DOCSLIB.ORG

HOX D13 Expression Across 79 Tumor Tissue Types

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
HOX D13 Expression Across 79 Tumor Tissue Types Int. J. Cancer: 125, 1532–1541 (2009) ' 2009 UICC HOX D13 expression across 79 tumor tissue types Monica Cantile1,3, Renato Franco3, Adrienne Tschan2, Daniel Baumhoer2, Inti Zlobec2, Giulia Schiavo2, Iris Forte3, Michel Bihl2, Giuseppina Liguori3, Gerardo Botti3, Luigi Tornillo2, Eva Karamitopoulou-Diamantis4, Luigi Terracciano2,5 and Clemente Cillo1,2* 1Department of Clinical & Experimental Medicine, Federico II University Medical School, Naples, Italy 2Molecular Pathology Department, Institute of Pathology, University of Basel, Basel, Switzerland 3Surgical Pathology Department, National Cancer Institute ‘‘G.Pascale,’’ Naples, Italy 4Second Department of Pathology, University of Athens, Athens, Greece 5Health Science Department, University of Molise, Italy HOX genes control normal development, primary cellular proc- (CREB1, CREB2, Neuro D1) lying several hundred kilobases from esses and are characterized by a unique genomic network organi- one another.18 zation. Locus D HOX genes play an important role in limb genera- The most posterior located HOXD gene, HOXD13, was the first tion and mesenchymal condensation. Dysregulated HOXD13 19 expression has been detected in breast cancer, melanoma, cervical HOX gene to be described as mutated in human synpolidactyly. During normal morphogenesis, HOXD13 is involved in the deter- cancer and astrocytomas. We have investigated the epidemiology 20–22 of HOXD13 expression in human tissues and its potential deregu- mination of the terminal digestive and urogenital tracts. lation in the carcinogenesis of specific tumors. HOXD13 homeo- HOXD13 deregulation has been further detected in different tumor protein expression has been detected using microarray technology types, such as breast cancer, melanoma, cervical cancer and atroc- comprising more than 4,000 normal and neoplastic tissue samples ytomas,23–26 and in the neuro-endocrine differentiation of human including 79 different tumor categories. Validation of HOXD13 advanced prostate cancers.27 expression has been performed, at mRNA level, for selected tumor types. Significant differences are detectable between specific nor- Here, to immunohistochemically detect the expression of mal tissues and corresponding tumor types with the majority of HOXD13 homeoprotein in normal tissues and its potential deregu- cancers showing an increase in HOXD13 expression (16.1% nor- lation along the evolution of specific tumor types, we utilized tis- mal vs. 57.7% cancers). In contrast, pancreas and stomach tumor sue microarrays (TMAs) including >4,000 different normal tissue subtypes display the opposite trend. Interestingly, detection of the and cancer sample types from 79 different tumor categories. HOXD13 homeoprotein in pancreas-tissue microarrays shows HOXD13 expression has been further validated, at mRNA level, that its negative expression has a significant and adverse effect on through real-time quantification, for selected tumor types. the prognosis of patients with pancreatic cancer independent of the T or N stage at the time of diagnosis. Our study provides, for We report, for the first time, that an overview of a HOX protein the first time, an overview of a HOX protein expression in a large expression in a large series of normal and neoplastic tissues types series of normal and neoplastic tissue types, identifies pancreatic allows the identification of the specific cancer phenotype related cancer as one of the most affected by the HOXD13 hoemoprotein to the HOX protein function. This may represent a general and underlines the way homeoproteins can be associated to human approach useful for the whole HOX network to underline the role cancerogenesis. of the homeoproteins in human cancerogenesis and to allow ' 2009 UICC potential future clinical applications. Key words: HOXD13; HOX and multitumor tissue microarray; HOXD13 and pancreas Material and methods Class I Homeobox genes (Hox, mice; HOX, human) are tran- Normal tissue array, multitumor tissue array and scription factors mostly involved in embryonic development.1 pancreas tissue array They display