DOCSLIB.ORG

A Rare Variant in the FHL1 Gene Associated with X-Linked Recessive

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Rare Variant in the FHL1 Gene Associated with X-Linked Recessive Hum Genet DOI 10.1007/s00439-017-1804-9 ORIGINAL INVESTIGATION A rare variant in the FHL1 gene associated with X‑linked recessive hypoparathyroidism Nir Pillar1 · Oren Pleniceanu1,2 · Mingyan Fang3 · Limor Ziv4 · Einat Lahav2 · Shay Botchan1 · Le Cheng3 · Benjamin Dekel1,2 · Noam Shomron1 Received: 20 December 2016 / Accepted: 17 April 2017 © The Author(s) 2017. This article is an open access publication Abstract Isolated familial hypoparathyroidism is an c.C283T, p.R95W). Since FHL1 has not been linked to cal- extremely rare disorder, which to date has been linked cium regulation before, we provide evidence for its func- to several loci including mutations in CASR, GCM2, and tional role in hypoparathyroidism by: (i) bioinformatics PTH, as well as a rare condition defned as X-linked reces- analysis coupling its action to known modulators of PTH sive hypoparathyroidism, previously associated with a function; (ii) observing strong expression of fhl1b in Cor- 1.5 Mb region on Xq26-q27. Here, we report a patient with puscles of Stannius, gland-like aggregates in zebrafsh that hypocalcemia-induced seizures leading to the diagnosis of function in calcium regulation similar to mammalian PTH; primary hypoparathyroidism. Mutations in CASR, GCM2, and (iii) implicating fhl1b and FHL1 as regulators of cal- and PTH were ruled out, while whole exome sequencing of cium homeostasis in zebrafsh and human cells, respec- the family suggested FHL1, located on chromosome Xq26, tively. Altogether, our data suggest that FHL1 is a novel as the most likely causative gene variant (FHL1, exon 4, regulator of calcium homeostasis and implicate it as the causative gene for X-linked recessive hypoparathyroidism. Nir Pillar, Oren Pleniceanu, and Mingyan Fang are equal frst authors. Introduction Le Cheng, Benjamin Dekel, and Noam Shomron are equal last authors. Deep Sequencing, or Next Generation Sequencing (NGS), is a powerful tool to identify causative variants in clinical Electronic supplementary material The online version of this article (doi:10.1007/s00439-017-1804-9) contains supplementary cases, where other methods have been exhausted. Here, we material, which is available to authorized users. describe a 4-year-old male, born at full term following an uneventful pregnancy and delivery to non-consanguineous * Le Cheng parents, and four siblings (Fig. 1) presented with gen- [email protected] eralized seizure at the age of 9 days. Upon ruling out all * Benjamin Dekel other major etiologies for seizures, initial evaluation iden- [email protected] tifed severe hypocalcemia of 5.7 mg/dl [9–11], hyper- * Noam Shomron phosphatemia of 11.5 mg/dl [5–9], and inappropriately [email protected] low PTH of 20.7, alongside normal albumin, magnesium, 1 Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, potassium, chloride, blood gases, and vitamin D levels. Israel Urinary calcium levels were low at 0.18 mg/dl [5.2–35.7]. 2 Pediatric Stem Cell Research Institute & Division Physical examination revealed no dysmorphic features, of Pediatric Nephrology, Edmond & Lily Safra Children’s short stature, malformations, or developmental delay. Addi- Hospital, Sheba Medical Center, Tel Hashomer, Israel tional studies included chest X-ray, brain US, echocardio- 3 BGI-Yunnan, Kunming, China gram, renal ultrasound, electroencephalogram, bone age 4 Sheba Cancer Research Center, Sheba Medical Center, study, and audiogram were all normal. Following a clinical Tel Hashomer, Israel geneticist consultation, 22q11.2 deletion was ruled out via 1 3 Hum Genet Fig. 1 Family pedigree. Squares denote male family members, circles female members, and shaded symbols affected members; the arrow points to the proband Fluorescent In-Situ Hybridization (FISH). Sanger Sequenc- with