DOCSLIB.ORG

Mouse Gcm2 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Gcm2 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Gcm2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Gcm2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Gcm2 gene (NCBI Reference Sequence: NM_008104 ; Ensembl: ENSMUSG00000021362 ) is located on Mouse chromosome 13. 5 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 5 (Transcript: ENSMUST00000021791). Exon 5 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Gcm2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-126N18 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygous null mice lack parathyroid glands and exhibit hypocalcemia, hypophosphatemia, a mild abnormal bone phenotype, and partial perinatal lethality. Hypoparathyroidism is observed although parathyroid hormone serum levels are normal. Exon 5 covers 61.51% of the coding region. Start codon is in exon 1, and stop codon is in exon 5. The size of intron 4 for 5'-loxP site insertion: 879 bp. The size of effective cKO region: ~1203 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy gRNA region Wildtype allele T A 5' gRNA region G 3' 1 2 3 4 5 Targeting vector T A G Targeted allele T A G Constitutive KO allele (After Cre recombination) Legends Exon of mouse Gcm2 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. It may be difficult to construct this targeting vector. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7430bp) | A(27.58% 2049) | C(22.85% 1698) | T(26.43% 1964) | G(23.14% 1719) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr13 - 41103940 41106939 3000 browser details YourSeq 77 1120 1271 3000 89.7% chr9 + 78059657 78059808 152 browser details YourSeq 60 4 88 3000 94.2% chr14 + 60132410 60132496 87 browser details YourSeq 59 2 79 3000 90.5% chr1 + 130378375 130378453 79 browser details YourSeq 52 7 60 3000 98.2% chr4 - 43355006 43355059 54 browser details YourSeq 52 1736 1994 3000 68.2% chr11 + 5761272 5761426 155 browser details YourSeq 51 2 60 3000 93.3% chr16 - 52310259 52310317 59 browser details YourSeq 48 1926 2004 3000 77.5% chr12 + 108344629 108344696 68 browser details YourSeq 47 1960 2086 3000 94.6% chr14 - 52798199 52798633 435 browser details YourSeq 45 1961 2068 3000 89.4% chr10 + 60024281 60024385 105 browser details YourSeq 44 1971 2077 3000 95.9% chr7 - 107276536 107276643 108 browser details YourSeq 41 20 60 3000 100.0% chr2 - 27410516 27410556 41 browser details YourSeq 41 29 90 3000 90.2% chr19 + 7490912 7490974 63 browser details YourSeq 38 1971 2068 3000 69.4% chrX - 73847520 73847617 98 browser details YourSeq 38 1978 2078 3000 93.1% chr10 - 5241365 5241466 102 browser details YourSeq 38 1974 2081 3000 93.2% chr5 + 108220323 108220430 108 browser details YourSeq 36 1975 2076 3000 94.9% chr10 + 95497961 95498062 102 browser details YourSeq 35 1961 2005 3000 88.9% chr2 - 32902867 32902911 45 browser details YourSeq 35 1957 2077 3000 83.0% chr16 - 18236985 18237102 118 browser details YourSeq 35 1961 1997 3000 97.3% chr1 - 190789741 190789777 37 Note: The 3000 bp section upstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr13 - 41099760 41102759 3000 browser details YourSeq 194 2367 2760 3000 81.9% chr9 + 56069148 56069506 359 browser details YourSeq 193 2367 2731 3000 81.0% chr18 + 32041254 32041590 337 browser details YourSeq 188 2367 2749 3000 84.2% chr10 - 71392848 71393211 364 browser details YourSeq 184 2376 2751 3000 81.8% chr1 - 87840020 87840366 347 browser details YourSeq 183 2417 2747 3000 86.3% chr1 - 136819287 136819785 499 browser details YourSeq 183 2375 2751 3000 81.5% chr13 + 59751026 59751372 347 browser details YourSeq 178 2365 2729 3000 78.7% chr9 + 70928847 70929172 326 browser details YourSeq 175 2399 2751 3000 83.2% chr18 - 11766306 11766599 294 browser details YourSeq 173 2420 2751 3000 81.9% chr12 - 41202573 41202887 315 browser details YourSeq 172 2363 2756 3000 81.8% chr1 + 181312749 181313126 378 browser details YourSeq 171 2381 2755 3000 84.4% chr13 + 114692691 114693067 377 browser details YourSeq 169 2375 2751 3000 80.5% chr2 + 5184688 5185040 353 browser details YourSeq 168 2375 2748 3000 78.0% chr2 + 69595808 69596133 326 browser details YourSeq 168 2366 2749 3000 84.7% chr15 + 76983194 77184678 201485 browser details YourSeq 167 2402 2751 3000 78.7% chrX + 60395821 60396160 340 browser details YourSeq 166 2427 2751 3000 83.5% chr5 - 116184431 116184711 281 browser details YourSeq 166 2461 2751 3000 84.4% chr16 + 97965847 97966130 284 browser details YourSeq 165 2375 2751 3000 82.8% chr11 - 105098801 105099138 338 browser details YourSeq 165 2367 2731 3000 82.0% chr10 - 43348525 43348877 353 Note: The 3000 bp section downstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Gcm2 glial cells missing homolog 2 [ Mus musculus (house mouse) ] Gene ID: 107889, updated on 10-Oct-2019 Gene summary Official Symbol Gcm2 provided by MGI Official Full Name glial cells missing homolog 2 provided by MGI Primary source MGI:MGI:1861438 See related Ensembl:ENSMUSG00000021362 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Gcm1; Gcm-rs1; Gcm1-rs2 Expression Low expression observed in reference dataset See more Orthologs human all Genomic context Location: 13; 13 A3.3 See Gcm2 in Genome Data Viewer Exon count: 6 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 13 NC_000079.6 (41101427..41111035, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 13 NC_000079.5 (41196796..41205357, complement) Chromosome 13 - NC_000079.6 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 3 transcripts Gene: Gcm2 ENSMUSG00000021362 Description glial cells missing homolog 2 [Source:MGI Symbol;Acc:MGI:1861438] Gene Synonyms Gcm1-rs2 Location Chromosome 13: 41,101,427-41,111,035 reverse strand. GRCm38:CM001006.2 About this gene This gene has 3 transcripts (splice variants), 193 orthologues, 1 paralogue, is a member of 1 Ensembl protein family and is associated with 21 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Gcm2-201 ENSMUST00000021791.7 3073 504aa ENSMUSP00000021791.6 Protein coding CCDS26472 A0A0R4J021 TSL:1 GENCODE basic APPRIS P1 Gcm2-202 ENSMUST00000225271.1 688 183aa ENSMUSP00000153244.1 Protein coding - A0A286YD23 CDS 3' incomplete Gcm2-203 ENSMUST00000225420.1 2662 No protein - Retained intron - - - 29.61 kb Forward strand 41.10Mb 41.11Mb 41.12Mb Genes Gm48344-201 >processed pseudogene Sycp2l-201 >protein coding (Comprehensive set... Contigs < AC158538.2 Genes (Comprehensive set... < Gcm2-203retained intron < Gcm2-201protein coding < Gcm2-202protein coding Regulatory Build 41.10Mb 41.11Mb 41.12Mb Reverse strand 29.61 kb Regulation Legend CTCF Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding pseudogene processed transcript Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000021791 < Gcm2-201protein coding Reverse strand 8.76 kb ENSMUSP00000021... MobiDB lite Superfamily GCM domain superfamily Pfam Transcription regulator GCM domain PROSITE profiles Transcription regulator GCM domain PANTHER PTHR12414:SF7 Chorion-specific transcription factor GCM Gene3D 2.20.28.80 3.30.1370.90 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant stop retained variant synonymous variant Scale bar 0 60 120 180 240 300 360 420 504 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • Identification of a Novel Mutation Disrupting the DNA Binding Activity
    443 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.2004.026898 on 29 April 2005. Downloaded from Identification of a novel mutation disrupting the DNA binding activity of GCM2 in autosomal recessive familial isolated hypoparathyroidism L Baumber, C Tufarelli, S Patel, P King, C A Johnson, E R Maher, R C Trembath ............................................................................................................................... J Med Genet 2005;42:443–448. doi: 10.1136/jmg.2004.026898 ypoparathyroidism is a heterogeneous group of dis- orders with both acquired and inherited causes, each Key points Hpresenting clinically with hypocalcaemia. Familial cases of hypoparathyroidism may be due to an isolated N Hypoparathyroidism is a heterogeneous group of defect of the parathyroid