an unique genomic network organization: 4 compact Three different sets of TMA were utilized for our study: a nor- chromosomal loci (HOXA at 7p15.3, HOXB at 17q21.3, HOXC at mal tissue array (NTA) composed of 8 samples of each 76 differ- 12q13.3 and HOXD at 2q312) where 39 sequence corresponding ent normal tissue types (n 5 608), a multitumor tissue array (MT- genes can be aligned with each other into 13 antero-posterior TMA) composed of up to 50 samples from 79 different tumor paralogous groups. The HOX gene network, the most repeat-poor types (n 5 4,018) and a pancreas tissue array (PTA) including 227 regions in the human genome,3 is also expressed in normal adult ductal carcinomas, 40 samples of pancreatic intraepithelial neopla- human organs.4 HOX genes appear to regulate phenotype cell iden- sia (PanIN3) and 40 specimens of normal pancreatic parenchyma tity,5,6 cell differentiation7,8 and control primary cellular processes, (n 5 307). Distale bile duct carcinomas, ampullary carcinomas as proven by the description of congenital,9 somatic10 and meta- and IPMN-associated carcinomas were not included in the PTA. bolic11 diseases involving these genes. Furthermore, besides the al- All ductal carcinomas of the pancreas were classified according to ready established role of the HOX network in hematopoiesis and the 6th Edition of the TNM classification (UICC).28 Selection and leukemogenesis,12 HOX genes are implicated in the neoplastic alter- characteristics of NTA and TMA have been reported elsewhere.29 ations of human solid tissues and organs such as kidney, colon, lung, skin, bladder, liver, breast and prostate.13,14 New crucial func- tions have recently been ascribed to HOX genes and homeoproteins Grant sponsor: Oncosuisse (Krebsliga Schweiz); Grant number: KLS mostly related to their interaction with miRNAs and ncRNAs to 02005-02-2007. Grant sponsor: Krebsliga Beider Basel; Grant number: guarantee transcription and export of specific mRNAs.15,16 KLBB 06/2006. Grant sponsor: PRIN (Italy); Grant number: 2006069951_003. Locus D HOX genes are localized on chromosome 2q31-32 and Monica Cantile, Renato Franco and Adrienne Tschan contributed play a role, with its posterior paralogous genes, in limb and digit equally to this work. generation during embryonic development17 through regulation of *Correspondence to: Department of Clinical & Experimental Medi- mesenchymal condensation. In this genomic area, a global control cine, Federico II University Medical School, Via S. Pansini 5, 80131 Na- ples, Italy. Fax: 10039-081-5454790. E-mail: [email protected] region (GCR) has been identified upstream of the HoxD cluster, Received 9 January 2009; Accepted after revision 5 March 2009 harboring cis-regulatory DNA elements able to coordinate DOI 10.1002/ijc.24438 the expression not only of HoxD genes and their immediate Published online 19 March 2009 in Wiley InterScience (www.interscience. surroundings but also of phylogenetically unrelated genes wiley.com). Publication of the International Union Against Cancer HOXD13 HOMEOPROTEIN IN MT-TMA 1533 TABLE I – COMPARISON OF HOXD13 NUCLEAR HOMEOPROTEIN EXPRESSION IN NORMAL TISSUE AND TUMOR TYPES OF THE SAME ORGAN (MULTITUMOR ARRAY) HOXD13 expression Organ Tissue type Cases (n) p-value1 Negative Positive p-value2 Mean (%) Median (%) Adrenal Gland Normal 6 0 0 0.014 6 (100.0) 0 (0.0) 0.014 Cortical adenoma 14 14.3 10 6 (42.9) 8 (57.1) 0.593 Phaeochromocytoma 23 4.3 0 19 (82.6) 4 (17.4) 0.002 Brain Normal 12 1.7 0 <0.001 10 (83.3) 2 (16.7) 0.021 Meningioma 47 4.5 0 35 (74.5) 12 (25.5) <0.001 Astrocytoma 45 12.9 0 24 (53.3) 21 (46.7) 0.655 Glioblastoma multiforme 35 25.1 20 4 (11.4) 31 (88.6) <0.001 Oligodendroglioma 21 22.9 10 8 (38.1) 13 (61.9) 0.275 Endometrium Normal 21 6.5 0 <0.001 14 (66.7) 7 (33.3) 0.127 Endometrioid adenocarcinoma 46 1.3 10 14 (30.4) 32 (69.6) 0.008 Serous adenocarcinoma 32 26.3 30 7 (21.9) 25 (78.1) 0.002 Esophagus Normal 12 3.6 0 0.247 10 (83.3) 2 (16.7) 0.021 Adenocarcinoma 9 8.9 0 6 (66.7) 3 (33.3) 0.317 Squamous cell carcinoma 32 10 0 17 (53.1) 15 (46.9) 0.724 Small-cell carcinoma 1 0 0 1 (100.0) Gall bladder Normal 9 8.9 0 0.178 7 (77.8) 2 (22.2) 0.096 Adenocarcinoma 44 3.6 0 22 (50.0) 22 (50.0) 1.0 Kidney Normal 24 9.2 10 