoglobulin domain//Immunoglobulin domain ger//Zinc finger, C2H2 type/Zinc finger, C2H2 type NT2RI20083360//b7IP transcription factor NT2RI20062 100/Src homology domain 2 NT2RI20084810/Acyltransferase NT2RI20064120/Ras family/Cell division protein NT2RI20085980//Bacterial regulatory proteins, crp family// NT2RI20066790/Immunoglobulin domain CUB domain/F5/8 type C domain NT2RI20067030/L1 (late) protein NT2RI200871.407/SET domain 0312 NT2RI20067350/Zinc finger, C2H2 type/Zinc NT2RI20088120//Bindin//HupF/HypC family finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, NT2RI20089420/Immunoglobulin domain/PKD domain C2H2 type/TRAF-type zinc finger//Zinc finger, C2H2 0315 NT2RI20090650/Zinc finger, C2H2 type/Zinc type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, finger, C2H2 type/Zinc finger, C2H2 type C2H2 type/Zinc finger, C3HC4 type (RING finger)//Zinc NT2RI20068250//Dolichyl-phosphate-mannose-protein finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, mannosyltransferase?/S-adenosylmethionine synthetase C3HC4 type (RING finger)//Zinc finger, C2H2 type//Puta tive zinc finger in N-recognin//Zinc finger, C2H2 type/Zinc NT2RI2006855.0//Helicases conserved C-terminal domain finger, C2H2 type/Zinc finger, C2H2 type NT2RI20070480/Atrial natriuretic peptide NT2RI2009 1440/ISPRY domain NT2RI20070840/Immunoglobulin domain NT2RI20092150/SCAN domain/Integrase core domain NT2RI20070960//Hydroxymethylglutaryl-coenzyme A 0316 NT2RI20092890/Leucine rich repeat N-terminal reductase/RhoGEF domain//Hpt domain/PH domain domain/Leucine Rich Repeat/Leucine Rich Repeat/Leu 0313 NT2RI20071330//KRAB box//Zinc finger, C2H2 cine Rich Repeat/Leucine Rich Repeat/Leucine Rich type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc Repeat/Leucine Rich Repeat/Leucine Rich Repeat/Leu finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, cine Rich Repeat/Leucine Rich Repeat/Leucine Rich C2H2 type/Zinc finger, C2H2 type/Transcription factor Repeat/Leucine Rich Repeat/Leucine Rich Repeat/Leu S-II (TFIIS)//Zinc finger, C2H2 type/Zinc finger, C2H2 cine rich repeat C-terminal domain//Immunoglobulin type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc domain finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 NT2RI20094060//DHHC zinc finger domain type/Zinc finger, C2H2 type/Zinc finger, C2H2 type NT2RP60000320/Cytochrome c oxidase subunit III/7 NT2RI2007 1480//WD domain, G-beta repeat/WD domain, transmembrane receptor (Secretin family)//Domain found in G-beta repeat/WD domain, G-beta repeat//WD domain, Dishevelled, Egl-10, and Pleckstrin G-beta repeat/WD domain, G-beta repeat//WD domain, NT2RP60000720/Molluscan rhodopsin C-terminal tail G-beta repeat NT2RP60000860//Ubiquitin-conjugating enzyme NT2RI20072540//Ribosomal RNA adenine dimethylases/ 0317 NT2RP60001000//KRAB box//Zinc finger, C2H2 SAM domain (Sterile alpha motif)/TFIIE alpha subunit/7 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc Zinc finger, C3HC4 type (RING finger) finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, NT2RI20073840//Eukaryotic protein kinase domain C2H2 type/TRAF-type zinc finger//Zinc finger, C2H2 0314 NT2RI20074390//Zinc finger, C2H2 type/Zinc type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 C2H2 type type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc NT2RP60001090//BTB/POZ domain/HMG (high mobility finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, group) box//Kelch motif//Kelch motif//Kelch motif?/Kelch C2H2 type/Zinc finger, C2H2 type motif (Kelch motif NT2RI20074690//Ubiquinol-cytochrome C reductase com NT2RP60001.230/7TPR Domain//TPR Domain/FTPR plex 14 kD subunit Domain/TPR Domain/PPR repeat/TPR Domain

US 2007/0015163 A1 Jan. 18, 2007 51

C2H2 type/Zinc finger, C2H2 type//Putative zinc finger in NT2RP70091490/Sugar (and other) transporter N-recognin//Zinc finger, C2H2 type/DM DNA binding 0325 NT2RP70092360//Immunoglobulin domain/Im domain//Zinc finger, C2H2 type munoglobulin domain//Immunoglobulin domain/Immuno NT2RP7007 1770/STAT protein//Zinc finger, C3HC4 type globulin domain/Immunoglobulin domain//Immunoglobu (RING finger) lin domain//Thioredoxin//Immunoglobulin domain// Immunoglobulin domain/Immunoglobulin domain// NT2RP70072210//Viral (Superfamily 1) RNA helicase Thioredoxin//Immunoglobulin domain//Adenovirus E3 NT2RP7007252O//PAS domain//PAS domain//PAS region protein CR1//Immunoglobulin domain//Immunoglo domain//Eukaryotic protein kinase domain bulin domain//Immunoglobulin domain//Immunoglobulin domain NT2RP70074060/Glutamine synthetase NT2RP70093220/CbiM/Voltage gated chloride channels/ NT2RP70075370//Zinc finger, C3HC4 type (RING finger)// CBS domain//CBS domain B-box zinc finger/CONSTANS family Zinc finger/Putative Zinc finger in N-recognin/SPRY domain NT2RP70093700//WD domain, G-beta repeat/Virion host shutoff protein//WD domain, G-beta repeat//WD domain, NT2RP70076100/SAM domain (Sterile alpha motif) G-beta repeat/WD domain, G-beta repeat/WD domain, NT2RP70076430/Apollipoprotein A1/A4/E family G-beta repeat/WD domain, G-beta repeat NT2RP70079250//F5/8 type C domain/Laminin G NT2RP7OO9394OFFIPTATIG domain domain/Laminin G domain//EGF-like domain/Thrombo NT2RP70094810/Myelin proteolipid protein (PLP or lipo spondin N-terminal-like domains/Laminin G domain philin)//Influenza non-structural protein (NS1)//Protein of unknown function DUF67//Patched family//7 transmem NT2RP70079750//Laminin G domain brane receptor (metabotropic glutamate family) NT2RP70081370//Herpesvirus glycoprotein M/ABC trans porter/Ribosomal S17 0326 NT2RP70094980//EGF-like domain//EGF-like domain//Trypsin Inhibitor like cysteine rich domain//EGF NT2RP70081440//Eukaryotic protein kinase domain like domain//EGF-like domain/Trypsin Inhibitor like cys teine rich domain//EGF-like domain/von Willebrand factor NT2RP70081670//Helix-hairpin-helix motif./S1 RNA type C domain/von Willebrand factor type C domain// binding domain Metallothionein//von Willebrand factor type C domain//von NT2RP70084060/Glycosyltransferases group 1 Willebrand factor type C domain/von Willebrand factor NT2RP70084410//Bromodomain//Bromodomain//Bromo type C domain//von Willebrand factor type C domain domain//Bromodomain//Bromodomain//Bromodomain// NTONG10000520//BTB/POZ domain//Kelch motif (Kelch BAH domain motif NT2RP70084870/Sulfotransferase proteins NTONG10001300//HlyD family secretion protein/Biop NT2RP70085500//Immunoglobulin domain/Immunoglo terin-dependent aromatic amino acid hydroxylase/Caspase bulin domain//Immunoglobulin domain//Immunoglobulin recruitment domain domain//Immunoglobulin domain/Fibronectin type III NTONG10002570//Rhabdovirus spike glycoprotein domain//Fibronectin type III domain/Fibronectin type III domain NTONG1000264.0//Phosphoglucomutase/phosphomanno mutase NT2RP70085570//Heavy-metal-associated domain/HECT NTONG20003340//Zinc finger, C2H2 type/Zinc finger, domain (ubiquitin-transferase). C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 0323 NT2RP70087200//KRAB box//KRAB box//Zinc type/Zinc finger, C2H2 type/Zinc finger, C2H2 type finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 NTONG20008780//Bacterial regulatory proteins, lacI fam type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc ily/Site-specific recombinases finger, C2H2 type/Zinc finger, C2H2 type/DM DNA bind NTONG20009660//Nebulin repeat/Nebulin repeat/Nebu ing domain//Zinc finger, C2H2 type//Zinc finger, C2H2 lin repeat/Nebulin repeat/Nebulin repeat/Nebulin repeat// type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc Nebulin repeat/Nebulin repeat finger, C2H2 type 0327 NTONG20015500//Zinc finger, C2H2 type/Zinc NT2RP70O8855O//PH domain finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/BolA-like protein//Zinc finger, C2H2 type/Zinc NT2RP70090120/Cytochrome oxidase subunit II//Voltage finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, gated chloride channels/CBS domain/CBS domain C2H2 type/Transcription factor S-II (TFIIS)//Zinc finger, 0324 NT2RP70090190//Zinc finger, C2H2 type/Zinc C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, type/Zinc finger, C2H2 type C2H2 type/Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 NTONG20016120/PH domain/Phosphoglycerate mutase type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc family/OXysterol-binding protein finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, OCBBF10000910//Sorbin homologous domain/Peptidase C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type family M1/SH3 domain/SH3 domain/SH3 domain US 2007/0015163 A1 Jan. 18, 2007 52

OCBBF 10001180//K+ channel tetramerisation domain 0332 PEBLM20003080//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, OCBBF10001190//DNA topoisomerase II (N-terminal C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 region) type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc OCBBF 1000 1220//BTB/POZ domain//Ketch motif Kelch finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, motif (Kelch motifi/Kelch motifi/Kelch motif C2H2 type 0328 OCBBF20002310/Leucine rich repeat N-terminal PEBLM20003950 (SCAN domain domain/Leucine Rich Repeat/Leucine Rich Repeat/Leu cine Rich Repeat/Leucine Rich Repeat/Leucine Rich PEBLM20004790/Src homology domain 2//Eukaryotic Repeat/Leucine Rich Repeat/Leucine Rich Repeat/Leu protein kinase domain cine Rich Repeat/Leucine Rich Repeat/Leucine rich repeat C-terminal domain PLACE50000370/7-fold repeat in Clathrin and VPS OCBBF20007190//Metallo-beta-lactamase superfamily PLACE50000580/Apolipoprotein A1/A4/E family OCBBF20008240//bzIP transcription factor//tRNA syn PLACE50000680//Sushi domain (SCR repeat)//Sushi thetase class II (G, H. P. S and T) domain (SCR repeat) OCBBF20010750/Spectrin repeat PLACE60002050//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type 0329 OCBBF20011010//Zinc finger, C2H2 type/Zinc finger, C2H2 type/PHD-finger//Zinc finger, C2H2 type/ PLACE60003790/Lumenal portion of Cytochrome b559, Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, alpha (gene psbE) Subunit. C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/FYVE Zinc finger//Zinc finger, C2H2 type/Zinc fin PLACE60004290//Gag P30 core shell protein ger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 PLACE60012810/AMP-binding enzyme type/Transcription factor S-II (TFIIS)//Zinc finger, C2H2 type/Zinc finger, C2H2 type PLACE60014.430//moaA/nifB/pqqE family/MoaC family OCBBF2001 1240//Glutathione S-transferases. PLACE60018860//Adenylate and Guanylate cyclase cata OCBBF20011400//WD domain, G-beta repeat/K+ channel lytic domain tetramerisation domain//7-fold repeat in Clathrin and VPS PLACE60021020//Integrase Zinc binding domain/Inte OCBBF20011760//BTB/POZ domain//Kelch motif Kelch grase Zinc binding domain//DnaJ central domain (4 repeats) motif (Kelch motifi/Kelch motifi/Kelch motif 0333 PLACE60021510//KRAB box//Zinc finger, C2H2 OCBBF2001 2100/PAP2 superfamily type/Zinc finger, C2H2 type//Putative zinc finger in N-rec ognin//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc OCBBF20013070//Zinc finger, C2H2 type/Zinc finger, finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 OCBBF2001 4940//UBA domain type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type OCBBF20015270//Zinc finger, C2H2 type/Bacterial type II secretion system protein PLACE60026680//Sorbin homologous domain/SH3 OCBBF20015280//lactate/malate dehydrogenase domain/SH3 domain OCBBF20015860/ATP synthase Alpha chain, C terminal PLACE60030380//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 PEBLM10000340//RNA recognition motif. (a.k.a. RRM, type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc RBD, or RNP domain)//Zn-finger in Ran binding protein finger, C2H2 type and others. PLACE60032040//Hirudin PEBLM100.00680//Actin PEBLM2000 1120//Thymidylate kinase/Leucine Rich PLACE60037050//ENV polyprotein (coat polyprotein) Repeat/Leucine Rich Repeat/Leucine Rich Repeat/Leu PLACE60038500//Mitochondrial carrier proteins/Mito cine Rich Repeat/Leucine Rich Repeat chondrial carrier proteins 0330 PEBLM20002480/KRAB box//Zinc finger, C2H2 PLACE60044640//Small cytokines (intecrine/chemokine), type/Zinc finger, C2H2 type/Zinc finger, C2H2 type?/ interleukin-8 like TRAF-type zinc finger//Zinc finger, C2H2 type/Transcrip tion factor S-II (TFIIS)//Zinc finger, C2H2 type/Zinc finger, PLACE60046630/Phorbol esters/diacylglycerol binding C2H2 type/Zinc finger, C2H2 type domain (C1 domain)/PHD-finger 0331 PEBLM20002700//KRAB box//Zinc finger, C2H2 0334) PROST10003430/PHD-finger//Zinc finger, type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc C3HC4 type (RING finger)/(TRAF-type zinc finger/PDZ finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, domain (Also known as DHR or GLGF)./PDZ domain C2H2 type/Zinc finger, C2H2 type/PHD-finger//Zinc fin (Also known as DHR or GLGF)./PDZ domain (Also known ger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 as DHR or GLGF).//WHEP-TRS domain containing pro type/Zinc finger, C2H2 type/Zinc finger, C2H2 type teins/PDZ domain (Also known as DHR or GLGF). US 2007/0015163 A1 Jan. 18, 2007

PROST10005360/F5/8 type C domain/Laminin G SKMUS10000640//Zinc finger, C3HC4 type (RING fin domain/Laminin G domain//EGF-like domain//Fibrinogen ger)//Zinc finger, C3HC4 type (RING finger)/PHD-finger// beta and gamma chains, C-terminal globular domain B-box zinc finger//3',5'-cyclic nucleotide phosphodiesterase PROST20003250//RNA recognition motif. (a.k.a. RRM, SKMUS1000 1040//bzIP transcription factor RBD, or RNP domain) SKMUS10001180//Coronavirus S2 glycoprotein PROST20018230//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type SKMUS10001290//MutT-like domain SKMUS10001770//Protein-L-isoaspartate (D-aspartate) PROST20018990/ADP-ribosylation factor family/Ras family O-methyltransferase (PCMT) SKMUS20000740//ubiE/COQ5 methyltransferase family// PROST20023380//K+ channel tetramerisation domain// Cyclopropane-fatty-acyl-phospholipid synthase BTB/POZ domain SKMUS20001170/ATP synthase Alpha chain, C terminal/ PROST20029600/Small cytokines (intecrine/chemokine), MAGE family interleukin-8 like/Immunoglobulin domain SKMUS20002710/Hepatitis C virus capsid protein PROST20031170//Heavy-metal-associated domain/HECT domain (ubiquitin-transferase). SKMUS20003900/Mov34/MPN/PAD-1 family SKMUS20004580/LIM domain containing proteins/Nebu PROST200333807 FTPR Domain/FTPR Domain//TPR lin repeat/Nebulin repeat/Nebulin repeat/Nebulin repeat// Domain Nebulin repeat/Nebulin repeat/Nebulin repeat/Nebulin PROST20033400//Eukaryotic protein kinase domain repeat/Nebulin repeat PROST20043320//Paramyxovirus nucleocapsid protein// SKMUS20007240/Thiamine pyrophosphate enzymes/ SH3 domain Thiamine pyrophosphate enzymes/Thiamine pyrophos PROST20044160//Tropomyosins phate enzymes SKMUS20008630/OB-fold nucleic acid binding domain// PROST20051210//Protein phosphatase 2C/Protein phos tRNA synthetases class II (F)//tRNA synthetases class II (D. phatase 2C K and N) PROST20064.500/Sulfotransferase proteins SKMUS2000.954.0//F-box domain. PROST20067370//TRAF-type zinc finger//DnaJ central SKMUS2001 1290//Iron-containing alcohol dehydrogena domain (4 repeats) ses/Iron-containing alcohol dehydrogenases PROST20069880/Atrial natriuretic peptide SKMUS20013640/Laminin EGF-like (Domains III and V) PROST2007 2890//K+ channel tetramerisation domain// SKMUS2001634.0//HMG (high mobility group) box BTB/POZ domain SKMUS20016620/Ank repeat/Ank repeat/Glutamine PROST20073170//K+ channel tetramerisation domain// amidotransferases class-III/Ank repeat BTB/POZ domain//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger present in dystrophin, CBP/p300 SKMUS20016680//Phorbol esters/diacylglycerol binding domain (C1 domain)/CONSTANS family Zinc finger/SH3 PROST20073890//Platelet-derived growth factor (PDGF) domain PROST20085160//Tropomyosins/Tropomyosins SKNMC10000290//Zinc finger C-x8-C-x5-C-X3-H type PROST20094830//PH domain (and similar). SKNMC10002510/ABC transporter transmembrane PUAEN10003220//Photosystem I reaction centre subunit region./Phosphoribulokinase/ATPases associated with VIII various cellular activities (AAA)/ABC transporter SALGL10000050//Permeases for cytosine/purines, uracil, SKNMC20000650/Zinc finger, C2H2 type//Protein phos thiamine, allantoin phatase 2C//Zinc finger, C2H2 type/Zinc finger, C2H2 SALGL10000650/SAM domain (Sterile alpha motif)/Ster type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc ile alpha motif (SAM)/Pointed domain finger, C2H2 type SALGL10001570/Colicin pore forming domain/MotA/ SKNMC20000970//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)//Elongation factor TS/Protein-L- TolO/ExbB proton channel family isoaspartate (D-aspartate) O-methyltransferase (PCMT)// SKMUS10000140/Ubiquitin family//Ubiquitin family/ Met-10+ like-proteins Ubiquitin family//Ubiquitin family//Ubiquitin family//Ubiq 0335) SKNMC20002240//KRAB box//Zinc finger, C2H2 uitin family type/LIM domain containing proteins/Zinc finger, C2H2 SKMUS10000220/WD domain, G-beta repeat/WD type/TRAF-type zinc finger//Zinc finger, C2H2 type/Zinc domain, G-beta repeat/WD domain, G-beta repeat/WD finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, domain, G-beta repeat/WD domain, G-beta repeat/WD C2H2 type/LIM domain containing proteins//PHD-finger// domain, G-beta repeat Zinc finger, C2H2 type US 2007/0015163 A1 Jan. 18, 2007 54

SKNMC20003560/Helix-loop-helix DNA-binding domain STOMA2000482O/IPH domain/FEF hand//EF hand?/Phos phatidylinositol-specific phospholipase C, X domain SKNMC20010570/7F-box domain. SYNOV10001280/Lipoate-protein ligase B SKNMC20015030//Keratin, high sulfur B2 protein 0337 SYNOV20013740//KRAB box//Bacterial type II 0336 SKNMC20015960/Ank repeat/Ank repeat/Ank secretion system protein I/J//Zinc finger, C2H2 type/Zinc repeat/Ank repeat/Ank repeat/Ank repeat/Ank repeat/ finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, Ank repeat/Ank repeat/Ank repeat/Ank repeat/Ank C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 repeat/Ank repeat/Ank repeat/Ank repeat/Bacterial stress type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc protein/Ank repeat/Formylmethanofuran-tetrahy finger, C2H2 type dromethanopterin formyltransferase/Ank repeat/Ank repeat/Ank repeat/Neuraxin and MAP1B proteins/FYVE SYNOV20014510/SRF-type transcription factor (DNA Zinc finger binding and dimerisation domain) SKNSH10001740/Pyridoxal-dependent decarboxylase SYNOV20016480//glycosyl transferase family SKNSH 1000301 07/SH3 domain TESTI10000420//K-box region/Penicillin amidase SKNSH20003470//Heme-binding domain in cytochrome b5 TESTI10000510/Transient receptor and oxidoreductases TESTI1 0000550//Homeobox domain SMINT10000160//UDP-glucoronosyl and UDP-glucosyl TESTI 1000064.0//K+ channel tetramerisation domain// transferases BTB/POZ domain//Kelch motif//Kelch motif//Kelch motif// Kelch motifi/Kelch motif MINT10000420/Cytochrome oxidase subunit II/ABC ransporter//Biopterin-dependent aromatic amino acid TESTI10000700/Ubiquitin carboxyl-terminal hydrolases ydroxylase family 2//Ubiquitin carboxyl-terminal hydrolase family 2 SMINT10000570/Immunoglobulin domain/Immunoglo TESTI1 0001270//PLAT/LH2 domain//PLAT/LH2 domain// bulin domain//Immunoglobulin domain PLAT/LH2 domain TESTI10001380/Subtilase family//Proprotein convertase MINT10000710//Immunoglobulin domain P-domain MINT10001030/Ank repeat/Ank repeat/Ank repeat/ TESTI10001680/Leucine Rich Repeat/Leucine Rich Ank repeat/Ank repeat/Ank repeat/Ank repeat/Ank Repeat/Leucine Rich Repeat/Leucine Rich Repeat/Leu repeat/Ank repeat/Ank repeat cine Rich Repeat/Leucine Rich Repeat SMINT20002270//Disintegrin/Trans-activation protein X TESTI2OOO12OO//KRAB box SMINT20002770/Transcriptional regulatory protein, Cter TESTI20001540//Eukaryotic protein kinase domain minal/Immunoglobulin domain TESTI20001770//von Willebrand factor type A domain// SPLEN10001430//HMG (high mobility group) box Proprotein convertase P-domain SPLEN20000720//Zinc finger, C2H2 type/Zinc finger, TESTI20002070//Niflu-like N terminal domain C2H2 type?/Zinc finger, C2H2 type/TRAF-type zinc fin ger//Zinc finger, C2H2 type//Zinc finger, C2H2 type/Zinc TESTI2000238.0//Exonucleasef/3'-5' exonuclease finger, C2H2 type TESTI20002530/Ubiquitin family SPLEN20001340/Peptidase family M20/M25/M40 TESTI20003560//Tubulin/FtsZ family SPLEN20001970/Transcription factor TFIIB repeat TESTI20005910//Adenylate kinase/Elongation factor Tu family//Adenylate kinase/6-phosphofructo-2-kinase/Shiki SPLEN20002670//WD domain, G-beta repeat mate kinase/pKID domain//Adenylate kinase/Thymidylate kinase/ATPases associated with various cellular activities SPLEN2OOO357O//RasGEF domain/Ras association (RalGDS/AF-6) domain (AAA) STOMA10001860/Cytosolic long-chain acyl-CoA TESTI20006000/Ank repeat/CAP-Gly domain thioester hydrolase/OB-fold nucleic acid binding domain// TESTI2OOO62707/TPR Domain/FTPR Domain//TPR Cytosolic long-chain acyl-CoA thioester hydrolase Domain//4-hydroxyphenylpyruvate dioxygenase C terminal domain//TPR Domain//TPR Domain STOMA20000880/Immunoglobulin domain TESTI20006950//Tudor domain/Stathmin family STOMA2000 1210/Cys/Met metabolism PLP-dependent enzyme?/Aminotransferases class-I TESTI2000.6990//KOW motif//Kinesin motor domain STOMA20002570/MgtC family TESTI20007070//DM DNA binding domain STOMA20002890/Adaptin N terminal region TESTI2000784.0/Apolipoprotein A1/A4/E family TESTI20008490/Apolipoprotein A1/A4/E family STOMA20003960/LIM domain containing proteins/LIM domain containing proteins TESTI20008830/Immunoglobulin domain US 2007/0015163 A1 Jan. 18, 2007

