DOCSLIB.ORG

Five Patients with Disorders of Calcium Metabolism Presented with GCM2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Five Patients with Disorders of Calcium Metabolism Presented with GCM2 www.nature.com/scientificreports OPEN Five patients with disorders of calcium metabolism presented with GCM2 gene variants Alejandro García‑Castaño1,11*, Leire Madariaga2,11, Sara Gómez‑Conde3, Carmen Lourdes Rey Cordo4, María López‑Iglesias5, Yolanda Garcia‑Fernández6, Alicia Martín7, Pedro González7, Ignacio Goicolea7, Gustavo Pérez de Nanclares8, Ana Belén De la Hoz9, Aníbal Aguayo8, Idoia Martínez de LaPiscina1, Rosa Martínez1, Laura Saso3, Inés Urrutia1, Olaia Velasco3, Luis Castaño10 & Sonia Gaztambide10 The GCM2 gene encodes a transcription factor predominantly expressed in parathyroid cells that is known to be critical for development, proliferation and maintenance of the parathyroid cells. A cohort of 127 Spanish patients with a disorder of calcium metabolism were screened for mutations by Next‑ Generation Sequencing (NGS). A targeted panel for disorders of calcium and phosphorus metabolism was designed to include 65 genes associated with these disorders. We observed two variants of uncertain signifcance (p.(Ser487Phe) and p.Asn315Asp), one likely pathogenic (p.Val382Met) and one benign variant (p.Ala393_Gln395dup) in the GCM2 gene in the heterozygous state in fve families (two index cases had hypocalcemia and hypoparathyroidism, respectively, and three index cases had primary hyperparathyroidism). Our study shows the utility of NGS in unravelling the genetic origin of some disorders of the calcium and phosphorus metabolism, and confrms the GCM2 gene as an important element for the maintenance of calcium homeostasis. Importantly, a novel variant in the GCM2 gene (p.(Ser487Phe)) has been found in a patient with hypocalcemia. Calcium (Ca2+) is required for many physiological functions (muscle contraction, nerve conduction, hormone release, mineralization of bone, and blood coagulation). Ca2+ metabolism maintains a dynamic balance between intestinal absorption, exchange with the bone, and renal excretion. Parathyroid hormone (PTH), vitamin D and calcitonin regulate this balance by acting on their targets: intestine, bone and renal tubule. PTH is secreted by the parathyroid glands. Te GCM2 gene (glial cells missing transcription factor 2, MIM *603716) encodes a transcription factor predominantly expressed in parathyroid cells 1,2. Tis transcription factor is known to be critical for development of the parathyroid cells and plays a critical role in adult parathyroid cell proliferation and maintenance3,4. Tus, it has been demonstrated that a GCM2-defcient mouse lacked parathyroid glands 5. Te GCM2 gene was mapped to chromosome 6p24.22 and encodes the chorion-specifc transcription factor GCMb. Te full-length protein (506 amino acids) contains a N-terminal Zn-containing DNA binding domain (amino acids from 19 to 174), a nuclear localization sequence (amino acids from 176 to 191), a C-terminal conserved inhibitory domain (CCID, amino acids from 379 to 395), and two transcriptional activation domains in the C-terminal region: TAD1 (amino acids from 175 to 263) and TAD2 (amino acids from 428 to 506)2,6–8. Loss-of-function mutations in the GCM2 gene have recently been described in humans as a rare cause of autosomal dominant or recessive familial isolated type 2 hypoparathyroidism (MIM #618883)6. Patients usually 1Biocruces Bizkaia Health Research Institute, CIBERDEM, CIBERER, Plaza de Cruces, Barakaldo, 48903 Bizkaia, Spain. 2Biocruces Bizkaia Health Research Institute, CIBERDEM, CIBERER, Pediatric Nephrology Department, Hospital Universitario Cruces, University of the Basque Country (UPV/EHU), Bizkaia, Spain. 3Biocruces Bizkaia Health Research Institute, Bizkaia, Spain. 4Pediatric Endocrinology Department, Hospital Álvaro Cunqueiro, EOXI, Vigo, Spain. 5Endocrinology Department, Hospital General La Mancha Centro, Ciudad Real, Spain. 6Endocrinology and Nutrition Department, OSI Barrualde-Galdakao, Bizkaia, Spain. 7Biocruces Bizkaia Health Research Institute, Endocrinology and Nutrition Department, Hospital Universitario Cruces, Bizkaia, Spain. 8Biocruces Bizkaia Health Research Institute, CIBERDEM, CIBERER, Hospital Universitario Cruces, Bizkaia, Spain. 9Biocruces Bizkaia Health Research Institute, CIBERER, Bizkaia, Spain. 10Biocruces Bizkaia Health Research Institute, CIBERDEM, CIBERER, Endocrinology and Nutrition Department, Hospital Universitario Cruces, University of the Basque Country (UPV/EHU), Bizkaia, Spain. 