0.534 20 (83.3) 4 (16.7) 0.001 Clear cell renal cell carcinoma 54 4.6 0 37 (68.5) 17 (31.5) 0.007 Papillary renal cell carcinoma 36 3.3 0 28 (77.8) 8 (22.2) <0.001 Chromophobe renal cell carcinoma 10 2 0 9 (90.0) 1 (10.0) 0.011 Oncocytoma 21 5.2 0 15 (71.4) 6 (28.6) 0.049 Larynx Squamous cell carcinoma 46 19.3 5 23 (50.0) 23 (50.0) 1.0 Liver Normal 20 7.5 0 0.887 16 (80.0) 4 (20.0) 0.007 Hepatocellular carcinoma 85 3.1 0 64 (75.3) 21 (24.7) <0.001 Lung Normal 23 2.7 0 <0.001 18 (78.3) 5 (21.7) 0.007 Squamous cell carcinoma 36 14.4 10 15 (41.7) 21 (58.3) 0.317 Adenocarcinoma 76 11.8 10 33 (43.4) 43 (56.6) 0.251 Large cell carcinoma 18 7.2 5 9 (50.0) 5 (50.0) 1.0 Small cell carcinoma 45 1.1 0 40 (88.9) 5 (11.1) <0.001 Bronchioloalveolar adenocarcinoma 7 14.3 20 2 (28.6) 5 (71.4) 0.257 Lymphoid tissue Normal lymph node 13 1.3 0 0.005 12 (92.3) 1 (7.7) 0.002 Nodular sclerosis Hodgkin lymphoma 25 9.2 0 17 (68.0) 8 (32.0) 0.072 Mixed cellularity Hodgkin lymphoma 17 5.3 0 11 (64.7) 6 (35.3) 0.225 Diffuse large B-cell lymphoma 10 2 0 9 (90.0) 1 (10.0) 0.011 Non-Hodgkin lymphoma, others 55 1.1 0 52 (94.6) 3 (5.4) <0.001 Myometrium Normal 54 7.5 0 <0.001 46 (85.2) 8 (14.8) <0.001 Leiomyoma 55 35.5 30 3 (5.5) 52 (94.6) <0.001 Neuroendocrine Typical
Load more

Recommended publications
  • (2017) Emerging Significance of Bile Acids
    Texas Medical Center Digestive Diseases Center 8th Annual Frontiers in Digestive Diseases Symposium: Emerging Significance of Bile Acids in Digestive & Liver Diseases Saturday, February 11, 2017 Onstead Auditorium, Houston, Texas 77030 Table of Contents ....................................................................................................................................................................... 1 Agenda .......................................................................................................................................................................................... 2 CME Activity............................................................................................................................................................................... 3 List of Abstracts .................................................................................................................................................................... 4 - 6 Abstracts............................................................................................................................................................................... 7 - 41 TMC DDC Leadership ............................................................................................................................................................ 42 List of Participants ............................................................................................................................................................ 43 - 46 Acknowledgements
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • A Conserved Tissue-Specific Homeodomain-Less Isoform of MEIS1 Is Downregulated in Colorectal Cancer
    Thomas Jefferson University Jefferson Digital Commons Department of Microbiology and Immunology Faculty Papers Department of Microbiology and Immunology 8-17-2011 A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer. Richard C Crist Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Jacquelyn J Roth Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Scott A Waldman Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia Arthur M Buchberg Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Follow this and additional works at: https://jdc.jefferson.edu/mifp Part of the Gastroenterology Commons, Medical Genetics Commons, Medical Microbiology Commons, Oncology Commons, and the Pathology Commons Let us know how access to this document benefits ouy Recommended Citation Crist, Richard C; Roth, Jacquelyn J; Waldman, Scott A; and Buchberg, Arthur M, "A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer." (2011). Department of Microbiology and Immunology Faculty Papers. Paper 25. https://jdc.jefferson.edu/mifp/25 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Microbiology and Immunology Faculty Papers by an authorized administrator of the Jefferson Digital Commons.