glands or be a component of a disorders with both acquired and inherited causes, syndrome disorder, examples of which include DiGeorge, each presenting clinically with hypocalcaemia. hypoparathyroidism-retardation-dysmorphism, and Kenny- N Familial isolated hypoparathyroidism is characterised 1 Caffey syndrome. Familial isolated hypoparathyroidism by hypocalcaemia and hyperphosphataemia and may (FIH) is characterised by hypocalcaemia and hyperpho- be due to an inherited deficiency or the abnormal sphataemia and may be due to an inherited deficiency or activity of parathyroid hormone. the abnormal activity of parathyroid hormone (PTH). FIH is heterogeneous with X linked, autosomal dominant, and N Recently, a homozygous deletion within the human autosomal recessive modes of inheritance reported.2 GCM2 gene has been shown to underlie hypopar- Mutations in the PTH gene on chromosome 11p have been athyroidism in one patient, while other compelling described in both autosomal dominant and autosomal evidence indicates a critical role for GCM2 in normal recessive forms of the disorder.34 Mature PTH is generated parathyroid gland function.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name glial cells missing homolog 2 (Drosophila) Gene Symbol GCM2 Organism Human Gene Summary This gene is a homolog of the Drosophila glial cells missing gene which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. Gene Aliases GCMB, hGCMb RefSeq Accession No. NC_000006.11, NG_008970.1, NT_007592.15 UniGene ID Hs.227098 Ensembl Gene ID ENSG00000124827 Entrez Gene ID 9247 Assay Information Unique Assay ID qHsaCIP0029896 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000379491 Amplicon Context Sequence ACATAGCCGTCAGGCCACTCTCGGAATTGGTCAAAGAGGGCCAGCTCCTGAGG CATCTGCGGATCGTTGATGTCCCAGCTGAGCTGCATCCCGTA Amplicon Length (bp) 65 Chromosome Location 6:10877579-10881984 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 101 R2 0.9999 cDNA Cq Target not expressed in universal RNA cDNA Tm (Celsius) Target not expressed in universal RNA Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Target not expressed in universal RNA Specificity
    [Show full text]
  • Presence and Significance of a R110W Mutation in the DNA
    European Journal of Endocrinology (2010) 162 407–421 ISSN 0804-4643 CLINICAL STUDY Presence and significance of a R110W mutation in the DNA-binding domain of GCM2 gene in patients with isolated hypoparathyroidism and their family members Neeraj Tomar1, Hema Bora2, Ratnakar Singh3, Nandita Gupta1, Punit Kaur4, Shyam Singh Chauhan3, Yagya Dutta Sharma2 and Ravinder Goswami1 Departments of 1Endocrinology and Metabolism, 2Biotechnology, 3Biochemistry and 4Biophysics, All India Institute of Medical Sciences, New Delhi 110029, India (Correspondence should be addressed to R Goswami; Email: [email protected]) Abstract Objective: Glial cells missing 2 (GCM2) gene encodes a parathyroid-specific transcription factor. We assessed GCM2 gene sequence in patients with isolated hypoparathyroidism (IH). Design: Case–control study. Methods: Complete DNA sequencing of the GCM2 gene including its exons, promoter, and 50 and 30 UTRs was performed in 24/101 patients with IH. PCR–restriction fragment length polymorphism was used to detect a novel R110W mutation in all 101 IH patients and 655 healthy controls. Significance of the mutation was assessed by electrophoretic mobility shift assay (EMSA) and nuclear localization on transfection. Results: A heterozygous R110W mutation was present in DNA-binding domain in 11/101 patients (10.9%) and absent in 655 controls (P!10K7). Four of 13 nonaffected first-degree relatives for five of these index cases had R110W mutation. Four heterozygous single nucleotide polymorphisms were found in the 50 region. One of the 11 patients with R110W also had T370M change in compound heterozygous form. Mutant R110W and T370M GCM2 proteins showed decreased binding with GCM recognition elements on EMSA indicating loss of function.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • REVIEW Mouse Models for Inherited Endocrine and Metabolic Disorders