low allele coverage (<5 ) was detected. When focus- × ing detected no genomic variants in PTH and GCM2 genes. ing on homozygous recessive/X-linked variants, four vari- Since no additional loci were related to the phenotype, ants remained. Prioritization of these variants by combining array-CGH was not performed. variant severity and gene information revealed an X-linked At the age of 4 years, the patient continued to exhibit nonsynonymous mutation in FHL1, ‘Four and a Half LIM persistent hypocalcemia alongside inappropriately low domains 1’ gene (FHL1, exon 4, c.C283T, p.R95W) to PTH levels. In addition, mild orolingual muscle weak- be the top candidate variant. The variant was predicted to ness was detected in the patient. Notably, a younger, sixth be deleterious by the highest number of prediction tools female sibling was also found to have mild hypoparathy- (8.5/10; see “Materials and methods”). It is a very rare vari- roidism albeit without any electrolyte abnormality, while ant with prevalence of 0.0005/45 in the Exome Aggrega- all other family members exhibit normal PTH and calcium tion Consortium, 0.0006/6 in the NHLBI exome sequenc- levels. The patient’s father, as well as all other male sib- ing project and is not present in the 1000 genomes project, lings, demonstrates slight hypotonicity, requiring occupa- or is it found in our personal database of over 900 Israeli tional therapy. exomes. Sanger sequencing confrmed the variant is present Taken together, these fndings indicate that the patient in the patient, heterozygous in his mother, and not detected suffers from isolated familial hypoparathyroidism of in other family members. unknown origin. Exome sequencing of the affected male, The FHL1 c.C283T variant was predicted by the major- his parents, and siblings was performed to detect a causal ity of our employed tools to be deleterious, it is found in a gene. conserved region of the gene, and alternate allele coverage was >30 . Manually reviewing the three other homozy- × gous recessive/X-linked variants (ZNF366 c.A58G p.K20E, Results CORO1B c.G1252A p.A418T, and ZNF208 c.T986C p.I329T), all three variants were not predicted to be delete- Genomic analysis uncovers FHL1 as the causative gene rious by any of the tools we employed. FHL1 (also known as SLIM, SLIM1, or SLIMMER) is Whole exome sequencing (WES) of the patient generated a member of the gene family encoding LIM domain con- 1,065,106 variants passing initial flters, 58,977 of which taining proteins. An LIM domain is mainly constituted of were rare variants (allele frequency <1% in all databases), two cysteine-rich zinc-fnger motifs, which coordinately and 1031 were found inside exons and resulted in an amino bind zinc atoms to mediate protein–protein interactions acid change. When searching for de novo mutations found (Kadrmas and Beckerle 2004). FHL1 expression is highly in the patient or in his parents/siblings, only one variant enriched in striated muscles (Fig. 2), and has, therefore, 1 3 Hum Genet Fig. 2 Expression of FHL1 protein in human tissues, estimated by immunohistochemistry (IHC) using FHL1 antibody. Height of the bars repre- sents IHC staining strength. Taken from the Human Protein Atlas (Uhlén et al. 2015) been suggested to play an important role in skeletal mus- four of the manually curated targets plus FHL1 (Supple- cle growth and remodeling (Cowling et al. 2008). FHL1 was mentary Table 1). Next, to test the interactions between demonstrated to have an important role in muscle devel- FHL1 and hypocalcemia-related proteins, we have manu- opment and disease. A number of genetic studies linked ally assembled a list of 11 genes (PTH, CALC1, PTHRP, FHL1 missense mutations to congenital myopathies previ- TBX1, GCM2, CASR, AIRE, GNA11, GATA3, GNAS, and ously recognized by particular structural features, including TRPM6), which code for proteins known to be involved in Reducing body myopathy (RBM) and Emery-Dreifuss