0338 TESTI20010490//KRAB box//Zinc finger, C2H2 TESTI20022230//Nucleosome assembly protein (NAP) type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, TESTI2002251.0/Calreticulin family/PHD-finger C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 TESTI20022560/Leucine Rich Repeat/Leucine Rich type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc Repeat/Leucine Rich Repeat/Leucine Rich Repeat/Leu finger, C2H2 type/Zinc finger, C2H2 type cine Rich Repeat/Leucine Rich Repeat/Leucine Rich Repeat/Leucine Rich Repeat/Guanylate kinase//Vesicu TESTI20011410 (RhoGEF domain/FPH domain/Phorbol lovirus phosphoprotein esters/diacylglycerol binding domain (C1 domain)/CXXC Zinc finger//FYVE Zinc finger//PH domain TESTI20024980//PDZ domain (Also known as DHR or GLGF).//SH3 domain//Guanylate kinase TESTI2001.2370//K+ channel tetramerisation domain// BTB/POZ domain//Ornithine decarboxylase antizyme?/ TESTI20025160//MAGE family Kelch motif//Kelch motif//Kelch motif//Kelch motif//Kelch TESTI20025800//lactate/malate dehydrogenase//Pyridine motif nucleotide-disulphide oxidoreductase TESTI20012690//Biotin-requiring enzymes/Biotin-requir TESTI2002676O7/SPRY domain ing enzymes/2-oxo acid dehydrogenases acyltransferase TESTI20027070//Type I phosphodiesterase/nucleotide (catalytic domain) pyrophosphatase TESTI20013300//EF hand//EF hand//Ubiquitin carboxyl terminal hydrolases family 2 TESTI20027290//RhoGAP domain TESTI20027890//KRAB box//Dictyostelium (s lime mold) TESTI20013450//Double-stranded RNA binding motif/Al repeats/Dictyostelium (slime mold) repeats/Zinc finger, dehyde oxidase and Xanthine dehydrogenase, C terminus// C2H2 type?/Dictyostelium (slime mold) repeats/Zinc finger, Adenosine-deaminase (editase) domain C2H2 type?/Dictyostelium (slime mold) repeats TESTI20014200/ABC 3 transport family/Sugar (and TESTI20029120//Eukaryotic protein kinase domain other) transporter TESTI20030050//Histone-like transcription factor (CBF/ TESTI20015110//bZIP transcription factor/Troponin//Do NF-Y) and archaeal histone main of unknown function DUF87 TESTI20030370/MYND finger//TPR Domain/TPR TESTI20015560//K+ channel tetramerisation domain// Domain//TPR Domain/Adaptin N terminal region BTB/POZ domain TESTI20030710//Herpesvirus UL25 family TESTI20016610/Leptin 0339 TESTI20031090/Armadillo/beta-catenin-like TESTI20018150/Zinc finger, C2H2 type/Zinc finger, repeats/Armadillo/beta-catenin-like repeats/Armadillo/ C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 beta-catenin-like repeats/Armadillo/beta-catenin-like type/Zinc finger, C2H2 type repeats/Armadillo/beta-catenin-like repeats/Armadillo/ beta-catenin-like repeats/Armadillo/beta-catenin-like TESTI20018270/Transketolase/Dehydrogenase E1 com repeats ponent/Transketolase TESTI2OO313OOf FTPR Domain TESTI20018520/F5/8 type C domain/Laminin G domain/ TESTI2003 1520//mRNA capping enzyme Ribosomal protein L11//Thrombospondin N-terminal-like domains/Laminin G domain//EGF-like domain//Fibrinogen TESTI20031960//WD domain, G-beta repeat beta and gamma chains, C-terminal globular domain TESTI20032280//Myb-like DNA-binding domain TESTI20018690/SAM domain (Sterile alpha motif) TESTI20033250//UBX domain//Orotidine 5'-phosphate decarboxylases TESTI20018790//KRAB box//Zinc finger, C2H2 type/Zinc finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, TESTI20033270//DM DNA binding domain C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc TESTI20033540//Zinc finger, C2H2 type finger, C2H2 type TESTI20033560//F-box domain. TESTI20034.190/ATP synthase Alpha chain, C terminal/ TESTI20020570/E1 Protein, N terminal domain//Actin AMP-binding enzyme TESTI20020810/7 transmembrane receptor (metabotropic glutamate family)/Transmembrane amino acid transporter TESTI2003498.0//RhoGEF domain protein TESTI20035120//C2 domain//Kinesin motor domain TESTI2002 10507/TPR Domain//TPR Domain//TPR TESTI20035510//NOL1/NOP2/sun family Domain//TPR Domain/7TPR Domain//TPR Domain/7TPR TESTI20035890//UBA domain//Zinc finger C-x8-C-x5-C- Domain x3-H type (and similar). TESTI20021490//BTB/POZ domain//Zinc finger, C2H2 TESTI20036250//TSC-22/dip/bun family/NAD dependent type/PHD-finger//Zinc finger, C2H2 type/Zinc finger, epimerase/dehydratase family//Adenylate kinase/ATPases C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type associated with various cellular activities (AAA) US 2007/0015163 A1 Jan. 18, 2007 56

TESTI20037810//Eukaryotic protein kinase domain globulin domain/Immunoglobulin domain/Fibronectin TESTI20038940/IQ calmodulin-binding motif?/IQ calm type III domain/Fibronectin type III domain odulin-binding motifi/IQ calmodulin-binding motif TESTI20080200/MttB family UPF0032 TESTI20040000//short chain dehydrogenase/3-beta TESTI20080330//Ribosomal protein L14p/L23e hydroxysteroid dehydrogenase/isomerase family TESTI20083430//TPR Domain TESTI2004.0310//Protein of unknown function DUF84 TESTI20083870//EF hand//EF hand//EF hand//Phosphati TESTI20041220//VPR/VPX protein dylinositol 3- and 4-kinases/EF hand TESTI20042870//ET module TESTI20086570/MAGE family TESTI20042950/3',5'-cyclic nucleotide phosphodiesterase/ TESTI2008.7740/7TPR Domain//TPR Domain//Outer mem Peptidase family M1 brane efflux protein//TPR Domain/TPR Domain TESTI20049820/Cyclic nucleotide-binding domain TESTI201383.20//Transketolase 0340 TESTI20053960//KRAB box//Zinc finger, C2H2 TESTI20140360//metallopeptidase family M24 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Transcription factor S-II (TFIIS)//Zinc TESTI20177400//WD domain, G-beta repeat/WD domain, finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, G-beta repeat/WD domain, G-beta repeat C2H2 type/TRAF-type zinc finger//Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc THYMU10000830/FAD binding domain finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, THYMU10001760/Immunoglobulin domain C2H2 type//Phorbol esters/diacylglycerol binding domain (C1 domain)//Zinc finger, C2H2 type/Zinc finger, C2H2 THYMU10002910/Adaptin N terminal region type/Zinc finger, C2H2 type/Zinc finger, C2H2 type THYMU10003590//PH domain/RhoGAP domain TESTI2005584.0//PH domain//PH domain THYMU10004590//HMG (high mobility group) box TESTI20056900//Urease, gamma subunit/IQ calmodulin THYMU10005580/Synaptobrevin binding motif?/IQ calmodulin-binding motif THYMU20002360/Pumilio-family RNA binding domains TESTI20057310/Tropomyosins (aka PUM-HD, Pumilio homology domain) TESTI20057420/Acyl CoA binding protein/Ribosomal THYMU20003690//Prokaryotic DNA topoisomerase//Pro Proteins L2 tein of unknown function DUF122//Eukaryotic protein TESTI20064830/Tetrahydrofolate dehydrogenase/cyclohy kinase domain drolase TRACH10000740//Immunoglobulin domain//Immunoglo TESTI20068660//Domain of unknown function DUF19// bulin domain//Immunoglobulin domain//Immunoglobulin TPR Domain/7TPR Domain//TPR Domain domain TESTI20068720//Zinc finger, C2H2 type/Zinc finger, TRACH1000 1250//Immunoglobulin domain//Immunoglo C2H2 type bulin domain//Immunoglobulin domain//Immunoglobulin 0341 TESTI20074640//KRAB box//Zinc finger, C2H2 domain type/MYND finger//Zinc finger, C2H2 type/Zinc finger, TRACH20000150//Fatty acid desaturase//Protein phos C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 phatase 2C type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, TRACH20001850//Molluscan rhodopsin C-terminal tail C2H2 type/Zinc finger, C2H2 type TRACH20002370//KRAB box//Zinc finger, C2H2 type/ 0342. TESTI20074660//KRAB box//Zinc finger, C2H2 FYVE Zinc finger//Zinc finger, C2H2 type/Zinc finger, type/Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 finger, C2H2 type?/Zinc finger, C2H2 type/Zinc finger, type/Zinc finger, C2H2 type/Zinc finger, C2H2 type C2H2 type/Zinc finger, C2H2 type/PHD-finger//Zinc fin TRACH20002500//WD domain, G-beta repeat/WD ger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 domain, G-beta repeat/WD domain, G-beta repeat/WD type/Zinc finger, C2H2 type/MYND finger//Zinc finger, domain, G-beta repeat/WD domain, G-beta repeat/WD C2H2 type domain, G-beta repeat/WD domain, G-beta repeat TESTI20074800/Glypican TRACH20002890//PH domain/Src homology domain 2 TESTI20077490/Signal peptidase (SPase) II TRACH20003930//RNA recognition motif. (a.k.a. RRM, TESTI20078640/ISCAN domain RBD, or RNP domain)//RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) TESTI20078720/ATP synthase B/B' CF(0)/Ribosomal L29 protein TRACH20004110//Zinc finger, C2H2 type TESTI200795.10//Immunoglobulin domain/Immunoglobu TRACH20004200//Neurohypophysial hormones, C-termi lin domain//Adenovirus E3 region protein CR1//Immuno nal Domain/Keratin, high sulfur B2 protein US 2007/0015163 A1 Jan. 18, 2007 57

TRACH20004720/Aminotransferases class-III/Ami 0348 The clone predicted to belong to the category of notransferases class-I disease-related protein means a clone having hit data with Some annotation, Such as disease mutation, syndrome, etc., TRACH20004960/AMP-binding enzyme Suggesting that the clone encodes a disease-related protein, TRACH2000.6650/Lacy proton/sugar Symporter?/Sugar or means a clone whose full-length nucleotide sequence has (and other) transporter hit data for Swiss-Prot, GenBank, or UniGene, where the hit data corresponds to genes or proteins which have been TRACH20006750//E1 Protein, N terminal domain//ATP deposited in the Online Mendelian Inheritance in Man synthase (E/31 kDa) subunit (OMIM) (http://www.ncbi.nlm.nih.gov/Omim/), which is TRACH20009260//short chain dehydrogenase the human gene and disease database. TRACH20012890//RNA recognition motif. (a.k.a. RRM, 0349 The clone predicted to belong to the category of RBD, or RNP domain) enzyme and/or metabolism-related protein means a clone having hit data with some annotation, Such as metabolism, TRACH20016070/Adenylate cyclase oxidoreductase, E. C. No. (Enzyme commission number), UMVEN10001220/Corticotropin-releasing factor family etc., Suggesting that the clone encodes an enzyme and/or metabolism-related protein. UMVEN20001330/7C2 domain?/C2 domain//C2 domain 0350. The clone predicted to belong to the category of UTERU10001600/SCAN domain//Zinc finger, C2H2 type/ cell division and/or cell proliferation-related protein means Zinc finger, C2H2 type/Zinc finger, C2H2 type/Zinc finger, a clone having hit data with some annotation, such as cell C2H2 type/Zinc finger, C2H2 type/Zinc finger, C2H2 type division, cell cycle, mitosis, chromosomal protein, cell UTERU10001920/Integrase core domain growth, apoptosis, etc., Suggesting that the clone encodes a cell division and/or cell proliferation-related protein. EXAMPLE 6 0351. The clone predicted to belong to the category of cytoskeleton-related protein means a clone having hit data Functional Categorization Based on the Full-Length with some annotation, such as structural protein, cytoskel Nucleotide Sequences eton, actin-binding, microtubles, etc., Suggesting that the 0343. The functional prediction and categorization of the clone encodes a cytoskeleton-related protein. proteins encoded by the clones were carried out based on the 0352. The clone which is predicted to belong to the result of homology search of the databases of GenBank, category of nuclear protein and/or RNA synthesis-related Swiss-Prot, UniGene and nr (see the Homology Search protein means a clone having hit data with Some annotation, Result Data) for the full-length nucleotide sequences and the Such as nuclear protein, RNA splicing, RNA processing, result of domain search of the amino acid sequences RNA helicase, polyadenylation, etc., Suggesting that the deduced from the full-length nucleotide sequences (see clone encodes a nuclear protein and/or RNA synthesis Example 5). related protein. 0344) The clone predicted to belong to the category of 0353. The clone predicted to belong to the category of secretory protein/membrane protein means a clone having protein synthesis and/or transport-related protein means a hit data with some annotation, such as growth factor, cytok clone having hit data with some annotation, such as trans ine, hormone, signal, transmembrane, membrane, extracel lation regulation, protein biosynthesis, amino-acid biosyn lular matrix, receptor, G-protein coupled receptor, ionic thesis, ribosomal protein, protein transport, signal recogni channel, Voltage-gated channel, calcium channel, cell adhe tion particle, etc., Suggesting that the clone encodes a protein Sion, collagen, connective tissue, etc., Suggesting that it is a synthesis and/or transport-related protein. secretory or membrane protein, or means a clone in which the presence of nucleotide sequence encoding a signal 0354) The clone predicted to belong to the category of sequence or transmembrane domain was suggested by the cellular defense-related protein means a clone having hit results of PSORT and SOSUI analyses for deduced ORF. data with some annotation, such as heat shock, DNA repair, DNA damage, etc., Suggesting that the clone encodes a 0345 The clone predicted to belong to the category of cellular defense-related protein. glycoprotein-related protein means a clone having hit data with Some annotation, such as glycoprotein, Suggesting that 0355 The clone predicted to belong to the category of the clone encodes a glycoprotein-related protein. development and/or differentiation-related proteins means a clone having hit data with some annotation, such as devel 0346) The clone predicted to belong to the category of opmental protein, etc., Suggesting that the clone encodes a signal transduction-related protein means a clone having hit development and/or differentiation-related protein. data with some annotation, Such as serine/threonine-protein kinase, tyrosine-protein kinase, SH3 domain, SH2 domain, 0356. The clone predicted to belong to the category of etc., Suggesting that the clone encodes a signal transduction DNA-binding and/or RNA-binding protein means a clone related protein. having hit data with some annotation, such as DNA-binding, RNA-binding, etc. 0347 The clone predicted to belong to the category of transcription-related protein means a clone having hit data 0357 The clone predicted to belong to the category of with some annotation, such as transcription regulation, Zinc ATP-binding and/or GTP-binding protein means a clone finger, homeobox, etc., Suggesting that the clone encodes a having hit data with Some annotation, such as ATP-binding, transcription-related protein. GTP-binding, etc. US 2007/0015163 A1 Jan. 18, 2007

0358 In this functional categorization, when a single KIDNE20003150, KIDNE20003300, KIDNE20003490, clone corresponded to multiple categories of those shown KIDNE20004220, KIDNE20005170, KIDNE20005190, above, the clone was assigned to the multiple categories. KIDNE20033050, KIDNE20033570, KIDNE200394.10, However, the function of a protein is not restricted to the KIDNE20042620, KIDNE20042950, KIDNE2004.4110, functional category in this classification, and there is the KIDNE2004.8280, KIDNE20049810, KIDNE20054000, possibility that other functions are newly assigned to the KIDNE20054770, KIDNE20060530, KIDNE20060620, protein. KIDNE20063530, KIDNE20063760, KIDNE20066520, 0359 The clones predicted to belong to the category of KIDNE20067600, KIDNE2007 1860, KIDNE20073520, secretory protein and/or membrane protein are the following KIDNE20074220, KIDNE20075690, LIVER10000580, 439 clones. LIVER10000670, LIVER10001040, LIVER10001110, 0360 3NB6910000180, 3NB6910000850, LIVER10001750, LIVER10005420, LIVER20004160, 3NB6920000290, 3NB6920003300, 3NB6920005450, MAMGL10000320, MAMGL10001840, 3NB6920010020, ADRGL10000180, ADRGL10001600, MESAN10000350, MESAN10001470, MESAN10001800, ADRGL20003230, BGGI120010970, BNGH410000340, MESAN20001490, NB9N420000420, NHNPC20002060, BNGH410001040, BNGH410001180, BNGH410001370, NT2NE10000230, NT2NE10000830, NT2NE10001630, BNGH410001980, BRACE 10000730, BRACE10001690, NT2NE20003270, NT2NE20003920, NT2NE20004550, BRACE20002800, BRACE20007180, BRACE2001 0650, NT2NE20004700, NT2NE20005500, NT2NE2001 2470, BRACE20011170, BRACE20011430, BRACE20013400, NT2NE20014350, NT2NE20016260, NT2NE20034080, BRACE20013520, BRACE20014230, BRACE20014530, NT2NE20047160, NT2NE20055170, NT2NE20057200, BRACE20014920, BRACE20015080, BRACE20018590, NT2RI20005970, NT2RI2000.9740, NT2RI20010100, BRACE20022270, BRACE20024680, BRACE20026350, NT2RI20014490, NT2RI20015400, NT2RI20015950, BRACE20026850, BRACE20030780, BRACE20031100, NT2RI20016570, NT2RI20018660, NT2RI20020220, BRACE20034490, BRACE20071380, BRACE2007 1970, NT2RI20021520, NT2RI20022430, NT2RI20022520, BRACE20072810, BRACE20074010, BRACE2007.4470, NT2RI20025300, NT2RI2003.01.10, NT2RI20030510, BRACE20075020, BRACE20075380, BRACE20076410, NT2RI2003 1540, NT2RI20033010, NT2RI20033830, BRACE20076630, BRACE20076850, BRACE20077610, NT2RI20036780, NT2RI20042840, NT2RI2004.4420, BRACE20077640, BRACE20077980, BRACE20078680, NT2RI20049850, NT2RI20050870, NT2RI20051500, BRACE20079530, BRACE20084430, BRACE20086550, NT2RI20066820, NT2RI20068250, NT2RI20070480, BRACE20089600, BRACE2009 1880, BRAWH10000010, NT2RI20070840, NT2RI20073030, NT2RI20074980, BRAWH10000370, BRAWH10000940, NT2RI20077540, NT2RI20078270, NT2RI20080500, BRAWH10001620, BRAWH10001800, NT2RI20081880, NT2RI20084810, NT2RI20085980, BRAWH20001090, BRAWH20004430, NT2RI20089420, NT2RI20092890, NT2RI20094.060, BRAWH20006970, BRAWH20009840, NT2RP60000320, NT2RP60000390, NT2RP60001090, BRAWH2001 1290, BRAWH20011410, BRAWH20011660, NT2RP70000690, NT2RP70002380, NT2RP70002590, BRAWH20014380, BRAWH20014840, NT2RP70003640, NT2RP70011660, NT2RP70015910, BRAWH20015030, BRAWH20036930, NT2RP70021510, NT2RP70023760, NT2RP70023790, BRAWH20038320, BRAWH2004.0950, NT2RP700261.90, NT2RP700298.20, NT2RP70040800, BRAWH20052250, BRAWH20059980, NT2RP70043730, NT2RP70047900, NT2RP70049250, BRAWH20087060, BRAWH20092610, CD34C20000510, NT2RP70055200, NT2RP70064080, NT2RP7007 1540, CTONG20013660, CTONG20015330, CTONG20028160, NT2RP7007 1770, NT2RP70073810, NT2RP70074220, CTONG20037820, CTONG20047160, DFNES20003350, NT2RP70075040, NT2RP70076170, NT2RP70079250, FCBBF10006180, FCBBF10006750, FCBBF20005910, NT2RP70079750, NT2RP70081330, NT2RP70081370, FCBBF20007330, FCBBF20008150, FCBBF20009400, NT2RP70083150, NT2RP700.85500, NT2RP70090120, FCBBF20015380, FEBRA20003780, FEBRA20004040, NT2RP70091490, NT2RP700.91680, NT2RP70092360, FEBRA20004150, FEBRA20004520, FEBRA20004910, NT2RP700.93220, NT2RP700.93730, NT2RP70094290, FEBRA20006560, FEBRA20006900, FEBRA20007330, NT2RP70094810, NT2RP700.94980, NT2RP700.95070, FEBRA20008090, FEBRA20008800, FEBRA20010930, NTONG10000980, NTONG10002140, NTONG10002570, FEBRA20012270, FEBRA2001 2450, FEBRA20012940, NTONG20002650, NTONG20004920, NTONG20008000, FEBRA20013510, FEBRA20014870, FEBRA20014920, NTONG20012220, OCBBF10000420, OCBBF20002310, FEBRA20015840, FEBRA20020860, FEBRA20021910, OCBBF20009980, OCBBF20012100, PANCR10000210, FEBRA20025250, FEBRA2003 1550, FEBRA20037070, PLACE50000670, PLACE50000680, PLACE50001050, FEBRA20041100, FEBRA20041910, FEBRA20057780, PLACE50001130, PLACE60012810, PLACE60018860, FEBRA20063150, FEBRA20066670, FEBRA20067930, PLACE6002.0160, PLACE60020840, PLACE60026990, HCASM10000610, HCASM20002020, HEART20000990, PLACE60037050, PLACE60037450, PLACE60043960, HEART20004920, HHDPC20000950, HLUNG10000240, PLACE60044540, PLACE60047380, PLACE60049930, HLUNG10000370, HLUNG10001100, HLUNG20001160, PLACE60050290, PROST10002200, PROST10002720, HLUNG2000 1250, HLUNG20001420, HLUNG20001760, PROST10005260, PROST10005360, PROST20000360, HLUNG20002550, HSYRA20003470, HSYRA20006290, PROST20026820, PROST20029600, PROST20032320, HSYRA20008280, HSYRA20011030, HSYRA20013320, PROST20033020, PROST20039220, PROST20044160, HSYRA20014200, HSYRA20015800, IMR3210000440, PROST20051430, PROST20054260, PROST20058800, IMR3210001580, IMR3210002660, IMR3220007750, PROST200591.90, PROST20059430, PROST20069.880, IMR3220008590, IMR3220009840, IMR3220014350, PROST20072370, PROST20073890, PUAEN10000570, KIDNE10000080, KIDNE10001040, KIDNE10001430, PUAEN10003220, SALGL10001570, SKMUS20007740, KIDNE20000700, KIDNE20000850, KIDNE20001670, SKNMC10000190, SKNMC10000290, SKNMC10002290, US 2007/0015163 A1 Jan. 18, 2007 59

