DOCSLIB.ORG

Ii. Runx1-Eto

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ii. Runx1-Eto %NVUEDELOBTENTIONDU %0$503"5%&-6/*7&34*5² %&506-064& $ÏLIVRÏPAR Université Toulouse III Paul Sabatier (UT3 Paul Sabatier) $ISCIPLINEOUSPÏCIALITÏ Gènes, Cellules et Développement 0RÏSENTÏEETSOUTENUEPAR Stéphanie BRAS LE vendredi 8 juin 2012 4ITRE Etude des fonctions normales et pathologiques des facteurs de transcription de type RUNX au cours de l’hématopoïèse chez Drosophila melanogaster. %COLEDOCTORALE Biologie, Santé, Biotechnologies (BSB) 5NITÏDERECHERCHE Centre de Biologie du développement, CNRS UMR 5547 $IRECTEURS DE4HÒSE Dr. Lucas Waltzer Dr. Marc Haenlin 2APPORTEURS Dr. Marie Meister Dr. Georges Lacaud MEMBRES DUJURY: Pr David Cribbs, président Dr. Marie Meister, rapportrice Dr. Georges Lacaud, rapporteur Dr. Estelle Duprez, examinatrice Dr. Lucas Waltzer, directeur de thèse Dr. Marc Haenlin, directeur de thèse Je voudrais tout d’abord remercier les membres du jury : David Cribbs, Georges Lacaud, Marie Meister et Estelle Duprez qui ont accepté de lire et de juger mes travaux de thèse. Je remercie également mes deux directeurs de thèse, Lucas et Marc pour ces six ans passés au sein de leur équipe. Et oui, je n’étais pas rassasiée de mes deux années de master passée dans votre équipe, il a fallu que je m’accroche encore 4ans pour faire ma thèse dans votre équipe ! Ma première pensée va vers Lucas : Merci Lucas pour toutes ces discussions qui m’ont permis de me recentrer sur les questions essentielles à des moments où les résultats n’étaient pas des plus clairs. Tu m’as soutenu. Tu as été toujours plus disponible au fil des années pour m’encadrer et me permettre de mener à bien mes deux projets de thèse. Même si parfois la réussite n’était pas évidente, tu as su croire en mes résultats et en ma capacité à rebondir et grâce à ton soutien je suis arrivée au bout de cette folle aventure ! Au fil des années que j’ai passé dans ton équipe, j’ai beaucoup appris à tes côtés, aussi bien scientifiquement que humainement ; Encore merci pour tout Lucas, c’est un bien faible mot pour exprimé à quel point je te suis reconnaissante mais tu l’auras compris je ne suis pas la meilleure pour les remerciements ! Je remercie également notre cher directeur qui est aussi mon directeur de thèse, Marc, fantaisiste mais tellement philosophe. Avec toi les discussions sont toujours très riche et tu m’as permis de voir la science avec un autre regard ! Je tiens également à remercier tous les membres de l’équipe Waltzer/Haenlin, ceux d’hier et d’aujourd’hui. Merci Benoit pour le soutien que tu m’as témoigné depuis le jour où j’ai mis les pieds dans notre cher labo. Merci de ta présence, de ton soutien technique exceptionnel, de ta joie de vivre et pour toutes les blagues et les parties de rigolades qu’on a pu avoir au cours de ces 6années. Je crois que je ne t’ai jamais assez remercié pour toutes les attentions et le soutien que tu as pu me donner. Ces quelques mots sont bien faibles compte tenu de tout ce que tu as pu m’apporter durant ma thèse. Sincèrement, Merci Benoit. Je voulais aussi remercier Assia, avec qui j’ai passé de super moment au labo. Grâce à ton sourire quotidien, tu m’as fait retrouvé le mien à bien des reprises. Merci de ton soutien, de ta bonne humeur permanente. Tu es partie vers de nouveaux horizons maintenant, mais tu resteras toujours ma Boudinette préférée ! Bien sûr je tiens à remercier notre grand thésard, Bilel ou notre glandeur pour les intimes ! Très discret et réservé au début, j’ai appris à te connaître et j’ai découvert une personne sincère, drôle et en somme une personne exceptionnelle ! Je te remercie pour ta bonne humeur, tes blagues toujours bien placées et ton sens du partage ! Bilel, tu es formidable, ne change pas : tu vas devenir un grand scientifique !! Bon courage pour la suite… Bien sûr je remercie également