    [Show full text]
  • Homeobox Genes D11–D13 and A13 Control Mouse Autopod Cortical
    Research article Homeobox genes d11–d13 and a13 control mouse autopod cortical bone and joint formation Pablo Villavicencio-Lorini,1,2 Pia Kuss,1,2 Julia Friedrich,1,2 Julia Haupt,1,2 Muhammed Farooq,3 Seval Türkmen,2 Denis Duboule,4 Jochen Hecht,1,5 and Stefan Mundlos1,2,5 1Max Planck Institute for Molecular Genetics, Berlin, Germany. 2Institute for Medical Genetics, Charité, Universitätsmedizin Berlin, Berlin, Germany. 3Human Molecular Genetics Laboratory, National Institute for Biotechnology & Genetic Engineering (NIBGE), Faisalabad, Pakistan. 4National Research Centre Frontiers in Genetics, Department of Zoology and Animal Biology, University of Geneva, Geneva, Switzerland. 5Berlin-Brandenburg Center for Regenerative Therapies (BCRT), Charité, Universitätsmedizin Berlin, Berlin, Germany. The molecular mechanisms that govern bone and joint formation are complex, involving an integrated network of signaling pathways and gene regulators. We investigated the role of Hox genes, which are known to specify individual segments of the skeleton, in the formation of autopod limb bones (i.e., the hands and feet) using the mouse mutant synpolydactyly homolog (spdh), which encodes a polyalanine expansion in Hoxd13. We found that no cortical bone was formed in the autopod in spdh/spdh mice; instead, these bones underwent trabecular ossification after birth. Spdh/spdh metacarpals acquired an ovoid shape and developed ectopic joints, indicating a loss of long bone characteristics and thus a transformation of metacarpals into carpal bones. The perichon- drium of spdh/spdh mice showed abnormal morphology and decreased expression of Runt-related transcription factor 2 (Runx2), which was identified as a direct Hoxd13 transcriptional target. Hoxd11–/–Hoxd12–/–Hoxd13–/– tri- ple-knockout mice and Hoxd13–/–Hoxa13+/– mice exhibited similar but less severe defects, suggesting that these Hox genes have similar and complementary functions and that the spdh allele acts as a dominant negative.
    [Show full text]
  • HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genes
    University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2007-02-28 HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes Mohammad Q. Hassan University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Life Sciences Commons, and the Medicine and Health Sciences Commons Repository Citation Hassan MQ, Tare RS, Lee SH, Mandeville M, Weiner B, Montecino MA, Van Wijnen AJ, Stein JL, Stein GS, Lian JB. (2007). HOXA10 controls osteoblastogenesis by directly activating bone regulatory and phenotypic genes. Open Access Articles. https://doi.org/10.1128/MCB.01544-06. Retrieved from https://escholarship.umassmed.edu/oapubs/1334 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. MOLECULAR AND CELLULAR BIOLOGY, May 2007, p. 3337–3352 Vol. 27, No. 9 0270-7306/07/$08.00ϩ0 doi:10.1128/MCB.01544-06 Copyright © 2007, American Society for Microbiology. All Rights Reserved. HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genesᰔ Mohammad Q. Hassan,1 Rahul Tare,1† Suk Hee Lee,1 Matthew Mandeville,1 Brian Weiner,1 Martin Montecino,2 Andre J. van Wijnen,1 Janet L. Stein,1 Gary S. Stein,1 and Jane B. Lian1* Department of Cell Biology and Cancer Center, University of Massachusetts Medical School, Worcester, Massachusetts 01655,1 and Departamento de Bioquimica y Biologia Molecular, Facultad de Ciencias Biologicas, Universidad de Concepcion, Concepcion, Chile2 Received 18 August 2006/Returned for modification 4 October 2006/Accepted 9 February 2007 HOXA10 is necessary for embryonic patterning of skeletal elements, but its function in bone formation beyond this early developmental stage is unknown.