    211 REVIEW Mouse models for inherited endocrine and metabolic disorders Siaˆn E Piret and Rajesh V Thakker Academic Endocrine Unit, Oxford Centre for Diabetes, Endocrinology and Metabolism, Churchill Hospital, University of Oxford, Headington, Oxford OX3 7LJ, UK (Correspondence should be addressed to R V Thakker; Email: [email protected]) Abstract In vivo models represent important resources for investigating mutagenesis; conventional, conditional and inducible knock- the physiological mechanisms underlying endocrine and out models; knockin models and transgenic models, and these metabolic disorders, and for pre-clinical translational studies strategies are often complementary. This review describes that may include the assessments of new treatments. In the some of the different strategies that are utilised for generating study of endocrine diseases, which affect multiple organs, mouse models. In addition, some mouse models that have in vivo models provide specific advantages over in vitro models, been successfully generated by these methods for some which are limited to investigation of isolated systems. In human hereditary endocrine and metabolic disorders are recent years, the mouse has become the popular choice for reviewed. In particular, the mouse models generated for developing such in vivo mammalian models, as it has a genome parathyroid disorders, which include: the multiple endocrine that shares w85% identity to that of man, and has many neoplasias; hyperparathyroidism-jaw tumour syndrome; physiological systems that are similar to those in man. disorders of the calcium-sensing receptor and forms of Moreover, methods have been developed to alter the inherited hypoparathyroidism are discussed. The advances expression of genes in the mouse, thereby generating models that have been made in our understanding of the mechanisms for human diseases, which may be due to loss- or gain- of these human diseases by investigations of these mouse of-function mutations.
    [Show full text]
  • Genetic Testing in Inherited Endocrine Disorders
    Eggermann et al. Orphanet Journal of Rare Diseases (2020) 15:144 https://doi.org/10.1186/s13023-020-01420-w REVIEW Open Access Genetic testing in inherited endocrine disorders: joint position paper of the European reference network on rare endocrine conditions (Endo-ERN) Thomas Eggermann1* , Miriam Elbracht1, Ingo Kurth1, Anders Juul2,3, Trine Holm Johannsen2,3, Irène Netchine4, George Mastorakos5, Gudmundur Johannsson6, Thomas J. Musholt7, Martin Zenker8, Dirk Prawitt9, Alberto M. Pereira10, Olaf Hiort11 and on behalf of the European Reference Network on Rare Endocrine Conditions (ENDO-ERN Abstract Background: With the development of molecular high-throughput assays (i.e. next generation sequencing), the knowledge on the contribution of genetic and epigenetic alterations to the etiology of inherited endocrine disorders has massively expanded. However, the rapid implementation of these new molecular tools in the diagnostic settings makes the interpretation of diagnostic data increasingly complex. Main body: This joint paper of the ENDO-ERN members aims to overview chances, challenges, limitations and relevance of comprehensive genetic diagnostic testing in rare endocrine conditions in order to achieve an early molecular diagnosis. This early diagnosis of a genetically based endocrine disorder contributes to a precise management and helps the patients and their families in their self-determined planning of life. Furthermore, the identification of a causative (epi)genetic alteration allows an accurate prognosis of recurrence risks for family planning as the basis of genetic counselling. Asymptomatic carriers of pathogenic variants can be identified, and prenatal testing might be offered, where appropriate. Conclusions: The decision on genetic testing in the diagnostic workup of endocrine disorders should be based on their appropriateness to reliably detect the disease-causing and –modifying mutation, their informational value, and cost-effectiveness.