11These authors contributed equally: Alejandro García-Castaño and Leire Madariaga. *email: [email protected] Scientifc Reports | (2021) 11:2968 | https://doi.org/10.1038/s41598-021-82661-y 1 Vol.:(0123456789) www.nature.com/scientificreports/ Figure 1. Pedigree of 5 families with variants in the GCM2 gene. Te novel variant is marked in bold. Index case are indicated by the arrows. Squares denote male family members, circles female family members, and solid symbols symptomatic subjects. develop seizures due to the hypocalcemia, in early life, with hyperphosphatemia, low to undetectable serum PTH levels and normal levels of 25-hydroxyvitamin D and 1,25-dihydroxyvitamin D. On the other hand, gain-of- function mutations in the GCM2 gene cause autosomal dominant hyperparathyroidism type 4 (MIM #617343)9, a disorder characterized by hypercalcemia and elevated or inappropriate PTH secretion by parathyroid glands. In the present study, we report a novel variant of uncertain signifcance in the GCM2 gene in a family from Spain with severe hypocalcemia. Moreover, we report three previously described GCM2 gene variants, one likely pathogenic, one of uncertain signifcance and one benign, in four families from Spain presenting with diferent disorders of calcium metabolism. Materials and methods Ethics statement. Te study was approved by the Ethics Committee for Clinical Research of Euskadi (CEIC-E). Patients and their participating relatives provided written informed consent for the genetic study. Te research was carried out in accordance with the Declaration of Helsinki on human experimentation of the World Medical Association. Patients. A total of 65 genes whose mutations are a recognized cause of calcium and phosphorus metabo- lism disorders were tested by a Next-Generation Sequencing (NGS) panel in a cohort of 127 Spanish patients (50 had hypocalciuric hypercalcemia, 44 were diagnosed of primary hyperparathyroidism, 13 presented with hypocalcemia and/or hypoparathyroidism, 12 were diagnosed of pseudohypoparathyroidism and 8 had rickets). Clinical diagnoses were made by adult and pediatric endocrinologists. In all cases, the molecular analysis was done in the Molecular Genetic Laboratory at Biocruces Bizkaia Health Research Institute, Barakaldo, Spain. From the whole cohort, fve index cases with a suspected disorder of calcium metabolism (GS0198, CA0117, ME0292, ME0371 and CA0103) presented with GCM2 gene variants (Fig. 1). Index case GS0198 was a 7-month-old child who was referred for evaluation of irritability and refusal to eat. He had sufered three episodes of seizures accompanied by rapid and involuntary muscle contractions. Labora- tory results showed low serum Ca 2+ (less than 5 mg/dL, reference range 8.5–10.4) and 25-hydroxyvitamin D (7.49 ng/mL, reference range 9–47), and high serum phosphate (11.7 mg/dL, reference range 2.6–4.8), whereas serum intact PTH levels (54 pg/mL, reference range 10–65) were within the normal range. In addition, he pre- sented with moderate hypomagnesemia (1.39 mg/dL, reference range 1.7–2.5). While the mother had normal calcium and phosphate metabolism, proband’s father had small stature (1.57 cm) and body segment dispar- ity (short lower limbs). He had normal levels of serum Ca 2+ (9 mg/dL), phosphate (3.18 mg/dL), magnesium (1.94 mg/dL), intact PTH (34.38 pg/mL) and 25-hydroxyvitamin D (30.4 ng/mL) (Fig. 1a). Index case CA0117 was a 65-year-old male who had hypocalcemia and hypoparathyroidism. He had osteoar- thritis and sufered tingling of fngers and toes. Moreover, he was diagnosed with glaucoma. Laboratory results showed low serum Ca2+ (5.4 mg/dL) and serum intact PTH (5.8 pg/mL), whereas 25-hydroxyvitamin D (24 ng/ Scientifc Reports | (2021) 11:2968 | https://doi.org/10.1038/s41598-021-82661-y 2 Vol:.(1234567890) www.nature.com/scientificreports/ mL) and serum phosphate (4.3 mg/dL) were within the normal range. He was treated with calcium and vitamin D supplements. Regarding family history, there was no history of hypoparathyroidism or hypocalcemia (Fig. 1b). Index case ME0292 was a 67-year-old male presenting with elevated serum intact PTH levels, hypophos- phatemia, normocalcemia with vitamin D defciency, hypercalciuria, and nephrolithiasis. Laboratory evaluation showed normal serum calcium (10.2 mg/dL), high intact PTH (95.6 pg/mL), low serum phosphate (2 mg/dL), and 25-hydroxyvitamin D levels of 11 ng/mL. In addition, he exhibited high urinary calcium excretion (386 mg/24 h, reference range in adult male < 300 mg/24 h). Furthermore, index case ME0292 had a personal history of ankylos- ing spondylitis, prostate gland enlargement, hepatic steatosis, and hyperlipidemia. He was diagnosed of primary hyperparathyroidism and parathyroid glands surgery was performed. Parathyroid hyperplasia of two superior glands was verifed histologically and both were removed. However, afer the surgical intervention, he contin- ued with high intact PTH levels (113 pg/mL). He had a 61 year-old sister who had hyperparathyroidism (intact PTH 103 pg/mL) and nephrolithiasis as well (Fig. 1c). She had normal serum Ca2+ (9.4 mg/dL), normal serum phosphate (3.1 mg/dL) and exhibited slightly
Load more

Recommended publications
  • (2017) Emerging Significance of Bile Acids