Mus- calcium sensing/metabolism with direct connection to pri- cular Dystrophy (EDMD) (Cowling et al. 2011). Mutations mary hypoparathyroidism. in the FHL1 gene have also been associated with arrhyth- We have assembled an induced network module, con- mias (San Román et al. 2016), HCM (Xu et al. 2015), and sisting of the 11 proteins coded by hypocalcemia-related dilated cardiomyopathy (Christodoulou et al. 2014) in sev- genes and FHL1 (Fig. 3). The induced network demon- eral patients affected by skeletal muscle disorders as well. strated an indirect connection between FHL1 and GATA3 Although the patient exhibits minimal muscular symp- (via STAT4) and CASR (via AKAP12 and FLNA). toms (see above), the phenotype differs signifcantly than STAT4 is a transcription factor belonging to the STAT previously ascribed to FHL1 mutations. Nonetheless, due protein family that is expressed mostly in immune cells and to the clinical assessment that the patient’s severe pheno- binds to hundreds of sites in the genome. It was shown that type and early onset strongly suggest a genetic cause, we FHl1 promotes both the degradation and the dephosphoryl- have decided to further pursue the connection between ation of STAT4 (Tanaka et al. 2005), presumably affecting FHL1 and hypocalcemia. GATA3 expression via this mechanism. AKAP12 (A-kinase anchor proteins) is a member of FHL1 interacts with calcium‑regulatory proteins a structurally diverse protein group, which has the com- mon function of binding to the regulatory subunit of pro- Using gene ontology, we tested the biological pathways tein kinase A (PKA) and confning the holoenzyme to dis- that were enriched by some of the 11 core genes plus crete locations within the cell. A connection with FHL1 FHL1. Several pathways associated with molecules trans- was noted in direct protein interaction (Vinayagam et al. port, including ion transport, transmembrane transport, 2011) and FLNA (Malovannaya et al. 2011). FLNA, coded and regulation of transport, were enriched with at least for Filamin A protein, is known to interact with CASR 1 3 Hum Genet Fig. 3 Induced module of FHL1 and connected proteins of interest. Nodes with black labels are seed proteins, and nodes with gray labels are intermediate nodes. Taken from ConsensusPathDB (Kamburov et al.
Load more

Recommended publications
  • The Role of IL-1 in Adipose Browning and Muscle Wasting in CKD-Associated Cachexia
    bioRxiv preprint doi: https://doi.org/10.1101/2021.02.05.429984; this version posted February 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The role of IL-1 in adipose browning and muscle wasting in CKD-associated cachexia Wai W Cheung1*, Ronghao Zheng2*, Sheng Hao3, Zhen Wang4, Alex Gonzalez1, Ping Zhou5, Hal M Hoffman6, Robert H Mak1 1 Pediatric Nephrology, Rady Children’s Hospital San Diego, University of California, San Diego, USA 2 Department of Pediatric Nephrology, Rheumatology, and Immunology, Maternal and Child Health Hospital of Hubei Province, TongJi Medical College, Huazhong University of Science and Technology, Wuhan, China 3Department of Nephrology and Rheumatology, Shanghai Children’s Hospital, Shanghai Jiao Tong University, Shanghai, China 4Department of Pediatrics, Shanghai General Hospital, Shanghai Jiao Tong University, Shanghai, China 5 Department of Pediatrics, the Second Affiliated Hospital of Harbin Medical University, Harbin, China 6 Department of Pediatrics, University of California, San Diego, USA * These authors contributed equally to this work. Correspondence: Robert H Mak Division of Pediatric Nephrology Rady Children’s Hospital University of California, San Diego 9500 Gilman Drive, MC0831, La Jolla, California 92093-0831, USA P: 858-822-6717 F: 858-822-6776 E-mail: [email protected] Running title: Anakinra attenuates uremic cachexia bioRxiv preprint doi: https://doi.org/10.1101/2021.02.05.429984; this version posted February 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved.
