DOCSLIB.ORG

A Genetic Screen for Genes Involved in Dendrite Morphogenesis of Central Neurons in Drosophila Melanogaster

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Genetic Screen for Genes Involved in Dendrite Morphogenesis of Central Neurons in Drosophila Melanogaster RADAR Research Archive and Digital Asset Repository Copyright © and Moral Rights for this thesis are retained by the author and/or other copyright owners. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the copyright holder(s). The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the copyright holders. When referring to this work, the full bibliographic details must be given as follows: North, A. (2011) A genetic screen for genes involved in dendrite morphogenesis of central neurons in Drosophila melanogaster. PhD Thesis. Oxford Brookes University. WWW.BROOKES.AC.UK/GO/RADAR A genetic screen for genes involved in dendrite morphogenesis of central neurons in Drosophila melanogaster Annemarie North B.Sc (Hons), M.Sc Awarded by Oxford Brookes University, Oxford in collaboration with University of Cambridge, Cambridge August 2011 A thesis submitted in partial fulfilment of the requirements of the award of Doctor of Philosophy i Declaration I hereby declare that this thesis is my own work and effort and that it has not been submitted anywhere for any award. Where other sources of information have been used, they have been acknowledged. Signature: ………………………………………. Date: ……………………………………………. i For Hazel and Rachel The true delight is in the finding out rather that the knowing Isaac Asimov Even if you fall on your face, you’re still moving forward Victor Kiam ii Abstract In order to produce a functional nervous system, it is essential that neurons project synaptic terminals into particular regions of the developing nervous system, so as to make connections with appropriate pre- and postsynaptic partners. While axon targeting has been studied extensively, much less is known about how the postsynaptic dendrites grow and branch. To study dendrite morphogenesis, a mosaic loss of function screen was developed and carried out in Drosophila melanogaster for chromosomal regions required for motor neuron dendrite development. Specifically, the Mosaic Analysis with a Repressible Cell Marker (MARCM) method was modified so that individual motor neurons can be made homozygous for a defined genomic aberration in an otherwise wild-type (heterozygous) background and visualised during early larval stages. In addition, 85 defined chromosomal deficiencies were recombined individually onto FRT-carrying chromosomes to be screened for genes involved in dendrite morphogenesis. These recombinant FRT-deficiency chromosomes provided a coverage of ~64.3% of chromosome 2 (3864 annotated genes). After analysis of ~35% of chromosome 2 (2092 annotated genes), 814 central nervous systems and 414 neurons, five genomic regions were identified that had a dendritic phenotype when absent. One of these regions, 2R:23D2;23E, uncovered by FRT40A Df(2L)S2590, was studied in more detail. Overlapping deficiencies were screened to define more precisely the region of chromosome 2 where the loss of gene(s) caused a dendritic phenotype in motor neurons. Of the seven candidate genes identified in this region, only one was shown to have expression in the embryonic central nervous system – the as yet uncharacterised gene CG34393. Based on sequence comparisons, CG34393 is predicted to encode a putative Ras guanyl exchange factor. Expression data from putative homologues in other species and Drosophila genes that are expressed in a similar developmental time course suggest that CG34393 may be involved in synapse development. iii Contents Declaration ............................................................................................................................... i Abstract .................................................................................................................................. iii Figures .................................................................................................................................. vii Tables ..................................................................................................................................... ix Chapter 1 Introduction ........................................................................................................... 1 Features of dendrites ............................................................................................................ 4 Dendritic growth .................................................................................................................... 5 The molecular basis of dendrite growth ............................................................................... 9 Parallels with axon guidance ............................................................................................ 9 Dendritic guidance ......................................................................................................... 10 Intrinsic factors required for dendrite morphogenesis .................................................... 11 Partner recognition and synapse formation ................................................................... 13 Dendrites and disease ........................................................................................................ 16 Genetic screens: Drosophila melanogaster as a genetic model system ........................... 17 Drosophila screens for genes involved in nervous system development .......................... 19 A screen for genes involved in dendrite morphogenesis ................................................... 20 Chapter 2 Method development ......................................................................................... 22 Methods for visualising motor neurons in Drosophila ........................................................ 23 The GAL4/UAS system and visualisation of motor neuron dendrites ............................ 23 Development of a FLP-out system to target individual identified motor neurons .......... 24 Mosaic analysis with a repressible cell marker .............................................................. 26 The MARCM system is modified to target a subset of motor neurons .......................... 28 Assessment of different versions of modified MARCM systems ........................................ 28 Experiments using mutations known to affect dendrite development confirm the function of the modified MARCM system ............................................................................................. 40 Variations of the ‘ftz loop’ MARCM stock ........................................................................... 