Downloaded, Preprocessed and Analysed Case-Control Gene Expression Datasets from Gene Ex- Pression Omnibus (GEO)
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
- 
												  Identification of the Binding Partners for Hspb2 and Cryab RevealsBrigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
- 
												  A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes MellitusPage 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
- 
												  Study of the G Protein Nucleolar 2 Value in Liver Hepatocellular Carcinoma Treatment and PrognosisHindawi BioMed Research International Volume 2021, Article ID 4873678, 12 pages https://doi.org/10.1155/2021/4873678 Research Article Study of the G Protein Nucleolar 2 Value in Liver Hepatocellular Carcinoma Treatment and Prognosis Yiwei Dong,1 Qianqian Cai,2 Lisheng Fu,1 Haojie Liu,1 Mingzhe Ma,3 and Xingzhong Wu 1 1Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, Key Lab of Glycoconjugate Research, Ministry of Public Health, Shanghai 200032, China 2Shanghai Key Laboratory of Molecular Imaging, Shanghai University of Medicine and Health Sciences, Shanghai 201318, China 3Department of Gastric Surgery, Fudan University Shanghai Cancer Center, Shanghai 200025, China Correspondence should be addressed to Xingzhong Wu; [email protected] Received 10 May 2021; Accepted 29 June 2021; Published 20 July 2021 Academic Editor: Tao Huang Copyright © 2021 Yiwei Dong et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. LIHC (liver hepatocellular carcinoma) mostly occurs in patients with chronic liver disease. It is primarily induced by a vicious cycle of liver injury, inflammation, and regeneration that usually last for decades. The G protein nucleolar 2 (GNL2), as a protein- encoding gene, is also known as NGP1, Nog2, Nug2, Ngp-1, and HUMAUANTIG. Few reports are shown towards the specific biological function of GNL2. Meanwhile, it is still unclear whether it is related to the pathogenesis of carcinoma up to date. Here, our study attempts to validate the role and function of GNL2 in LIHC via multiple databases and functional assays.
- 
												  Proteomics Provides Insights Into the Inhibition of Chinese Hamster V79www.nature.com/scientificreports OPEN Proteomics provides insights into the inhibition of Chinese hamster V79 cell proliferation in the deep underground environment Jifeng Liu1,2, Tengfei Ma1,2, Mingzhong Gao3, Yilin Liu4, Jun Liu1, Shichao Wang2, Yike Xie2, Ling Wang2, Juan Cheng2, Shixi Liu1*, Jian Zou1,2*, Jiang Wu2, Weimin Li2 & Heping Xie2,3,5 As resources in the shallow depths of the earth exhausted, people will spend extended periods of time in the deep underground space. However, little is known about the deep underground environment afecting the health of organisms. Hence, we established both deep underground laboratory (DUGL) and above ground laboratory (AGL) to investigate the efect of environmental factors on organisms. Six environmental parameters were monitored in the DUGL and AGL. Growth curves were recorded and tandem mass tag (TMT) proteomics analysis were performed to explore the proliferative ability and diferentially abundant proteins (DAPs) in V79 cells (a cell line widely used in biological study in DUGLs) cultured in the DUGL and AGL. Parallel Reaction Monitoring was conducted to verify the TMT results. γ ray dose rate showed the most detectable diference between the two laboratories, whereby γ ray dose rate was signifcantly lower in the DUGL compared to the AGL. V79 cell proliferation was slower in the DUGL. Quantitative proteomics detected 980 DAPs (absolute fold change ≥ 1.2, p < 0.05) between V79 cells cultured in the DUGL and AGL. Of these, 576 proteins were up-regulated and 404 proteins were down-regulated in V79 cells cultured in the DUGL. KEGG pathway analysis revealed that seven pathways (e.g.
- 
												  Ingenuity Pathway Analysis of Differentially Expressed Genes Involved in Signaling Pathways and Molecular Networks in Rhoe Gene‑Edited CardiomyocytesINTERNATIONAL JOURNAL OF MOleCular meDICine 46: 1225-1238, 2020 Ingenuity pathway analysis of differentially expressed genes involved in signaling pathways and molecular networks in RhoE gene‑edited cardiomyocytes ZHONGMING SHAO1*, KEKE WANG1*, SHUYA ZHANG2, JIANLING YUAN1, XIAOMING LIAO1, CAIXIA WU1, YUAN ZOU1, YANPING HA1, ZHIHUA SHEN1, JUNLI GUO2 and WEI JIE1,2 1Department of Pathology, School of Basic Medicine Sciences, Guangdong Medical University, Zhanjiang, Guangdong 524023; 2Hainan Provincial Key Laboratory for Tropical Cardiovascular Diseases Research and Key Laboratory of Emergency and Trauma of Ministry of Education, Institute of Cardiovascular Research of The First Affiliated Hospital, Hainan Medical University, Haikou, Hainan 571199, P.R. China Received January 7, 2020; Accepted May 20, 2020 DOI: 10.3892/ijmm.2020.4661 Abstract. RhoE/Rnd3 is an atypical member of the Rho super- injury and abnormalities, cell‑to‑cell signaling and interaction, family of proteins, However, the global biological function and molecular transport. In addition, 885 upstream regulators profile of this protein remains unsolved. In the present study, a were enriched, including 59 molecules that were predicated RhoE‑knockout H9C2 cardiomyocyte cell line was established to be strongly activated (Z‑score >2) and 60 molecules that using CRISPR/Cas9 technology, following which differentially were predicated to be significantly inhibited (Z‑scores <‑2). In expressed genes (DEGs) between the knockout and wild‑type particular, 33 regulatory effects and 25 networks were revealed cell lines were screened using whole genome expression gene to be associated with the DEGs. Among them, the most signifi- chips. A total of 829 DEGs, including 417 upregulated and cant regulatory effects were ‘adhesion of endothelial cells’ and 412 downregulated, were identified using the threshold of ‘recruitment of myeloid cells’ and the top network was ‘neuro- fold changes ≥1.2 and P<0.05.