    Texas Medical Center Digestive Diseases Center 8th Annual Frontiers in Digestive Diseases Symposium: Emerging Significance of Bile Acids in Digestive & Liver Diseases Saturday, February 11, 2017 Onstead Auditorium, Houston, Texas 77030 Table of Contents ....................................................................................................................................................................... 1 Agenda .......................................................................................................................................................................................... 2 CME Activity............................................................................................................................................................................... 3 List of Abstracts .................................................................................................................................................................... 4 - 6 Abstracts............................................................................................................................................................................... 7 - 41 TMC DDC Leadership ............................................................................................................................................................ 42 List of Participants ............................................................................................................................................................ 43 - 46 Acknowledgements
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Identification of a Novel Mutation Disrupting the DNA Binding Activity
    443 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.2004.026898 on 29 April 2005. Downloaded from Identification of a novel mutation disrupting the DNA binding activity of GCM2 in autosomal recessive familial isolated hypoparathyroidism L Baumber, C Tufarelli, S Patel, P King, C A Johnson, E R Maher, R C Trembath ............................................................................................................................... J Med Genet 2005;42:443–448. doi: 10.1136/jmg.2004.026898 ypoparathyroidism is a heterogeneous group of dis- orders with both acquired and inherited causes, each Key points Hpresenting clinically with hypocalcaemia. Familial cases of hypoparathyroidism may be due to an isolated N Hypoparathyroidism is a heterogeneous group of defect of the parathyroid glands or be a component of a disorders with both acquired and inherited causes, syndrome disorder, examples of which include DiGeorge, each presenting clinically with hypocalcaemia. hypoparathyroidism-retardation-dysmorphism, and Kenny- N Familial isolated hypoparathyroidism is characterised 1 Caffey syndrome. Familial isolated hypoparathyroidism by hypocalcaemia and hyperphosphataemia and may (FIH) is characterised by hypocalcaemia and hyperpho- be due to an inherited deficiency or the abnormal sphataemia and may be due to an inherited deficiency or activity of parathyroid hormone. the abnormal activity of parathyroid hormone (PTH). FIH is heterogeneous with X linked, autosomal dominant, and N Recently, a homozygous deletion within the human autosomal recessive modes of inheritance reported.2 GCM2 gene has been shown to underlie hypopar- Mutations in the PTH gene on chromosome 11p have been athyroidism in one patient, while other compelling described in both autosomal dominant and autosomal evidence indicates a critical role for GCM2 in normal recessive forms of the disorder.34 Mature PTH is generated parathyroid gland function.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name glial cells missing homolog 2 (Drosophila) Gene Symbol GCM2 Organism Human Gene Summary This gene is a homolog of the Drosophila glial cells missing gene which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. Gene Aliases GCMB, hGCMb RefSeq Accession No. NC_000006.11, NG_008970.1, NT_007592.15 UniGene ID Hs.227098 Ensembl Gene ID ENSG00000124827 Entrez Gene ID 9247 Assay Information Unique Assay ID qHsaCIP0029896 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000379491 Amplicon Context Sequence ACATAGCCGTCAGGCCACTCTCGGAATTGGTCAAAGAGGGCCAGCTCCTGAGG CATCTGCGGATCGTTGATGTCCCAGCTGAGCTGCATCCCGTA Amplicon Length (bp) 65 Chromosome Location 6:10877579-10881984 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 101 R2 0.9999 cDNA Cq Target not expressed in universal RNA cDNA Tm (Celsius) Target not expressed in universal RNA Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Target not expressed in universal RNA Specificity
    [Show full text]
  • Presence and Significance of a R110W Mutation in the DNA