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • 1 Single-Cell Mrna Profiling Reveals Heterogeneous
    bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Single-cell mRNA profiling reveals heterogeneous combinatorial expression of Hoxd genes during limb development Short title: Single-cell Hox combinations in developing limbs Authors : P. J. Fabre1,4,*, M. Leleu1, B. Mascrez2, Q. Lo Giudice4, J. Cobb3 and D. Duboule1,2,* Affiliations: 1School of Life Sciences, Ecole Polytechnique Fédérale, Lausanne, 1015 Lausanne, Switzerland. 2Department of Genetics and Evolution, University of Geneva, 1211 Geneva 4, Switzerland. 3Department of Biological Sciences, University of Calgary, Calgary, Canada. 4Department of Basic Neurosciences, University of Geneva, 1205 Geneva, Switzerland. KEYWORDS: Hox genes, digits, limb, development, enhancers, single-cell, transcriptome, differentiation, gene expression. *Corresponding authors: Pierre Fabre ([email protected]) and Denis Duboule ([email protected]) HIGHLIGHTS • Collinear expression of Hox genes is only weaved at the tissue scale • Enhancer-sharing to specific target genes is reduced at the single-cell level • Hoxd gene combinatorial expression is linked to distinct transcriptional signatures • In presumptive digits, Hoxd combinations follow a pseudotime trajectory 1 bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • View Conveyed by the Global Labelling
    Fabre et al. BMC Biology (2018) 16:101 https://doi.org/10.1186/s12915-018-0570-z RESEARCHARTICLE Open Access Heterogeneous combinatorial expression of Hoxd genes in single cells during limb development P. J. Fabre1,4* , M. Leleu1, B. Mascrez2, Q. Lo Giudice4, J. Cobb3 and D. Duboule1,2* Abstract Background: Global analyses of gene expression during development reveal specific transcription patterns associated with the emergence of various cell types, tissues, and organs. These heterogeneous patterns are instrumental to ensure the proper formation of the different parts of our body, as shown by the phenotypic effects generated by functional genetic approaches. However, variations at the cellular level can be observed within each structure or organ. In the developing mammalian limbs, expression of Hox genes from the HoxD cluster is differentially controlled in space and time, in cells that will pattern the digits and the forearms. While the Hoxd genes broadly share a common regulatory landscape and large-scale analyses have suggested a homogenous Hox gene transcriptional program, it has not previously been clear whether Hoxd genes are expressed together at the same levels in the same cells. Results: We report a high degree of heterogeneity in the expression of the Hoxd11 and Hoxd13 genes. We analyzed single-limb bud cell transcriptomes and show that Hox genes are expressed in specific combinations that appear to match particular cell types. In cells giving rise to digits, we find that the expression of the five relevant Hoxd genes (Hoxd9 to Hoxd13) is unbalanced, despite their control by known global enhancers. We also report that specific combinatorial expression follows a pseudo-time sequence, which is established based on the transcriptional diversity of limb progenitors.
    [Show full text]
  • Genetic Screening of 202 Individuals with Congenital Limb Malformations
    Original article Genetic screening of 202 individuals with congenital J Med Genet: first published as 10.1136/jmg.2009.066027 on 7 May 2009. Downloaded from limb malformations and requiring reconstructive surgery D Furniss,1,2 S-h Kan,1 I B Taylor,1 D Johnson,2 P S Critchley,2 H P Giele,2 A O M Wilkie1 c Additional tables and figure ABSTRACT Previous investigations into the genetics of are published online only at Background: Congenital limb malformations (CLMs) are human CLM have taken two approaches. First, http://jmg.bmj.com/content/ vol46/issue11 common and present to a variety of specialties, notably positional candidate methods have been used to plastic and orthopaedic surgeons, and clinical geneticists. identify mutated genes in affected families follow- 1 Weatherall Institute of The authors aimed to characterise causative mutations in ing linkage analysis, or in individuals harbouring Molecular Medicine, University 34 of Oxford, Oxford, UK; an unselected cohort of patients with CLMs requiring chromosome abnormalities. Second, genetic 2 Department of Plastic and reconstructive surgery. mutations causing CLM have been identified in Reconstructive Surgery, John Methods: 202 patients presenting with CLM were model organisms such as the mouse, and the Radcliffe Hospital, Oxford, UK recruited. The authors obtained G-banded karyotypes and orthologous gene in humans has been screened for 5 Correspondence to: screened EN1, GLI3, HAND2, HOXD13, ROR2, SALL1, mutations in patients with a similar phenotype. Professor A O M Wilkie, SALL4, ZRS of SHH, SPRY4, TBX5, TWIST1 and WNT7A for Although these approaches have yielded many Weatherall Institute of Molecular point mutations using denaturing high performance liquid important gene discoveries, they also have inherent Medicine, University of Oxford, chromatography (DHPLC) and direct sequencing.