SKNMC10002510, SKNMC20011130, SKNMC20015030, THYMU10001760, TRACH10000740, TRACH10001250, SMINT10000160, SMINT10000420, SMINT10000570, TRACH20004200, UTERU20000470 SMINT10001180, SMINT20000180, SMINT20002770, 0363 The clones predicted to belong to the category of SPLEN10000910, SPLEN20001340, SPLEN20002430, signal transduction-related protein are the following 46 SPLEN20002700, SPLEN20003100, SPLEN20004960, clones. STOMA10000520, STOMA10001170, STOMA20000320, STOMA20002570, SYNOV20001770, SYNOV20016480, 0364 ADRGL20000740, ASTRO10000180, TESTI10000420, TESTI10000960, TESTI10001270, BRACE20005770, BRACE20022020, BRACE20027360, TESTI10001380, TESTI20001770, TESTI20006000, BRACE20027920, BRAWH20006860, CTONG20005890, TESTI20007620, TESTI20008830, TESTI20009090, FEBRA20000350, HHDPC20000550, IMR3220003020, TESTI2000.9700, TESTI20011340, TESTI2001.2370, KIDNE20033730, KIDNE20040840, KIDNE20053360, TESTI20013520, TESTI20014200, TESTI20016210, KIDNE20062990, NT2RI20033440, NT2RI20058110, TESTI20016710, TESTI20018520, TESTI20018620, NT2RI20062100, NT2RI20073840, NT2RP70006240, TESTI20020020, TESTI20020810, TESTI20022510, NT2RP70043960, NT2RP70046870, NT2RP70061880, TESTI20024230, TESTI20024650, TESTI20024670, NT2RP70072520, NT2RP70081440, NT2RP700.93700, TESTI20025800, TESTI20026320, TESTI20026980, NTONG10001820, PEBLM20004790, PLACE60026680, TESTI20027000, TESTI20027070, TESTI20028660, PROST20033400, PROST20043320, SKMUS10000220, TESTI20030370, TESTI20031930, TESTI20034.190, SKMUS20016680, SPLEN20003570, TESTI20001540, TESTI20036490, TESTI20039980, TESTI20042870, TESTI20005910, TESTI20022560, TESTI20024980, TESTI20047120, TESTI20049940, TESTI20056900, TESTI20029120, TESTI20034980, TESTI20049820, TESTI20057420, TESTI20058600, TESTI20067740, TESTI20055840, THYMU10003590, THYMU20003690, TESTI20069780, TESTI20074800, TESTI20077490, TRACH20002500, TRACH20002890 TESTI20079510, TESTI20080200, TESTI20081440, TESTI20087740, TESTI20088470, TESTI20136910, 0365. The clones predicted to belong to the category of THYMU10000830, THYMU10001760, transcription-related protein are the following 140 clones. THYMU10003290, THYMU10003820, 0366 3.NB6920010220, 3NB6920015110, THYMU10005580, TRACH10000630, TRACH10001000, 3NB6920015570, ADRGL10000650, BGGI120006840, TRACH10001400, TRACH20001850, TRACH20001960, BGGI120006930, BGGI120017140, BNGH410000800, TRACH20004200, TRACH20004960, TRACH2000.6650, BNGH420005320, BRACE 10000930, BRACE20014.550, TRACH20007670, TRACH20008980, TRACH20015920, BRACE20018550, BRACE20020910, BRACE20024090, UMVEN20001330, UTERU10000770, UTERU10000960, BRACE2007 1740, BRAWH10000020, BRAWH10001640, UTERU10001920, UTERU20000470, UTERU20003930, BRAWH10001680, BRAWH20006330, UTERU2OOO4850 BRAWH20009010, CTONG20025580, CTONG20028200, 0361 The clones predicted to belong to the category of FCBBF10005980, FCBBF20000940, FCBBF200095.10, glycoprotein-related protein are the following 87 clones. FCBBF50002610, FEBRA20003970, FEBRA20003990, FEBRA20004540, FEBRA2000.9720, FEBRA20011460, 0362 BNGH410000340, BNGH410001180, FEBRA20017150, FEBRA20050140, FEBRA20064760, BRACE20014920, BRACE20015080, BRACE20018590, FEBRA20067360, FEBRA20069420, FEBRA20072800, BRACE20024680, BRACE20026350, BRACE20031100, HLUNG10000760, HLUNG20000680, HSYRA10001370, BRACE2007.4470, BRAWH10000370, BRAWH20001090, HSYRA20016310, IMR3210002420, IMR3220007420, BRAWH20011660, BRAWH20014840, KIDNE20000510, KIDNE20039940, KIDNE20061490, BRAWH20059980, CD34C20000510, CTONG20013660, KIDNE20078110, NESOP10000870, NHNPC10001 240, CTONG20028160, CTONG20037820, FCBBF20007330, NHNPC20002120, NT2NE20002590, NT2NE20008090, FEBRA20007330, FEBRA20008800, FEBRA20014920, NT2RI20003410, NT2RI20004120, NT2RI20004210, FEBRA20015840, FEBRA20057780, HEART20005060, NT2RI20010830, NT2RI20018460, NT2RI20025410, HLUNG10001100, HLUNG20002550, HSYRA20013320, NT2RI20025850, NT2RI20060710, NT2RI20067350, IMR3210002660, IMR3220007750, IMR3220013320, NT2RI20071330, NT2RI20074390, NT2RI20078790, KIDNE2004.4110, KIDNE20063760, KIDNE20067600, NT2RI20087140, NT2RI20090650, NT2RI20092.150, KIDNE20073520, LIVER20000370, MESAN10000350, NT2RP60001000, NT2RP60001270, NT2RP70002710, NT2NE10000830, NT2NE10001850, NT2NE20003270, NT2RP70008120, NT2RP70018560, NT2RP70024500, NT2NE20016260, NT2RI20018660, NT2RI20025300, NT2RP70032030, NT2RP70036290, NT2RP70042040, NT2RI20036780, NT2RI20077540, NT2RI20080500, NT2RP70045410, NT2RP70046560, NT2RP70055130, NT2RI20085980, NT2RI20089420, NT2RI20092890, NT2RP70061620, NT2RP70062960, NT2RP70064900, NT2RP70000690, NT2RP70004770, NT2RP70055200, NT2RP700.69860, NT2RP70075370, NT2RP70085570, NT2RP70081370, NT2RP70083150, NT2RP700.91490, NT2RP70087200, NT2RP700901.90, NTONG20003340, NT2RP70092360, NT2RP700.94980, NTONG10002140, NTONG20003630, NTONG20015500, OCBBF20011010, OCBBF20002310, OCBBF20002770, PLACE50000680, OCBBF2001 1240, OCBBF20015860, PEBLM20002480, PLACE50001130, PLACE60018860, PLACE60044540, PEBLM20002700, PEBLM20003080, PEBLM20003950, PROST20018230, PROST20032320, PROST20073890, PLACE60002050, PLACE60005550, PLACE60021510, SALGL10001570, SKNMC20015030, SMINT10000160, PLACE60030380, PROST20018230, PROST20031170, SMINT20002770, SPLEN20001340, TESTI10001270, PROST20073170, PUAEN10001610, SALGL10000650, TESTI10001380, TESTI20001770, TESTI20024230, SKMUS10000640, SKMUS20014920, SKNMC20000650, TESTI20027070, TESTI20036490, TESTI20039980, SKNMC20002240, SKNMC20003560, SMINT10001000, TESTI20056900, TESTI20057420, TESTI20079510, SMINT20005450, SPLEN20000200, SPLEN20000720, US 2007/0015163 A1 Jan. 18, 2007 60

SYNOV20010140, SYNOV20013740, SYNOV20014510, (128100), NT2RI20004120 (600140), NT2RI20004210 TESTI10000550, TESTI20001200, TESTI20007070, (314997), NT2RI20010910 (601940), NT2RI2001.4500 TESTI20010490, TESTI20015560, TESTI20018150, (190370), NT2RI2OO2O410 (168730; 180990), TESTI20018790, TESTI20021490, TESTI20026760, NT2RI200295.80 (605689), NT2RI20031540 (300061), TESTI20027890, TESTI20030710, TESTI20034130, NT2RI20033440 (601014), NT2RI2004.1900 (179715), TESTI20042290, TESTI20053960, TESTI20074640, NT2RI20056470 (123940), NT2RI20057230 (601940), TESTI20074660, TESTI20078640, THYMU10004590, NT2RI20067030 (603577), NT2RI20070960 (311030), TRACH20000790, TRACH20002370, TRACH20009440, NT2RI20074980 (603105), NT2RI20077540 (300112), UTERU1OOO16OO NT2RI20080500 (142461), NT2RI20083,960 (605612), 0367 The clones predicted to belong to the category of NT2RI20084810 (603099), NT2RI20092150 (600834), disease-related protein are the following 219 clones. Further, NT2RI20092890 (603104), NT2RP60000350 (605612), hit data of all the clones for Swiss-Prot, or GenBank, NT2RP60001000 (314995), NT2RP60001230 (600025), UniGene, or nr corresponded to genes or proteins which had NT2RP70000690 (158340; 113720), NT2RP70004250 been deposited in the Online Mendelian Inheritance in Man (160776), NT2RP70028750 (179838), NT2RP70029060 (OMIM), which is the human gene and disease database, (140571), NT2RP70032030 (602277), NT2RP70036290 (the OMIM Number is shown in the parenthesis after the (600005; 209920), NT2RP7OO426OO (160776), Clone Name). NT2RP70046560 (602410), NT2RP70049250 (601703), 0368 ADRGL10000020 (605332), ADRGL10001600 NT2RP70055020 (604581), NT2RP70062960 (133540), (201910), ADRGL20000740 (300118), ASTRO20004-170 NT2RP70063040 (604061), NT2RP70065270 (300111), (605937), BGGI120006840 (604480), BGGI120010970 NT2RP70069860 (602277), NT2RP7007 1770 (603046), (602346), BGGI120017140 (194631), BNGH410001770 NT2RP70073810 (601439), NT2RP70074220 (313440), (146690), BNGH420005320 (601260), BRACE10001870 NT2RP70075370 (109092), NT2RP70079250 (602346), (157132), BRACE20006980 (106410), BRACE20007180 NT2RP70081440 (601335), NT2RP70090120 (602727), (114160), BRACE20014550 (140580), BRACE20018550 NT2RP70090190 (194558), NT2RP700.93220 (300008; (109560), BRACE20018590 (602644), BRACE20027550 300009; 310468), NT2RP700.9498O (135820), (179715), BRACE20027720 (138760), BRACE20076850 NTONG10002460 (600856), NTONG20003630 (600140), (605209), BRACE20086550 (603540), BRAWH10000020 NTONG20015500 (604077), OCBBF10001180 (191161), (605678), BRAWH10001640 (606043), BRAWH20001770 OCBBF20008240 (187790), PEBLM10000340 (133450), (138450), BRAWH20005030 (179715), BRAWH20005220 PEBLM20002480 (300024), PEBLM20003080 (604077), (603747), BRAWH20006330 (194500), BRAWH20006860 PEBLM20003950 (600834), PLACE50000800 (601797), (602958), BRAWH20009840 (601258), BRAWH20011660 PLACE60002050 (600013), PLACE60003790 (603403), (230500: 230600: 230650; 253010), CD34C20000510 PLACE60014430 (603707), PROST10001670 (313440), (600031), CTONG20005890 (603583), CTONG20019110 PROST10005360 (602346), PROST20002730 (601985; (603486), CTONG20024180 (602895), CTONG20025580 188550), PROST20032320 (253220), PROST20033400 (601856), CTONG20037820 (602729), CTONG20055530 (300203), PROST20062600 (601940), PROST20072890 (106410), FCBBF20000940 (601408), FCBBF20009510 (191161), PROST20073890 (192240), PROST20085160 (194531), FCBBF40002820 (130410), FEBRA20001050 (191030; 164970), SALGL1 OOO1570 (603743), (600025), FEBRA20003990 (601781), FEBRA20004150 SKMUS10000140 (191340), SKMUS10001180 (601402), (126650: 214700), FEBRA2OOO4540 (194558), SKMUS10001290 (604055), SKMUS20000740 (605196), FEBRA2000.9720 (602277), FEBRA20010930 (603878), SKMUS20003900 (604850), SKMUS20007240 (604300), FEBRA20011460 (603.900), FEBRA20050790 (176879), SKMUS20016340 (163906), SKNMC10002510 (605452), FEBRA20057880 (604362), FEBRA20064760 (602277), SKNMC20000650 (604078), SKNMC20003220 (117140), FEBRA20067930 (602921), FEBRA20070170 (606098), SMINT10000420 (601615), SMINT10000570 (604814), FEBRA20075510 (179513), FEBRA20075660 (179715), SMINT10001000 (603851), SMINT10001030 (605759), HCASM20002140 (123834), HEART20004480 (191045; SMINT20004000 (601278), SPLEN10001430 (163905), 115195), HLUNG10001050 (310400), HLUNG20000680 SPLEN20001970 (601940), STOMA20000880 (147220), (300024), HSYRA10001370 (602277), HSYRA20006400 STOMA20003960 (300111), SYNOV20013740 (604076), (601278), HSYRA20013320 (146732), HSYRA20016310 SYNOV20014510 (600661), SYNOV20016480 (131222; (604080), IMR3210000440 (601890), IMR3220007910 60304.1), TESTI1OOO1270 (601313; 173900), (313440), KIDNE10001040 (603217), KIDNE20003150 TESTI10001310 (186982), TESTI20001200 (194510), (602417), KIDNE20033730 (605216), KIDNE20042950 TESTI20001770 (146650), TESTI20002530 (605440), (120160), KIDNE2004.4110 (605239), KIDNE20050420 TESTI20006000 (179838), TESTI20006990 (602591), (214500), KIDNE20059080 (604276), KIDNE20063760 TESTI20007620 (126650; 214700), TESTI20008830 (231950), KIDNE20078110 (603430), LIVER10002300 (160794), TESTI20011800 (190370), TESTI20012690 (161015), LIVER10004330 (603197), LIVER20000330 (109720), TESTI20015120 (604700), TESTI20018520 (191161), LIVER20000370 (138670), MAMGL10001780 (602346), TESTI20018790 (300024), TESTI20021490 (603403), MESAN10001800 (606048), MESAN20002910 (604073), TESTI20025160 (300097), TESTI20027070 (142810), MESAN20005010 (602769), NB9N410001350 (173335), TESTI20027290 (300127), TESTI20029120 (179508), NHNPC10000840 (604819), NHNPC20002120 (600855), TESTI20033250 (168730), TESTI20049820 (194558), NT2NE10000730 (601905), NT2NE20002990 (176894), TESTI20053960 (604074), TESTI20068660 (147625), NT2NE20003690 (232000), NT2NE20005170 (603395), TESTI2007 1830 (605769), TESTI20074640 (603330), NT2NE20005360 (150370), NT2NE20006580 (603899), TESTI20079510 (116930), TESTI20086570 (605969), NT2NE20008090 (603899), NT2NE20013720 (300153), TESTI20140360 (170100), THYMU10000830 (180480), NT2NE20016340 (602184), NT2NE20055170 (600857), THYMU10001760 (116930), THYMU10003590 US 2007/0015163 A1 Jan. 18, 2007

(602857), THYMU10004910 (604908), TRACH20002370 0371 The clones predicted to belong to the category of (602277), UTERU10000960 (603931), UTERU20000470 cell division and/or cell proliferation-related protein are the (602070) following 23 clones. 0369 The clones predicted to belong to the category of 0372 BGGI120001610, BRACE20027550, enzyme and/or metabolism-related protein are the following BRACE20076850, BRAWH20005030, BRAWH20005220, 168 clones. FEBRA20075660, HCASM20002140, HLUNG10000640, 0370) 3NB6920002810, ADRGL10001600, IMR3220009730, NT2NE20003840, NT2RI20006850, ADRGL10001650, BGGI120005330, BNGH410000340, NT2RI20041900, NT2RI20058110, NTONG10002460, BNGH410001770, BRACE 10000420, BRACE20015080, NTONG20008780, SKMUS20016340, SKNMC20003220, BRACE20022020, BRACE20024680, BRACE20026850, SPLEN10001430, TESTI10001680, TESTI20001840, BRACE20027360, BRACE20027720, BRACE20027920, TESTI20021050, TESTI20035120, TESTI20057310 BRACE20071380, BRACE20084430, BRAWH20001770, 0373 The clones predicted to belong to the category of BRAWH20006510, BRAWH20006860, cytoskeleton-related protein are the following 60 clones. BRAWH20009840, BRAWH20011660, BRAWH20014180, BRAWH20014840, 0374) ADRGL10000020, BRACE20006980, BRAWH2003.6890, BRAWH20059980, BRACE20008.850, BRACE20027960, BRACE2007.4470, BRAWH20069890, BRAWH2008.9560, CTONG20013660, BRACE20076630, BRACE20078820, BRACE20093070, CTONG20019110, DFNES20002120, FCBBF20007330, BRAWH20000480, BRAWH20066220, CTONG2001.9550, FCBBF20015380, FEBRA20000350, FEBRA20001290, CTONG20028160, CTONG20055530, DFNES20002680, FEBRA20003110, FEBRA20024420, FEBRA20041100, FCBBF20005910, FEBRA20007720, FEBRA20008810, FEBRA20045920, FEBRA20050790, FEBRA20052160, FEBRA20034290, FEBRA20043290, FEBRA20072000, FEBRA20062700, FEBRA20063150, HEART20000350, HEART20004480, HEART20005200, HLUNG10001100, HHDPC20000550, HHDPC20004550, HLUNG10001050, HSYRA20006050, IMR3220007910, KIDNE20040840, HLUNG20002550, HSYRA10001680, HSYRA20005100, KIDNE20052960, NT2RI20014090, NT2RI20032220, HSYRA20015740, IMR3220008380, IMR32200091.90, NT2RI20058510, NT2RI20090660, NT2RP70000690, IMR3220012180, IMR3220013170, KIDNE20000410, NT2RP70004250, NT2RP70028750, NT2RP70042600, KIDNE20003490, KIDNE20004220, KIDNE20005130, NT2RP70049250, NT2RP70074220, NTONG20009660, KIDNE20033050, KIDNE20040840, KIDNE20046810, OCBBF20011760, OCBBF20015280, PEBLM10000680, KIDNE20056290, KIDNE20060530, KIDNE20063760, PROST10001670, PROST20033380, TESTI10000420, KIDNE20068800, KIDNE20073280, KIDNE20073520, TESTI10000510, TESTI20003560, TESTI20004350, KIDNE20078100, LIVER10000670, LIVER10002300, TESTI20006000, TESTI20006990, TESTI20008490, MAMGL10001780, MESAN20002910, MESAN20005010, TESTI20008830, TESTI20011410, TESTI20015110, NT2NE10000730, NT2NE10001850, NT2NE20002140, TESTI20016610, TESTI20020570, TESTI20024230, NT2NE20003270, NT2NE20003690, NT2NE20005860, TESTI20031090, TESTI20031170, TESTI20039140, NT2NE20013720, NT2NE20016340, NT2NE20016660, TESTI2007872O NT2RI10000480, NT2RI20010100, NT2RI20015400, 0375. The clones predicted to belong to the category of NT2RI20020220, NT2RI20025300, NT2RI20033010, nuclear protein and/or RNA synthesis-related protein are the NT2RI20036780, NT2RI20037510, NT2RI20051500, following 59 clones. NT2RI2006.8550, NT2RI20073840, NT2RI20074980, 0376 3.NB6920002810, 3NB6920015280, NT2RI20084810, NT2RI20087910, NT2RP70004770, BGGI120005440, BRACE10001150, BRACE20024780, NT2RP70006240, NT2RP70011660, NT2RP700261.90, BRACE20027550, BRAWH20005030, BRAWH20014180, NT2RP70062960, NT2RP70072520, NT2RP70076100, BRAWH20069890, CTONG20024180, FEBRA20001290, NT2RP70081440, NT2RP70084.060, NT2RP70085570, FEBRA20075660, HEART20003090, HLUNG10000640, NT2RP700.93700, NTONG10001820, OCBBF20008240, HSYRA10001680, HSYRA20005100, IMR3220008.630, OCBBF2001 2100, OCBBF20014080, OCBBF20014940, IMR3220012180, MAMGL10001780, NT2NE10001850, PANCR10000210, PEBLM20004790, PLACE50001050, NT2NE20002140, NT2NE20003840, NT2NE20016660, PLACE50001130, PLACE60003790, PLACE60012810, NT2NE20054410, NT2RI20002820, NT2RI20006850, PLACE60018860, PLACE60044540, PROST20031170, NT2RI20010910, NT2RI20025540, NT2RI20041900, PROST20032320, PROST20033400, PROST20051210, NT2RI20053350, NT2RI20057230, NT2RI20060720, PROST20064500, SKMUS10001290, SKMUS10001770, NT2RI20067030, NT2RI20068550, NT2RI20078840, SKMUS20000740, SKMUS20007240, SKMUS20008630, NT2RI20087490, NT2RP70004770, NT2RP70013060, SKMUS20009330, SKMUS2001 1290, SKNSH10001740, NT2RP70076430, NTONG20008780, PEBLM10000340, SKNSH20003470, SMINT10000160, SPLEN20001340, PLACE50000580, PLACE60003790, PROST20001760, STOMA10001860, STOMA2000.1210, STOMA20004820, PROST20062600, SKMUS10000220, SKMUS20016340, SYNOV20016480, TESTI10000700, TESTI10001380, SKNMC20003220, SPLEN10001430, SPLEN20001970, TESTI20001540, TESTI20005910, TESTI20012690, TESTI10001680, TESTI20002530, TESTI20007840, TESTI20018270, TESTI20022560, TESTI20027070, TESTI20021050, TESTI20029120, TESTI20035120, TESTI20029120, TESTI20034.190, TESTI20034980, TESTI20057310, TRACH20003930, TRACH20012890 TESTI20040000, TESTI20042070, TESTI20042950, TESTI20047120, TESTI20049820, TESTI20138320, 0377 The clones predicted to belong to the category of TESTI20140360, TESTI30000020, THYMU10000830, protein synthesis and/or transport-related protein are the THYMU10004910, THYMU20003170, following 24 clones. THYMU20003690, TRACH20000150, TRACH20004720, 0378 BRACE20078680, FEBRA20075510, TRACH20004970, TRACH20009260, UTERU10000960 IMR3220008380, KIDNE20005190, KIDNE20050420, US 2007/0015163 A1 Jan. 18, 2007 62

MESAN20002910, NB9N410001350, NT2NE20005360, PLACE60005550, PLACE60021510, PLACE60030380, NT2RI20032050, NT2RI20032220, NT2RP70000760, PROST20001760, PROST20003250, PROST20018230, NT2RP70076430, NT2RP70093940, OCBBF20008240, PROST20031170, PROST20062600, PROST20073170, PLACE50000580, PROST20000530, SKMUS20000740, SALGL10000650, SKMUS10000640, SKMUS20014920, SKMUS20008.630, TESTI20007840, TESTI20015120, SKMUS20016340, SKNMC20000650, SKNMC20002240, TESTI20018690, TESTI20078720, THYMU10005580, SKNMC20003220, SKNMC20003560, SMINT10001000, UMVEN2OOO1330 SMINT20005450, SPLEN10001430, SPLEN20000200, 0379 The clones predicted to belong to the category of SPLEN20000720, SPLEN20001970, SYNOV20010140, cellular defense-related protein are the following 6 clones. SYNOV20013740, SYNOV20014510, TESTI10000550, TESTI20001200, TESTI20007070, TESTI20010490, BRACE20014.550, NT2RI20037510, NT2RI20053350, TESTI20013450, TESTI20015560, TESTI20018150, NT2RP70029060, NT2RP70062960, PLACE50001700 TESTI20021050, TESTI20021490, TESTI20026760, 0380 The clones predicted to belong to the category of TESTI20027890, TESTI20030710, TESTI20033270, development and/or differentiation-related protein are the TESTI20034130, TESTI20035120, TESTI20053960, following 19 clones. TESTI20074640, TESTI20074660, TESTI20078640, THYMU10004590, TRACH20000790, TRACH20002370, 0381 BGGI120006930, CTONG20028200, TRACH20009440, TRACH20012890, UTERU10001600 FCBBF50002610, FEBRA20014920, FEBRA20017150, FEBRA20060920, MAMGL10001820, NESOP10000870, 0384 The clones predicted to belong to the category of NHNPC10001240, NT2RI20078790, NT2RP70008120, ATP binding and/or GTP-binding protein are the following NT2RP70018560, NT2RP70045410, OCBBF20002770, 63 clones. SALGL10000650, SMINT10001000, TESTI10000550, 0385) 3NB6920002810, BNGH410000390, TESTI20026760, TESTI20078140 BRACE20022020, BRACE20028120, BRACE20071380, 0382. The clones predicted to belong to the category of BRAWH20000480, BRAWH20006860, DNA-binding and/or RNA-binding protein are the following BRAWH20066220, CTONG20013200, DFNES20002680, 158 clones. FEBRA20043290, FEBRA20052160, FEBRA20072000, FEBRA20075510, HHDPC20000550, HLUNG20001160, 0383) 3NB6920002810, 3NB6920010220, HSYRA10001680, HSYRA20005100, HSYRA20006050, 3NB6920015110, 3NB6920015570, ADRGL10000650, KIDNE20040840, MAMGL10001780, MESAN20002910, BGGI120006840, BGGI120006930, BNGH410000800, NB9N410001350, NT2NE20003690, NT2NE20005170, BNGH420005320, BRACE2001.4550, BRACE20020910, NT2NE20016660, NT2NE20055170, NT2RI2006.8550, BRACE20024090, BRACE20024780, BRACE2007 1740, NT2RI20073840, NT2RP70004250, NT2RP70011660, BRAWH10001640, BRAWH10001680, NT2RP70029060, NT2RP70036290, NT2RP70042600, BRAWH20000340, BRAWH20006330, NT2RP70046870, NT2RP70062960, NT2RP70081370, BRAWH20009010, BRAWH20014180, NT2RP70081440, NT2RP700.93700, OCBBF20008240, BRAWH20069890, CTONG20025580, CTONG20028200, OCBBF20015280, PEBLM20004790, PLACE50001700, D3OST20001840, FCBBF10005980, FCBBF200095.10, PLACE60003790, PROST20018990, PROST20033400, FCBBF50002610, FEBRA20003970, FEBRA20003990, SKMUS20008630, SMINT10000420, TESTI20001540, FEBRA20004540, FEBRA20008560, FEBRA2000.9720, TESTI20003560, TESTI20005910, TESTI20006950, FEBRA20017150, FEBRA20017900, FEBRA20050140, TESTI20006990, TESTI20008490, TESTI20015110, FEBRA20064760, FEBRA20067360, FEBRA20069420, TESTI20016610, TESTI20022560, TESTI20029120, FEBRA20072800, HEART20003090, HLUNG10000760, TESTI20034980, TESTI20042290, TESTI20047120, HSYRA10001370, HSYRA20016310, IMR3210002420, TESTI20049820, TESTI20057310 IMR3220007420, IMR3220008630, KIDNE20000510, KIDNE20039940, KIDNE20061490, KIDNE20078110, 0386 Among the clones other than the ones shown NESOP10000870, NHNPC10000840, NHNPC10001240, above, NTONG10001300 is a clone which was predicted to NHNPC20002120, NT2NE20002590, NT2NE20003840, highly possibly belong to the category of Secretory protein NT2NE20008090, NT2NE20016660, NT2NE20054410, and/or membrane protein based on the result of domain NT2RI20003410, NT2RI20004210, NT2RI20006850, search by Pfam. NT2RI20010830, NT2RI20010910, NT2RI20025410, NT2RI20025850, NT2RI20057230, NT2RI20060710, FEBRA20017060, NT2RI20066790, SMINT10000710 NT2RI20067350, NT2RI20071330, NT2RI20074390, 0387. The three clones shown above are clones which NT2RI20078790, NT2RI20078840, NT2RI20087140, were predicted to highly possibly belong to the category of NT2RI20087490, NT2RI20090650, NT2RP60001000, glycoprotein-related protein based on the result of domain NT2RP60001270, NT2RP70002710, NT2RP70008120, search by Pfam. NT2RP70013060, NT2RP70018560, NT2RP70024500, NT2RP70032030, NT2RP70042040, NT2RP70045410, 0388 BRACE20080970, BRACE20092.120, NT2RP70046560, NT2RP70055130, NT2RP70061620, BRAWH10001300, FEBRA20019890, KIDNE2003 1850, NT2RP70062960, NT2RP70064900, NT2RP70069860, KIDNE20060140, MESAN20000920, NB9N410000470, NT2RP70075370, NT2RP7008 1670, NT2RP70085570, NT2RI2007 1480, NT2RI20078910, NT2RP7008.8550, NT2RP70087200, NT2RP70090190, NTONG20003340, NTONG20016120, OCBBF10000910, PROST20094830, NTONG20008780, NTONG20015500, OCBBF20011010, SKNSH10003010, SPLEN20002670, TESTI20031960, OCBBF20015860, PEBLM10000340, PEBLM20001120, TESTI20036250, TESTI20037810, TESTI20083870, PEBLM20002700, PEBLM20003080, PLACE60002050, TESTI2O177400 US 2007/0015163 A1 Jan. 18, 2007