    European Journal of Endocrinology (2010) 162 407–421 ISSN 0804-4643 CLINICAL STUDY Presence and significance of a R110W mutation in the DNA-binding domain of GCM2 gene in patients with isolated hypoparathyroidism and their family members Neeraj Tomar1, Hema Bora2, Ratnakar Singh3, Nandita Gupta1, Punit Kaur4, Shyam Singh Chauhan3, Yagya Dutta Sharma2 and Ravinder Goswami1 Departments of 1Endocrinology and Metabolism, 2Biotechnology, 3Biochemistry and 4Biophysics, All India Institute of Medical Sciences, New Delhi 110029, India (Correspondence should be addressed to R Goswami; Email: [email protected]) Abstract Objective: Glial cells missing 2 (GCM2) gene encodes a parathyroid-specific transcription factor. We assessed GCM2 gene sequence in patients with isolated hypoparathyroidism (IH). Design: Case–control study. Methods: Complete DNA sequencing of the GCM2 gene including its exons, promoter, and 50 and 30 UTRs was performed in 24/101 patients with IH. PCR–restriction fragment length polymorphism was used to detect a novel R110W mutation in all 101 IH patients and 655 healthy controls. Significance of the mutation was assessed by electrophoretic mobility shift assay (EMSA) and nuclear localization on transfection. Results: A heterozygous R110W mutation was present in DNA-binding domain in 11/101 patients (10.9%) and absent in 655 controls (P!10K7). Four of 13 nonaffected first-degree relatives for five of these index cases had R110W mutation. Four heterozygous single nucleotide polymorphisms were found in the 50 region. One of the 11 patients with R110W also had T370M change in compound heterozygous form. Mutant R110W and T370M GCM2 proteins showed decreased binding with GCM recognition elements on EMSA indicating loss of function.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • HOX D13 Expression Across 79 Tumor Tissue Types
    Int. J. Cancer: 125, 1532–1541 (2009) ' 2009 UICC HOX D13 expression across 79 tumor tissue types Monica Cantile1,3, Renato Franco3, Adrienne Tschan2, Daniel Baumhoer2, Inti Zlobec2, Giulia Schiavo2, Iris Forte3, Michel Bihl2, Giuseppina Liguori3, Gerardo Botti3, Luigi Tornillo2, Eva Karamitopoulou-Diamantis4, Luigi Terracciano2,5 and Clemente Cillo1,2* 1Department of Clinical & Experimental Medicine, Federico II University Medical School, Naples, Italy 2Molecular Pathology Department, Institute of Pathology, University of Basel, Basel, Switzerland 3Surgical Pathology Department, National Cancer Institute ‘‘G.Pascale,’’ Naples, Italy 4Second Department of Pathology, University of Athens, Athens, Greece 5Health Science Department, University of Molise, Italy HOX genes control normal development, primary cellular proc- (CREB1, CREB2, Neuro D1) lying several hundred kilobases from esses and are characterized by a unique genomic network organi- one another.18 zation. Locus D HOX genes play an important role in limb genera- The most posterior located HOXD gene, HOXD13, was the first tion and mesenchymal condensation. Dysregulated HOXD13 19 expression has been detected in breast cancer, melanoma, cervical HOX gene to be described as mutated in human synpolidactyly. During normal morphogenesis, HOXD13 is involved in the deter- cancer and astrocytomas. We have investigated the epidemiology 20–22 of HOXD13 expression in human tissues and its potential deregu- mination of the terminal digestive and urogenital tracts. lation in the carcinogenesis of specific tumors. HOXD13 homeo- HOXD13 deregulation has been further detected in different tumor protein expression has been detected using microarray technology types, such as breast cancer, melanoma, cervical cancer and atroc- comprising more than 4,000 normal and neoplastic tissue samples ytomas,23–26 and in the neuro-endocrine differentiation of human including 79 different tumor categories.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • A Conserved Tissue-Specific Homeodomain-Less Isoform of MEIS1 Is Downregulated in Colorectal Cancer
    Thomas Jefferson University Jefferson Digital Commons Department of Microbiology and Immunology Faculty Papers Department of Microbiology and Immunology 8-17-2011 A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer. Richard C Crist Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Jacquelyn J Roth Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Scott A Waldman Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia Arthur M Buchberg Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Follow this and additional works at: https://jdc.jefferson.edu/mifp Part of the Gastroenterology Commons, Medical Genetics Commons, Medical Microbiology Commons, Oncology Commons, and the Pathology Commons Let us know how access to this document benefits ouy Recommended Citation Crist, Richard C; Roth, Jacquelyn J; Waldman, Scott A; and Buchberg, Arthur M, "A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer." (2011). Department of Microbiology and Immunology Faculty Papers. Paper 25. https://jdc.jefferson.edu/mifp/25 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Microbiology and Immunology Faculty Papers by an authorized administrator of the Jefferson Digital Commons.