Vanessa, pour m’avoir fait progresser sur bien des points durant ma thèse ; Osman, pour ta bonne humeur et ta simplicité : je n’ai pas eu le temps de bien te connaître mais ton arrivée au labo a été bénéfique pour l’ambiance musicale durant nos manip du lundi matin !!! Fernando, pour ta présence bien que discrète à mes côtés mais pour tes conseils toujours avisés qui m’ont permis de recentrer mon attention. Merci pour ton regard critique mais toujours valorisant sur mon travail. J’ai aussi une attention envers Marion, notre nouvelle thésard, arrivée depuis peu au labo et que je n’aurai pu que croiser durant cette dernière année. Bien que je n’ai pas pu passé trop de temps à tes côtés, j’ai découvert une personne généreuse, très sympathique et joyeuse : bon courage pour ta thèse Marion, ne lâche jamais rien, et je sais que tu vas faire une super thèse !! Ces remerciements n’auraient pas de sens si je ne remerciais pas notre Dani international !! Et oui Dani, c’est en fait grâce à toi que j’ai pu arriver jusque là. Après une année en tant que stagiaire à tes côtés, où oui je l’avoue je t’en ai fait baver : entre mes blagues fouareuses, mon sale caractère et ma naïveté scientifique…. Tu m’as tout de même soutenu comme un frère, un ami et un maitre de stage !! Grâce à toi j’ai progresser pour arriver à passer le cap du master et obtenir mon concours qui n’était pas gagné d’avance : Tu m’as soutenu quotidiennement, parfois à la limite du harcèlement scientifique, mais je ne te remercierai jamais assez pour tout ça ! Tu es parti très vite ensuite vers la Suisse avec ta petite famille mais malgré la distance, ton soutien est resté entier et tu resteras mon modèle scientifique !!!! MERCI de tout cœur Dani ! Bien sûr, je ne peux oublier de remercier Cédric pour sa présence à mes côtés durant ces 4ans de thèse : pour ta bonne humeur, ton soutien et ton réconfort plus que précieux ! C’est court mais je ne trouve pas de mot assez fort pour t’exprimer au combien je suis touché par ton soutien durant ma thèse. C’est aussi tout naturellement que mes pensées vont maintenant vers Julie, ma tutrice de thèse. Et là, les mots sont encore moins faciles à trouver pour exprimer toute ma reconnaissance…..Pour moi, ça a été une révélation : tu m’as soutenu sans limites au moment les plus difficiles de ma thèse, grâce à ton énergie débordante et à ta présence quotidienne, tu m’as fait relativiser et grâce à toi j’ai toujours pu avancer encore plus loin….Tu as une joie de vivre communicative et un sens de la vie exceptionnel : Plus qu’une tutrice de thèse, tu es devenue mon allier indispensable durant ces dernières années. Merci pour tout Julie ! Bien évidemment je ne pourrais pas terminer ces remerciements sans penser à mon allier de tous les jours, depuis les pauses tisanes jusqu’aux discussions philosophiques….Et oui Yacine, effusif souvent mais toujours tellement généreux, attentionné et énormément adorable : j’ai appris à te connaître durant ces années et j’ai découvert que tu étais une personne exceptionnellement gentille, dévouée et intelligente. A tes côtés, j’ai appris à relativiser et un nouveau mode de vie : le mode toile cirée !!! Merci pour tout Yac’ ! Je remercie aussi mes autres accolites de M2R, Hadi (alias Jacques), Tim, Lisa, Magalie et les autres pour cette année de fou rire. J’ai également une pensée pour l’ensemble des membres du CBD, les thésards, avec une mention spéciale à Laurence qui m’a supporté pendant 15jours à Shéffield !! Je terminerai ces remerciements en remerciant de tout cœur ma famille et mes amis qui m’ont soutenus, écoutés et surtout supportés durant ces années pleines de rebondissement… Malgré la distance qui nous séparait, mes parents ont toujours su trouver les mots pour me pousser toujours plus loin : je leur dois ma réussite ! Bien sûr, mon remerciement le plus émus se dirige vers celui qui m’a supporté