0389. The 21 clones shown above are clones which were 0397) The 34 clones shown above are clones which were predicted to highly possibly belong to the category of signal predicted to highly possibly belong to the category of transduction-related protein based on the result of domain DNA-binding and/or RNA-binding protein based on the search by Pfam. result of domain search by Pfam. 0390 3NB6920009120, 3NB692001.4710, BRACE10001660, BRACE20083,850, BRAWH20004760, 0398. The clone shown above is a clone which was BRAWH20012030, CTONG20011390, CTONG20018200, predicted to highly possibly belong to the category of FEBRA20007870, FEBRA20043250, HHDPC20003150, ATP-binding and/or GTP-binding protein based on the result NT2RI10000270, NT2RI20036950, NT2RI20053680, NT2RI20072540, NT2RI20083360, NT2RP70030550, of domain search by Pfam. OCBBF20013070, OCBBF20015270, PLACE60046630, 0399. The 178 clones shown below are clones which PROST10003430, PROST20067370, SKMUS10001040, were unassignable to any of the above-mentioned catego SKNMC20015960, TESTI20030050, TESTI20033540, ries, but have been predicted to have some functions based TESTI20035890, TESTI20068720, TRACH20004110 on homology search for their full-length nucleotide sequences and motif search in their deduced ORFs. Clone 0391 The 29 clones shown above are clones which were Name, Definition in the result of homology search or Motif predicted to highly possibly belong to the category of Name in the motif search, demarcated by a double slash transcription-related protein based on the result of domain mark (//), are shown below. search by Pfam. 3NB691OOO1160/FSTEROIDOGENIC ACUTE REGULA 0392 BNGH410001900, BRACE20080970, TORY PROTEIN PRECURSOR. BRACE20092120, BRAWH20093600, FEBRA20003770, FEBRA20024290, HLUNG10000990, KIDNE20004030, 3NB691OOO1290//KRAB box MESAN20000920, NB9N42000 1040, NT2NE10000140, 3NB6910001730//RI01/ZK632.3/MJ0444 family NT2NE20001740, NT2RI20050610, NT2RI20055640, NT2RI20072540, NT2RI20074690, NT2RP60000860, 3NB6920014330//Domain of unknown function NT2RP7003.6470, NT2RP70036800, NT2RP70072210, ASTRO20000950/SNAP-25 family NT2RP70074060, NT2RP70084870, NTONG10001300, NTONG10002640, NTONG20016120, OCBBF10000910, BNGH410000030//R. norvegicus trg mRNA. OCBBF10001190, OCBBF20007190, SKMUS20001170, BNGH410000290/SPRY domain SKMUS20016620, SKNMC20000970, SKNMC20015960, SYNOV10001280, TESTI20002380, TESTI20006270, BRACE20005250//DRR1 PROTEIN (TU3A PROTEIN). TESTI20013300, TESTI2003 1520, TESTI20036250, TESTI20037810, TESTI20064830, TESTI20083870, BRACE20005650/ATP synthase ab C terminal TRACH20006750, TRACH20016070 BRACE20013750//Hepatitis C virus non-structural protein 0393. The 43 clones shown above are clones which were NS4a predicted to highly possibly belong to the category of BRACE2OO 1477O/AHUNTINGTIN ASSOCIATED PRO enzyme and/or metabolism-related protein based on the TEIN 1 (HAP1). result of domain search by Pfam. BRACE20016730/Mus musculus mdgl-1 mRNA, complete cds. 0394 The clone shown above is a clone which were BRACE20017370/IP vivax pval gene. predicted to highly possibly belong to the category of cell division and/or cell proliferation-related protein based on the BRACE20019440//Protein of unknown function DUF82 result of domain search by Pfam. BRACE2OO2431 Of FP53-INDUCED PROTEIN 11. BRACE20083800, KIDNE20004970 BRACE20028960/Mus musculus mRNA for Ca2+ depen dent activator protein for secretion, complete cas. 0395. The two clones shown above are clones which were predicted to highly possibly belong to the category of BRACE20077840//Putative Protein that mediates attach cytoskeleton-related protein based on the result of domain ment of autophagosomes to microtubules, by similarity to search by Pfam. yeast aut2 Schizosaccharomyces pombe. 0396 3.NB6920009120, 3NB692001.4710, BRACE20093610//Bacterial type II secretion system pro BRACE10001660, BRACE20083,850, BRAWH20004760, tein BRAWH20012030, BRAWH20064500, CTONG 20011390, BRAWH20003230//Proline rich protein CTONG20018200, FEBRA20007870, FEBRA20043250, HCASM20003070, HHDPC20003150, NT2RI10000270, BRAWH20009440/Arabidopsis thaliana pollenless3 (178) NT2RI20036950, NT2RI20053680, NT2RI20072540, gene, complete cas; NT2RI20083360, NT2RP700 12310, NT2RP70030550, beta-9 tubulin (TUB9) gene, partial cds; and unknown gene. NT2RP7003.6470, OCBBF20013070, OCBBF20015270, PLACE60046630, PROST10003430, PROST20067370, BRAWH20014610//TS-N domain//UBA domain SKMUS10001040, SKNMC20000970, SKNMC20015960, TESTI20030050, TESTI20032280, TESTI20033540, BRAWH20060440/PPR repeat TESTI20035890, TESTI20068720, TRACH20004110 BRAWH2OO7605OFFLORICRIN. US 2007/0015163 A1 Jan. 18, 2007 64

CTONG 2002721 OffVACUOLAR PROTEIN SORTING HSYRA10001780/Alpha-2-macroglobulin family N-termi ASSOCIATED PROTEIN VPS13. nal region CTONG 20028030//Domain of unknown function DUF19// HSYRA2OOO13507/CELL POLARITY PROTEIN TEA1. Ribosomal protein S18 HSYRA2001.4760//von Willebrand factor type A domain CTONG20064490/Drosophila melanogaster 26S protea Some regulatory complex subunit p42A mRNA, complete HSYRA2001 6210//HesB-like domain cds. IMR3220002230/HINT PROTEIN (PROTEIN KINASEC DFNES20004320//Homo sapiens ubiquitous TPR-motif INHIBITOR 1) (PKCI-1) (17 KD INHIBITOR OF PRO protein Y isoform (UTY) gene, partial cds; alternatively TEIN KINASEC). spliced. IMR322001.4910//Rattus norvegicus tricarboxylate carrier like protein mRNA, complete cds. FCBBF10006870/Mus musculus Rap2 interacting protein 8 (RPIP8) mRNA, complete cds. KIDNE10001520/Mus musculus yolk sac permease-like FCBBF2OOO232O/FT-box molecule 1 (YSPL-1) mRNA, complete cds. KIDNE20003750/Mus musculus mRNA for granuphilin-a, FCBBF2OOO276Of FALPHASCRUIN. complete cds. FCBBF20012110//Leishmania major partial ppg 1 gene for KIDNE20005740/Staphylococcus epidermidis putative proteophosphoglycan. cell-surface adhesin SdrE (sdrF) gene, complete cds. FCBBF20016720//Domain of unknown function DUF94 KIDNE20043440//Vacuolar protein sorting-associated pro FEBRA20000530//Drosophila melanogaster Diablo (dbo) tein fission yeast mRNA, complete cds. KIDNE2005676OfFNEURONAL PROTEIN. FEBRA20005360//Homo sapiens paraneoplastic cancer-tes KIDNE20060300/Gallus gallus syndesmos mRNA, com tis-brain antigen (MA5) mRNA, complete cds. plete cods. FEBRA20007570//Homo sapiens BM-009 mRNA, com KIDNE20062480/Scorpion short toxins plete cods. KIDNE20067750//Homo sapiens PTOV1 (PTOV1) gene, FEBRA2OO 11330//26S PROTEASOME REGULATORY complete cds. SUBUNIT S3 (PROTEASOME SUBUNIT P58). LIVER100007907/Rattus norvegicus fertility related protein FEBRA20030540//Halocynthia roretzi mRNA for HrPET-1, WMP1 mRNA, complete cds. complete cds. MAMGL10000560//K-box region FEBRA20044900//R. norvegicus mRNA for CPG2 protein. MESAN10001010//Rat trg gene product FEBRA20048.180//DRR1 PROTEIN (TU3A PROTEIN). NB9N42OOO495O/FPROBABLE NUCLEAR ANTIGEN. FEBRA20053800//Homo sapiens ubiquitous TPR-motif protein Y isoform (UTY) gene, partial cds; alternatively NT2NE1 OOOO18Of FSUPPRESSOR PROTEIN SRP4O. spliced. NT2NE10000630//Gallus gallus Dach2 protein (Dach2) mRNA, complete cds. FEBRA2005,7260//TBC domain FEBRA2006873.0//Trg protein NT2NE20007630//Matrix protein (MA), p.15 NT2NE20013370//Homo sapiens estrogen-responsive B HCASM10000210//Plasmodium berghei strain NYU2 box protein (EBBP) mRNA, complete cds. merozoite surface protein-1 mRNA, partial cds. NT2NE2OO1697Of FMSF1 PROTEIN. HCASM20005360//Macrophage migration inhibitory factor NT2NE20035690//Homo sapiens phosphoinositol 3-phos HEART20004110/POT family phate-binding protein-2 (PEPP2) mRNA, complete cds. HEART20005680//Nerve growth factor family NT2NE20053710/Ank repeat HHDPC20001150/Mus musculus putative secreted protein NT2RI2OOO66907 FTRICHOHYALIN. ZSIG37 (Zsig37) mRNA, complete cds. NT2RI20013420/Mus musculus cyclin ania-6b mRNA, par HHDPC20001490/Mus musculus partial mRNA for muscle tial cds. protein 534 (mg534 gene). NT2RI20013850//Homo sapiens P38IP (P381P) mRNA, HHDPC20004560/2S seed storage family complete cds. HHDPC20004620//FAD binding domain NT2RI20015190//Homo sapiens misato mRNA, partial cds. HSYRA10001190//PROBABLE GYP7 PROTEIN (FRAG NT2RI20016210//Probable transposase human transpo MENT). Son MER37 US 2007/0015163 A1 Jan. 18, 2007 65

NT2RI20022700/X123 protein OCBBF20014020/Mus musculus NSD1 protein mRNA, NT2RI20025170//Homo sapiens PAR3 (PAR3) mRNA, complete cds. complete cds. PEBLM10001440/Trg NT2RI2OO2926O7/ARP2A3 COMPLEX 16 KDA SUBUNIT PEBLM20002130/Mus musculus genes for integrinaM290, (P16-ARC). hapsin, partial and complete cds. NT2RI2002.9700//EF hand//EF hand PLACE50000370//Homo sapiens mRNA for hVPS11, com NT2RI20043040//Homo sapiens NY-REN-2 antigen plete cods. mRNA, complete cds. PLACE60004290//Gag P30 core shell protein NT2RI20046060//K+ channel tetramerisation domain PLACE60021020//Integrase Zinc binding domain/Inte NT2RI20061830//Proline-rich protein M14 precursor grase Zinc binding domain//DnaJ central domain (4 repeats) NT2RI20065060//Drosophila melanogaster rudimentary PLACE6OO24.190/ATRICHOHYALIN. gene, intron 3; anon-15AB gene, complete cds. PLACE60032040//Hirudin NT2RI20077230//Homo sapiens BRI3 mRNA, complete PLACE6OO33990/ASPIDROIN 1 (DRAGLINE SILK cds. FIBROIN 1) (FRAGMENT). NT2RI20082210/CORNIFIN B (SMALL PROLINE PLACE60038500//Homo sapiens mitochondrial solute car RICH PROTEIN 1B) (SPR1B) (SPR1B). rier mRNA, complete cds. NT2RI2OO8812O/FAXONEME-ASSOCIATED PROTEIN PLACE60043970//Takifiugu rubripes retinitis pigmentosa MST101(2). GTPase regulator-like protein gene, partial cds. PLACE60044640//Human placenta (Diff48) mRNA, com NT2RI2009 1440/7SPRY domain plete cods. NT2RP60000080//Homo sapiens Pig.11 (PIG11) mRNA, complete cds. PROST20023380/Cca3 protein PROST2003472O//IMMEDIATE-EARLY PROTEIN. NT2RP60000720//Pinus taeda clone PtaAGP6 putative ara binogalactan protein mRNA, complete cds. PROST2007974Of ANTER-SPECIFIC PROLINE-RICH PROTEIN APG (PROTEIN CEX) (FRAGMENT). NT2RP70009060/Medicago truncatula mRNA for 85p pro tein (85p gene). SALGL10000050//Permeases for cytosine/purines, uracil, thiamine, allantoin NT2RP70010800/Mus musculus mRNA for MILI (Miwi like), complete cas. SALGL10000470//NG36 Homo sappiens SKMUS20002710/Hepatitis C virus capsid protein NT2RP70022430//Tax1-binding protein TRX human. SKMUS20003650//Human (p23) mRNA, complete cds. NT2RP70028290/Scm-related gene containing four mbt domains Mus musculus. SKMUS20004580/Mus musculus N-RAP mRNA, com plete cods. NT2RP70033040//YceA protein homologybfO-Bacillus subtilis. SKMUS2OOO902O//BRO1 PROTEIN. SKMUS2000954.0//Homo sapiens F-box protein Fbx25 NT2RP70036320//Microfilarial sheath protein (FBX25) mRNA, partial cds. NT2RP70039600/Calpain inhibitor repeat SKMUS2001 0080//Mus musculus mRNA for a skeletal NT2RP7OO4233O/AHYPOTHETICAL PROTEIN MJO941. muscle and cardiac protein. NT2RP70049150//Mus musculus mRNA for UBE-1c1, SKMUS20011470/Mus musculus RP42 mRNA, complete UBE-1 c2, UBE-1c3, complete cds. cds. NT2RP70052050//Human transformation-related protein SKMUS20013640/Laminin EGF-like (Domains III and V) mRNA, 3' end. SKMUS20015430//Homo sapiens HDCMC29P mRNA, NT2RP70084410/Polybromo 1 protein-chicken partial cds. NTONG10000520/Rattus norvegicus mRNA for Kelch SKNMC20010570//F-box domain. related protein 1 (krp1 gene). SMINT20001450//Halocynthia roretzi mRNA for HrPET-3, complete cds. NTONG1000 1230/Mus msuculus mRNA, partial cds, clone CLFEST42. SMINT20002270/Disintegrin/Trans-activation protein X OCBBF10001220//RING CANAL PROTEIN (KELCH SMINT20003960/A kinase anchor protein AKAP-KL iso PROTEIN). form 2 OCBBF20010750/Spectrin repeat STOMA20002890/Adaptin N terminal region OCBBF2OO114OOFFVACUOLAR PROTEIN SORTING SYNOV20002910/Arabinogalactan-like protein ASSOCIATED PROTEIN VPS8. SYNOV20008200//Trichoplusia ni transposon IFP2. US 2007/0015163 A1 Jan. 18, 2007 66

TESTI10000250/M. musculus mRNA for testis-specific TRACH20007800//Homo sapiens PTH-responsive osteosa protein, DDC8. rcoma B1 protein (B1) mRNA, complete cds. TESTI 10000640//Fugu rubripes sex comb on midleg-like 2 TRACH20008940/PROTEIN TSG24 (MEIOTIC CHECK protein (SCML2) gene, complete cds. POINT REGULATOR). TESTI10001910//Homo sapiens 88-kDa Golgi protein TRACH20013950//Homo sapiens NY-REN-25 antigen (GM88) mRNA, complete cds. mRNA, partial cds. TESTI2OOOO44Off TRICHOHYALIN. UMVEN10001220/Corticotropin-releasing factor family TESTI2OOO2O7O//NIFU-LIKE PROTEIN. 0400. With respect to the remaining 476 clones, there are TESTI20002080/Homo sapiens mRNA for Gab2, complete So far no information available for estimating their func cds. tions. However, there is the possibility that the functions of these clones will be revealed in future. Their Clone Names TESTI2OO1412O/FTRICHOHYALIN. are indicated below. TESTI2OO1665Of FIMMEDIATE-EARLY PROTEIN. 04.01 3NB6920013490, 3NB6920016370, TESTI20022230/Chlamydomonas reinhardtii strain 3NB6920017190, ADRGL10001820, ADRGL20004280, 1132D-flagellar protofilament ribbon protein (RIB43a) ASTRO20004800, BGGI110002850, BNGH410000130, mRNA, complete cds. BNGH410000170, BNGH410000330, BNGH410001530, BNGH420004740, BRACE 10000200, BRACE10000700, TESTI20022940/MOB2 PROTEIN (MPS1 BINDER 2). BRACE10001590, BRACE20000770, BRACE20001000, BRACE20001410, BRACE20003320, BRACE20004210, TESTI2OO2461 OFFTRICHOHYALIN. BRACE20005050, BRACE20005450, BRACE20009880, TESTI20030590/ITESTIS-SPECIFIC PROTEIN PBS 13. BRACE20010700, BRACE20011880, BRACE20013740, BRACE20015430, BRACE20016920, BRACE20018650, TESTI2OO3O74Off TRICHOHYALIN. BRACE20018980, BRACE20020500, BRACE20021510, TESTI2OO313OOf FTPR Domain BRACE20021760, BRACE20024950, BRACE20025900, BRACE20027520, BRACE20028600, BRACE20028610, TESTI20033560//F-box domain. BRACE20032850, BRACE20033190, BRACE20033980, TESTI2003551.0//Proliferating-cell nucleolar antigen P120 BRACE20034310, BRACE20035160, BRACE20035270, like protein Archaeoglobus fulgidus. BRACE20035390, BRACE20035940, BRACE2007 1530, BRACE20072010, BRACE20072320, BRACE20075270, TESTI2OO35740F/A-KINASE ANCHOR PROTEIN 150 BRACE20075630, BRACE20076210, BRACE20076460, (AKAP 150) (CAMP-DEPENDENT PROTEIN KINASE BRACE20077080, BRACE20077270, BRACE20077670, REGULATORY SUBUNIT II HIGHAFFINITY BINDING BRACE20077680, BRACE20079020, BRACE20081140, PROTEIN) (P150) (FRAGMENT). BRACE20084800, BRACE20084880, BRACE20086530, TESTI20038940/IQ calmodulin-binding motif?/IQ calm BRACE20087080, BRACE20087540, BRACE20088570, odulin-binding motifi/IQ calmodulin-binding motif BRACE20089990, BRACE20090140, BRACE20092740, BRACE20092750, BRACE20093.110, BRACE2009.4370, TESTI2004.0310//Protein of unknown function DUF84 BRACE20095170, BRAWH10000070, BRAWH10001740, BRAWH20000930, BRAWH20002480, TESTI20041220//Babesia bigemina 200 kDa antigen p200 BRAWH20005540, BRAWH20008660, mRNA, partial cds. BRAWH20008920, BRAWH20011030, TESTI2005.2680//Rattus norvegicus RSD-6 mRNA, com BRAWH20047310, BRAWH20064930, plete cods. BRAWH20069600, BRAWH20074060, BRAWH20089030, BRAWH20092270, TESTI2OO5408OFFSERFTHR-RICH PROTEIN T10 IN BRAWH20094850, CTONG20003030, CTONG20007710, DGCR REGION. CTONG20008270, CTONG20020730, CTONG20021430, TESTI20065720/PROTEIN D52 (N8 PROTEIN). CTONG20024530, CTONG2002.9650, DFNES20002920, FCBBF10006860, FCBBF10006910, FCBBF10007320, TESTI20078670//RING CANAL PROTEIN (KELCH FCBBF10007600, FCBBF20001050, FCBBF20001950, PROTEIN). FCBBF20005760, FCBBF20006770, FCBBF20008080, TESTI20080330//Ribosomal protein L14p/L23e FCBBF20012990, FCBBF20014800, FCBBF20017180, FCBBF20017200, FEBRA20003300, FEBRA20003910, TESTI20083430/7TPR Domain FEBRA20006800, FEBRA20007400, FEBRA20007710, THYMU10000020/Homo sapiens mRNA for Golgi protein FEBRA20008740, FEBRA20009010, FEBRA2000.9590, (GPP34 gene). FEBRA2001 1970, FEBRA20015900, FEBRA20015910, FEBRA20021940, FEBRA20027270, FEBRA20027830, THYMU10002910//Homo sapiens AP-4 adaptor complex FEBRA20028820, FEBRA20028970, FEBRA20029080, beta4 subunit mRNA, complete cds. FEBRA20033080, FEBRA20042240, FEBRA20042370, THYMU20002360/Pumilio-family RNA binding domains FEBRA20042930, FEBRA20044120, FEBRA20044430, FEBRA20053770, FEBRA20054270, FEBRA20057520, (aka PUM-HD, Pumilio homology domain) FEBRA20059980, FEBRA20061500, FEBRA20063540, TRACH10000300/Anabaena PCC7120 hetC gene, com FEBRA20066270, FEBRA20074140, FEBRA20074580, plete cods. FEBRA20076220, HCASM10001150, HCASM20005340, US 2007/0015163 A1 Jan. 18, 2007 67

HLUNG10000300, HLUNG20003140, HLUNG20004120, PLACE60049310, PROST10001520, PROST10002460, HLUNG20004800, HLUNG20005010, HSYRA10001480, PROST10005640, PROST20002060, PROST20002670, HSYRA20002480, HSYRA20002530, HSYRA20007600, PROST20002740, PROST20004630, PROST20017390, HSYRA20011530, IMR3210000740, IMR3210000750, PROST20017960, PROST20019980, PROST20021620, IMR3210001650, IMR3220006090, IMR3220009350, PROST20025910, PROST20028420, PROST20031020, IMR322000.9530, IMR3220011850, IMR3220016000, PROST20032100, PROST20033030, PROST20037320, IMR3220017240, KIDNE10000280, KIDNE10000500, PROST20044810, PROST20056040, PROST2006 1960, KIDNE10001450, KIDNE20001920, KIDNE20002440, PUAEN10000810, SKMUS10001240, SKMUS20003430, KIDNE20002450, KIDNE20002660, KIDNE20033350, SKMUS20004670, SKMUS20004680, SKMUS20008470, SKMUS2000.9450, SKMUS20015010, SKMUS20016080, KIDNE20033770, KIDNE20037520, KIDNE20040340, SKMUS20016310, SKMUS20016710, SKNMC10000070, KIDNE2004.0540, KIDNE20042940, KIDNE20045200, SKNMC10000100, SKNMC10001100, SKNMC10001590, KIDNE20045340, KIDNE20045790, KIDNE20048640, SKNMC10001680, SKNMC10002640, SKNMC20003050, KIDNE20048790, KIDNE20059370, KIDNE20070050, SKNMC20005930, SKNMC20006120, SKNMC20015550, KIDNE20070770, KIDNE20073560, LIVER100.00990, SKNSH10000860, SKNSH10003080, SKNSH20001510, LIVER10002780, LIVER10003030, LIVER20004460, SKNSH20001630, SMINT10000390, SMINT10000540, LIVER20005150, MAMGL10000350, MESAN20002670, SMINT20000400, SMINT20002390, SMINT20005580, MESAN20003370, NB9N410001210, NB9N410001460, SPLEN10000490, SPLEN20000470, SPLEN20002420, NHNPC10001010, NT2NE10000040, NT2NE10001200, SPLEN20004430, SPLEN20005410, STOMA10000470, NT2NE20000380, NT2NE20000560, NT2NE20000640, STOMA10001330, STOMA20001880, STOMA20004780, NT2NE20006360, NT2NE20007060, NT2NE20007870, SYNOV10001640, SYNOV20011440, SYNOV2001.4570, NT2NE20008020, NT2NE20009800, NT2NE20011560, TESTI10000230, TESTI10001250, TESTI10001630, NT2NE20013240, NT2NE20013640, NT2NE20014030, TESTI10001790, TESTI20000180, TESTI20001790, NT2NE20014280, NT2NE20015300, NT2NE20016230, TESTI20003720, TESTI20004620, TESTI20005200, NT2NE20016480, NT2NE2004.4900, NT2RI10000160, TESTI20006710, TESTI20008190, TESTI20008300, NT2RI10001640, NT2RI20000640, NT2RI20002700, TESTI20009510, TESTI20010080, TESTI20010820, NT2RI20002940, NT2RI20006710, NT2RI20007380, TESTI20013060, TESTI20015930, TESTI20017580, NT2RI20008650, NT2RI20012350, NT2RI2001 2440, TESTI20017660, TESTI20017920, TESTI20018260, NT2RI20014100, NT2RI20017260, NT2RI20026540, TESTI20018290, TESTI20018980, TESTI2001.9500, NT2RI20028020, NT2RI20028520, NT2RI20030190, TESTI20019680, TESTI20019910, TESTI20020480, NT2RI20030670, NT2RI20033040, NT2RI20033380, TESTI20020900, TESTI200224.50, TESTI20022640, NT2RI20035560, NT2RI20040590, NT2RI20043980, TESTI20023610, TESTI20023690, TESTI20024150, NT2RI20047830, NT2RI20048400, NT2RI20049160, TESTI20025440, TESTI20028060, TESTI200284.00, NT2RI20049840, NT2RI20056280, NT2RI20061270, TESTI2002.9650, TESTI20032550, TESTI20032800, NT2RI20063450, NT2RI20064870, NT2RI20065530, TESTI20032990, TESTI20033760, TESTI20034180, NT2RI20066670, NT2RI20067880, NT2RI20071160, TESTI20035410, TESTI20035800, TESTI20037270, NT2RI20072140, NT2RI20073860, NT2RI20075070, TESTI20041110, TESTI20042430, TESTI20049290, NT2RI20075720, NT2RI20075890, NT2RI20077290, TESTI20051550, TESTI20054920, TESTI20062380, NT2RI20077510, NT2RI20085260, NT2RI20086560, TESTI20062550, TESTI20064250, TESTI20069790, NT2RI20088010, NT2RI20090830, NT2RP60000170, TESTI20073580, TESTI20074020, TESTI20076130, NT2RP60000590, NT2RP70000410, NT2RP70003.910, TESTI20077500, TESTI20081390, TESTI20082340, NT2RP70005790, NT2RP70013350, NT2RP70024490, TESTI20082400, TESTI20084400, THYMU10000320, NT2RP70025540, NT2RP700284.10, NT2RP70030500, THYMU10001050, THYMU10003660, NT2RP70030910, NT2RP70047510, NT2RP70047660, THYMU10004730, THYMU10005270, NT2RP70049750, NT2RP700521.90, NT2RP70054680, THYMU20001400, TRACH10000180, TRACH10000570, NT2RP70054930, NT2RP70063740, NT2RP70066210, TRACH10001060, TRACH20002350, TRACH20004610, NT2RP70067010, NT2RP70069.800, NT2RP70071140, TRACH2001 1920, TRACH20014000, UTERU20003380, NT2RP70073590, NT2RP700793.00, NT2RP70081420, UTERU20005410, UTERU20005690 NT2RP70086230, NT2RP70092.150, NT2RP70092.590, NT2RP700.93630, NT2RP70093970, NT2RP70094.660, EXAMPLE 7 NT2RP700.95020, NTONG10000330, NTONG20005830, NTONG20009850, NTONG20011370, NTONG20014280, OCBBF10000670, OCBBF10000860, OCBBF10001040, Expression Frequency Analysis In Silico OCBBF20000130, OCBBF2000 1260, OCBBF20002870, 0402. The cDNA libraries derived from various tissues OCBBF20009040, OCBBF20017060, PANCR10001850, and cells as indicated in Example 1 were prepared, and PEBLM10000290, PEBLM10001800, PEBLM20000300, cDNA clones were selected from each library at random. PEBLM2000 1260, PEBLM20001470, PLACE50001530, The 5'-end sequences were determined and the database was PLACE60000440, PLACE60000700, PLACE60000800, constructed based on the data. The database was constructed PLACE60001370, PLACE60002630, PLACE60003710, based on the nucleotide sequences of 770.546 clones, and PLACE60004240, PLACE60005230, PLACE60005500, thus the population of the database is large enough for the PLACE60009530, PLACE60012940, PLACE60019230, analysis. PLACE60019250, PLACE60026920, PLACE60029490, PLACE60030940, PLACE60031090, PLACE60033720, 0403. Then, clones having a homologous sequence are PLACE60037400, PLACE60040050, PLACE60043.120, categorized into a single cluster (clustering) by searching the PLACE60043360, PLACE60044910, PLACE60046870, nucleotide sequences of respective clones in this database US 2007/0015163 A1 Jan. 18, 2007