    [Show full text]
  • Homeobox Genes D11–D13 and A13 Control Mouse Autopod Cortical
    Research article Homeobox genes d11–d13 and a13 control mouse autopod cortical bone and joint formation Pablo Villavicencio-Lorini,1,2 Pia Kuss,1,2 Julia Friedrich,1,2 Julia Haupt,1,2 Muhammed Farooq,3 Seval Türkmen,2 Denis Duboule,4 Jochen Hecht,1,5 and Stefan Mundlos1,2,5 1Max Planck Institute for Molecular Genetics, Berlin, Germany. 2Institute for Medical Genetics, Charité, Universitätsmedizin Berlin, Berlin, Germany. 3Human Molecular Genetics Laboratory, National Institute for Biotechnology & Genetic Engineering (NIBGE), Faisalabad, Pakistan. 4National Research Centre Frontiers in Genetics, Department of Zoology and Animal Biology, University of Geneva, Geneva, Switzerland. 5Berlin-Brandenburg Center for Regenerative Therapies (BCRT), Charité, Universitätsmedizin Berlin, Berlin, Germany. The molecular mechanisms that govern bone and joint formation are complex, involving an integrated network of signaling pathways and gene regulators. We investigated the role of Hox genes, which are known to specify individual segments of the skeleton, in the formation of autopod limb bones (i.e., the hands and feet) using the mouse mutant synpolydactyly homolog (spdh), which encodes a polyalanine expansion in Hoxd13. We found that no cortical bone was formed in the autopod in spdh/spdh mice; instead, these bones underwent trabecular ossification after birth. Spdh/spdh metacarpals acquired an ovoid shape and developed ectopic joints, indicating a loss of long bone characteristics and thus a transformation of metacarpals into carpal bones. The perichon- drium of spdh/spdh mice showed abnormal morphology and decreased expression of Runt-related transcription factor 2 (Runx2), which was identified as a direct Hoxd13 transcriptional target. Hoxd11–/–Hoxd12–/–Hoxd13–/– tri- ple-knockout mice and Hoxd13–/–Hoxa13+/– mice exhibited similar but less severe defects, suggesting that these Hox genes have similar and complementary functions and that the spdh allele acts as a dominant negative.
    [Show full text]
  • HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genes
    University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2007-02-28 HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes Mohammad Q. Hassan University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Life Sciences Commons, and the Medicine and Health Sciences Commons Repository Citation Hassan MQ, Tare RS, Lee SH, Mandeville M, Weiner B, Montecino MA, Van Wijnen AJ, Stein JL, Stein GS, Lian JB. (2007). HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes. Open Access Articles. https://doi.org/10.1128/MCB.01544-06. Retrieved from https://escholarship.umassmed.edu/oapubs/1334 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. MOLECULAR AND CELLULAR BIOLOGY, May 2007, p. 3337–3352 Vol. 27, No. 9 0270-7306/07/$08.00ϩ0 doi:10.1128/MCB.01544-06 Copyright © 2007, American Society for Microbiology. All Rights Reserved. HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genesᰔ Mohammad Q. Hassan,1 Rahul Tare,1† Suk Hee Lee,1 Matthew Mandeville,1 Brian Weiner,1 Martin Montecino,2 Andre J. van Wijnen,1 Janet L. Stein,1 Gary S. Stein,1 and Jane B. Lian1* Department of Cell Biology and Cancer Center, University of Massachusetts Medical School, Worcester, Massachusetts 01655,1 and Departamento de Bioquimica y Biologia Molecular, Facultad de Ciencias Biologicas, Universidad de Concepcion, Concepcion, Chile2 Received 18 August 2006/Returned for modification 4 October 2006/Accepted 9 February 2007 HOXA10 is necessary for embryonic patterning of skeletal elements, but its function in bone formation beyond this early developmental stage is unknown.
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]