au quotidien (dans tous les sens du terme) : Jérôme !!!! Tu as été présent à chaque minute de ma thèse et tu as vu les facettes les plus cachées de mon caractère, mais tu as toujours été là : un simple merci n’est pas suffisant, mais tu sais à quel point je te suis reconnaissante ! -SOMMAIRE- SOMMAIRE A CA@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ G @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ L @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@GF @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@GI @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@GK @ B @@@@@@@@@@@@@@@@@@@@@@@@@@@@@GL G@ &,'!&1+-+/+,1%"2%,'('32,#)- @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@GL H@ +*#(,#'&+# 2*&,+$#!&!+"2%,'('32,#)-+,$-*+ '&,#'&+@@@@@@@@@@@@GM I@ +$-2%#+ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@GO " """"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""" &- " """""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""'% " """""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""'& " """""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""'& @ G @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@HI G@ G?-&%%* %#$$ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@HI
Load more

Recommended publications
  • Identification of a Novel Mutation Disrupting the DNA Binding Activity
    443 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.2004.026898 on 29 April 2005. Downloaded from Identification of a novel mutation disrupting the DNA binding activity of GCM2 in autosomal recessive familial isolated hypoparathyroidism L Baumber, C Tufarelli, S Patel, P King, C A Johnson, E R Maher, R C Trembath ............................................................................................................................... J Med Genet 2005;42:443–448. doi: 10.1136/jmg.2004.026898 ypoparathyroidism is a heterogeneous group of dis- orders with both acquired and inherited causes, each Key points Hpresenting clinically with hypocalcaemia. Familial cases of hypoparathyroidism may be due to an isolated N Hypoparathyroidism is a heterogeneous group of defect of the parathyroid glands or be a component of a disorders with both acquired and inherited causes, syndrome disorder, examples of which include DiGeorge, each presenting clinically with hypocalcaemia. hypoparathyroidism-retardation-dysmorphism, and Kenny- N Familial isolated hypoparathyroidism is characterised 1 Caffey syndrome. Familial isolated hypoparathyroidism by hypocalcaemia and hyperphosphataemia and may (FIH) is characterised by hypocalcaemia and hyperpho- be due to an inherited deficiency or the abnormal sphataemia and may be due to an inherited deficiency or activity of parathyroid hormone. the abnormal activity of parathyroid hormone (PTH). FIH is heterogeneous with X linked, autosomal dominant, and N Recently, a homozygous deletion within the human autosomal recessive modes of inheritance reported.2 GCM2 gene has been shown to underlie hypopar- Mutations in the PTH gene on chromosome 11p have been athyroidism in one patient, while other compelling described in both autosomal dominant and autosomal evidence indicates a critical role for GCM2 in normal recessive forms of the disorder.34 Mature PTH is generated parathyroid gland function.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Study of the G Protein Nucleolar 2 Value in Liver Hepatocellular Carcinoma Treatment and Prognosis