with the program of nucleotide sequence homology search; Genes Involved in Neural Cell Differentiation the number of clones belonging to each cluster was deter 04.09 Genes involved in neural cell differentiation are mined and normalized for every library; thus, the ratio of a useful for treating neurological diseases. Genes with varying certain gene in each cDNA library was determined. This expression levels in response to induction of cellular differ analysis gave the information of the expression frequency of entiation in neural cells are thought to be involved in genes in tissues and cells which were sources of the cDNA neurological diseases. libraries. 0410. A survey was performed for genes whose expres 04.04 Then, in order to analyze the expression of a gene sion levels are varied in response to induction of differen containing the nucleotide sequence of the cDNA of the tiation (stimulation by retinoic acid (RA) or growth inhibitor present invention in tissues and cells, the library derived treatment after RA stimulation) in cultured cells of a neural from a tissue or a cell used in the large-scale cDNA analysis strain, NT2. The result of comparative analysis of cDNA was Subjected to the comparison of the expression levels libraries derived from undifferentiated NT2 cells (NT2RM) between tissues or cells. Namely, the expression frequency and the cells subjected to the differentiation treatment was analyzed by comparing the previously normalized val (NT2RP, NT2RI or NT2NE) showed that the genes whose ues between tissues and/or cells for which the nucleotide expression levels were different between the two were the sequences of 600 or more cDNA clones had been analyzed. following clones (Table 4). By this analysis, some of the genes were revealed to be 0411 SKNMC20000970, 3NB6920009120, involved in the pathology and functions indicated below. BRAWH20006970, KIDNE20062480, NHNPC20002060, Each value in Tables 3 to 39 shown below represents a NT2NE20053710, NT2RI20000640, NT2RI20004210, relative expression frequency; the higher the value, the NT2RI20006710, NT2RI2000.9740, NT2RI20013420, higher the expression level. NT2RI20013850, NT2RI20014100, NT2RI20025410, NT2RI20033040, NT2RI20035560, NT2RI20036950, Osteoporosis-Related Genes NT2RI20051500, NT2RI20053350, NT2RI20057230, NT2RI20071330, NT2RI20075720, NT2RI20083960, 04.05 Osteoporosis is a pathology in which bones are NT2RI20087910, NT2RI20090650, NT2RI20094.060, easily broken owing to overall decrease in components of NT2RP60000350, NT2RP70000760, NT2RP70036800, bone. The onset involves the balance between the functions NT2RP7007 1770, NT2RP70074220, TESTI20007840, of osteoblast producing bone and osteoclast absorbing bone, TESTI20080200, 3NB6920002810, 3NB6920005450, namely bone metabolism. Thus, the genes involved in the HSYRA20015740, HSYRA20016210, IMR3220016000, increase of osteoclasts differentiating from precursor cells of KIDNE20060140, NT2RI20014490, NT2RI20015950, monocyte/macrophage line (Molecular Medicine 38. 642 NT2RI20022520, NT2RI20025170, NT2RI20025540, 648. (2001)) are genes involved in bone metabolism asso NT2RI20030510, NT2RI20040590, NT2RI20046060, ciated with osteoporosis. NT2RI20053680, NT2RI20058510, NT2RI20066820, NT2RI20067030, NT2RI20074980, NT2RI20075890, 0406 A nucleotide sequence information-based analysis NT2RI20078840, NT2RI20084810, NT2RI20089420, was carried out to identify the genes whose expression NT2RP70002380, NT2RP70023790, NT2RP70029820, frequencies are higher or lower in CD34+ cell (cell express NT2RP70049.150, NT2RP70055020, NT2RP70065270, ing a glycoprotein CD34) treated with the osteoclast differ NT2RP70069860, NT2RP70075370, NT2RP70079750, entiation factor (Molecular Medicine 38. 642-648. (2001)) NT2RP700925.90, OCBBF20000130, PLACE60043970, than in the untreated CD34+ cell, which is the precursor cell TESTI20053960, BNGH420004740, HSYRA20002480, of monocyte/macrophage line. The result of comparative NT2NE10000730, NT2NE20000560, NT2NE20003270, analysis for the frequency between the two cDNA libraries NT2NE20008090, NT2NE20014030, NT2RP60000720, prepared from the RNA of CD34+ cells (CD34C) and from NT2RP60001090, NT2RP70004770, NT2RP70010800, the RNA of CD34+ cells treated with the osteoclast differ NT2RP70011660, NT2RP70028750, NT2RP70029060, entiation factor (D30ST, D60ST or D90ST) showed that the NT2RP70030550, NT2RP70032030, NT2RP70036320, genes whose expression levels were different between the NT2RP70064900, NT2RP700.93220, NT2RP700.93730, two were the following clones (Table 3). SYNOV20013740, TESTI20021490, TRACH20004720, 04.07 KIDNE20062480, NT2RI20016570, TRACH20007800, 3NB6920003300, BRACE10000200, PLACE60020840, 3NB6920002810, BRACE20035270, BRACE20018550, FEBRA20008740, FEBRA20074580, BRAWH20000340, FEBRA20062700, HSYRA20011030, FEBRA20076220, KIDNE20073520, MAMGL10000320, NT2RP70030910, OCBBF2001 1240, PLACE60043.120, NT2NE20002140, NT2NE20006360, NT2NE20007870, SYNOV20011440, HCASM10001150, IMR3220016000, NT2NE20009800, NT2NE20035690, NT2RI20002940, NT2RI20082210, D3OST20001840, FEBRA20012940, NT2RI2001.4500, NT2RI20016210, NT2RI20029260, FEBRA20021910, IMR3220002230, IMR322001 2180, NT2RI20037510, NT2RI20055640, NT2RI20064120, NT2RI20000640, NT2RI20010910, NT2RI20058110, NT2RI20074390, NT2RI20077230, NT2RI20090660, NT2RP60000350, NT2RP70011660, PEBLM20003950, PLACE60040050, TRACH20012890, 3NB6910001730, PLACE60049310, PROST20062600, TESTI20007840, BRACE10001150, BRACE20011170, BRACE20020910, TESTI20040310, TESTI20080200, THYMU10003590, BRACE20035270, BRAWH20005220, FEBRA20003970, TRACH10000630, TRACH20007800, CD34C20000510, FEBRA2001 2450, HLUNG20003140, IMR3220009350, HSYRA20016210, KIDNE20004030, KIDNE20073280, IMR3220013170, IMR3220013320, IMR3220014350, NT2RP70055020, PLACE60043960, SKMUS10000220 NT2NE10000040, NT2NE10000140, NT2NE10000180, NT2NE10000230, NT2NE10000630, NT2NE10000830, 0408. These genes are involved in osteoporosis. NT2NE10001200, NT2NE10001630, NT2NE10001850, US 2007/0015163 A1 Jan. 18, 2007 69

NT2NE20000380, NT2NE20000640, NT2NE20001740, NT2RI20092.15-0, NT2RI20092890, NTONG10001820, NT2NE20002590, NT2NE20002990, NT2NE20003690, OCBBF20002770, OCBBF2001 1240, PEBLM10001440, NT2NE20003840, NT2NE20003920, NT2NE20004550, PLACE50001130, PLACE60014.430, PROST20029600, NT2NE20004700, NT2NE20005170, NT2NE20005360, PUAEN10000570, SALGL10001570, SKMUS10000220, NT2NE20005500, NT2NE20005860, NT2NE20006580, SKMUS20004670, STOMA20002890, SYNOV10001280, NT2NE20007060, NT2NE20007630, NT2NE20008020, TESTI20012690, TESTI20023690, TESTI20028660, NT2NE20011560, NT2NE2001.2470, NT2NE2001.3240, TESTI20068720 THYMU10000020, THYMU10000830, NT2NE2001.3370, NT2NE20013640, NT2NE20013720, TRACH20002370, 3NB6910001290, BRACE10000700, NT2NE20014280. NT2NE20014350. NT2NE20015300. BRACE2000:20, BRACE2005080, BRACE2007020, NT2NE2006230 NT2NE20016260 NT2NE2006,340. BRACE20083800, BRACE20092740, FEBRA20008810, NT2NE20016480,s NT2NE20016660,s NT2NE20016970, FEBRA20017150, FEBRA20067930, HHDPC20000550, NT2NE20034080, NT2NE2004.4900, NT2NE20047160, HSYRA20008280,KIDNE20000850. HSYRA2001.4760,KIDNE20002660. KIDNE10001450,KIDNE20003300 NT2NE20054410, NT2NE20055170, NT2NE20057200, KDNEoososo. KNE2004sso. NT2RPooooooso. OCBBF20009040, OCBBF20015860, PLACE60020840, NT2RPooooo. NTRDooooo.320 NT2Rboooooo. PROST10005260. SKMUS20008.630. SMINT20003960, NT2Rpooooosoo. NT2RPoooosco. NTRDoooooo. STOMA20001210, SYNOV20011440, TESTI10000230. NTRDoooo. NTRDooo.270 NT2RP700000 TESTI20009700, TESTI20040310. THYMU10003290, NT2Rp7ooooooo. NTRp70002soo. NT2Rp70002710 TRACH20013950, BGGI120010970, BNGH410001980, NT2RD7ooooo. NTRD7ooooo. NTRD70004250 BRACE10001660, BRACE20014770, BRACE20034490, NT2Rp7000s,700 NT2RP7000620. NTRp7oooslo BRACE2007 1740, BRAWH20009440, BRAWH20036930, NTRD7oooooo. NTRD7oosio N2RD70000 CTONG20020730, CTONG20028030, FCBBF 10006750, NT2RD7001350 NT2RP700 solo NT2RD7osso FCBBF20012110, FCBBF20015380, FEBRA20007570, NT2Rp7002 So NT2Rp70022430 NT2Rp7002760. FEBRA20043250, FEBRA20068730. HCASM10001150. NTRD7oo2400 NT2RP70024500 NT2RP7002350 HCASM20002140, HHDPC20000950, HHDPC20004620. NTRD7ooloo. NTRp702800 NT2RD70280 HSYRA10001370, HSYRA10001780, HSYRA20001350. NTRD7ooooo. NTRD7ooooo. NTRD70000 HSYRA20006050, IMR3210001580, IMR3220002230, NT2Rp700soo. NT2RP700s,470. NTRp700sooo. IMR3220003020, KIDNE20004030. KIDNE20060300. NTRD7ooooo. NTRp70000 NT2RD70020 KIDNE20073280. MESAN20005010, NT2RI10000160, NT2RD7ooloo. NTRD70013730 NT2RD7ooloo NT2RI10000270. NT2RI10000480, NT2RI10001640. NTRD700so NT2RP7006560 NT2RP700.870. NT2RI20002700, NT2RI20002820, NT2RI20003410, NTRD700750 NT2RP700,760 NT2RP700-7000 NT2RI20004120. NT2RI20005970, NT2RI20006690, NTRp7000256. NTRp70040750 NT2RP700.520so NT2RI20006850, NT2RI20007380, NT2RI20008.650. NTRD700s,200 NT2RP700.54680 NTRD7oosoo NT2RI20010100, NT2RI20010830, NT2RI20010910, NTRD7ooss30 NT2RP700s soo. NTRD700,620 NT2RI20012350. NT2RI20012440, NT2RI20014090. NTRp700618so. NTRp7ooooo. NTRp7oooo. NT2RI20015190, NT2RI20015400. NT2RI20016570, NT2RP700,740. NTRp7006080. NTRp7006620. NT2RI20017260, NT2RI20018460, NT2RI20018660, NTRp700,700 NT2RP70060soo. NTRp7007110. NT2R120020220, NT2RI20020410, NT2RI20021520. NTRD700,150 NT2RP700,720 NT2RP7072520. NT2RI20022430, NT2RI20022700, NT2RI20025300. NTRp70073Soo. NT2RB7007slo. NT2RP700.70so NT2R12002.5850, NT2RI20026540, NT2RI20028020. NTRD7007500 NT2RP700.7.600. N2RP70770 NT2R120028520, NT2R120029580, NT2RI2002.9700. NTRD707630 NT2RD7007020. NTRD7070300 NT2RI2003.01.10, NT2RI20030190. NT2RI20030670, NTRp70os330 NT2Rp70081370. NTRp7008140 NT2RI20031540, NT2RI20032050, NT2RI20032220, NT2RP700s,440. NTRp7oosgro. NTRp70os31so NT2RI20033010, NT2RI20033380, NT2RI20033440. NTRp7oosoo. NTRp7oosio. NTRp7oos4870. NT2RI20033830, NT2RI20036780, NT2RI20041900, NTRD7ooss-soo. NTRD7ooss570 NT2RP700so NT2RI20042840, NT2RI20043040, NT2RI20043980, NTRp7oos700. NTRp7oosssso. NTRp7ooooo. NT2R12004.4420, NT2RI20047830, NT2RI20048400. NTRD7oooooo. NTRD7ooooo. NTRD7000so NT2R1200491.60, NT2RI20049840, NT2RI20049850, NTRD7ooo so. NTRD7000260 NT2RP70000 NT2RI20050610, NT2RI20050870, NT2RI20056280, NTRp70003700 NT2Rp7ooooo. NTRp7oooo70. NT2RI20056470, NT2RI20058110, NT2RI20060710, NT2RP70004200. NTRp70004660 NTRp70004810. NT2RI20060720, NT2RI20061270, NT2RI20061830, NTRp7ooooso. NTRp7ooosoo. NTRp70005070. NT2RI20062100, NT2RI20063450, NT2RI20064870, NTONG 0000980. NTONG 000210. NTONG200026so NT2RI20065060, NT2RI20065530, NT2RI20066670, NTONo.2006120 PEBM2000soso. PROsloosco. NT2RI20066790, NT2RI20067350, NT2RI20067880, PROST2000s,250. SKNMC20000650. SKNSoooosco. NT2RI20068250, NT2RI2006.8550, NT2RI20070480. SRNS2000370. TESTIOoooo. TESTIOooooo. NT2RI20070840, NT2RI20070960, NT2RI20071160. EST200510, TEST200760. TRAC2000610 NT2RI2007 1480, NT2RI20072140, NT2RI20072540, s s NT2RI20073030, NT2RI20073840, NT2RI20073860, 0412. These genes are neurological disease-related NT2RI20074690, NT2RI20075070, NT2RI20077290, genes. NT2RI20077510, NT2RI20077540, NT2RI20078270, Cae-Related Gees NT2RI20078790, NT2RI20078910, NT2RI20080500, NT2RI20081880, NT2RI20082210, NT2RI20083360, 0413. It has been assumed that, distinct from normal NT2RI20085260, NT2RI20085980, NT2RI20086560, tissues, cancer tissues express a distinct set of genes, and NT2RI20087140, NT2RI20087490, NT2RI20088010, thus the expression can contribute to the carcinogenesis in NT2RI20088120, NT2RI20090830, NT2RI20091440, tissues and cells. Thus, the genes whose expression patterns US 2007/0015163 A1 Jan. 18, 2007 70 in cancer tissues are different from those in normal tissues NTONG10002460, NTONG20015500, OCBBF20002310, are cancer-related genes. Search was carried out for the OCBBF20013070, PEBLM20001470, PEBLM20003950, genes whose expression levels in cancer tissues were dif PLACE60021510, PLACE60040050, PLACE60043970, ferent from those in normal tissues. PROST20051430, STOMA2000.1210, STOMA20002570, STOMA20002890, SYNOV20011440, TESTI10000230, 0414. The result of comparative analysis of cDNA librar TESTI2000.9700, TESTI20021490, TESTI20032800, ies derived from breast tumor (TBAES) and normal breast TESTI20053960, TESTI20080200, TESTI20082400, (BEAST) showed that the genes whose expression levels BGGI120010970, BRACE20004210, BRACE20005250, were different between the two were the following clones BRACE20011170, BRACE20020910, BRACE20080970, (Table 5). BRAWH20000340, BRAWH20006970, 3NB6910001730, FCBBF10007600, KIDNE20033050, BRAWH20011660, FCBBF20001950, FEBRA20043250, KIDNE20060300, NT2RI20065530, NT2RP60000720, HLUNG10000640, IMR3220007420, IMR3220014350, NT2RP70075370, TRACH20004200, LIVER10000670, KIDNE10000080, KIDNE10000280, KIDNE10000500, LIVER10005420, LIVER20000370 KIDNE10001040, KIDNE10001430, KIDNE10001450, KIDNE10001520, KIDNE20000410, KIDNE20000510, 0415. The result of comparative analysis of cDNA librar KIDNE20000700, KIDNE20000850, KIDNE20001670, ies derived cervical tumor (TCERX) and normal cervical KIDNE20001920, KIDNE20002440, KIDNE20002450, duct (CERVX) showed that the genes whose expression KIDNE20002660, KIDNE20003150, KIDNE20003300, levels were different between the two were the following KIDNE20003490, KIDNE20003750, KIDNE20004030, clones (Table 6). KIDNE20004220, KIDNE20004970, KIDNE20005130, BRACE10001590, HHDPC20000950, HSYRA20016210, KIDNE20005170, KIDNE20005190, KIDNE20005740, NT2RI20074980, 3NB6920014330, NT2RI20087490, KIDNE2003 1850, KIDNE20033050, KIDNE20033350, NT2RP60001090, PROST10002200, SKNMC20003220, KIDNE20033570, KIDNE20033730, KIDNE20033770, STOMA2OOO1210 KIDNE20037520, KIDNE20039410, KIDNE20039940, KIDNE20040340, KIDNE2004.0540, KIDNE20040840, 0416) The result of comparative analysis of cDNA librar KIDNE20042620, KIDNE20042940, KIDNE20042950, ies derived from colon tumor (TCOLN) and normal colon KIDNE20043440, KIDNE2004.4110, KIDNE20045200, (COLON) showed that the genes whose expression levels KIDNE20045340, KIDNE20045790, KIDNE20046810, were different between the two were the following clones KIDNE2004.8280, KIDNE20048640, KIDNE20048790, (Table 7). KIDNE20049810, KIDNE20050420, KIDNE20052960, BRACE20028610, BRACE20011170, BRACE20035940, KIDNE20053360, KIDNE20054000, KIDNE20054770, IMR3220013320, NT2NE20053710 KIDNE20056290, KIDNE20056760, KIDNE20059080, KIDNE20059370, KIDNE20060140, KIDNE20060300, 0417. The result of comparative analysis of cDNA librar KIDNE20060530, KIDNE20060620, KIDNE20061490, ies derived from esophageal tumor (TESOP) and normal KIDNE20062990, KIDNE20063530, KIDNE20063760, esophagus (NESOP) showed that the genes whose expres KIDNE20066520, KIDNE20067600, KIDNE20067750, sion levels were different between the two were the follow KIDNE20068800, KIDNE20070050, KIDNE20070770, ing clones (Table 8). KIDNE2007 1860, KIDNE20073280, KIDNE20073520, KIDNE20005740, MAMGL10000320, NESOP10000870, KIDNE20073560, KIDNE20074220, KIDNE20075690, NT2RI20056470, NTONG20008000 KIDNE20078100, KIDNE20078110, LIVER10000790, MAMGL10000320, NB9N410000470, NT2NE20053710, 0418. The result of comparative analysis of cDNA librar NT2RI20006710, NT2RI20013420, NT2RI20016570, ies derived from kidney tumor (TKIDN) and normal kidney NT2RI20018460, NT2RI20025540, NT2RI20040590, (KIDNE) showed that the genes whose expression levels NT2RI20065530, NT2RI20087490, NT2RI20087910, were different between the two were the following clones NT2RP60000350, NT2RP60001230, NT2RP70043730, (Table 9). NT2RP70069860, NT2RP70074220, OCBBF20014940, PLACE60020840, PLACE60043.120, PROST10003430, 0419) 3NB6920002810, ADRGL10000020, SKNSH20001510, SMINT10000160, SPLEN20000470, BNGH420004740, BRACE 10000200, BRACE10000420, SPLEN20001340, SPLEN20003570, STOMA10000470, BRACE10000730, BRACE 10001590, BRACE20005650, TESTI10000700, TESTI20027070, TESTI20040310, BRACE20016730, BRACE20028120, BRACE20077980, TRACH10000300, TRACH20000790, TRACH20002500, BRACE20083800, BRACE20083,850, BRAWH10001740, TRACH2OOO78OO BRAWH20036930, BRAWH20064500, BRAWH20064930, CTONG20028030, FCBBF20015380, 0420. The result of comparative analysis of cDNA librar FEBRA20005360, FEBRA20007570, FEBRA20008740, ies derived from liver tumor (TLIVE) and normal liver FEBRA20012270, FEBRA20025250, HSYRA20002480, (LIVER) showed that the genes whose expression levels HSYRA20006400, HSYRA20008280, HSYRA20015740, were different between the two were the following clones HSYRA20016210, IMR3220009350, LIVER10001110, (Table 10). NT2NE20003920, NT2NE20007630, NT2NE20007870, 0421. FCBBF50002610, FEBRA20076220, NT2RI20025410, NT2RI20026540, NT2RI20029580, KIDNE20033050, NT2NE20003840, KIDNE20062480, NT2RI20033380, NT2RI20033830, NT2RI20051500, KIDNE20068800, LIVER10000580, LIVER10000670, NT2RI20058110, NT2RI20090650, NT2RP60000720, LIVER10000790, LIVER100.00990, LIVER10001040, NT2RP70013350, NT2RP70023790, NT2RP70024490, LIVER10001110, LIVER10001750, LIVER10002300, NT2RP70028750, NT2RP70029060, NT2RP70036800, LIVER10002780, LIVER10003030, LIVER100.04330, NT2RP70075370, NT2RP70076100, NTONG10000980, LIVER10005420, LIVER20000330, LIVER20004160, US 2007/0015163 A1 Jan. 18, 2007 71