42 Neuroblast GAL4 drivers ................................................................................................ 42 Red fluorescence protein ............................................................................................... 43 iv Alternative GAL80 expression constructs ...................................................................... 46 Concluding remarks ............................................................................................................ 47 Chapter 3 Loss of function screen ..................................................................................... 48 Generation of a fly stock collection for FLP/FRT mediated mitotic recombination with defined chromosome 2 deficiencies ................................................................................... 49 Coverage of chromosome 2 by recombinant FRT-deficiency stocks ................................. 51 Screening chromosome 2 using the ‘ftz loop’ MARCM method and FRT-deficiency recombinants ...................................................................................................................... 63 Effects of lethality in neurons homozygous for recombinant FRT-deficiencies .................. 64 Regions of chromosome 2 that cause a motor neuron dendrite phenotype when homozygous ....................................................................................................................... 66 Df(2L)al ........................................................................................................................... 68 Df(2L)TE35BC-24 .......................................................................................................... 71 Df(2R)Np5 ...................................................................................................................... 75 Df(2R)Px2 ....................................................................................................................... 78 Bloomington stock 4101 ................................................................................................. 81 Df(2L)S2590 ................................................................................................................... 83 Chapter 4 Df(2L)S2590 ......................................................................................................... 84 Analysis of deletions overlapping with Df(2L)S2590 refines the genomic area containing candidate genes for dendritic development ........................................................................ 87 MARCM analysis of dendritic phenotypes deficiencies that overlap with Df(2L)S2590 ..... 89 Df(2L)BSC28 .................................................................................................................. 89 Df(2L)BSC162 ...............................................................................................................
Load more

Recommended publications
  • Supplementary Data
    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
    [Show full text]
  • Identification of a Novel Mutation Disrupting the DNA Binding Activity
    443 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.2004.026898 on 29 April 2005. Downloaded from Identification of a novel mutation disrupting the DNA binding activity of GCM2 in autosomal recessive familial isolated hypoparathyroidism L Baumber, C Tufarelli, S Patel, P King, C A Johnson, E R Maher, R C Trembath ............................................................................................................................... J Med Genet 2005;42:443–448. doi: 10.1136/jmg.2004.026898 ypoparathyroidism is a heterogeneous group of dis- orders with both acquired and inherited causes, each Key points Hpresenting clinically with hypocalcaemia. Familial cases of hypoparathyroidism may be due to an isolated N Hypoparathyroidism is a heterogeneous group of defect of the parathyroid glands or be a component of a disorders with both acquired and inherited causes, syndrome disorder, examples of which include DiGeorge, each presenting clinically with hypocalcaemia. hypoparathyroidism-retardation-dysmorphism, and Kenny- N Familial isolated hypoparathyroidism is characterised 1 Caffey syndrome. Familial isolated hypoparathyroidism by hypocalcaemia and hyperphosphataemia and may (FIH) is characterised by hypocalcaemia and hyperpho- be due to an inherited deficiency or the abnormal sphataemia and may be due to an inherited deficiency or activity of parathyroid hormone. the abnormal activity of parathyroid hormone (PTH). FIH is heterogeneous with X linked, autosomal dominant, and N Recently, a homozygous deletion within the human autosomal recessive modes of inheritance reported.2 GCM2 gene has been shown to underlie hypopar- Mutations in the PTH gene on chromosome 11p have been athyroidism in one patient, while other compelling described in both autosomal dominant and autosomal evidence indicates a critical role for GCM2 in normal recessive forms of the disorder.34 Mature PTH is generated parathyroid gland function.
    [Show full text]
  • The Direction of Cross Affects Obesity After Puberty in Male but Not Female
    Kärst et al. BMC Genomics (2015) 16:904 DOI 10.1186/s12864-015-2164-2 RESEARCH ARTICLE Open Access The direction of cross affects obesity after puberty in male but not female offspring Stefan Kärst1†, Danny Arends1†, Sebastian Heise1†, Jan Trost1, Marie-Laure Yaspo2, Vyacheslav Amstislavskiy2, Thomas Risch2, Hans Lehrach2 and Gudrun A. Brockmann1* Abstract Background: We investigated parent-of-origin and allele-specific expression effects on obesity and hepatic gene expression in reciprocal crosses between the Berlin Fat Mouse Inbred line (BFMI) and C57Bl/6NCrl (B6N). Results: We found that F1-males with a BFMI mother developed 1.8 times more fat mass on a high fat diet at 10 weeks than F1-males of a BFMI father. The phenotype was detectable from six weeks on and was preserved after cross-fostering. RNA-seq data of liver provided evidence for higher biosynthesis and elongation of fatty acids (p = 0.00635) in obese male offspring of a BFMI mother versus lean offspring of a BFMI father. Furthermore, fatty acid degradation (p = 0.00198) and the peroxisome pathway were impaired (p = 0.00094). The circadian rhythm was affected as well (p = 0.00087). Among the highest up-regulated protein coding genes in obese males were Acot4 (1.82 fold, p = 0.022), Cyp4a10 (1.35 fold, p = 0.026) and Cyp4a14 (1.32 fold, p = 0.012), which hydroxylize fatty acids and which are known to be increased in liver steatosis. Obese males showed lower expression of the genetically imprinted and paternally expressed 3 (Peg3) gene (0.31 fold, p = 0.046) and higher expression of the androgen receptor (Ar) gene (2.38 fold, p = 0.068).