    Hindawi BioMed Research International Volume 2021, Article ID 4873678, 12 pages https://doi.org/10.1155/2021/4873678 Research Article Study of the G Protein Nucleolar 2 Value in Liver Hepatocellular Carcinoma Treatment and Prognosis Yiwei Dong,1 Qianqian Cai,2 Lisheng Fu,1 Haojie Liu,1 Mingzhe Ma,3 and Xingzhong Wu 1 1Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, Key Lab of Glycoconjugate Research, Ministry of Public Health, Shanghai 200032, China 2Shanghai Key Laboratory of Molecular Imaging, Shanghai University of Medicine and Health Sciences, Shanghai 201318, China 3Department of Gastric Surgery, Fudan University Shanghai Cancer Center, Shanghai 200025, China Correspondence should be addressed to Xingzhong Wu; [email protected] Received 10 May 2021; Accepted 29 June 2021; Published 20 July 2021 Academic Editor: Tao Huang Copyright © 2021 Yiwei Dong et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. LIHC (liver hepatocellular carcinoma) mostly occurs in patients with chronic liver disease. It is primarily induced by a vicious cycle of liver injury, inflammation, and regeneration that usually last for decades. The G protein nucleolar 2 (GNL2), as a protein- encoding gene, is also known as NGP1, Nog2, Nug2, Ngp-1, and HUMAUANTIG. Few reports are shown towards the specific biological function of GNL2. Meanwhile, it is still unclear whether it is related to the pathogenesis of carcinoma up to date. Here, our study attempts to validate the role and function of GNL2 in LIHC via multiple databases and functional assays.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name glial cells missing homolog 2 (Drosophila) Gene Symbol GCM2 Organism Human Gene Summary This gene is a homolog of the Drosophila glial cells missing gene which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. Gene Aliases GCMB, hGCMb RefSeq Accession No. NC_000006.11, NG_008970.1, NT_007592.15 UniGene ID Hs.227098 Ensembl Gene ID ENSG00000124827 Entrez Gene ID 9247 Assay Information Unique Assay ID qHsaCIP0029896 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000379491 Amplicon Context Sequence ACATAGCCGTCAGGCCACTCTCGGAATTGGTCAAAGAGGGCCAGCTCCTGAGG CATCTGCGGATCGTTGATGTCCCAGCTGAGCTGCATCCCGTA Amplicon Length (bp) 65 Chromosome Location 6:10877579-10881984 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 101 R2 0.9999 cDNA Cq Target not expressed in universal RNA cDNA Tm (Celsius) Target not expressed in universal RNA Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Target not expressed in universal RNA Specificity
    [Show full text]
  • Proteomics Provides Insights Into the Inhibition of Chinese Hamster V79
    www.nature.com/scientificreports OPEN Proteomics provides insights into the inhibition of Chinese hamster V79 cell proliferation in the deep underground environment Jifeng Liu1,2, Tengfei Ma1,2, Mingzhong Gao3, Yilin Liu4, Jun Liu1, Shichao Wang2, Yike Xie2, Ling Wang2, Juan Cheng2, Shixi Liu1*, Jian Zou1,2*, Jiang Wu2, Weimin Li2 & Heping Xie2,3,5 As resources in the shallow depths of the earth exhausted, people will spend extended periods of time in the deep underground space. However, little is known about the deep underground environment afecting the health of organisms. Hence, we established both deep underground laboratory (DUGL) and above ground laboratory (AGL) to investigate the efect of environmental factors on organisms. Six environmental parameters were monitored in the DUGL and AGL. Growth curves were recorded and tandem mass tag (TMT) proteomics analysis were performed to explore the proliferative ability and diferentially abundant proteins (DAPs) in V79 cells (a cell line widely used in biological study in DUGLs) cultured in the DUGL and AGL. Parallel Reaction Monitoring was conducted to verify the TMT results. γ ray dose rate showed the most detectable diference between the two laboratories, whereby γ ray dose rate was signifcantly lower in the DUGL compared to the AGL. V79 cell proliferation was slower in the DUGL. Quantitative proteomics detected 980 DAPs (absolute fold change ≥ 1.2, p < 0.05) between V79 cells cultured in the DUGL and AGL. Of these, 576 proteins were up-regulated and 404 proteins were down-regulated in V79 cells cultured in the DUGL. KEGG pathway analysis revealed that seven pathways (e.g.