LIVER20004460, LIVER20005150, NT2NE20002140, (UTERU) showed that the genes whose expression levels NT2RI20030510, NT2RI20043040, NT2RI20090650, were different between the two were the following clones PROST10005640, PROST20032320, SALGL10001570, (Table 14). SMINT10000160, SPLEN20002420, TESTI20002530, 0428 NT2RI20085260, 3NB6920002810, TESTI20080200, THYMU10003590, TRACH20004720 BRACE10000420, BRACE20089990, BRACE20092120, 0422 The result of comparative analysis of cDNA librar BRAWH10001680, BRAWH20011410, ies derived from lung tumor (TLUNG) and normal lung BRAWH20011660, FCBBF20005910, FCBBF50002610, (HLUNG) showed that the genes whose expression levels FEBRA20005360, FEBRA20006800, FEBRA20008800, were different between the two were the following clones FEBRA20044120, FEBRA20057520, HEART20005060, (Table 11). HHDPC20000950, HLUNG10000760, HLUNG20003140, HSYRA20014200, HSYRA2001.4760, HSYRA20015800, 0423) NT2RI2003.01.10, BNGH410001980, IMR3210002420, IMR3220002230, IMR32200093.50, BRACE10000420, BRACE10001150, BRACE20014770, IMR3220014350, IMR3220016000, KIDNE20000850, BRACE20018550, BRAWH20006970, BRAWH20014610, KIDNE20060140, KIDNE20060300, MAMGL10000350, FEBRA20008810, FEBRA20015840, FEBRA20044120, NT2NE20035690, NT2NE20053710, NT2RI10000270, HHDPC20001490, HLUNG10000240, HLUNG1000300, NT2RI20000640, NT2RI20002940, NT2RI20010910, HLUNG10000370, HLUNG10000640, HLUNG10000760, NT2RI20013420, NT2RI20016570, NT2RI20033380, HLUNG10000990, HLUNG10001050, HLUNG10001100, NT2RI20036950, NT2RI20037510, NT2RI20053350, HLUNG20000680, HLUNG20001160, HLUNG2000 1250, NT2RI20057230, NT2RI20058110, NT2RI2007 1480, HLUNG20001420, HLUNG20001760, HLUNG20002550, NT2RI20074980, NT2RI20084810, NT2RI20087490, HLUNG20003140, HLUNG20004120, HLUNG20004800, NT2RI20087910, NT2RP60000350, NT2RP70032030, HLUNG20005010, HSYRA20014200, KIDNE20002660, NT2RP70043730, NTONG10000980, NTONG10002460, KIDNE20033050, NT2NE20014350, NT2RI20016570, PLACE60014.430, PLACE60026680, PLACE60043960, NT2RI20026540, NT2RI20051500, NT2RI20064120, PLACE60044910, PLACE60047380, PROST10002200, NT2RI20083960, NT2RI20085260, NT2RI20087490, PROST10005260, PROST20025910, PROST20033380, NT2RP70009060, NT2RP70011660, NT2RP70029060, PUAEN10000570, SALGL10001570, SKMUS10000140, NT2RP70055020, NT2RP70074220, NT2RP70076100, SKMUS20003430, SKMUS2000.9540, SKNMC10002510, NTONG10002460, NTONG20008000, PLACE60043.120, SKNMC20000970, SKNSH10000860, SMINT20002770, SKMUS20016340, SKNMC20005930, SMINT20000180, STOMA20002890, SYNOV20011440, TESTI10000230, SMINT20002390, SMINT20002770, SMINT20003960, TESTI20018290, TESTI20021490, TESTI20080200, STOMA10000470, STOMA20001880, SYNOV20013740, TESTI20082400, TRACH10000300, TRACH20002370, TESTI20036250, TESTI20080200, TRACH20004610 TRACH20007800, TRACH20012890, UTERU10000770, 0424 The result of comparative analysis of cDNA librar UTERU10000960, UTERU10001600, UTERU10001920, ies derived from ovary tumor (TOVER) and normal ovary UTERU20000470, UTERU20003380, UTERU20003930, (NOVER) showed the genes whose expression levels were UTERU20004850, UTERU20005410, UTERU20005690 different between the two were the following clones (Table 0429 The result of comparative analysis of cDNA librar 12). ies derived from tongue cancer (CTONG) and normal BRACE20011880, TESTI20030710, BRACE200762.10, tongue (NTONG) showed that the genes whose expression NT2RI20053680, SKMUS20008630, TESTI20005910, levels were different between the two were the following TESTI2OO4031 O clones (Table 15). 0430) 3NB6910001160, 3NB6910001290, 0425 The result of comparative analysis of cDNA librar 3NB6910001730, BNGH420004740, BRACE20008850, ies derived from stomach tumor (TSTOM) and normal BRACE20020910, BRACE20074010, BRAWH20014840, stomach (STOMA) showed that the genes whose expression BRAWH2008.9560, CTONG20003030, CTONG20005890, levels were different between the two were the following CTONG20007710, CTONG20008270, CTONG20011390, clones (Table 13). CTONG20013200, CTONG20013660, CTONG20015330, 0426 HSYRA20011030, NT2RI20013420, CTONG20018200, CTONG20019110, CTONG2001.9550, NT2RP70079750, BRACE20003320, HEART20005060, CTONG20020730, CTONG20021430, CTONG20024180, HHDPC20000950, HLUNG20004120, HLUNG20005010, CTONG20024530, CTONG20025580, CTONG20027210, HSYRA20006400, KIDNE10000500, KIDNE20062480, CTONG20028030, CTONG20028160, CTONG20028200, NT2NE20053710, NT2NE20054410, NT2RI20015400, CTONG2002.9650, CTONG20037820, CTONG20047160, NT2RI20016570, NT2RI20064120, NT2RI20070840, CTONG20055530, CTONG20064.490, FEBRA20003770, NT2RI20071330, NT2RI20074980, NT2RI20077230, FEBRA20004520, FEBRA20007400, FEBRA20007570, NT2RI20089420, NT2RP70000760, NT2RP70028750, FEBRA20012940, FEBRA20021940, FEBRA20044120, PLACE60014.430, PLACE60024190, SKNMC20000970, HCASM10001150, HHDPC20004560, HLUNG20003140, STOMA10000470, STOMA10000520, STOMA10001170, HSYRA20002480, IMR3220009350, IMR322001 2180, STOMA10001330, STOMA10001860, STOMA20000320, KIDNE20000850, KIDNE20002660, KIDNE20004220, STOMA20000880, STOMA2000.1210, STOMA20001880, KIDNE20005740, KIDNE20056760, KIDNE20060140, STOMA20002570, STOMA20002890, STOMA20003960, KIDNE20062480, MESAN20000920, MESAN20003370, STOMA20004780, STOMA20004820, THYMU10003590 NHNPC20002060, NT2NE10001850, NT2NE20000560, NT2NE20002140, NT2NE20003270, NT2NE20003840, 0427. The result of comparative analysis of cDNA librar NT2NE20014350, NT2NE20053710, NT2RI2000.6690, ies derived from uterine tumor (TUTER) and normal uterus NT2RI20006710, NT2RI20016570, NT2RI20018660, US 2007/0015163 A1 Jan. 18, 2007 72

NT2RI20025300, NT2RI20025410, NT2RI20030190, BRACE20088570, BRAWH10000010, BRAWH10000020, NT2RI20030510, NT2RI20036950, NT2RI20046060, BRAWH10000070, BRAWH10000370, NT2RI20053350, NT2RI20067350, NT2RI20075720, BRAWH10000940, BRAWH10001300, NT2RI20078790, NT2RI20083960, NT2RI20087140, BRAWH10001640, BRAWH10001680, NT2RI20094.060, NT2RP60000350, NT2RP6000 1230, BRAWH10001740, BRAWH10001800, NT2RP70000760, NT2RP70004770, NT2RP70009060, BRAWH20000340, BRAWH20000340, NT2RP70011660, NT2RP70023760, NT2RP70023790, BRAWH20000480, BRAWH20000930, NT2RP70024500, NT2RP700261.90, NT2RP70029820, BRAWH20001770, BRAWH20002480, NT2RP7003.6470, NT2RP70043730, NT2RP70061880, BRAWH20003230, BRAWH20004430, NT2RP70071770, NT2RP70076100, NT2RP70079750, NT2RP70084870, NT2RP70093730, OCBBF20013070, BRAWH20004760, BRAWH20005030, PEBLM20003950, PLACE60037450, PLACE60043.120, BRAWH20005540, BRAWH20006330, PROST10003430, PROST10005260, PROST20032320, BRAWH20006510, BRAWH20006970, PROST20033020, PROST20056040, SKNMC10002510, BRAWH20008660, BRAWH20008920, SKNMC20000650, SKNMC20010570, SKNSH20003470, BRAWH20009010, BRAWH20009440, SMINT20000180, SYNOV20013740, TESTI10000230, BRAWH20009840, BRAWH20011030, TESTI10001680, TESTI20007840, TESTI20021490, BRAWH2001 1290, BRAWH20011660, TESTI20022230, TESTI20023690, TESTI20030050, BRAWH20012030, BRAWH20014180, TESTI20042950, TESTI20068720, TESTI20080200, BRAWH20014380, BRAWH20014610, TRACH20012890, BRACE20006980, BRACE20092740, BRAWH20015030, BRAWH2003.6890, BRAWH20006970, FCBBF10007600, FEBRA20062700, BRAWH20038320, BRAWH20047310, IMR3220016000, KIDNE20073280, MAMGL10000350, BRAWH20059980, BRAWH20060440, NT2NE20035690, NT2RI20056470, NT2RI20058110, BRAWH20064930, BRAWH20066220, NT2RI20084810, NT2RI20085260, NT2RP70015910, BRAWH20069600, BRAWH20069890, NT2RP70036290, NT2RP70036320, NT2RP70074220, BRAWH20074060, BRAWH20076050, NT2RP70075370, NTONG10000330, NTONG10000520, BRAWH2008.9560, BRAWH20092270, NTONG10001230, NTONG10001300, NTONG10001820, BRAWH20092610, BRAWH20093600, NTONG10002140, NTONG10002460, NTONG10002570, BRAWH20094850, IMR3220013170, KIDNE20000850, NTONG10002640, NTONG20002650, NTONG20003340, KIDNE20004220, KIDNE2003 1850, KIDNE20050420, NTONG20003630, NTONG20004920, NTONG20005830, MAMGL10000350, NT2NE20001740, NT2RI20042840, NTONG20008000, NTONG20008780, NTONG20009660, NT2RI20086560, NT2RP70002590, NT2RP70065270, NTONG20009850, NTONG20011370, NTONG20012220, NT2RP70074220, NTONG10001820, PEBLM20001470, NTONG20014280, NTONG20015500, NTONG20016120, PLACE60032040, SKMUS10000140, SMINT20005450, OCBBF2001 1240, OCBBF20015860, PROST10002200, TESTI20004350, TESTI20008830, TRACH20007800, SKMUS20016340, SKNMC20000970, STOMA20004820, TRACH20016070, UMVEN20001330, 3NB6910001730, SYNOV10001280, SYNOV20011440, THYMU10000830, 3NB6920002810, ADRGL20000740, BNGH410001370, TRACH20000790, TRACH20009260 BNGH410001980, BRACE 10000200, BRACE10000730, BRACE10000930, BRACE20000770, BRACE20001000, 0431. These genes are involved in cancers. BRACE20001410, BRACE20002800, BRACE20003320, 0432. Further, there is a method to search for genes BRACE20005050, BRACE20005250, BRACE20005450, involved in development and differentiation: the expression BRACE20005650, BRACE20005650, BRACE20005770, frequency analysis in which the expression levels of genes BRACE20006980, BRACE20007180, BRACE20008850, are compared between developing or differentiating tissues BRACE20009880, BRACE20010650, BRACE20010700, and/or cells and adult tissues and/or cells. The genes BRACE20011170, BRACE20011430, BRACE20011430, involved in tissue development and/or differentiation are BRACE20011880, BRACE20013400, BRACE20013520, genes participating in tissue construction and expression of BRACE20013740, BRACE20013750, BRACE20014230, function, and thus are useful genes, which are available for BRACE20014530, BRACE2001.4550, BRACE20014770, regenerative medicine aiming at convenient regeneration of BRACE20014920, BRACE20015080, BRACE20015430, injured tissues. BRACE20016730, BRACE20016920, BRACE20017370, 0433 Search was carried out for the genes whose expres BRACE20018550, BRACE20018590, BRACE20018650, sion frequencies were different between developing and/or BRACE20018980, BRACE20021510, BRACE20021760, differentiating tissues and/or cells, and adult tissues and/or BRACE20022020, BRACE20022270, BRACE20024090, cells, by using the information of gene expression frequency BRACE20024090, BRACE20024310, BRACE20024680, based on the database of the nucleotide sequences of 770, BRACE20024950, BRACE20025900, BRACE20026350, 546 clones shown above. BRACE20026850, BRACE20027360, BRACE20027520, BRACE20027550, BRACE20027720, BRACE20027920, 0434. The result of comparative analysis of cDNA librar BRACE20027960, BRACE20028120, BRACE20028600, ies derived from fetal brain (FCBBF, FEBRA or OCBBF) BRACE20030780, BRACE20032850, BRACE20033190, and adult brain (BRACE, BRALZ, BRAMY, BRAWH, BRACE20033980, BRACE20034310, BRACE20035160, BRCAN, BRCOC, BRHIP, BRSSN, BRSTN or BRTHA) BRACE20035940, BRACE20071380, BRACE2007 1530, showed that the genes whose expression levels were differ BRACE2007 1970, BRACE20072010, BRACE20072320, ent between the two were the following clones (Tables 16 to BRACE20072810, BRACE2007.4470, BRACE20075020, 36). BRACE20075270, BRACE20075380, BRACE20075630, 0435 BRACE20028960, BRACE20074010, BRACE20076210, BRACE20076460, BRACE20076630, BRACE20077080, BRACE20077980, BRACE20083800, BRACE20076850, BRACE20077610, BRACE20077640, US 2007/0015163 A1 Jan. 18, 2007 73

BRACE20077670, BRACE20077840, BRACE20078680, HLUNG20003140, HLUNG20005010, HSYRA20001350, BRACE20079020, BRACE20079530, BRACE20080970, HSYRA2001.4760, HSYRA20016310, IMR3220007420, BRACE20081140, BRACE20083,850, BRACE20084430, IMR3220009730, IMR3220009840, IMR322001 2180, BRACE20084880, BRACE20086530, BRACE20086550, IMR3220013320, KIDNE20002660, KIDNE20056760, BRACE20087080, BRACE20087540, BRACE20089600, KIDNE20073520, LIVER20004160, MESAN20000920, BRACE20089990, BRACE20090140, BRACE2009 1880, NT2NE20015300, NT2NE20035690, NT2RI20010910, BRACE20092120, BRACE20092750, BRACE20093.070, NT2RI20016210, NT2RI20016570, NT2RI20033040, BRACE200931.10, BRACE20094.370, CTONG20008270, NT2RI20033440, NT2RI20058110, NT2RI20065060, CTONG20013200, CTONG20020730, CTONG20064.490, NT2RI20087490, NT2RP60000720, NT2RP70002710, HHDPC20000950, HHDPC20001150, HHDPC20004560, NT2RP70012310, NT2RP70036800, NT2RP70055020, HSYRA10001780, HSYRA20008280, HSYRA20011530, NT2RP70055130, NT2RP70061880, NT2RP70084410, IMR3210002660, IMR3220003020, IMR3220009350, PLACE60037450, PLACE60049310, PROST10005260, KIDNE20003300, KIDNE20004970, KIDNE20005170, PROST20018230, PROST20051430, SKMUS20000740, KIDNE20059370, KIDNE20068800, KIDNE20073280, SKMUS20011470, SKNMC20003560, SKNSH20001630, LIVER20000370, MESAN20002670, NT2NE20005170, SPLEN10000490, STOMA20002890, SYNOV20013740, NT2NE20011560, NT2NE20013640, NT2NE20016970, TESTI20011410, TESTI20033760, TESTI20074640, NT2RI20006710, NT2RI2000.9740, NT2RI20022430, TRACH10000300, TRACH20013950, 3NB6920003300, NT2RI20025300, NT2RI20028020, NT2RI20029260, 3NB6920009120, ADRGL10000180, BRACE10001150, NT2RI2003.01.10, NT2RI20030510, NT2RI20040590, BRACE10001590, BRACE 10001690, BRACE20077680, NT2RI20046060, NT2RI20049840, NT2RI20049850, BRACE20092740, BRACE20093610, BRACE20095170, NT2RI20056470, NT2RI20060720, NT2RI20062100, BRAWH20011410, BRAWH20036930, NT2RI20067350, NT2RI20068250, NT2RI20070840, BRAWH20064500, BRAWH20087060, CTONG20019110, NT2RI20070960, NT2RI2007.1480, NT2RI20072540, FEBRA20000350, FEBRA20000530, FEBRA20001050, NT2RI20074980, NT2RI20085260, NT2RI20088120, FEBRA20001290, FEBRA20003110, FEBRA20003300, NT2RI20090660, NT2RI20090830, NT2RP70013060, FEBRA20003780, FEBRA20003910, FEBRA20003970, NT2RP70013350, NT2RP70023760, NT2RP70024500, FEBRA20003990, FEBRA20004040, FEBRA20004150, NT2RP70030910, NT2RP70036320, NT2RP7003.6470, FEBRA20004540, FEBRA20004910, FEBRA20006560, NT2RP70042330, NT2RP70054930, NT2RP70064900, FEBRA20006800, FEBRA20006900, FEBRA20007330, NT2RP70071140, NT2RP70075370, NT2RP70076100, FEBRA20007400, FEBRA20007710, FEBRA20007720, NT2RP70079750, NT2RP70081370, NT2RP70090120, FEBRA20007870, FEBRA20008090, FEBRA20008560, NT2RP700.91490, NT2RP700.93730, NTONG20014280, FEBRA20008800, FEBRA20008810, FEBRA2000.9590, NTONG20015500, PEBLM10000340, PLACE60014430, FEBRA20009720, FEBRA20010930, FEBRA20011330, PLACE60020840, PLACE60024190, PLACE60026920, FEBRA20011460, FEBRA20012270, FEBRA20012940, PLACE60030380, PLACE60038500, PLACE60043970, FEBRA20013510, FEBRA20014870, FEBRA20015900, PROST10002720, PROST20000530, PROST20021620, FEBRA20015910, FEBRA20017060, FEBRA20017900, PROST20032320, PROST20033380, PROST20062600, FEBRA20019890, FEBRA20020860, FEBRA20024290, SALGL10000050, SALGL10001570, SKMUS10000220, FEBRA20024420, FEBRA20027270, FEBRA20027830, SKMUS20001170, SKMUS20002710, SKMUS2000.9540, FEBRA20028820, FEBRA20028970, FEBRA20029080, SKMUS2001 1290, SKMUS20015010, SKMUS20015430, FEBRA20030540, FEBRA2003 1550, FEBRA20033080, SKMUS20016340, SKNMC20002240, SKNMC20015030, FEBRA20034290, FEBRA20037070, FEBRA20041100, SKNSH20001510, SMINT10001000, SMINT20002390, FEBRA20041910, FEBRA20042240, FEBRA20042370, SPLEN20001970, STOMA2000 1210, STOMA20002570, FEBRA20042930, FEBRA20043290, FEBRA20044430, SYNOV20002910, SYNOV20011440, TESTI10000510, FEBRA20044900, FEBRA20045920, FEBRA20048180, TESTI10000700, TESTI10001680, TESTI20005200, FEBRA20050140, FEBRA20050790, FEBRA20052160, TESTI20015110, TESTI20018290, TESTI20018690, FEBRA20053770, FEBRA20053800, FEBRA20054270, TESTI20018980, TESTI20024670, TESTI20032800, FEBRA20057260, FEBRA20057520, FEBRA20059980, TESTI20033250, TESTI20036250, TESTI20136910, FEBRA20060920, FEBRA20061500, FEBRA20062700, THYMU10000830, THYMU10003290, FEBRA20063150, FEBRA20063540, FEBRA20064760, THYMU10003590, UTERU10000960, UTERU20005690, FEBRA20066670, FEBRA20067360, FEBRA20067930, ADRGL10000650, BGGI120010970, BRACE20004210, FEBRA20068730, FEBRA20069420, FEBRA20070170, BRACE20020500, BRACE20020910, BRACE20024780, FEBRA20072000, FEBRA20072800, FEBRA20074140, BRACE20028610, BRACE20031100, BRACE20035270, FEBRA20075510, FEBRA20075660, HSYRA20006400, BRACE20035390, BRACE2007 1740, BRACE20077270, HSYRA20015800, IMR3220002230, KIDNE20005740, BRAWH20001090, CTONG20024530, CTONG20028200, KIDNE20053360, NT2NE20002140, NT2NE20003270, CTONG 20055530, FCBBF10005980, FCBBF10006180, NT2NE20003840, NT2NE20007870, NT2NE20047160, FCBBF10006870, FCBBF10006910, FCBBF10007320, NT2NE20053710, NT2RI20025410, NT2RI20051500, FCBBF10007600, FCBBF20000940, FCBBF20001050, NT2RI20055640, NT2RI20058510, NT2RI20061830, FCBBF20001950, FCBBF20002320, FCBBF20002760, NT2RI20064120, NT2RI20071330, NT2RI20075890, FCBBF20005760, FCBBF20005910, FCBBF20006770, NT2RI20077230, NT2RI20094.060, NT2RP70002380, FCBBF20007330, FCBBF20008080, FCBBF20008150, NT2RP70009060, NT2RP70015910, NT2RP700.94810, FCBBF20009400, FCBBF200095.10, FCBBF20012110, NT2RP70094980, PLACE60012810, PLACE60040050, FCBBF20012990, FCBBF20014800, FCBBF20016720, SKMUS20008630, SKNMC20003050, SKNSH20003470, FCBBF20017180, FCBBF20017200, FCBBF40002820, TESTI20003560, TESTI20012690, TESTI20030710, HCASM10001150, HHDPC20001490, HLUNG10000640, TESTI20082400, TRACH20009260, 3NB6910001160, US 2007/0015163 A1 Jan. 18, 2007 74