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name glial cells missing homolog 2 (Drosophila) Gene Symbol GCM2 Organism Human Gene Summary This gene is a homolog of the Drosophila glial cells missing gene which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. Gene Aliases GCMB, hGCMb RefSeq Accession No. NC_000006.11, NG_008970.1, NT_007592.15 UniGene ID Hs.227098 Ensembl Gene ID ENSG00000124827 Entrez Gene ID 9247 Assay Information Unique Assay ID qHsaCIP0029896 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000379491 Amplicon Context Sequence ACATAGCCGTCAGGCCACTCTCGGAATTGGTCAAAGAGGGCCAGCTCCTGAGG CATCTGCGGATCGTTGATGTCCCAGCTGAGCTGCATCCCGTA Amplicon Length (bp) 65 Chromosome Location 6:10877579-10881984 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 101 R2 0.9999 cDNA Cq Target not expressed in universal RNA cDNA Tm (Celsius) Target not expressed in universal RNA Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Target not expressed in universal RNA Specificity
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • Presence and Significance of a R110W Mutation in the DNA
    European Journal of Endocrinology (2010) 162 407–421 ISSN 0804-4643 CLINICAL STUDY Presence and significance of a R110W mutation in the DNA-binding domain of GCM2 gene in patients with isolated hypoparathyroidism and their family members Neeraj Tomar1, Hema Bora2, Ratnakar Singh3, Nandita Gupta1, Punit Kaur4, Shyam Singh Chauhan3, Yagya Dutta Sharma2 and Ravinder Goswami1 Departments of 1Endocrinology and Metabolism, 2Biotechnology, 3Biochemistry and 4Biophysics, All India Institute of Medical Sciences, New Delhi 110029, India (Correspondence should be addressed to R Goswami; Email: [email protected]) Abstract Objective: Glial cells missing 2 (GCM2) gene encodes a parathyroid-specific transcription factor. We assessed GCM2 gene sequence in patients with isolated hypoparathyroidism (IH). Design: Case–control study. Methods: Complete DNA sequencing of the GCM2 gene including its exons, promoter, and 50 and 30 UTRs was performed in 24/101 patients with IH. PCR–restriction fragment length polymorphism was used to detect a novel R110W mutation in all 101 IH patients and 655 healthy controls. Significance of the mutation was assessed by electrophoretic mobility shift assay (EMSA) and nuclear localization on transfection. Results: A heterozygous R110W mutation was present in DNA-binding domain in 11/101 patients (10.9%) and absent in 655 controls (P!10K7). Four of 13 nonaffected first-degree relatives for five of these index cases had R110W mutation. Four heterozygous single nucleotide polymorphisms were found in the 50 region. One of the 11 patients with R110W also had T370M change in compound heterozygous form. Mutant R110W and T370M GCM2 proteins showed decreased binding with GCM recognition elements on EMSA indicating loss of function.
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • Comparative Transcriptomics Reveals Similarities and Differences
    Seifert et al. BMC Cancer (2015) 15:952 DOI 10.1186/s12885-015-1939-9 RESEARCH ARTICLE Open Access Comparative transcriptomics reveals similarities and differences between astrocytoma grades Michael Seifert1,2,5*, Martin Garbe1, Betty Friedrich1,3, Michel Mittelbronn4 and Barbara Klink5,6,7 Abstract Background: Astrocytomas are the most common primary brain tumors distinguished into four histological grades. Molecular analyses of individual astrocytoma grades have revealed detailed insights into genetic, transcriptomic and epigenetic alterations. This provides an excellent basis to identify similarities and differences between astrocytoma grades. Methods: We utilized public omics data of all four astrocytoma grades focusing on pilocytic astrocytomas (PA I), diffuse astrocytomas (AS II), anaplastic astrocytomas (AS III) and glioblastomas (GBM IV) to identify similarities and differences using well-established bioinformatics and systems biology approaches. We further validated the expression and localization of Ang2 involved in angiogenesis using immunohistochemistry. Results: Our analyses show similarities and differences between astrocytoma grades at the level of individual genes, signaling pathways and regulatory networks. We identified many differentially expressed genes that were either exclusively observed in a specific astrocytoma grade or commonly affected in specific subsets of astrocytoma grades in comparison to normal brain. Further, the number of differentially expressed genes generally increased with the astrocytoma grade with one major exception. The cytokine receptor pathway showed nearly the same number of differentially expressed genes in PA I and GBM IV and was further characterized by a significant overlap of commonly altered genes and an exclusive enrichment of overexpressed cancer genes in GBM IV. Additional analyses revealed a strong exclusive overexpression of CX3CL1 (fractalkine) and its receptor CX3CR1 in PA I possibly contributing to the absence of invasive growth.
