Genetic Screening of 202 Individuals with Congenital Limb Malformations
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
(2017) Emerging Significance of Bile Acids
Texas Medical Center Digestive Diseases Center 8th Annual Frontiers in Digestive Diseases Symposium: Emerging Significance of Bile Acids in Digestive & Liver Diseases Saturday, February 11, 2017 Onstead Auditorium, Houston, Texas 77030 Table of Contents ....................................................................................................................................................................... 1 Agenda .......................................................................................................................................................................................... 2 CME Activity............................................................................................................................................................................... 3 List of Abstracts .................................................................................................................................................................... 4 - 6 Abstracts............................................................................................................................................................................... 7 - 41 TMC DDC Leadership ............................................................................................................................................................ 42 List of Participants ............................................................................................................................................................ 43 - 46 Acknowledgements -
Detailed Review Paper on Retinoid Pathway Signalling
1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process. -
Type II Familial Synpolydactyly: Report on Two Families with an Emphasis on Variations of Expression
European Journal of Human Genetics (2011) 19, 112–114 & 2011 Macmillan Publishers Limited All rights reserved 1018-4813/11 www.nature.com/ejhg SHORT REPORT Type II familial synpolydactyly: report on two families with an emphasis on variations of expression Mohammad M Al-Qattan*,1 Type II familial synpolydactyly is rare and is known to have variable expression. However, no previous papers have attempted to review these variations. The aim of this paper was to review these variations and show several of these variable expressions in two families. The classic features of type II familial synpolydactyly are bilateral synpolydactyly of the third web spaces of the hands and bilateral synpolydactyly of the fourth web spaces of the feet. Several members of the two families reported in this paper showed the following variations: the third web spaces of the hands showing syndactyly without the polydactyly, normal feet, concurrent polydactyly of the little finger, concurrent clinodactyly of the little finger and the ‘homozygous’ phenotype. It was concluded that variable expressions of type II familial synpolydactyly are common and awareness of such variations is important to clinicians. European Journal of Human Genetics (2011) 19, 112–114; doi:10.1038/ejhg.2010.127; published online 18 August 2010 Keywords: type II familial syndactyly; inherited synpolydactyly; variations of expression INTRODUCTION CASE REPORTS Type II familial synpolydactyly is rare and it has been reported in o30 The first family families.1–12 It is characterized by bilateral synpolydactyly of the third The family had a history of synpolydactyly type II for several web spaces of the hands and bilateral synpolydactyly of the fourth web generations on the mother’s side (Table 1). -
The Genetic Basis for Skeletal Diseases
insight review articles The genetic basis for skeletal diseases Elazar Zelzer & Bjorn R. Olsen Harvard Medical School, Department of Cell Biology, 240 Longwood Avenue, Boston, Massachusetts 02115, USA (e-mail: [email protected]) We walk, run, work and play, paying little attention to our bones, their joints and their muscle connections, because the system works. Evolution has refined robust genetic mechanisms for skeletal development and growth that are able to direct the formation of a complex, yet wonderfully adaptable organ system. How is it done? Recent studies of rare genetic diseases have identified many of the critical transcription factors and signalling pathways specifying the normal development of bones, confirming the wisdom of William Harvey when he said: “nature is nowhere accustomed more openly to display her secret mysteries than in cases where she shows traces of her workings apart from the beaten path”. enetic studies of diseases that affect skeletal differentiation to cartilage cells (chondrocytes) or bone cells development and growth are providing (osteoblasts) within the condensations. Subsequent growth invaluable insights into the roles not only of during the organogenesis phase generates cartilage models individual genes, but also of entire (anlagen) of future bones (as in limb bones) or membranous developmental pathways. Different mutations bones (as in the cranial vault) (Fig. 1). The cartilage anlagen Gin the same gene may result in a range of abnormalities, are replaced by bone and marrow in a process called endo- and disease ‘families’ are frequently caused by mutations in chondral ossification. Finally, a process of growth and components of the same pathway. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Genetics of Congenital Hand Anomalies