    [Show full text]
  • Functional Conservation of the Glide/Gcm Regulatory Network Controlling Glia, Hemocyte, and Tendon Cell Differentiation in Drosophila
    | INVESTIGATION Functional Conservation of the Glide/Gcm Regulatory Network Controlling Glia, Hemocyte, and Tendon Cell Differentiation in Drosophila Pierre B. Cattenoz,*,†,‡,§ Anna Popkova,*,†,‡,§,1 Tony D. Southall,**,2 Giuseppe Aiello,*,†,‡,§ Andrea H. Brand,** and Angela Giangrande*,†,‡,§,3 *Department of Functional Genomics and Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire and †Centre National de la Recherche Scientifique (CNRS), UMR7104, F-67404 Illkirch Cedex, France, ‡Institut National de la Santé et de la Recherche Médicale (INSERM), U964, F-67404 Illkirch Cedex, France, §Université de Strasbourg, F-67404 Illkirch, France, and **Gurdon Institute and Department of Physiology, Development and Neuroscience, University of Cambridge, United Kingdom CB2 1QN ABSTRACT High-throughput screens allow us to understand how transcription factors trigger developmental processes, including cell specification. A major challenge is identification of their binding sites because feedback loops and homeostatic interactions may mask the direct impact of those factors in transcriptome analyses. Moreover, this approach dissects the downstream signaling cascades and facilitates identification of conserved transcriptional programs. Here we show the results and the validation of a DNA adenine methyltransferase identification (DamID) genome-wide screen that identifies the direct targets of Glide/Gcm, a potent transcription factor that controls glia, hemocyte, and tendon cell differentiation in Drosophila. The screen identifies many genes that had not been previously associated with Glide/Gcm and highlights three major signaling pathways interacting with Glide/Gcm: Notch, Hedgehog, and JAK/STAT, which all involve feedback loops. Furthermore, the screen identifies effector molecules that are necessary for cell-cell interactions during late developmental processes and/or in ontogeny.
    [Show full text]
  • 393LN V 393P 344SQ V 393P Probe Set Entrez Gene
    393LN v 393P 344SQ v 393P Entrez fold fold probe set Gene Gene Symbol Gene cluster Gene Title p-value change p-value change chemokine (C-C motif) ligand 21b /// chemokine (C-C motif) ligand 21a /// chemokine (C-C motif) ligand 21c 1419426_s_at 18829 /// Ccl21b /// Ccl2 1 - up 393 LN only (leucine) 0.0047 9.199837 0.45212 6.847887 nuclear factor of activated T-cells, cytoplasmic, calcineurin- 1447085_s_at 18018 Nfatc1 1 - up 393 LN only dependent 1 0.009048 12.065 0.13718 4.81 RIKEN cDNA 1453647_at 78668 9530059J11Rik1 - up 393 LN only 9530059J11 gene 0.002208 5.482897 0.27642 3.45171 transient receptor potential cation channel, subfamily 1457164_at 277328 Trpa1 1 - up 393 LN only A, member 1 0.000111 9.180344 0.01771 3.048114 regulating synaptic membrane 1422809_at 116838 Rims2 1 - up 393 LN only exocytosis 2 0.001891 8.560424 0.13159 2.980501 glial cell line derived neurotrophic factor family receptor alpha 1433716_x_at 14586 Gfra2 1 - up 393 LN only 2 0.006868 30.88736 0.01066 2.811211 1446936_at --- --- 1 - up 393 LN only --- 0.007695 6.373955 0.11733 2.480287 zinc finger protein 1438742_at 320683 Zfp629 1 - up 393 LN only 629 0.002644 5.231855 0.38124 2.377016 phospholipase A2, 1426019_at 18786 Plaa 1 - up 393 LN only activating protein 0.008657 6.2364 0.12336 2.262117 1445314_at 14009 Etv1 1 - up 393 LN only ets variant gene 1 0.007224 3.643646 0.36434 2.01989 ciliary rootlet coiled- 1427338_at 230872 Crocc 1 - up 393 LN only coil, rootletin 0.002482 7.783242 0.49977 1.794171 expressed sequence 1436585_at 99463 BB182297 1 - up 393