3NB6920015280, BRACE10000700, BRACE20019440, 0436 The result of comparative analysis of cDNA librar BRAWH20052250, KIDNE20045340, NT2NE20002590, ies derived from fetal heart (FEHRT) and adult heart NT2NE20014030, NT2RI20020220, NT2RI20026540, (HEART) showed that the genes whose expression levels NT2RI20060710, NT2RI20083960, NT2RI20084810, were different between the two were the following clones NT2RP70011660, NT2RP70021510, NT2RP70024490, (Table 37). NT2RP70026190, NT2RP70039600, NT2RP70049250, 0437 KIDNE20062480, NT2RI20033040, NT2RP7007 1770, NT2RP70093940, NTONG10002640, NT2RP60000350, BGGI120010970, BRACE10000420, NTONG20002650, OCBBF10000420, OCBBF10000670, BRACE10001150, BRACE20003320, BRACE20077980, OCBBF10000860, OCBBF10000910, OCBBF10001040, BRAWH10000370, BRAWH20000340, OCBBF10001180, OCBBF10001190, OCBBF10001220, BRAWH20011660, BRAWH20014840, FEBRA20008740, OCBBF20002770, OCBBF20002870, OCBBF20007190, FEBRA20072800, HEART20000350, HEART20000990, OCBBF20008240, OCBBF20009980, OCBBF20010750, HEART20003090, HEART20004110, HEART20004480, OCBBF20011010, OCBBF20011400, OCBBF20011760, HEART20004920, HEART20005060, HEART20005200, OCBBF20014080, OCBBF20014940, OCBBF20015270, HEART20005680, HHDPC20001150, HLUNG20005010, OCBBF20015280, OCBBF20015860, OCBBF20017060, HSYRA20014200, IMR3220013170, KIDNE20004970, PLACE60043960, SMINT20002770, TESTI20001790, NT2RI20000640, NT2RI20006710, NT2RI20015400, TESTI20007840, TESTI2000.9700, TESTI20027070, NT2RI20026540, NT2RI20037510, NT2RI20057230, TESTI20053960, TRACH20000790, 3NB6920010220, NT2RI20064120, NT2RI20071330, NT2RI2007 1480, BRACE10001870, BRAWH20014840, BRAWH20040950, NT2RI20077540, NT2RI20084810, NT2RI20087910, FEBRA2001 1970, KIDNE20062480, NT2RI20029580, NT2RP70000760, NT2RP70024500, NT2RP70029060, NT2RI20035560, NT2RI20043980, NT2RP70000760, NTONG10001820, PLACE60012810, PLACE60043.120, NT2RP70042040, NT2RP700.69860, NT2RP7008.8550, PROST20000530, SKMUS10000640, SKMUS20004580, OCBBF2000 1260, TESTI10000230, 3NB6920017190, SKMUS20015010, SMINT20002770, TESTI20033250, ADRGL10000020, BRACE10001660, BRAWH10001620, TESTI20074640, UMVEN20001330 CTONG20028030, KIDNE20004030, KIDNE20060300, NB9N420000420, NT2NE20000560, NT2NE20004700, 0438. The result of comparative analysis of cDNA librar NT2NE20007630, NT2RI20004120, NT2RI20013420, ies derived from fetal kidney (FEKID) and adult kidney NT2RI20033380, NT2RI20036950, NT2RI20053350, (KIDNE) showed that the genes whose expression levels NT2RI20053680, NT2RI20078840, NT2RI20083360, were different between the two were the following clones NT2RI20090650, NT2RP60001090, NT2RP70004770, (Table 38). NT2RP70023790, NT2RP70055200, NT2RP70085570, 0439) 3NB6920003300, 3NB6920009120, NTONG10000980, NTONG20016120, OCBBF2001 1240, BGGI120010970, BRACE20004210, BRACE20005250, OCBBF2001 2100, OCBBF20013070, OCBBF20014020, BRACE20011170, BRACE20020910, BRACE20026850, PEBLM20003950, PLACE50001130, PLACE60021510, BRACE20080970, BRAWH20000340, BRAWH20006970, PUAEN10000570, SKNMC20000970, TESTI20040310, BRAWH20011660, FCBBF20001950, FEBRA2002 1940, TRACH20004610, 3NB6920005450, BRACE10000420, FEBRA20043250, HLUNG10000640, IMR3220007420, BRACE20076410, BRACE20078820, BRAWH20006860, IMR3220014350, KIDNE10000280, KIDNE10000500, BRAWH20089030, FCBBF10006750, FCBBF10006860, KIDNE10001040, KIDNE10001430, KIDNE10001450, FCBBF20015380, FCBBF50002610, FEBRA20004520, KIDNE10001520, KIDNE20000410, KIDNE20000510, FEBRA20005360, FEBRA20009010, FEBRA20014920, KIDNE20000700, KIDNE20000850, KIDNE20001670, FEBRA20015840, FEBRA20021910, FEBRA2002 1940, KIDNE20001920, KIDNE20002440, KIDNE20002450, FEBRA20043250, FEBRA20057780, FEBRA20057880, KIDNE20002660, KIDNE20003150, KIDNE20003300, FEBRA20066270, FEBRA20074580, HHDPC20000550, KIDNE20003490, KIDNE20003750, KIDNE20004030, HSYRA20015740, HSYRA20016210, IMR3210002420, KIDNE20004220, KIDNE20004970, KIDNE20005130, IMR3220016000, KIDNE20060140, MAMGL10000320, KIDNE20005170, KIDNE20005190, KIDNE20005740, NT2NE20008090, NT2NE20014350, NT2RI20000640, KIDNE2003 1850, KIDNE20033050, KIDNE20033350, NT2RI20002940, NT2RI20015400, NT2RI20033830, KIDNE20033570, KIDNE20033730, KIDNE20033770, NT2RI20037510, NT2RI20057230, NT2RI20087910, KIDNE20037520, KIDNE20039410, KIDNE20039940, NT2RI20089420, NT2RP70043730, NT2RP70047900, KIDNE20040340, KIDNE2004.0540, KIDNE20040840, PLACE60043.120, PROST20033020, SYNOV10001280, KIDNE20042620, KIDNE20042940, KIDNE20042950, TESTI20021490, THYMU20002360, TRACH20012890, KIDNE20043440, KIDNE20045200, KIDNE20045340, 3NB6910001290, BNGH420004740, BRACE20034490, KIDNE20045790, KIDNE20046810, KIDNE2004.8280, BRAWH20005220, FEBRA20003770, FEBRA20007570, KIDNE20048640, KIDNE20048790, KIDNE20049810, FEBRA20008740, FEBRA2001 2450, FEBRA2001 2450, KIDNE20050420, KIDNE20052960, KIDNE20053360, FEBRA20017150, FEBRA20025250, FEBRA20044120, KIDNE20054000, KIDNE20054770, KIDNE20056290, FEBRA20076220, HSYRA20002480, IMR3220014350, KIDNE20056760, KIDNE20059080, KIDNE20059370, MESAN20001490, NHNPC20002060, NT2NE10000180, KIDNE20060140, KIDNE20060300, KIDNE20060530, NT2NE20003920, NT2RI2000.6690, NT2RI20013850, KIDNE20060620, KIDNE20061490, KIDNE20062480, NT2RI2001.4500, NT2RI20025540, NT2RI20033010, KIDNE20062990, KIDNE20063530, KIDNE20063760, NT2RI20075720, NT2RP60000350, NT2RP6000 1230, KIDNE20066520, KIDNE20067600, KIDNE20067750, NT2RP70028750, NT2RP70029060, NT2RP70032030, KIDNE20068800, KIDNE20070050, KIDNE20070770, NTONG20003340, OCBBF20000130, OCBBF20002310, KIDNE2007 1860, KIDNE20073280, KIDNE20073520, OCBBF20009040, SKNMC20000650, SMINT20003960, KIDNE20073560, KIDNE20074220, KIDNE20075690, TESTI20026320, TESTI20080200 KIDNE20078100, KIDNE20078110, LIVER10000790, US 2007/0015163 A1 Jan. 18, 2007 75

MAMGL10000320, NB9N410000470, NT2NE20053710, 0444 THP-1 cell line (purchased from DAINIPPON NT2RI20006710, NT2RI20013420, NT2RI20016570, PHARMACEUTICAL) was cultured to be confluent in NT2RI20018460, NT2RI20025540, NT2RI20040590, RPMI1640 medium (sigma) containing 5% fetal calf serum NT2RI20065530, NT2RI20087490, NT2RI20087910, (GIBCO BRL). Then, the medium was changed with the NT2RP60000350, NT2RP6000 1230, NT2RP70043730, medium containing 10 ng/ml TNF-C. (human recombinant NT2RP700.69860, NT2RP70074220, OCBBF20014940, TNF-C.: Pharmacia Biotech) or 1 ug/mL LPS (Lipopolysac PLACE60014.430, PLACE60020840, PLACE60043.120, charides; sigma), and the culture was continued at 37° C. PROST10003430, SKNMC20000970, SKNSH20001510, under 5% CO. After three hours, the cells were harvested, SMINT10000160, SMINT20003960, SPLEN20000470, and total RNA was extracted from them by using ISOGEN SPLEN20001340, SPLEN20003570, STOMA10000470, reagent (Nippon Gene). The extraction was carried out SYNOV10001280, TESTI10000700, TESTI20027070, according to the method in the document attached to TESTI20040310, TRACH10000300, TRACH20000790, ISOGEN reagent. In addition, total RNA was also extracted TRACH20002500, TRACH20007800, KIDNE10000080, from the cells cultured without stimulation of TNF-C. or KIDNE2004.4110, NT2RI20033040, NT2RI20037510, LPS. NT2RP70065270, TRACH20012890 0445. The genes involved in the onset of gastritis and 0440 The result of comparative analysis of cDNA librar gastroduodenal ulcer induced by the infection of Helico ies derived from fetal lung (FELNG) and adult lung bacter pylori to the epithelia of stomach can be identified by (HLUNG) showed that the genes whose expression levels revealing the genes whose expression levels are altered were different between the two were the following clones depending on co-culturing the cells with Helicobacter (Table 39). pylori. Then, by using co-culture of a gastric cancer cell line 0441 BNGH410001980, BRACE10000420, with Helicobacter pylori, suitable for this system, the genes BRACE10001150, BRACE20014770, BRACE20018550, whose expression levels are altered depending on the pres BRAWH20006970, BRAWH20014610, FEBRA20008810, ence of Helicobacter pylori, were searched for by the FEBRA20015840, FEBRA20044120, HHDPC20001490, system. HLUNG10000240, HLUNG10000300, HLUNG10000370, 0446. A gastric cancer cell line MKN45 (provided by the HLUNG10000640, HLUNG10000760, HLUNG10000990, Cell Bank, RIKENGENE BANK, The Institute of Physical HLUNG10001050, HLUNG10001100, HLUNG20000680, and Chemical Research) was cultured to be confluent in HLUNG20001160, HLUNG20001250, HLUNG20001420, RPMI1640 medium (sigma) containing 10% fetal calf serum HLUNG20001760, HLUNG20002550, HLUNG20003140, (GIBCO BRL). Then, the medium was changed with the HLUNG20004120, HLUNG20004800, HLUNG20005010, medium containing 100-fold excess (in terms of the number HSYRA20014200, KIDNE20002660, KIDNE20033050, of cells or the number of colonies) of Helicobacter pylori NT2NE20014350, NT2RI20016570, NT2RI20026540, (TN2 strain: provided by Prof. Omata, Faculty of Medicine, NT2RI20051500, NT2RI20064120, NT2RI20083960, The University of Tokyo), as compared with the number of NT2RI20085260, NT2RI20087490, NT2RP70009060, the cancer cells. The culture was continued at 37° C. under NT2RP70011660, NT2RP70029060, NT2RP70055020, 5% CO. After three hours, the cells were harvested, and NT2RP70074220, NT2RP70076100, NTONG10002460, total RNA was extracted from them by using ISOGEN NTONG20008000, PLACE60043.120, SKMUS20016340, reagent (Nippon Gene). The extraction was carried out SKNMC20005930, SMINT20000180, SMINT20002390, according to the method in the document attached to SMINT20002770, SMINT20003960, STOMA10000470, ISOGEN reagent. In addition, total RNA was also extracted STOMA20001880, SYNOV20013740, TESTI20036250, from the cells cultured without Helicobacter pylori. TESTI20080200, TRACH20004610, BRACE20004210, IMR322OOO742O 0447 The analysis by the ATAC-PCR method was car ried out basically according to “DNA Micro-array and 0442. These genes are involved in regeneration of tissues Advanced PCR Techniques”. Cell Technology, supplement and/or cells. (Genome Science Series 1, Eds. Muramatsu and Nawa EXAMPLE 8 (Shujunsha, 2000): 104-112). Adapter ligation to the internal standard sample (sample to make the calibration curve for Expression Frequency Analysis by PCR the clone of interest) and test sample was carried out in the two separate reaction systems indicated below. The combi 0443 Specific PCR primers were prepared based on the nation of 6 types of adapters (AD-1, AD-2, AD-3, AD-4, full-length nucleotide sequences, and the expression fre AD-5 and AD-6: see the sequences indicated below) and the quency was analyzed by the ATAC-PCR method (Adaptor samples are as follows. tagged competitive PCR method: Nucleic Acids Research 1997, 25(22): 4694-4696; “DNA Micro-array and Advanced Reaction System A PCR Techniques”. Cell Technology, supplement, Eds. Muramatsu and Nawa (Shujunsha, 2000): 104-112). Inflam AD1; internal standard, 10-fold mation-related genes can be identified by revealing the AD2: THP-1 cells, unstimulated genes whose expression levels are altered depending on the presence of an inflammation-inducing factor. Then, by using AD3; internal standard, 3-fold THP-1 cell line, which is a cell line of monocyte line, and TNF-C. and LPS, both of which are inflammation-inducing AD4: THP-1 cells, TNF-C. Stimulation factors, Suitable for this system, the genes whose expression AD5; THP-1 cells, LPS stimulation levels are altered depending on the presence of the factors were searched for by the system. AD6; internal standard, 1-fold US 2007/0015163 A1 Jan. 18, 2007 76

Reaction System B seconds/annealing at 50° C. for 60 seconds/extension at 72° C. for 90 seconds; in Some cases, merely the annealing AD1; internal standard, 1-fold temperature was changed. AD2: MKN45 cells, unstimulated The Nucleotide Sequences of Clone Specific Primers Used AD3; internal standard, 3-fold in the Experiments AD4; MKN45 cells, co-cultured with Helicobacter pylori 0451 Clone name, primer sequence and SEQID NO are indicated below in this order. Each is demarcated by a AD5; internal standard, 10-fold double slash mark (//). 0448 Adapter Sequences: SEQ ID NO: 3296 3NB692OOOO290//CTCCTCCAGCAGAACTTG/A AD1; SEQ ID NO : SEQ ID NO: 3297 3283//5'-GTACATATTGTCGTTAGAACGCG-3' ADRGL10000180/WTTTAGAGCTGATTCCCCATT//

SEQ ID NO : SEQ ID NO: 3298 3284//3'-CATGTATAACAGCAATCTTGCGCCTAG-5' BNGH410 001370//TAAAAGcAGGAAATTGTAAA//

A. SEQ ID NO: 3299 S EQ D NO BRACE10 OO1590//ATATGGACAAAGGACCAATT/A 3 285/ A5'-GTACATATTGTGGTTAGAACGCGACT-3' SEQ ID NO : 3300 D NO BRACE10 OO1690//AGGACTAGATTCACTGCTTA/A 3286//3'-CATGTATAACAGCAATCTTGCGCTGACTAG-5' SEQ ID NO : 3301 BRACE 2001 0650//CAACTCTCAACACCACAATC/A SEQ ID NO : 3287/A5'-GTACATATTGTCGTTAGAACGCGCATACT-3' SEQ ID NO : 3302 BRACE 2001340 O//CTACTCAAGGACAGCCACAC// SEQ ID NO : 3288//3'-CATGTATAACAGCAATCTTGCGCGTATGACTAG-5 SEQ ID NO: 3303 BRACE 20030780//AGATAGAGGCTTGCTGGTGT// AD4; SEQ ID NO : SEQ ID NO : 3304 3289//5'-GTACATATTGTCGTTAGAACGCGATCCATACT-3' BRACE 2003 449 OA/CCTTATGTCAAACTGCGATT/A

SEQ ID NO : SEQ ID NO : 3305 3290//3'-CATGTATAACAGCAATCTTGCGCTAGGTATGACTAG-5 BRACE20 07764 OAATTTGCCTTATTCATTGGTTG/A AD5; SEQ ID NO : 3306 SEQ ID NO : BRACE 20079530//GTAATATCACCCCACAGAGG// 3291//5'-GTACATATTGTCGTTAGAACGCGTCAATCCATAcT-3' SEQ ID NO : 3307 SEQ ID NO : BRACE2008385 OAATATCATCTTTTGGGGCTTTG/A 3292//3'-CATGTATAACAGCAATCTTGCGCAGTTAGGTATGAcTA G-5 SEQ ID NO : 3308 BRACE 2009 1880//AATAAGCCAGTTGCATCCTC/A AD6; SEQ ID NO : SEQ ID NO : 3309 3293//5'-GTACATATTGTCGTTAGAACGCGTACT CAATCCATACT-3' BRAWH10OO162O//TCTCTGATCTCCAACATGC//

SEQ ID NO : SEQ ID NO : 3310 3294//3'-CATGTATAACAGCAATCTTGCGCATGAGTTAGGTATGACTA BRAWH2OOO 4430//TGAATTGAAGAGACACACT// G-5 SEQ ID NO : 3311 FCBBF10 OO6.180//CTTAATCCAGTTCATCAGCT/A 0449 The internal standard sample used for this assay was a mixture of total RNAs of THP-1 Control, MKN45 SEQ ID NO : 3312 Control, NT2 (Stratagene: catalog No. 204101). RNA prepa FEBRA20003780//TTTTGAGACAGAGTTTCGCTA/ ration from the culture cells was carried out according to the SEQ ID NO : 3313 standard method. FEBRA20 OO6800//ATGTTTTACGATTGCCTTTG/A 0450. The sequences of primers specific to the genes and SEQ ID NO : 3314 the names of clones of interest in the analysis are as follows. FEBRA2000 8810//GAAGCATCTTTGGTGTACTA/A The gene specific primers were designed to produce the PCR SEQ ID NO : 3315 products of 70 to 200 bp, which are derived from the FEBRA2001294.0//TGTCCGTGGAGTATATA/A adapter-containing cDNA. The sequence of adapter-specific primer (labeled with fluorescence (FAM)) used in the com SEQ ID NO : 3316 petitive PCR was GTACATATTGTCGTTAGAACGC (22 FEBRA2001584.0//AACACAGTAGCCAGACCAG// nucleotides; SEQID NO: 3295). PCR was basically carried SEQ ID NO : 3317 out with a cycling profile of preheating at 94° C. for 3 HCASM10000610//AAGAGCCTACTACACGCCAG// minutes, and 30 cycles of denaturation at 94° C. for 30

US 2007/0015163 A1 Jan. 18, 2007 78

KIDNE20061490, NT2NE10001630, NT2NE20003920, -continued NT2NE20005500, NT2RI2001.4500, NT2RI20016570, SEQ ID NO : 3369 NT2RI20078270, NTONG10002570, PUAEN10003220, STOMA20002570//GGTATCTTGGAGCTCCTCAG/A STOMA20002570, TESTI20011340. These genes whose expression levels were elevated by LPS stimulation, were all SEQ ID NO : 3370 STOMA20002890//GTCAGCATCTACTCTGGGTCA/ up-regulated by the TNF-C. stimulation. SEQ ID NO : 3371 0455 On the other hand, with respect to the genes whose SYNOV20001770//AAGAAATAAACACACGAAAA// expression is suppressed, in particular cases where the SEQ ID NO : 3372 expression levels were relatively high in the unstimulated TESTI1 OOOO230//AAATGCAAAATTGCTGAGAT// cells (the relative value were 1 or higher), the clones whose expression levels were decreased by twofold or more by the SEQ ID NO : 3373 TESTI10 OOO550/ACAGAACACTCCTCATACCTCAA TNF-C. stimulation, Were BRACE20013400, BRACE2009 1880, HEART20005060, HLUNG20001760, SEQ ID NO : 3374 IMR3220008590, NT2NE10001850, NT2RI20018660, TESTI 20011340//AAAGTACAGCAGAAGATGGG// NT2RI20053350, NT2RI20070480, PLACE60047380, SEQ ID NO : 3375 STOMA20002890, SYNOV20001770, TRACH20001960. THYMU10005580/AAACAGCTTCTTCATCACAGT// Further, when the levels were normalized by using the ratio of the expression level of B-actin widely used in data SEQ ID NO : 3376 TPACH10 000630//ATAGAGGAAGGTGGCAACTG// normalization for gene expression level, the clones whose expression levels were decreased by tenfold or more SEQ ID NO : 3377 depending on the LPS stimulation, were BRACE20013400, TRACH2OOO 1960//CTCTTTTCCATCACATTCCC/A BRACE2009 1880, HEART20005060, HLUNG20001760, SEQ ID NO : 3378 NT2RI20070480, UMVEN20001330. Among the genes UMVEN10 OO 1220/ACCAAGTTCTCATTCCACATT/A whose expression levels were decreased by TNF-C. stimu SEQ ID NO : 3379 lation, the genes whose expression levels were also UMVEN2OOO 133Q//AGCTAACAAGGTTTTGACAC// decreased by the LPS stimulation were BRACE20013400, BRACE2009 1880, HEART20005060, HLUNG20001760, SEQ ID NO : 3380 NT2RI2OO70480. UTERU2000 4850//AGACTGGGTCTTGCCATACT// 0456. These clones were thus revealed to be involved in 0452. The result of expression frequency analysis is shown in Table 40. The clones not shown in the table contain the inflammation reaction induced by TNF-C. or LPS. clones whose expression levels could not be measured 0457. The result obtained by the search for the genes because the levels were too low or the sizes of the PCR whose expression levels were altered depending on co products were different from the expected. It was confirmed culturing gastric cancer cell line MKN45 with Helicobacter that the expression levels of TNF-C. IL-1, and IL-8 genes pylori, showed that the clones whose expression levels were used as positive control genes were elevated. elevated by twofold or more depending on the presence of 0453 The result obtained by the search for the genes Helicobacter pylori (the clones whose expression levels whose expression levels were altered depending on the were 0.1 or lower both before and after the stimulation were presence of TNF-C. or LPS in culturing THP-1 cell, which is excluded), were BRACE10001590, BRACE20079530, a human monocyte cell line, showed that the clones whose BRAWH10001620, FEBRA20006800, KIDNE20003490, expression levels were elevated by twofold or more depend KIDNE2004.0540, KIDNE20050420, NT2NE10001850, ing on the TNF-C. stimulation (the clones whose expression STOMA20002890, SYNOV20001770, TESTI10000550, levels were 0.1 or lower both before and after the stimulation UTERU20004850. Of the clones, FEBRA20006800, Were excluded), Were ADRGL10000180, KIDNE2004.0540 and UTERU20004850 were also up-regu BRACE20030780, BRACE20077640, BRACE20083850, lated by TNF-C. Stimulation in the human monocyte cell line BRAWH20004430, FCBBF10006180, FEBRA20003780, THP-1. FEBRA20006800, FEBRA20012940, FEBRA20015840, HEART20004480, HLUNG10000370, HLUNG20001160, 0458. On the other hand, with respect to the genes whose HSYRA20013320, IMR3220008380, KIDNE10001520, expression is suppressed, in particular cases where the KIDNE2004.0540, KIDNE20061490, KIDNE20062990, expression levels were relatively high in the unstimulated NT2NE10001630, NT2NE20003920, NT2NE20005500, cells in (the relative value were 1 or higher), when the levels NT2RI2001.4500, NT2RI20016570, NT2RI20078270, were normalized by using the ratio of the expression level of NT2RI20083360, NTONG10002570, PUAEN10003220, B-actin widely used in data normalization for gene expres SKNMC10000290, STOMA20002570, TESTI20011340, sion level, the clones whose expression levels were UTERU2OOO4850. decreased by fivefold or more in the presence of Helico 0454 Further, the clones whose expression levels were bacter pylori, were BRACE20034490, BRACE20077640, elevated by twofold or more depending on the LPS stimu BRACE20083850, KIDNE20005170, LIVER20000330, lation (the clones whose expression levels were 0.1 or lower NT2RP60000390, NTONG10000980, UMVEN20001330. both before and after the stimulation were excluded), were FCBBF10006180, FEBRA20015840, HLUNG10000370, 0459. These clones are involved in gastritis or gas HLUNG20001160, HSYRA20013320, KIDNE2004.0540, troduodenal ulcer.