    [Show full text]
  • The Posterior HOXD Locus: Its Contribution to Phenotype and Malignancy of Ewing Sarcoma Supplementary Materials
    www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 The posterior HOXD locus: Its contribution to phenotype and malignancy of Ewing sarcoma Supplementary Materials SUPPLEMENTARY MATERIALS AND (antisense); si.HOXD11_6 5′-GGCCGAGCGGAUCCU METHODS AAUAUU-3′ (sense) and 5′-AAUAUUAGGAUCCGCU CGGCC-3′ (antisense); si.HOXD13_1 5′-GAGAGUGCC UUACACCAAAUU-3′ (sense) and 5′-UUUGGUGUAAG Cell lines GCACUCUCUU-3′ (antisense); si.HOXD13_2 5′-GAA Osteosarcoma cell lines (HOS, MG-63, SaOS-2 and CCUAUCUGAGAGACAAUU-3′ (sense) and 5′-UUGUC U2 OS) were kindly provided by Jan Smida and Michaela UCUCAGAUAGGUUCGU-3′ (antisense); si.HOXD13_3 Nathrath, Institute of Pathology and Radiation Biology 5′-CAGUAUAAAGGGACUUGAAGC-3′ (sense) and (Neuherberg, Germany) and ES line EW7 by Olivier 5′-GCUUCAAGUCCCUUUAUACUG-3′ (antisense); si. Delattre, Institut Curie (Paris, France). A673 was purchased TCF4_3 5′-CAGCUGUUUGGUCUAGAAATT-3′ (sense) from ATCC (LGC Standards GmbH). The other ES lines and 5′-UUUCUAGACCAAACAGCUGTG-3′ (antisense); (MHH-ES1, RD-ES, SK-ES1, SK-N-MC and TC-71) si.TCF4_5 5′-CGACAAGAAGGAUAUCAAATT-3′ and neuroblastoma lines (SH-SY5Y and SIMA) were (sense) and 5′-UUUGAUAUCCUUCUUGUCGTC-3′ obtained from the German Collection of Microorganisms (antisense) and si.control 5′-UUCUCCGAACGUGUC and Cell Cultures (DSMZ). Mesenchymal stem cells L87 ACGU-3′ (sense) and 5′-ACGUGACACGUUCGGAG and V54.2, kindly provided by Peter Nelson (Medizinische AA-3′ (antisense). Klinik und Poliklinik IV, München, Germany), were immortalized with SV40 large T-antigen [1]. Retrovirus Short hairpin RNA coding oligonucleotides packaging cell line PT67 was from Takara Bio Europe/ Clontech. DKK2 (sh.DKK2) 5′-GATCCGGGGATTT GCTATCATAATATTCAAGAGATATTATGATAGCAAA Small interfering RNAs used TCCCCTTTTTTCTAGAG-3′ (sense) and 5′-AATTCTCT AGAAAAAAGGGGATTTGCTATCATAATATCTCTTG siRNAs for EWS-FLI1 were synthesized at MWG AATATTATGATAGCAAATCCCCG-3′ (antisense); Biotech and correspond to published sequences [2].
    [Show full text]
  • BMC Biology Biomed Central
    BMC Biology BioMed Central Research article Open Access Classification and nomenclature of all human homeobox genes PeterWHHolland*†1, H Anne F Booth†1 and Elspeth A Bruford2 Address: 1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK and 2HUGO Gene Nomenclature Committee, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, UK Email: Peter WH Holland* - [email protected]; H Anne F Booth - [email protected]; Elspeth A Bruford - [email protected] * Corresponding author †Equal contributors Published: 26 October 2007 Received: 30 March 2007 Accepted: 26 October 2007 BMC Biology 2007, 5:47 doi:10.1186/1741-7007-5-47 This article is available from: http://www.biomedcentral.com/1741-7007/5/47 © 2007 Holland et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results: We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes.
    [Show full text]