- 
												  Low Abundance of the Matrix Arm of Complex I in Mitochondria Predicts Longevity in MiceARTICLE Received 24 Jan 2014 | Accepted 9 Apr 2014 | Published 12 May 2014 DOI: 10.1038/ncomms4837 OPEN Low abundance of the matrix arm of complex I in mitochondria predicts longevity in mice Satomi Miwa1, Howsun Jow2, Karen Baty3, Amy Johnson1, Rafal Czapiewski1, Gabriele Saretzki1, Achim Treumann3 & Thomas von Zglinicki1 Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence approach, we demonstrate that electron transport chain proteins, especially the matrix arm subunits of complex I, are decreased in young long-living mice, which is associated with improved complex I assembly, higher complex I-linked state 3 oxygen consumption rates and decreased superoxide production, whereas the opposite is seen in old mice. Disruption of complex I assembly reduces oxidative metabolism with concomitant increase in mitochondrial superoxide production. This is rescued by knockdown of the mitochondrial chaperone, prohibitin. Disrupted complex I assembly causes premature senescence in primary cells. We propose that lower abundance of free catalytic complex I components supports complex I assembly, efficacy of substrate utilization and minimal ROS production, enabling enhanced longevity. 1 Institute for Ageing and Health, Newcastle University, Newcastle upon Tyne NE4 5PL, UK. 2 Centre for Integrated Systems Biology of Ageing and Nutrition, Newcastle University, Newcastle upon Tyne NE4 5PL, UK. 3 Newcastle University Protein and Proteome Analysis, Devonshire Building, Devonshire Terrace, Newcastle upon Tyne NE1 7RU, UK. Correspondence and requests for materials should be addressed to T.v.Z.
- 
												  Noelia Díaz BlancoEffects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
- 
												  Mouse Trim41 Knockout Project (CRISPR/Cas9)https://www.alphaknockout.com Mouse Trim41 Knockout Project (CRISPR/Cas9) Objective: To create a Trim41 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Trim41 gene (NCBI Reference Sequence: NM_145377 ; Ensembl: ENSMUSG00000040365 ) is located on Mouse chromosome 11. 6 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 6 (Transcript: ENSMUST00000047145). Exon 1~3 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 1 starts from the coding region. Exon 1~3 covers 60.32% of the coding region. The size of effective KO region: ~7606 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 6 Legends Exon of mouse Trim41 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 813 bp section of Exon 1 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 231 bp section of Exon 3 is aligned with itself to determine if there are tandem repeats.
- 
												  Individual Protomers of a G Protein-Coupled Receptor Dimer Integrate Distinct Functional ModulesOPEN Citation: Cell Discovery (2015) 1, 15011; doi:10.1038/celldisc.2015.11 © 2015 SIBS, CAS All rights reserved 2056-5968/15 ARTICLE www.nature.com/celldisc Individual protomers of a G protein-coupled receptor dimer integrate distinct functional modules Nathan D Camp1, Kyung-Soon Lee2, Jennifer L Wacker-Mhyre2, Timothy S Kountz2, Ji-Min Park2, Dorathy-Ann Harris2, Marianne Estrada2, Aaron Stewart2, Alejandro Wolf-Yadlin1, Chris Hague2 1Department of Genome Sciences, University of Washington School of Medicine, Seattle, WA, USA; 2Department of Pharmacology, University of Washington School of Medicine, Seattle, WA, USA Recent advances in proteomic technology reveal G-protein-coupled receptors (GPCRs) are organized as large, macromolecular protein complexes in cell membranes, adding a new layer of intricacy to GPCR signaling. We previously reported the α1D-adrenergic receptor (ADRA1D)—a key regulator of cardiovascular, urinary and CNS function—binds the syntrophin family of PDZ domain proteins (SNTA, SNTB1, and SNTB2) through a C-terminal PDZ ligand inter- action, ensuring receptor plasma membrane localization and G-protein coupling. To assess the uniqueness of this novel GPCR complex, 23 human GPCRs containing Type I PDZ ligands were subjected to TAP/MS proteomic analysis. Syntrophins did not interact with any other GPCRs. Unexpectedly, a second PDZ domain protein, scribble (SCRIB), was detected in ADRA1D complexes. Biochemical, proteomic, and dynamic mass redistribution analyses indicate syntrophins and SCRIB compete for the PDZ ligand, simultaneously exist within an ADRA1D multimer, and impart divergent pharmacological properties to the complex. Our results reveal an unprecedented modular dimeric architecture for the ADRA1D in the cell membrane, providing unexpected opportunities for fine-tuning receptor function through novel protein interactions in vivo, and for intervening in signal transduction with small molecules that can stabilize or disrupt unique GPCR:PDZ protein interfaces.