G. C. Schwabe1 S. Mundlos2 Genetics of Congenital Hand Anomalies Die Genetik angeborener Handfehlbildungen Original Article Abstract Zusammenfassung Congenital limb malformations exhibit a wide spectrum of phe- Angeborene Handfehlbildungen sind durch ein breites Spektrum notypic manifestations and may occur as an isolated malforma- an phänotypischen Manifestationen gekennzeichnet. Sie treten tion and as part of a syndrome. They are individually rare, but als isolierte Malformation oder als Teil verschiedener Syndrome due to their overall frequency and severity they are of clinical auf. Die einzelnen Formen kongenitaler Handfehlbildungen sind relevance. In recent years, increasing knowledge of the molecu- selten, besitzen aber aufgrund ihrer Häufigkeit insgesamt und lar basis of embryonic development has significantly enhanced der hohen Belastung für Betroffene erhebliche klinische Rele- our understanding of congenital limb malformations. In addi- vanz. Die fortschreitende Erkenntnis über die molekularen Me- tion, genetic studies have revealed the molecular basis of an in- chanismen der Embryonalentwicklung haben in den letzten Jah- creasing number of conditions with primary or secondary limb ren wesentlich dazu beigetragen, die genetischen Ursachen kon- involvement. The molecular findings have led to a regrouping of genitaler Malformationen besser zu verstehen. Der hohe Grad an malformations in genetic terms. However, the establishment of phänotypischer Variabilität kongenitaler Handfehlbildungen er- precise genotype-phenotype correlations for limb malforma- schwert jedoch eine Etablierung präziser Genotyp-Phänotyp- tions is difficult due to the high degree of phenotypic variability. Korrelationen. In diesem Übersichtsartikel präsentieren wir das We present an overview of congenital limb malformations based Spektrum kongenitaler Malformationen, basierend auf einer ent- 85 on an anatomic and genetic concept reflecting recent molecular wicklungsbiologischen, anatomischen und genetischen Klassifi- and developmental insights. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
HOX D13 Expression Across 79 Tumor Tissue Types
Int. J. Cancer: 125, 1532–1541 (2009) ' 2009 UICC HOX D13 expression across 79 tumor tissue types Monica Cantile1,3, Renato Franco3, Adrienne Tschan2, Daniel Baumhoer2, Inti Zlobec2, Giulia Schiavo2, Iris Forte3, Michel Bihl2, Giuseppina Liguori3, Gerardo Botti3, Luigi Tornillo2, Eva Karamitopoulou-Diamantis4, Luigi Terracciano2,5 and Clemente Cillo1,2* 1Department of Clinical & Experimental Medicine, Federico II University Medical School, Naples, Italy 2Molecular Pathology Department, Institute of Pathology, University of Basel, Basel, Switzerland 3Surgical Pathology Department, National Cancer Institute ‘‘G.Pascale,’’ Naples, Italy 4Second Department of Pathology, University of Athens, Athens, Greece 5Health Science Department, University of Molise, Italy HOX genes control normal development, primary cellular proc- (CREB1, CREB2, Neuro D1) lying several hundred kilobases from esses and are characterized by a unique genomic network organi- one another.18 zation. Locus D HOX genes play an important role in limb genera- The most posterior located HOXD gene, HOXD13, was the first tion and mesenchymal condensation. Dysregulated HOXD13 19 expression has been detected in breast cancer, melanoma, cervical HOX gene to be described as mutated in human synpolidactyly. During normal morphogenesis, HOXD13 is involved in the deter- cancer and astrocytomas. We have investigated the epidemiology 20–22 of HOXD13 expression in human tissues and its potential deregu- mination of the terminal digestive and urogenital tracts. lation in the carcinogenesis of specific tumors. HOXD13 homeo- HOXD13 deregulation has been further detected in different tumor protein expression has been detected using microarray technology types, such as breast cancer, melanoma, cervical cancer and atroc- comprising more than 4,000 normal and neoplastic tissue samples ytomas,23–26 and in the neuro-endocrine differentiation of human including 79 different tumor categories. -
Angeborene Fehlbildungen Der Extremitäten
Aus der Klinik für Orthopädie (Direktor: Prof. Dr. med. J. Hassenpflug) der Medizinischen Fakultät der Christian-Albrechts-Universität zu Kiel Die angeborenen Fehlbildungen der oberen und unteren Extremitäten in der Orthopädischen Universitätsklinik Kiel von 1974-2001 Inauguraldissertation zur Erlangung der Doktorwürde vorgelegt von Karsten Naused aus Wolfenbüttel Kiel 2014 1. Berichterstatter: Prof. Dr. J. Hassenpflug, Klinik für Orthopädie 2. Berichterstatter: Prof. Dr. M. Schrappe, Klinik für Allgemeine Pädiatrie Tag der mündlichen Prüfung: 12.06.2014 Zum Druck genehmigt, Kiel, den 12.06.2014 gez.: PD Dr. S. Lippross, Klinik Unfallchirurgie (Prüfer) Prof. Dr. A. Seekamp, Klinik Unfallchirurgie (Beisitzer) Prof. Dr. Johann Roider, Vorsitzender des Ausschusses für Promotion Inhaltsverzeichnis 1. Einleitung Seite 1.1 Vorbemerkung.................................................................................................1 1.2 Historisches.....................................................................................................2 1.3 Embryologie.....................................................................................................3 1.4 Ätiologie und Pathogenese..............................................................................6 2. Patientengut und Methode 2.1 Quellen der Patientendaten...........................................................................10 2.2 Dokumentation der Daten..............................................................................12 2.3 Datenabfrage.................................................................................................13 -