    [Show full text]
  • Supplemetary Table 2. List of Genes Down-Regulated in LPAR6 Knocked Down Cells
    Supplemetary Table 2. List of genes down-regulated in LPAR6 knocked down cells g# initial alias c# converted alias name description namespace 1 NM_002317.5 1.1 ENSG00000113083 LOX lysyl oxidase [Source:HGNC Symbol;Acc:6664] REFSEQ_MRNA 2 NM_006183.4 2.1 ENSG00000133636 NTS neurotensin [Source:HGNC Symbol;Acc:8038] REFSEQ_MRNA 3 NM_005213.3 3.1 ENSG00000121552 CSTA cystatin A (stefin A) [Source:HGNC Symbol;Acc:2481] REFSEQ_MRNA 4 NM_007231.3 4.1 ENSG00000087916 SLC6A14 solute carrier family 6 (amino acid transporter), member 14 [Source:HGNC Symbol;Acc:11047] REFSEQ_MRNA 5 NM_001873.2 5.1 ENSG00000109472 CPE carboxypeptidase E [Source:HGNC Symbol;Acc:2303] REFSEQ_MRNA 6 NM_019856.1 6.1 ENSG00000101605 MYOM1 myomesin 1, 185kDa [Source:HGNC Symbol;Acc:7613] REFSEQ_MRNA 7 NM_032590.4 7.1 ENSG00000089094 KDM2B lysine (K)-specific demethylase 2B [Source:HGNC Symbol;Acc:13610] REFSEQ_MRNA 8 NM_001901.2 8.1 ENSG00000118523 CTGF connective tissue growth factor [Source:HGNC Symbol;Acc:2500] REFSEQ_MRNA 9 NM_007183.2 9.1 ENSG00000184363 PKP3 plakophilin 3 [Source:HGNC Symbol;Acc:9025] REFSEQ_MRNA 10 NM_182965.2 10.1 ENSG00000176170 SPHK1 sphingosine kinase 1 [Source:HGNC Symbol;Acc:11240] REFSEQ_MRNA 11 NM_152423.4 11.1 ENSG00000157502 MUM1L1 melanoma associated antigen (mutated) 1-like 1 [Source:HGNC Symbol;Acc:26583] REFSEQ_MRNA 12 NM_002923.3 12.1 ENSG00000116741 RGS2 regulator of G-protein signaling 2, 24kDa [Source:HGNC Symbol;Acc:9998] REFSEQ_MRNA 13 NR_003038.2 13.1 N/A N/A N/A N/A 14 NM_080862.1 14.1 ENSG00000175093 SPSB4 splA/ryanodine receptor
    [Show full text]
  • REVIEW Mouse Models for Inherited Endocrine and Metabolic Disorders
    211 REVIEW Mouse models for inherited endocrine and metabolic disorders Siaˆn E Piret and Rajesh V Thakker Academic Endocrine Unit, Oxford Centre for Diabetes, Endocrinology and Metabolism, Churchill Hospital, University of Oxford, Headington, Oxford OX3 7LJ, UK (Correspondence should be addressed to R V Thakker; Email: [email protected]) Abstract In vivo models represent important resources for investigating mutagenesis; conventional, conditional and inducible knock- the physiological mechanisms underlying endocrine and out models; knockin models and transgenic models, and these metabolic disorders, and for pre-clinical translational studies strategies are often complementary. This review describes that may include the assessments of new treatments. In the some of the different strategies that are utilised for generating study of endocrine diseases, which affect multiple organs, mouse models. In addition, some mouse models that have in vivo models provide specific advantages over in vitro models, been successfully generated by these methods for some which are limited to investigation of isolated systems. In human hereditary endocrine and metabolic disorders are recent years, the mouse has become the popular choice for reviewed. In particular, the mouse models generated for developing such in vivo mammalian models, as it has a genome parathyroid disorders, which include: the multiple endocrine that shares w85% identity to that of man, and has many neoplasias; hyperparathyroidism-jaw tumour syndrome; physiological systems that are similar to those in man. disorders of the calcium-sensing receptor and forms of Moreover, methods have been developed to alter the inherited hypoparathyroidism are discussed. The advances expression of genes in the mouse, thereby generating models that have been made in our understanding of the mechanisms for human diseases, which may be due to loss- or gain- of these human diseases by investigations of these mouse of-function mutations.
    [Show full text]