    [Show full text]
  • An Integrative Genomic Analysis of the Longshanks Selection Experiment for Longer Limbs in Mice
    bioRxiv preprint doi: https://doi.org/10.1101/378711; this version posted August 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Title: 2 An integrative genomic analysis of the Longshanks selection experiment for longer limbs in mice 3 Short Title: 4 Genomic response to selection for longer limbs 5 One-sentence summary: 6 Genome sequencing of mice selected for longer limbs reveals that rapid selection response is 7 due to both discrete loci and polygenic adaptation 8 Authors: 9 João P. L. Castro 1,*, Michelle N. Yancoskie 1,*, Marta Marchini 2, Stefanie Belohlavy 3, Marek 10 Kučka 1, William H. Beluch 1, Ronald Naumann 4, Isabella Skuplik 2, John Cobb 2, Nick H. 11 Barton 3, Campbell Rolian2,†, Yingguang Frank Chan 1,† 12 Affiliations: 13 1. Friedrich Miescher Laboratory of the Max Planck Society, Tübingen, Germany 14 2. University of Calgary, Calgary AB, Canada 15 3. IST Austria, Klosterneuburg, Austria 16 4. Max Planck Institute for Cell Biology and Genetics, Dresden, Germany 17 Corresponding author: 18 Campbell Rolian 19 Yingguang Frank Chan 20 * indicates equal contribution 21 † indicates equal contribution 22 Abstract: 23 Evolutionary studies are often limited by missing data that are critical to understanding the 24 history of selection. Selection experiments, which reproduce rapid evolution under controlled 25 conditions, are excellent tools to study how genomes evolve under strong selection. Here we 1 bioRxiv preprint doi: https://doi.org/10.1101/378711; this version posted August 19, 2018.
    [Show full text]
  • Regulatory Mechanisms of Thymus and T Cell Development ⇑ Dongyuan Ma 1, Yonglong Wei 1, Feng Liu
    Developmental and Comparative Immunology 39 (2013) 91–102 Contents lists available at SciVerse ScienceDirect Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci Review Regulatory mechanisms of thymus and T cell development ⇑ Dongyuan Ma 1, Yonglong Wei 1, Feng Liu State Key Laboratory of Biomembrane and Membrane Biotechnology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China article info abstract Article history: The thymus is a central hematopoietic organ which produces mature T lymphocytes with diverse antigen Available online 29 December 2011 specificity. During development, the thymus primordium is derived from the third pharyngeal endoder- mal pouch, and then differentiates into cortical and medullary thymic epithelial cells (TECs). TECs repre- Keywords: sent the primary functional cell type that forms the unique thymic epithelial microenvironment which is Thymopoiesis essential for intrathymic T-cell development, including positive selection, negative selection and emigra- T cell tion out of the thymus. Our understanding of thymopoiesis has been greatly advanced by using several Signaling important animal models. This review will describe progress on the molecular mechanisms involved in Transcription factors thymus and T cell development with particular focus on the signaling and transcription factors involved Mouse Zebrafish in this process in mouse and zebrafish. Ó 2011 Elsevier Ltd. All rights reserved. Contents 1. Introduction . ......................................................................................................