    [Show full text]
  • Presence and Significance of a R110W Mutation in the DNA
    European Journal of Endocrinology (2010) 162 407–421 ISSN 0804-4643 CLINICAL STUDY Presence and significance of a R110W mutation in the DNA-binding domain of GCM2 gene in patients with isolated hypoparathyroidism and their family members Neeraj Tomar1, Hema Bora2, Ratnakar Singh3, Nandita Gupta1, Punit Kaur4, Shyam Singh Chauhan3, Yagya Dutta Sharma2 and Ravinder Goswami1 Departments of 1Endocrinology and Metabolism, 2Biotechnology, 3Biochemistry and 4Biophysics, All India Institute of Medical Sciences, New Delhi 110029, India (Correspondence should be addressed to R Goswami; Email: [email protected]) Abstract Objective: Glial cells missing 2 (GCM2) gene encodes a parathyroid-specific transcription factor. We assessed GCM2 gene sequence in patients with isolated hypoparathyroidism (IH). Design: Case–control study. Methods: Complete DNA sequencing of the GCM2 gene including its exons, promoter, and 50 and 30 UTRs was performed in 24/101 patients with IH. PCR–restriction fragment length polymorphism was used to detect a novel R110W mutation in all 101 IH patients and 655 healthy controls. Significance of the mutation was assessed by electrophoretic mobility shift assay (EMSA) and nuclear localization on transfection. Results: A heterozygous R110W mutation was present in DNA-binding domain in 11/101 patients (10.9%) and absent in 655 controls (P!10K7). Four of 13 nonaffected first-degree relatives for five of these index cases had R110W mutation. Four heterozygous single nucleotide polymorphisms were found in the 50 region. One of the 11 patients with R110W also had T370M change in compound heterozygous form. Mutant R110W and T370M GCM2 proteins showed decreased binding with GCM recognition elements on EMSA indicating loss of function.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Supplementary Table 3: Genes Only Influenced By
    Supplementary Table 3: Genes only influenced by X10 Illumina ID Gene ID Entrez Gene Name Fold change compared to vehicle 1810058M03RIK -1.104 2210008F06RIK 1.090 2310005E10RIK -1.175 2610016F04RIK 1.081 2610029K11RIK 1.130 381484 Gm5150 predicted gene 5150 -1.230 4833425P12RIK -1.127 4933412E12RIK -1.333 6030458P06RIK -1.131 6430550H21RIK 1.073 6530401D06RIK 1.229 9030607L17RIK -1.122 A330043C08RIK 1.113 A330043L12 1.054 A530092L01RIK -1.069 A630054D14 1.072 A630097D09RIK -1.102 AA409316 FAM83H family with sequence similarity 83, member H 1.142 AAAS AAAS achalasia, adrenocortical insufficiency, alacrimia 1.144 ACADL ACADL acyl-CoA dehydrogenase, long chain -1.135 ACOT1 ACOT1 acyl-CoA thioesterase 1 -1.191 ADAMTSL5 ADAMTSL5 ADAMTS-like 5 1.210 AFG3L2 AFG3L2 AFG3 ATPase family gene 3-like 2 (S. cerevisiae) 1.212 AI256775 RFESD Rieske (Fe-S) domain containing 1.134 Lipo1 (includes AI747699 others) lipase, member O2 -1.083 AKAP8L AKAP8L A kinase (PRKA) anchor protein 8-like -1.263 AKR7A5 -1.225 AMBP AMBP alpha-1-microglobulin/bikunin precursor 1.074 ANAPC2 ANAPC2 anaphase promoting complex subunit 2 -1.134 ANKRD1 ANKRD1 ankyrin repeat domain 1 (cardiac muscle) 1.314 APOA1 APOA1 apolipoprotein A-I -1.086 ARHGAP26 ARHGAP26 Rho GTPase activating protein 26 -1.083 ARL5A ARL5A ADP-ribosylation factor-like 5A -1.212 ARMC3 ARMC3 armadillo repeat containing 3 -1.077 ARPC5 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa -1.190 activating transcription factor 4 (tax-responsive enhancer element ATF4 ATF4 B67) 1.481 AU014645 NCBP1 nuclear cap
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • REVIEW Mouse Models for Inherited Endocrine and Metabolic Disorders
    211 REVIEW Mouse models for inherited endocrine and metabolic disorders Siaˆn E Piret and Rajesh V Thakker Academic Endocrine Unit, Oxford Centre for Diabetes, Endocrinology and Metabolism, Churchill Hospital, University of Oxford, Headington, Oxford OX3 7LJ, UK (Correspondence should be addressed to R V Thakker; Email: [email protected]) Abstract In vivo models represent important resources for investigating mutagenesis; conventional, conditional and inducible knock- the physiological mechanisms underlying endocrine and out models; knockin models and transgenic models, and these metabolic disorders, and for pre-clinical translational studies strategies are often complementary. This review describes that may include the assessments of new treatments. In the some of the different strategies that are utilised for generating study of endocrine diseases, which affect multiple organs, mouse models. In addition, some mouse models that have in vivo models provide specific advantages over in vitro models, been successfully generated by these methods for some which are limited to investigation of isolated systems. In human hereditary endocrine and metabolic disorders are recent years, the mouse has become the popular choice for reviewed. In particular, the mouse models generated for developing such in vivo mammalian models, as it has a genome parathyroid disorders, which include: the multiple endocrine that shares w85% identity to that of man, and has many neoplasias; hyperparathyroidism-jaw tumour syndrome; physiological systems that are similar to those in man. disorders of the calcium-sensing receptor and forms of Moreover, methods have been developed to alter the inherited hypoparathyroidism are discussed. The advances expression of genes in the mouse, thereby generating models that have been made in our understanding of the mechanisms for human diseases, which may be due to loss- or gain- of these human diseases by investigations of these mouse of-function mutations.