A Conserved Tissue-Specific Homeodomain-Less Isoform of MEIS1 Is Downregulated in Colorectal Cancer
Thomas Jefferson University Jefferson Digital Commons Department of Microbiology and Immunology Faculty Papers Department of Microbiology and Immunology 8-17-2011 A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer. Richard C Crist Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Jacquelyn J Roth Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Scott A Waldman Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia Arthur M Buchberg Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Follow this and additional works at: https://jdc.jefferson.edu/mifp Part of the Gastroenterology Commons, Medical Genetics Commons, Medical Microbiology Commons, Oncology Commons, and the Pathology Commons Let us know how access to this document benefits ouy Recommended Citation Crist, Richard C; Roth, Jacquelyn J; Waldman, Scott A; and Buchberg, Arthur M, "A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer." (2011). Department of Microbiology and Immunology Faculty Papers. Paper 25. https://jdc.jefferson.edu/mifp/25 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Microbiology and Immunology Faculty Papers by an authorized administrator of the Jefferson Digital Commons. -
Triphalangeal Thumb: Clinical Features and Treatment
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Erasmus University Digital Repository Full Length Article Journal of Hand Surgery (European Volume) Triphalangeal thumb: clinical features 2019, Vol. 44(1) 69–79 and treatment ! The Author(s) 2018 Article reuse guidelines: sagepub.com/journals-permissions DOI: 10.1177/1753193418797922 1,2,3 1 Steven E. R. Hovius , Jacob W. P. Potuijt and journals.sagepub.com/home/jhs Christianne A. van Nieuwenhoven1 Abstract Triphalangeal thumb is a rare congenital anomaly in which the thumb has three phalanges. Clinical presen- tation of triphalangeal thumb can vary considerably and can be present in both hands or unilateral. The thumb can be long with a Enger-like appearance. The presence of clinodactyly depends on the shape of the extra phalanx varying from wedge-shaped to rectangular. Various joints, ligaments, muscles, and tendons of the Erst ray can be hypoplastic or absent, with varying degrees of stiffness or instability. The aim of surgical treatment is to reconstruct or correct the anatomic anomalies to obtain greater function and a more accept- able appearance. In our series, operations varied from removal of the delta phalanx with ligament recon- struction to multiple osteotomies and rebalancing of soft tissues. Results in these often complex cases can be rewarding if the surgeon has sufEcient knowledge of the underlying anatomic differences. This review sum- marizes our current concepts of presentation and management of the triphalangeal thumb. Keywords Congenital hand, triphalangeal thumb, reconstruction Date received: 16th June 2018; revised: 7th August 2018; accepted: 7th August 2018 Introduction Based on our results, the prevalence of TPT in the Triphalangeal thumb (TPT) is a congenital hand Netherlands is higher than stated in the literature anomaly in which the thumb has an additional phal- (1:16,000). -
Homeobox Genes D11–D13 and A13 Control Mouse Autopod Cortical
Research article Homeobox genes d11–d13 and a13 control mouse autopod cortical bone and joint formation Pablo Villavicencio-Lorini,1,2 Pia Kuss,1,2 Julia Friedrich,1,2 Julia Haupt,1,2 Muhammed Farooq,3 Seval Türkmen,2 Denis Duboule,4 Jochen Hecht,1,5 and Stefan Mundlos1,2,5 1Max Planck Institute for Molecular Genetics, Berlin, Germany. 2Institute for Medical Genetics, Charité, Universitätsmedizin Berlin, Berlin, Germany. 3Human Molecular Genetics Laboratory, National Institute for Biotechnology & Genetic Engineering (NIBGE), Faisalabad, Pakistan. 4National Research Centre Frontiers in Genetics, Department of Zoology and Animal Biology, University of Geneva, Geneva, Switzerland. 5Berlin-Brandenburg Center for Regenerative Therapies (BCRT), Charité, Universitätsmedizin Berlin, Berlin, Germany. The molecular mechanisms that govern bone and joint formation are complex, involving an integrated network of signaling pathways and gene regulators. We investigated the role of Hox genes, which are known to specify individual segments of the skeleton, in the formation of autopod limb bones (i.e., the hands and feet) using the mouse mutant synpolydactyly homolog (spdh), which encodes a polyalanine expansion in Hoxd13. We found that no cortical bone was formed in the autopod in spdh/spdh mice; instead, these bones underwent trabecular ossification after birth. Spdh/spdh metacarpals acquired an ovoid shape and developed ectopic joints, indicating a loss of long bone characteristics and thus a transformation of metacarpals into carpal bones. The perichon- drium of spdh/spdh mice showed abnormal morphology and decreased expression of Runt-related transcription factor 2 (Runx2), which was identified as a direct Hoxd13 transcriptional target. Hoxd11–/–Hoxd12–/–Hoxd13–/– tri- ple-knockout mice and Hoxd13–/–Hoxa13+/– mice exhibited similar but less severe defects, suggesting that these Hox genes have similar and complementary functions and that the spdh allele acts as a dominant negative.