    [Show full text]
  • The Rise and Fall of the Bovine Corpus Luteum
    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 The Rise and Fall of the Bovine Corpus Luteum Heather Talbott University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Molecular Biology Commons, and the Obstetrics and Gynecology Commons Recommended Citation Talbott, Heather, "The Rise and Fall of the Bovine Corpus Luteum" (2017). Theses & Dissertations. 207. https://digitalcommons.unmc.edu/etd/207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. THE RISE AND FALL OF THE BOVINE CORPUS LUTEUM by Heather Talbott A DISSERTATION Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor John S. Davis University of Nebraska Medical Center Omaha, Nebraska May, 2017 Supervisory Committee: Carol A. Casey, Ph.D. Andrea S. Cupp, Ph.D. Parmender P. Mehta, Ph.D. Justin L. Mott, Ph.D. i ACKNOWLEDGEMENTS This dissertation was supported by the Agriculture and Food Research Initiative from the USDA National Institute of Food and Agriculture (NIFA) Pre-doctoral award; University of Nebraska Medical Center Graduate Student Assistantship; University of Nebraska Medical Center Exceptional Incoming Graduate Student Award; the VA Nebraska-Western Iowa Health Care System Department of Veterans Affairs; and The Olson Center for Women’s Health, Department of Obstetrics and Gynecology, Nebraska Medical Center.
    [Show full text]
  • Identification of a Novel Mutation Disrupting the DNA Binding Activity
    443 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.2004.026898 on 29 April 2005. Downloaded from Identification of a novel mutation disrupting the DNA binding activity of GCM2 in autosomal recessive familial isolated hypoparathyroidism L Baumber, C Tufarelli, S Patel, P King, C A Johnson, E R Maher, R C Trembath ............................................................................................................................... J Med Genet 2005;42:443–448. doi: 10.1136/jmg.2004.026898 ypoparathyroidism is a heterogeneous group of dis- orders with both acquired and inherited causes, each Key points Hpresenting clinically with hypocalcaemia. Familial cases of hypoparathyroidism may be due to an isolated N Hypoparathyroidism is a heterogeneous group of defect of the parathyroid glands or be a component of a disorders with both acquired and inherited causes, syndrome disorder, examples of which include DiGeorge, each presenting clinically with hypocalcaemia. hypoparathyroidism-retardation-dysmorphism, and Kenny- N Familial isolated hypoparathyroidism is characterised 1 Caffey syndrome. Familial isolated hypoparathyroidism by hypocalcaemia and hyperphosphataemia and may (FIH) is characterised by hypocalcaemia and hyperpho- be due to an inherited deficiency or the abnormal sphataemia and may be due to an inherited deficiency or activity of parathyroid hormone. the abnormal activity of parathyroid hormone (PTH). FIH is heterogeneous with X linked, autosomal dominant, and N Recently, a homozygous deletion within the human autosomal recessive modes of inheritance reported.2 GCM2 gene has been shown to underlie hypopar- Mutations in the PTH gene on chromosome 11p have been athyroidism in one patient, while other compelling described in both autosomal dominant and autosomal evidence indicates a critical role for GCM2 in normal recessive forms of the disorder.34 Mature PTH is generated parathyroid gland function.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Identification of Potential Proteases for Abdominal Aortic Aneurysm by Weighted Gene Coexpression Network Analysis
    Genome Identification of potential proteases for abdominal aortic aneurysm by weighted gene coexpression network analysis Journal: Genome Manuscript ID gen-2020-0041.R1 Manuscript Type: Article Date Submitted by the 28-Jun-2020 Author: Complete List of Authors: Zhang, Hui; Peking Union Medical College Hospital, Department of Vascular Surgery Yang, Dan; Chinese Academy of Medical Sciences and Peking Union Medical College, Department of Computational Biology and Bioinformatics,Draft Institute of Medicinal Plant Development Chen, Siliang; Peking Union Medical College Hospital, Department of Vascular Surgery Li, Fangda; Peking Union Medical College