    [Show full text]
  • Genetic Testing in Inherited Endocrine Disorders
    Eggermann et al. Orphanet Journal of Rare Diseases (2020) 15:144 https://doi.org/10.1186/s13023-020-01420-w REVIEW Open Access Genetic testing in inherited endocrine disorders: joint position paper of the European reference network on rare endocrine conditions (Endo-ERN) Thomas Eggermann1* , Miriam Elbracht1, Ingo Kurth1, Anders Juul2,3, Trine Holm Johannsen2,3, Irène Netchine4, George Mastorakos5, Gudmundur Johannsson6, Thomas J. Musholt7, Martin Zenker8, Dirk Prawitt9, Alberto M. Pereira10, Olaf Hiort11 and on behalf of the European Reference Network on Rare Endocrine Conditions (ENDO-ERN Abstract Background: With the development of molecular high-throughput assays (i.e. next generation sequencing), the knowledge on the contribution of genetic and epigenetic alterations to the etiology of inherited endocrine disorders has massively expanded. However, the rapid implementation of these new molecular tools in the diagnostic settings makes the interpretation of diagnostic data increasingly complex. Main body: This joint paper of the ENDO-ERN members aims to overview chances, challenges, limitations and relevance of comprehensive genetic diagnostic testing in rare endocrine conditions in order to achieve an early molecular diagnosis. This early diagnosis of a genetically based endocrine disorder contributes to a precise management and helps the patients and their families in their self-determined planning of life. Furthermore, the identification of a causative (epi)genetic alteration allows an accurate prognosis of recurrence risks for family planning as the basis of genetic counselling. Asymptomatic carriers of pathogenic variants can be identified, and prenatal testing might be offered, where appropriate. Conclusions: The decision on genetic testing in the diagnostic workup of endocrine disorders should be based on their appropriateness to reliably detect the disease-causing and –modifying mutation, their informational value, and cost-effectiveness.
    [Show full text]
  • Functional Conservation of the Glide/Gcm Regulatory Network Controlling Glia, Hemocyte, and Tendon Cell Differentiation in Drosophila
    | INVESTIGATION Functional Conservation of the Glide/Gcm Regulatory Network Controlling Glia, Hemocyte, and Tendon Cell Differentiation in Drosophila Pierre B. Cattenoz,*,†,‡,§ Anna Popkova,*,†,‡,§,1 Tony D. Southall,**,2 Giuseppe Aiello,*,†,‡,§ Andrea H. Brand,** and Angela Giangrande*,†,‡,§,3 *Department of Functional Genomics and Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire and †Centre National de la Recherche Scientifique (CNRS), UMR7104, F-67404 Illkirch Cedex, France, ‡Institut National de la Santé et de la Recherche Médicale (INSERM), U964, F-67404 Illkirch Cedex, France, §Université de Strasbourg, F-67404 Illkirch, France, and **Gurdon Institute and Department of Physiology, Development and Neuroscience, University of Cambridge, United Kingdom CB2 1QN ABSTRACT High-throughput screens allow us to understand how transcription factors trigger developmental processes, including cell specification. A major challenge is identification of their binding sites because feedback loops and homeostatic interactions may mask the direct impact of those factors in transcriptome analyses. Moreover, this approach dissects the downstream signaling cascades and facilitates identification of conserved transcriptional programs. Here we show the results and the validation of a DNA adenine methyltransferase identification (DamID) genome-wide screen that identifies the direct targets of Glide/Gcm, a potent transcription factor that controls glia, hemocyte, and tendon cell differentiation in Drosophila. The screen identifies many genes that had not been previously associated with Glide/Gcm and highlights three major signaling pathways interacting with Glide/Gcm: Notch, Hedgehog, and JAK/STAT, which all involve feedback loops. Furthermore, the screen identifies effector molecules that are necessary for cell-cell interactions during late developmental processes and/or in ontogeny.
    [Show full text]