US 2007/0015163 A1 Jan. 18, 2007 88

TABLE 16-continued

Clone ID FCBBF FEBRA OCBBF BRACE BRALZ, BRAMY BRAWH BRCAN BRCOC BRHIP BRSSN BRSTN BRTHA

BRACE- O O O 24.099 O O 39.894 O O O O O O 20O88570 BRAWH- O O O O 15441 O 33.582 9.804 15.139 10.129 15.905 O O OOOOO10 BRAWH- O O O O O O 1OO O O O O O O OOOOO2O BRAWH- O O O O O O 34.097 O O O O O O OOOOO70 BRAWH- O O O O O O 34.637 O O O O O O OOOO370 BRAWH- O O O O O O 1OO O O O O O O OOOO940 BRAWH- O O O O O O 1OO O O O O O O OOO1300 BRAWH- O O O O O O 1OO O O O O O O OOO1640 BRAWH- O O O O O O 50.775 O O O O O O OOO1680 BRAWH- O O O O O O 21.077 36.92 19.003 O O O O OOO1740 BRAWH- O O O O O O 1OO O O O O O O OOO1800 BRAWH- O O O O O O 11.808 O 10.646 O O O O 2OOOO340 BRAWH- O O O O O O 11.808 O 10.646 O O O O 2OOOO340 BRAWH- O O O O O O 1OO O O O O O O 2OOOO480 BRAWH- O O O O O O 1OO O O O O O O 2OOOO930 BRAWH- O O O O O O 11.171 6.522 O 6.739 O O O 20001770 BRAWH- O O O O O O 1OO O O O O O O 2OOO248O BRAWH- O O O O O O 1OO O O O O O O 2OOO3230 BRAWH- O O O O O O 1OO O O O O O O 2OOO4430 BRAWH- O O O O O O 62.374 O O 37.626 O O O 20004760 BRAWH- O O O O O O 32.294 O O 38.962 O O O 2OOOSO3O BRAWH- O O O O O O OO O O O O O O 2OOOSS40 BRAWH- O O O O O 3.43 S. 888 O O O O O O 20006330 BRAWH- O O O O O O OO O O O O O O 2OOO651O BRAWH- O O O O 8.209 O 8.927 2.606 12.073 2.693 8.456 8.171 O 2OOO6970 BRAWH- O O O O O O OO O O O O O O 200O8660 BRAWH- O O O O O O OO O O O O O O 200O892O BRAWH- O O O O O O OO O O O O O O 2OOO9010 BRAWH- O O O O O O 18.383 O O O O O O 2OOO9440 BRAWH- O O O O O O OO O O O O O O 2OOO984O

0473)

TABLE 17

BRAWH- O O O O O O 69.012 O O O O O O 20011030 BRAWH- O O O O O O 1OO O O O O O O 2OO11290 US 2007/0015163 A1 Jan. 18, 2007 89

TABLE 17-continued

BRAWH- O O O O O 1936 3.323 O O O O 3.042 O 20011660 BRAWH- O O O O O O OO O O O O O O 20012030 BRAWH- O O O 14.525 11.056 7.004 24.046 7.02 10.84 14.SOS O 11.004 O 2001418O BRAWH- O O O O O O OO O O O O O O 2001438O BRAWH- O O O O O 2.145 3.683 O O O O O 9.34 20014610 BRAWH- O O O O O O OO O O O O O O 2001SO3O BRAWH- O O O O O O OO O O O O O O 2003.6890 BRAWH- O O O O O O OO O O O O O O 20O3832O BRAWH- O O O O O O OO O O O O O O 20047310 BRAWH- O O O O O O 63.136 36.864 O O O O O 2005998O BRAWH- O O O O O O OO O O O O O O 2006O440 BRAWH- O O O O O O 37.381 21.826 O O O O O 20064930 BRAWH- O O O O O O OO O O O O O O 2006622O BRAWH- O O O O O O OO O O O O O O 20069600 BRAWH- O O O 27.609 O O 45.705 26.686 O O O O O 20069890 BRAWH- O O O O O O OO O O O O O O 20074060 BRAWH- O O O O O O OO O O O O O O 20076OSO BRAWH- O O O O O O 36.711 O O O O O O 2008.9560 BRAWH- O O O O O O OO O O O O O O 20092270 BRAWH- O O O O O O OO O O O O O O 200926.10 BRAWH- O O O O O O 32.978 O 29.733 O O O O 20093600 BRAWH- O O O O O O OO O O O O O O 20094.850 MR32- O O O 5.763 6.58 O 2.385 1.393 O O O 15.282 O 20013170 KIDNE- O O O 1.63 O O 2.698 O O O 2.556 O O 2OOOO8SO KIDNE- O O O O O O 40.315 O O O O O O 20004220 KIDNE- O O O O O O 9.125 O O O O O 46.286 20O318iSO KIDNE- O O O O O O 40.153 O O 24.222 O O O 2OOSO42O MAMGL- O O O O O O 1.157 O O O O O O OOOO3SO NT2NE- O O O 2.567 O O 4.249 2.481 3.831 O 8.049 O O 2OOO1740 NT2RI- O O O O O 42.OOS 36.052 O O O O O O 20042840 NT2RI- O O O O O O 22.915 O O O O O O 20O86560 NT2RP- O O O O O O 35.182 2O.S.42 O O O O O 70002590 NT2RP- O O O O O O 1855 O O 1119 O O O 70065270 NT2RP- O O O O 8.209 O 8.927 2.606 12.073 2.693 8.456 8.171 O US 2007/0015163 A1 Jan. 18, 2007 90

0474)

TABLE 1.8 NTONG- O O O O O O 6.951 O 6.267 4.193 O 6.362 O OOO1820 PEBLM- O O O O O 19.082 8.189 O O 9.88 O O O 2OOO1470 PLACE- O O O O O O 35.969 O O O O O O 60O32040 SKMUS- O O O O O O 24.247 O O O O O O OOOO140 SMINT O O O O O O 22.O3S O O O O O O 2OOOS4SO TESTI- O O O O O O 44.17 O O O O O O 2OOO43SO TESTI- O O O O O O 20.762 O 18.719 O O 38.006 O 200O8830 TRACEH- O O O O O 3.68 6.317 O 5.695 O O O O 2OOO7800 TRACEH- O O O O O 11.56S 19.852 O O O O O O 20016O70 UMVEN- O O O O O O 3.329 O O O O O O 2OOO1330 3NB69- O O O O 2.926 O O O O O.96 O 1.456 O 1OOO1730 3NB69- O O O O O O.805 O 1.613 1.245 O.833 O O O 200O2810 ADRGL- O O O O O 19.598 O O O O O 30.792 O 2OOOO740 BNGH4- O O O O O 15.04 O O O O O O O OOO1370 BNGH4- O O O O O O O O O O O 15.451 O OOO1980 BRACE- O O O 18.724 O O O O O O O O O OOOO2OO BRACE- O O O 19.762. 15.042 O O O 29.495 O O O O OOOO730 BRACE- O O O 1OO O O O O O O O O O OOOO930 BRACE- O O O 1OO O O O O O O O O O 20000770 BRACE- O O O 1OO O O O O O O O O O 2OOO1 OOO BRACE- O O O 1OO O O O O O O O O O 2OOO1410 BRACE- O O O 28.46 O O O O O 28.42 O 43.121 O 20002800 BRACE- O O O O.OS9 O O O O O O O O O 2OOO332O BRACE- O O O 1OO O O O O O O O O O 2OOOSOSO BRACE- O O O 2.749 6.469 O O 8.215 6.342 8.487 6.664 O O 2OOOS2SO BRACE- O O O 1OO O O O O O O O O O 2OOOS4SO BRACE- O O O S.282 O 14.737 O 14.771 O O O O O 2OOOS6SO BRACE- O O O S.282 O 14.737 O 14.771 O O O O O 2OOOS6SO BRACE- O O O 62.564 O O O O O O O O O 20005770 BRACE- O O O 7.865 O O O O 26.664 O O O O 2OOO698O BRACE- O O O 1OO O O O O O O O O O 2000718O BRACE- O O O S.638 O O O O O O O O O 200O88SO BRACE- O O O 1OO O O O O O O O O O 2000988O BRACE- O O O 6.902 51.46 O O O O O O O O 2001.06SO BRACE- O O O 38.94 O O O O O O 6106 O O 200107OO BRACE- O O O 2.249 3424 O O O O O O O O 20011170 US 2007/0015163 A1 Jan. 18, 2007 91

0475)

TABLE 19 BRACE- O O O 23.186 O O O O O O O O O 20011430 BRACE- O O O 23.186 O O O O O O O O O 20011430 BRACE- O O O 2.733 4.16 O O O O O O O O 20011880 BRACE- O O O 1OO O O O O O O O O O 20013400 BRACE- O O O 1OO O O O O O O O O O 20013520 BRACE- O O O 50.907 O 49.093 O O O O O O O 20013740 BRACE- O O O 24 O O O O O O O O O 20013750 BRACE- O O O OO O O O O O O O O O 20014230 BRACE- O O O OO O O O O O O O O O 2OO14530 BRACE- O O O OO O O O O O O O O O 2001.45SO BRACE- O O O 8.901 O O O O O 8.888 O O O 2001.4770 BRACE- O O O OO O O O O O O O O O 2OO14920 BRACE- O O O 17694 O O O O O O O O O 2OO1508O BRACE- O O O OO O O O O O O O O O 2OO15430 BRACE- O O O 23.14 O O O O O O O 35.06 O 20016730 BRACE- O O O OO O O O O O O O O O 2OO16920 BRACE- O O O OO O O O O O O O O O 20017370 BRACE- O O O 8.117 O O O O O O O O O 200185SO BRACE- O O O OO O O O O O O O O O 20018590 BRACE- O O O OO O O O O O O O O O 200186SO BRACE- O O O OO O O O O O O O O O 2OO1898O BRACE- O O O OO O O O O O O O O O 20021510 BRACE- O O O OO O O O O O O O O O 20021760 BRACE- O O O OO O O O O O O O O O 20022O20 BRACE- O O O OO O O O O O O O O O 20022270 BRACE- O O O OO O O O O O O O O O 20024O90 BRACE- O O O OO O O O O O O O O O 20024O90 BRACE- O O O OO O O O O O O O O O 20024310 BRACE- O O O OO O O O O O O O O O 2002468O BRACE- O O O 39.759 O O O O O O O 60.241 O 200249SO BRACE- O O O OO O O O O O O O O O 20O2S900 BRACE- O O O OO O O O O O O O O O 200263SO BRACE- O O O 23.391 O O O O O O O O O 20026850 BRACE- O O O OO O O O O O O O O O 20027360 BRACE- O O O 29.06 O O O O O O O O O 2002752O BRACE- O O O 34.821 O O O O O O O O O 20027550 US 2007/0015163 A1 Jan. 18, 2007 92

0476)

TABLE 20 BRACE- O O O O O O 2002772O BRACE- O O O O O O 2002792O BRACE- O O O O O O 20027960 BRACE- O O 59.705 O O 18.724 O O 2002812O BRACE- O O O O O O 20O286OO BRACE- O O 39.759 O O O 60.241 O 20030780 BRACE- O O O O O O 200328SO BRACE- O O 23.804 O O O O 20033190 BRACE- O O 39.646 O O O O 2003398O BRACE- O O OO O O O O 20O34310 BRACE- O O OO O O O O 20O3S160 BRACE- O O 2.721 O O O O 20035940 BRACE- O O OO O O O O 20071380 BRACE- O O 50.85 O O O O 2007 1530 BRACE- O O OO O O O O 2007 1970 BRACE- O O OO O O O O 20072010 BRACE- O O OO O O O O 20072320 BRACE- O O OO O O O O 20072810 BRACE- O O OO O O O O 2007.4470 BRACE- O O OO O O O O 20075020 BRACE- O O OO O O O O 20075.270 BRACE- O O OO O O O O 2007538O BRACE- O O OO O O O O 20075630 BRACE- O O 2.87 O O O O 20076210 BRACE- O O 50.907 49.093 O O O 20076460 BRACE- O O 75.026 O O O O 2007 6630 BRACE- O O OO O O O O 200768SO BRACE- O O OO O O O O 20077610 BRACE- O O OO O O O O 20077640 BRACE- O O 18376 O O O O 20077670 BRACE- O O OO O O O O 20077840 BRACE- O O OO O O O O 20078680 BRACE- O O 40.241 O O O O 2007902O BRACE- O O OO O O O O 20079530 BRACE- O O 13.841 O O O 20.658 O O O 20080970 BRACE- O O OO O O O O 20081140 US 2007/0015163 A1 Jan. 18, 2007 93

0477)

TABLE 21 BRACE- O O O 13.995 O O O O 20.888 O O 21.2OS O 20O838SO BRACE- O O O OO O O O O O O O O O 20O84430 BRACE- O O O OO O O O O O O O O O 20O8488O BRACE- O O O 24.161 O O O O O O O O O 20O86530 BRACE- O O O OO O O O O O O O O O 20O86SSO BRACE- O O O 56.896 O O O O O O O 43.104 O 20087.08O BRACE- O O O OO O O O O O O O O O 20O87540 BRACE- O O O OO O O O O O O O O O 20O896OO BRACE- O O O 17.942 O O O O O O O O O 20089990 BRACE- O O O OO O O O O O O O O O 20090140 BRACE- O O O OO O O O O O O O O O 2009 1880 BRACE- O O O 38.389 O O O O O O O O O 20092.120 BRACE- O O O OO O O O O O O O O O 20092750 BRACE- O O O 26.36 O O O O O 26.323 O O O 20093.07.0 BRACE- O O O 50.907 O 49.093 O O O O O O O 20093.110 BRACE- O O O 1OO O O O O O O O O O 20094,370 CTONG- O O O O O O O O O O O O 81.043 200O827O CTONG- O O O O O O O O O O 31.824 O O 2001.32OO CTONG- O O O O O O O 49.28 O O O O O 2002O730 CTONG- O O O O O O O O 36.973 O O O O 20064.490 HHDPC- O O O O O O O 2.27 O O O 1.779 O 2OOOO950 HHDPC- O O O O O 7.181 O O O O O O O 2OOO11SO HHDPC- O O O O O O O O O O O 14.647 O 20004560 HSYRA- O O O O O 6.902 O O O 14.294 O O O OOO1780 HSYRA- O O O O 2.439 O O O O O 2.512 2.427 O 200O828O HSYRA- O O O O 19.869 O O O O O O O O 20011530 MR32- O O O O O O O O O 12.063 O O O OOO2660 MR32- O O O O O O O O O 4.348 O O O 2OOO3O20 MR32- O O O O O O O O O S.491 12.933 O O 200093:SO KIDNE- O O O O O O O O O O O O 58.701 2OOO33OO KIDNE- O O O O O O O O O O O O 35.702 20004970 KIDNE- O O O O O O O O O 18.476 O O O 20005170 KIDNE- O O O O O O O O O 11.97 O O O 20059370 KIDNE- O O O O O 15.848 O O O O O O O 200688OO KIDNE- O O O O O O O O O 3.085 O O O 2007328O LIVER- O O O O O.637 O O O O O O O O US 2007/0015163 A1 Jan. 18, 2007 94

0478)

TABLE 22 MESAN- O O O 30.348 O O O O O O O O O 2OOO2670 NT2NE- O O O O O 38.711 O O O O O O O 20005170 NT2NE- O O O O 40.251 O O O O O O O O 20011560 NT2NE- O O O O O O O O O O SO.666 O O 2OO1364 NT2NE- O O O O O 38.711 O O O O O O O 2001697 NT2RI- O O O O O 1611 O O O O 2.619 O O 2OOO6710 NT2RI- O O O O O O O 9.103 O O O O O 2OOO974O NT2RI- O O O O O 21469 O O O O O O O 20022430 NT2RI- O O O O O O O 24.543 O O O O O 20O2S300 NT2RI- O O O O O 37.52 O O O O O O O 20O28O20 NT2RI- O O O O O O O O O O O 27.171 O 20029.260 NT2RI- O O O 2.704 O O O O O O O O O 2003O110 NT2RI- O O O O O O O O 7.544 O O O O 20030510 NT2RI- O O O O 14.174 O O O O O O O O 2004.0590 NT2RI- O O O 6.506 O O O O O O O O O 20046060 NT2RI- O O O O O 48.905 O O O O O O O 20049840 NT2RI- O O O O 25927 16.425 O O O O O O O 2004.98SO NT2RI- O O O O O O O O O O O.791 O O 20056470 NT2RI- O O O O O O O 34.563 O O O O O 2006O720 NT2RI- O O O O O O O O O 4.348 O O O 20062100 NT2RI- O O O O O O O O O 27.843 O O O 20067350 NT2RI- O O O O O O O O O O O 60.06 O 200682SO NT2RI- O O O O O O O O 8.2O3 O O O O 20070840 NT2RI- O O O O 60.173 O O O O O O O O 20070960 NT2RI- O O O O O 7.713 O O O O O O 33.576 20071.480 NT2RI- O O O O O O O 20.831 O O O O O 20072540 NT2RI- O O O O O O O O O O O O S.656 2007498O NT2RI- O O O O O O O O O 1.73 O O O 20085260 NT2RI- O O O O O 14.618 O O O O O 22.966 O 20O8812O NT2RI- O O O S.633 O O O 5.445 O 11.251 O O O 20090660 NT2RI- O O O O O 23.893 O O O O O O O 20090830 NT2RP- O O O O O O O O SO.126 O O O O 70013060 NT2RP- O O O O O O O 1967 22.78 10.161 7.978 O O 70013350 NT2RP- O O O O O O O O O O O O 50.521 70023760 NT2RP- O O O O O O O O O 26.32 O O O 7.0024500 NT2RP O O O O O O O O O 6.997 21973 O O 70030910 US 2007/0015163 A1 Jan. 18, 2007 95

0479)

TABLE 23 NT2RP- O O O O O 5.755 O O O 5.959 O O O 7.003632 NT2RP- O O O O O O O O 25.125 16.811 O O O 70O3.6470 NT2RP- O O O O O O O 39.426 O O O O O 7OO4233 NT2RP- O O O O SO.62 O O O O O O O O 7OOS4930 NT2RP- O O O O O O O O O O O 33.469 O 7OO64900 NT2RP- O O O O O O O O 16.656 O O O O 7OO71140 NT2RP- O O O O O O O O O 3.241 O O O 70075370 NT2RP- O O O 8.084 O O O 7.814 O O O O O 7.0076100 NT2RP- O O O 6.271 O 2.016 O O O O O O O 70079750 NT2RP- O O O O O O O O O O O O 73.871 70O81370 NT2RP- O O O O O O O O O O O 50.503 O 7OO90120 NT2RP- O O O O SO.62 O O O O O O O O 7OO91490 NT2RP- O O O O O 19.45 O O O O O O O 70093.730 NTONG- O O O O O 23.698 O O O O O O O 2001428O NTONG- O O O O O O O O O 16.897 O O O 2001SSOO PEBLM- O O O O O 23344 O O O O O O O OOOO340 PLACE- O O O O O O O O O 3.198 O O O 6OO1443O PLACE- O O O O O O O O O 1807 O O O 6002O84 PLACE- O O O O O 18.179 O O O O O O O 6.0024190 PLACE- O O O O O 39.559 O O O O O O O 60026920 PLACE- O O O O O 31.763 O O O O O O O 60O3O380 PLACE- O O O O O O O O O O O 33.856 O 60038SOO PLACE- O O O O 13149 O O 8.349 12.892 O 6.772 O O 60043970 PROST O O O 40.095 O O O O O O O O O OOO272O PROST O O O O 11.605 O O O O O O O O 2OOOOS30 PROST O O O O O 39.227 O O O O O O O 2002162O PROST O O O 8.436 O 4.068 O O 6.295 8.424 6.614 O O 20O32320 PROST O O O 40.252 O O O 9.726 O O O O O 20033380 PROST O O O O O O O O O 13.599 O O O 20062600 SALGL- O O O O O O O O O O O 1.103 O OOOOOSO SALGL- O O O O O O O O O O 1.042 O O OOO1570 SKMUS- O O O 3.263 O O O 6.308 9.741 O 5.117 O O OOOO220 SKMUS- O O O O 33.898 O O O O O O O O 2OOO1170 SKMUS- O O O 14.288 O O O O O O O 43.297 O 20002710 SKMUS- O O O 5.866 O O O 5.67 O O 9.198 8.888 O 2OOO954O SKMUS- O O O O O 17.838 O O O O O O O 2OO11290 US 2007/0015163 A1 Jan. 18, 2007 96

0480

TABLE 24 SKMUS- O O O 11.766 O O O O O O O O O 2OO15010 SKMUS- O O O 25.198 O O O O O O O O O 2OO15430 SKMUS- O O O O 7.379 O O O 7.234 O O O O 2OO16340 SKNMC- O O O O O 4.105 O O O O O O O 2OOO2240 SKNMC- O O O O O 6.882 O O O O O S4O6 O 2001SO3O SKNSH- O O O 27.517 O O O O O O O O O 2OOO1510 SMINT O O O O O 39.345 O O O O O O O

SMINT O O O O O O O O O O O 24.589 O 2OOO2390 SPLEN- O O O O O O O O O O O O 85.137 2OOO1970 STOMA- O O O O O O O O O O O O 6.046 2OOO1210 STOMA- O O O O O O O O O O 13.006 O O 20002570 SYNOV- O O O O O O O O O 44.213 O O O 2OOO2910 SYNOV- O O O 2.737 O O O O O O 12.876 4.147 11491 20011440 TESTI- O O O O O O O O O 7.619 O O O OOOOS10 TESTI- O O O O O 16.555 O O O 17.143 O O O OOOO7OO TESTI- O O O O O 8.261 O O O O O O O OOO1680 TESTI- O O O O O O O O O O O 38.108 O

TESTI- O O O O O 21.276 O O O O O O O 2OO15110 TESTI- O O O O O O O 7.673 O O O O O 20018290 TESTI- O O O O O O O 61.764 O O O O O 20018690 TESTI- O O O O O O O O O 62.532 O O O

TESTI- O O O O O O O O O O O 2SO49 O 20024670 TESTI- O O O 11.93 36.321 O O 23.061 O O O O O 20032800 TESTI- O O O 18.795 O O O O O O O O O 200332SO TESTI- O O O O O O O O O O 16.219 O O 200362SO TESTI- O O O O O O O 61.764 O O O O O 20136910 THYMU- O O O O O 8.566 O O O O O O O OOOO830 THYMU- O O O O O O O O 33.614 O O O O OOO3290 THYMU- O O O O O O O O O O O 3.029 O OOO3590 UTERU- O O O O O O O O O O 49.42 O O OOOO960 UTERU- O O O O O O O O O O 49.42 O O 2OOOS690 ADRGL- 48.889 O O O O O O O O O O O O OOOO6SO BGGI1- 2.298 O O O O 2.847 O O O O O O O 20010970 BRACE- 1899 O O 2.44 O O O O O O O O O 20004210 BRACE- 9.224 O O 23.701 O O O 11.454 17.687 O O O O 2002OSOO BRACE- 10.127 O O 13.01.1 O O O O O O O O O 20020910 US 2007/0015163 A1 Jan. 18, 2007 97

0481)

TABLE 25 BRACE- 28.014 O O 71.986 O O O O O O O O O 20O2478O BRACE- 2.126 O O 2.732 O O O O O O O O O 20O2861 O BRACE- 43.768 O O 56.232 O O O O O O O O O 20031100 BRACE- 9.11 O O 11.704 O O O S.656 O O 9.176 O O 20035270 BRACE- 13.023 O O 16.732 O O O O O O O O 70.246 20O3S390 BRACE- 21.571 O O 27.714 O O O O O O O O O 2007 1740 BRACE- 23.581 O O 30.297 46.122 O O O O O O O O 20077270 BRAWH- 31.981 O O O O O 68.019 O O O O O O 2OOO1090 CTONG- 18.811 O O O O O O O O O O O O 20024530 CTONG- 44.214 O O O O O O O O O O O O 20O282OO CTONG- 30.136 O O O O O O O O O O O O 200555.30 FCBBF- OO O O O O O O O O O O O O OOOS98O FCBBF- OO O O O O O O O O O O O O OOO618O FCBBF- OO O O O O O O O O O O O O OOO6870 FCBBF- OO O O O O O O O O O O O O OOO6910 FCBBF- OO O O O O O O O O O O O O OOO732O FCBBF- 8.367 O O O O O 3.559 O O O O O O OOO76OO FCBBF- OO O O O O O O O O O O O O 2OOOO940 FCBBF- OO O O O O O O O O O O O O 2OOO1 OSO FCBBF- 34.637 O O O O O O O O O O O O 2OOO1950 FCBBF- OO O O O O O O O O O O O O 2OOO2320 FCBBF- OO O O O O O O O O O O O O 20002760 FCBBF- OO O O O O O O O O O O O O 2OOOS760 FCBBF- 8.519 O O O O O O O O O O O O 2OOOS910 FCBBF- OO O O O O O O O O O O O O 2OOO6770 FCBBF- 33.171 O O O O O O O O O 66.829 O O 2OOO7330 FCBBF- OO O O O O O O O O O O O O 20008080 FCBBF- OO O O O O O O O O O O O O 200081SO FCBBF- 23.045 O O 14.804 O O O O O O O O 62.152 2OOO94OO FCBBF- OO O O O O O O O O O O O O 2OOO951O FCBBF- 14.958 O O O O 18.533 O 18.575 O O O O O 2001.2110 FCBBF- OO O O O O O O O O O O O O 20012990 FCBBF- 44.606 O O O O O O SS-394 O O O O O 20014800 FCBBF- OO O O O O O O O O O O O O 2001672O FCBBF- OO O O O O O O O O O O O O 2001718O FCBBF- OO O O O O O O O O O O O O 20017200 US 2007/0015163 A1 Jan. 18, 2007 98

0482

TABLE 26 FCBBF- 1OO O O O O O O O O O O O O 400O282O HCASM- 1.105 O O O O 1.369 O O O 1417 O O O OOO11SO HHDPC- 6.308 O O 8.1 OS O O O O O O O O O 2OOO1490 HLUNG- 12.676 O O O O O O O O O O O O OOOO640 HLUNG- 6.906 O O O O 4.278 7.344 8.576 O O O 6.722 O 20003140 HLUNG- 1.306 O O O S.108 O 2.778 4.865 O 1676 2.631 O O 2OOOSO10 HSYRA- 5.798 O O O O 7.183 O O O 7.438 O O O 2OOO1350 HSYRA- 5.57 O O O O O O O S.34 O O O O 2001.4760 HSYRA- 2O.226 O O O O O O O O O O O O 2OO16310 MR32- 1.259 O O 1.617 7.386 O O O O O O O O 2OOO742O MR32- 1911 O O O O O O O O O O O O 2OOO973O MR32- 5.075 O O O O O O O O O O O O 2OOO984O MR32- 2.92 O O 3.752 O O O O O O O S.685 O 2OO1218O MR32- 1349 O O 3.466 O O O O O O O 2.626 O 2001.332O KIDNE- 3.71 O O 9.S32 O 4.596 O O O O 14.947 O O 2OOO2660 KIDNE- 25.852 O O O O O O O O O O O O 20056760 KIDNE- 4.679 O O 8.016 O O 6.63S O O 10.006 O O O 20073520 LIVER- 7.091 O O O O O 15.081 O O 9.098 O 13.803 O 2OOO4160 MESAN- 15.63S O O O O O 33.255 O O O O O O 2OOOO920 NT2NE- 11.539 O O O O O O O O O O O O 2OO153OO NT2NE- 5.488 O O O O 6.8 O O O O O O O 20035690 NT2RI- 7.537 O O O O O O O O O O O O 20010910 NT2RI- 8.216 O O O O O 17.474 O O O 16. SS2 O O 20016210 NT2RI- 1129 O O O O O O O 2.16S O O O O 2OO16570 NT2RI- O.876 O O O O O 1863 O O O 1764 O O 20033040 NT2RI- 24.272 O O O O O O O O O O O O 20O33440 NT2RI- 6.517 O O O O 4.037 O O 6.248 O O O O 20058110 NT2RI- 43.582 O O O O O O O O O O O O 20065060 NT2RI- 1493 O O O O O 1.587 1853 O O 1...SO3 O 4.025 20O874.90 NT2RP- 1.537 O O O O O O O 2.947 O O O O 6OOOO720 NT2RP- 7.63 O O O O 9.454 O O 14.632 9.79 O 14.854 O 70002710 NT2RP- 51164 O O O O O O O O O O O O 7OO12310 NT2RP- 6.873 O O O O O 7.309 4.267 6.589 O 13.846 O O 70O368OO NT2RP- 2.574 O O O O O 5.475 O O O O O O 70055020 NT2RP- 1.702 O O O O O O O O 2.184 O O O 70055.130 NT2RP- 10.8.19 O O O O O O O O O O O O 7006188