Hospital, Department of Vascular Surgery Cui, Liqiang; Peking Union Medical College Hospital, Department of Vascular Surgery Liu, Zhili; Peking Union Medical College Hospital, Department of Vascular Surgery Shao, Jiang; Peking Union Medical College Hospital, Department of Vascular Surgery Chen, Yuexin; Peking Union Medical College Hospital, Department of Vascular Surgery Liu, Bao; Peking Union Medical College Hospital, Department of Vascular Surgery Zheng, Yuehong; Peking Union Medical College Hospital, Department of Vascular Surgery Abdominal aortic aneurysm, next-generation sequencing, WGCNA, Keyword: proteases, matrix metalloproteinase Is the invited manuscript for consideration in a Special Not applicable (regular submission) Issue? : https://mc06.manuscriptcentral.com/genome-pubs Page 1 of 35 Genome 1 Identification of potential proteases for abdominal aortic aneurysm by weighted gene 2 coexpression network analysis 3 Short title: WGCNA identifies crucial proteases in AAA 4 5 Hui Zhang1, Dan Yang2, Siliang Chen1, Fangda Li1, Liqiang Cui1, Zhili Liu1, Jiang Shao1, Yuexin 6 Chen1, Bao Liu1, Yuehong Zheng1. 7 1Department of Vascular Surgery, Peking Union Medical College Hospital, Beijing 100730, PR 8 China; 2Department of Computational Biology and Bioinformatics, Institute of Medicinal Plant 9 Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 10 100730, PR China.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name glial cells missing homolog 2 (Drosophila) Gene Symbol GCM2 Organism Human Gene Summary This gene is a homolog of the Drosophila glial cells missing gene which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. Gene Aliases GCMB, hGCMb RefSeq Accession No. NC_000006.11, NG_008970.1, NT_007592.15 UniGene ID Hs.227098 Ensembl Gene ID ENSG00000124827 Entrez Gene ID 9247 Assay Information Unique Assay ID qHsaCIP0029896 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000379491 Amplicon Context Sequence ACATAGCCGTCAGGCCACTCTCGGAATTGGTCAAAGAGGGCCAGCTCCTGAGG CATCTGCGGATCGTTGATGTCCCAGCTGAGCTGCATCCCGTA Amplicon Length (bp) 65 Chromosome Location 6:10877579-10881984 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 101 R2 0.9999 cDNA Cq Target not expressed in universal RNA cDNA Tm (Celsius) Target not expressed in universal RNA Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Target not expressed in universal RNA Specificity
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • Single-Cell RNA Sequencing Demonstrates the Molecular and Cellular Reprogramming of Metastatic Lung Adenocarcinoma
    ARTICLE https://doi.org/10.1038/s41467-020-16164-1 OPEN Single-cell RNA sequencing demonstrates the molecular and cellular reprogramming of metastatic lung adenocarcinoma Nayoung Kim 1,2,3,13, Hong Kwan Kim4,13, Kyungjong Lee 5,13, Yourae Hong 1,6, Jong Ho Cho4, Jung Won Choi7, Jung-Il Lee7, Yeon-Lim Suh8,BoMiKu9, Hye Hyeon Eum 1,2,3, Soyean Choi 1, Yoon-La Choi6,10,11, Je-Gun Joung1, Woong-Yang Park 1,2,6, Hyun Ae Jung12, Jong-Mu Sun12, Se-Hoon Lee12, ✉ ✉ Jin Seok Ahn12, Keunchil Park12, Myung-Ju Ahn 12 & Hae-Ock Lee 1,2,3,6 1234567890():,; Advanced metastatic cancer poses utmost clinical challenges and may present molecular and cellular features distinct from an early-stage cancer. Herein, we present single-cell tran- scriptome profiling of metastatic lung adenocarcinoma, the most prevalent histological lung cancer type diagnosed at stage IV in over 40% of all cases. From 208,506 cells populating the normal tissues or early to metastatic stage cancer in 44 patients, we identify a cancer cell subtype deviating from the normal differentiation trajectory and dominating the metastatic stage. In all stages, the stromal and immune cell dynamics reveal ontological and functional changes that create a pro-tumoral and immunosuppressive microenvironment. Normal resident myeloid cell populations are gradually replaced with monocyte-derived macrophages and dendritic cells, along with T-cell exhaustion. This extensive single-cell analysis enhances our understanding of molecular and cellular dynamics in metastatic lung cancer and reveals potential diagnostic and therapeutic targets in cancer-microenvironment interactions. 1 Samsung Genome Institute, Samsung Medical Center, Seoul 06351, Korea.