- 
												  Supplement for TWO-SIGMA-G S1 Additional Type-I Error and Power ResultsSupplement for TWO-SIGMA-G Eric Van Buren, Ming Hu, Liang Chen, John Wrobel, Kirk Wilhelmsen, Lishan Su, Yun Li, Di Wu S1 Additional Type-I Error and Power Results Independent Genes (No IGC) Genes Simulated with IGC (A) No Gene-Level Random Effects (B) No Gene-Level Random Effects Test Size = 30, Ref. Size = 30 Test Size = 30, Ref. Size = 30 0.03 0.03 0.02 0.02 0.01 0.01 Type-I Error Type-I Error Observed Set-Level Observed Set-Level 0.00 0.00 0.0000 0.0025 0.0050 0.0075 0.0100 0.0000 0.0025 0.0050 0.0075 0.0100 Significance Threshold Significance Threshold CAMERA MAST TWO-SIGMA-G CAMERA MAST TWO-SIGMA-G Genes Simulated with IGC Genes Simulated with IGC (C) Gene-Level Random Effects Present (D) Gene-Level Random Effects Test Size = 30, Ref. Size = 30 Incorrectly Absent 0.03 Test Size = 30, Ref. Size = 30 0.03 0.02 0.02 0.01 0.01 Type-I Error Type-I Error Observed Set-Level 0.00 Observed Set-Level 0.00 0.0000 0.0025 0.0050 0.0075 0.0100 0.0000 0.0025 0.0050 0.0075 0.0100 Significance Threshold Significance Threshold CAMERA MAST TWO-SIGMA-G CAMERA MAST TWO-SIGMA-G Supplementary Figure S1: Type-I error performance of CAMERA, MAST, and TWO-SIGMA-G as significance threshold varies from 0 to .01. Each panel varies the existence of IGC between genes in the test set and the presence of gene-level random effect terms in gene-level model (CAMERA never includes gene-level random effect terms).
- 
												  Supplementary Table 3: Genes Only Influenced BySupplementary Table 3: Genes only influenced by X10 Illumina ID Gene ID Entrez Gene Name Fold change compared to vehicle 1810058M03RIK -1.104 2210008F06RIK 1.090 2310005E10RIK -1.175 2610016F04RIK 1.081 2610029K11RIK 1.130 381484 Gm5150 predicted gene 5150 -1.230 4833425P12RIK -1.127 4933412E12RIK -1.333 6030458P06RIK -1.131 6430550H21RIK 1.073 6530401D06RIK 1.229 9030607L17RIK -1.122 A330043C08RIK 1.113 A330043L12 1.054 A530092L01RIK -1.069 A630054D14 1.072 A630097D09RIK -1.102 AA409316 FAM83H family with sequence similarity 83, member H 1.142 AAAS AAAS achalasia, adrenocortical insufficiency, alacrimia 1.144 ACADL ACADL acyl-CoA dehydrogenase, long chain -1.135 ACOT1 ACOT1 acyl-CoA thioesterase 1 -1.191 ADAMTSL5 ADAMTSL5 ADAMTS-like 5 1.210 AFG3L2 AFG3L2 AFG3 ATPase family gene 3-like 2 (S. cerevisiae) 1.212 AI256775 RFESD Rieske (Fe-S) domain containing 1.134 Lipo1 (includes AI747699 others) lipase, member O2 -1.083 AKAP8L AKAP8L A kinase (PRKA) anchor protein 8-like -1.263 AKR7A5 -1.225 AMBP AMBP alpha-1-microglobulin/bikunin precursor 1.074 ANAPC2 ANAPC2 anaphase promoting complex subunit 2 -1.134 ANKRD1 ANKRD1 ankyrin repeat domain 1 (cardiac muscle) 1.314 APOA1 APOA1 apolipoprotein A-I -1.086 ARHGAP26 ARHGAP26 Rho GTPase activating protein 26 -1.083 ARL5A ARL5A ADP-ribosylation factor-like 5A -1.212 ARMC3 ARMC3 armadillo repeat containing 3 -1.077 ARPC5 ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa -1.190 activating transcription factor 4 (tax-responsive enhancer element ATF4 ATF4 B67) 1.481 AU014645 NCBP1 nuclear cap