    [Show full text]
  • Ii. Runx1-Eto
    %NVUEDELOBTENTIONDU %0$503"5%&-6/*7&34*5² %&506-064& $ÏLIVRÏPAR Université Toulouse III Paul Sabatier (UT3 Paul Sabatier) $ISCIPLINEOUSPÏCIALITÏ Gènes, Cellules et Développement 0RÏSENTÏEETSOUTENUEPAR Stéphanie BRAS LE vendredi 8 juin 2012 4ITRE Etude des fonctions normales et pathologiques des facteurs de transcription de type RUNX au cours de l’hématopoïèse chez Drosophila melanogaster. %COLEDOCTORALE Biologie, Santé, Biotechnologies (BSB) 5NITÏDERECHERCHE Centre de Biologie du développement, CNRS UMR 5547 $IRECTEURS DE4HÒSE Dr. Lucas Waltzer Dr. Marc Haenlin 2APPORTEURS Dr. Marie Meister Dr. Georges Lacaud MEMBRES DUJURY: Pr David Cribbs, président Dr. Marie Meister, rapportrice Dr. Georges Lacaud, rapporteur Dr. Estelle Duprez, examinatrice Dr. Lucas Waltzer, directeur de thèse Dr. Marc Haenlin, directeur de thèse Je voudrais tout d’abord remercier les membres du jury : David Cribbs, Georges Lacaud, Marie Meister et Estelle Duprez qui ont accepté de lire et de juger mes travaux de thèse. Je remercie également mes deux directeurs de thèse, Lucas et Marc pour ces six ans passés au sein de leur équipe. Et oui, je n’étais pas rassasiée de mes deux années de master passée dans votre équipe, il a fallu que je m’accroche encore 4ans pour faire ma thèse dans votre équipe ! Ma première pensée va vers Lucas : Merci Lucas pour toutes ces discussions qui m’ont permis de me recentrer sur les questions essentielles à des moments où les résultats n’étaient pas des plus clairs. Tu m’as soutenu. Tu as été toujours plus disponible au fil des années pour m’encadrer et me permettre de mener à bien mes deux projets de thèse.
    [Show full text]
  • Gcm2 Promotes Glial Cell Differentiation and Is Required with Glial Cells Missing for Macrophage Development in Drosophila
    Developmental Biology 248, 369–383 (2002) doi:10.1006/dbio.2002.0740 gcm2 Promotes Glial Cell Differentiation and Is Required with glial cells missing for Macrophage Development in Drosophila Teresa B. Alfonso and Bradley W. Jones1 Molecular Neurobiology Program, Skirball Institute of Biomolecular Medicine, and Department of Pharmacology, New York University School of Medicine, New York NY 10016 glial cells missing (gcm) is the primary regulator of glial cell fate in Drosophila. In addition, gcm has a role in the differentiation of the plasmatocyte/macrophage lineage of hemocytes. Since mutation of gcm causes only a decrease in plasmatocyte numbers without changing their ability to convert into macrophages, gcm cannot be the sole determinant of plasmatocyte/macrophage differentiation. We have characterized a gcm homolog, gcm2. gcm2 is expressed at low levels in glial cells and hemocyte precursors. We show that gcm2 has redundant functions with gcm and has a minor role promoting glial cell differentiation. More significant, like gcm, mutation of gcm2 leads to reduced plasmatocyte numbers. A deletion removing both genes has allowed us to clarify the role of these redundant genes in plasmatocyte development. Animals deficient for both gcm and gcm2 fail to express the macrophage receptor Croquemort. Plasmatocytes are reduced in number, but still express the early marker Peroxidasin. These Peroxidasin-expressing hemocytes fail to migrate to their normal locations and do not complete their conversion into macrophages. Our results suggest that both gcm and gcm2 are required together for the proliferation of plasmatocyte precursors, the expression of Croquemort protein, and the ability of plasmatocytes to convert into macrophages.
    [Show full text]