    [Show full text]
  • Presence and Significance of a R110W Mutation in the DNA
    European Journal of Endocrinology (2010) 162 407–421 ISSN 0804-4643 CLINICAL STUDY Presence and significance of a R110W mutation in the DNA-binding domain of GCM2 gene in patients with isolated hypoparathyroidism and their family members Neeraj Tomar1, Hema Bora2, Ratnakar Singh3, Nandita Gupta1, Punit Kaur4, Shyam Singh Chauhan3, Yagya Dutta Sharma2 and Ravinder Goswami1 Departments of 1Endocrinology and Metabolism, 2Biotechnology, 3Biochemistry and 4Biophysics, All India Institute of Medical Sciences, New Delhi 110029, India (Correspondence should be addressed to R Goswami; Email: [email protected]) Abstract Objective: Glial cells missing 2 (GCM2) gene encodes a parathyroid-specific transcription factor. We assessed GCM2 gene sequence in patients with isolated hypoparathyroidism (IH). Design: Case–control study. Methods: Complete DNA sequencing of the GCM2 gene including its exons, promoter, and 50 and 30 UTRs was performed in 24/101 patients with IH. PCR–restriction fragment length polymorphism was used to detect a novel R110W mutation in all 101 IH patients and 655 healthy controls. Significance of the mutation was assessed by electrophoretic mobility shift assay (EMSA) and nuclear localization on transfection. Results: A heterozygous R110W mutation was present in DNA-binding domain in 11/101 patients (10.9%) and absent in 655 controls (P!10K7). Four of 13 nonaffected first-degree relatives for five of these index cases had R110W mutation. Four heterozygous single nucleotide polymorphisms were found in the 50 region. One of the 11 patients with R110W also had T370M change in compound heterozygous form. Mutant R110W and T370M GCM2 proteins showed decreased binding with GCM recognition elements on EMSA indicating loss of function.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Human Engineered Skeletal Muscle
    SUPPLEMENTARY MATERIAL Human engineered skeletal muscle of hypaxial origin from pluripotent stem cells with advanced function and regenerative capacity Mina Shahriyari1,2, Md Rezaul Islam3, M. Sadman Sakib3, Anastasia Rika1,2, Dennis Krüger3, Lalit Kaurani3, Harithaa Anandakumar1,2, Orr Shomroni4, Matthias Schmidt5, Jana Zschüntzsch5, Jens Schmidt5, Gabriela Salinas-Riester4, Andreas Unger6, Wolfgang A. Linke6, André Fischer3,7, Wolfram-Hubertus Zimmermann1,2,3,7,8*, Malte Tiburcy1,2* 1 Institute of Pharmacology and Toxicology, University Medical Center Göttingen, Göttingen, Germany. 2 DZHK (German Center for Cardiovascular Research), partner site Göttingen. 3 Department for Epigenetics and Systems Medicine in Neurodegenerative Diseases, German Center for Neurodegenerative Diseases (DZNE) Göttingen, Göttingen, Germany 4 NGS Integrative Genomics Core Unit, Institute of Human Genetics, University Medical Center Göttingen, Göttingen, Germany 5 Department of Neurology, University Medical Center Göttingen, Göttingen, Germany 6 Institute of Physiology II, University of Münster, D-48149 Münster, Germany 7 Cluster of Excellence "Multiscale Bioimaging: from Molecular Machines to Networks of Excitable Cells" (MBExC), University of Göttingen, Germany; 8 Fraunhofer Institute for Translational Medicine and Pharmacology (ITMP), Göttingen, Germany Supplementary table 1 related to Figure 2: Biological process annotation of coexpression clusters. Cluster Biological process annotated Enriched GO terms identifier Black Migrating limb progenitors Muscle
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]