Therapeutic Potential of Antibodies Against FZD10, a Cell-Surface Protein, for Synovial Sarcomas

Home , Cell surface receptor, FZD10, FZD3, FZD5, FZD9

Oncogene (2005) 24, 6201–6212 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc ORIGINAL PAPERS Therapeutic potential of antibodies against FZD10, a cell-surface protein, for synovial sarcomas

Satoshi Nagayama1,2,6, Chikako Fukukawa1,6, Toyomasa Katagiri1, Takeshi Okamoto3,4, Tomoki Aoyama3,4, Naoki Oyaizu5, Masayuki Imamura2, Junya Toguchida3 and Yusuke Nakamura*,1

1Laboratory of Molecular Medicine, Human Genome Center, The Institute of Medical Science, The University of Tokyo, Tokyo 108- 8639, Japan; 2Department of Surgery and Surgical Basic Science, Graduate School of Medicine, Kyoto University, Kyoto 606-8507, Japan; 3Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan; 4Department of Orthopaedic Surgery, Graduate School of Medicine, Kyoto University, Kyoto 606-8507, Japan; 5Department of Laboratory Medicine, Division of Pathology, Hospital of the Institute of Medical Science, The University of Tokyo, Tokyo 108-8639, Japan

Genome-wide expression profiling revealed overexpression lymphoma (Fendly et al., 1990; Maloney et al., 1997). of the gene encoding frizzled homologue 10 (FZD10), a Humanized antibodies are thought to exert antitumor cell-surface receptor for molecules in the Wnt pathway, as effects by inhibiting transduction of growth signals a potential contributor to synovial sarcomas (SS). North- either by blocking cell-surface receptors or downregu- ern blotting and immunohistochemical staining confirmed lating target molecules, and/or by contributing to that expression levels of FZD10 were very high in nearly antibody-dependent cell-mediated cytotoxicity (ADCC). all SS tumors and cell lines examined but absent in most Those promising observations imply that a genome-wide normal organs or in some cancers arising in other tissues. search for cancer-specific cell-surface molecules should Treatment of human SS cells with small-interfering RNA be an effective approach to development of new (siRNA) to FZD10 decreased the amount of its product treatments for various types of cancer. and suppressed growth of SS cells. Moreover, a polyclonal Among malignant tumors occurring in mesenchymal antibody specifically recognizing the extracellular domain tissues, osteosarcomas, Ewing’s sarcomas and rhabdo- (ECD) of FZD10 was markedly effective in mediating myosarcomas are generally sensitive to chemotherapy. ADCC against FZD10-overexpressing synovial sarcoma However, other sarcomas, especially spindle-cell sarco- cells in vitro. Injection of the antibody into SS xenografts mas in adults such as synovial sarcomas (SS), are chemo in nude mice attenuated tumor growth, and TUNEL and radiation resistant and show poor prognosis assays revealed clusters of apoptotic cells in antibody- (Sarcoma Meta-analysis Collaboration, 1997; Wunder treated xenografts. Taken together, these findings suggest et al., 1998; Crist et al., 2001; Ferguson and Goorin, that a humanized antibody against FZD10 might be a 2001). Therefore, novel treatment modalities including promising treatment for patients with tumors that over- antibody-based therapy need to be developed in the express FZD10; minimal or no adverse reactions would be interest of further improvement. expected because FZD10 protein is not abundant in vital If one is to avoid severe adverse reactions, a critical organs. issue for development of any antibody-based therapy is Oncogene (2005) 24, 6201–6212. doi:10.1038/sj.onc.1208780; to identify cell-surface molecules that are overexpressed published online 27 June 2005 in the majority of the target tumors but are absent or barely detectable in normal tissues. Based upon a Keywords: synovial sarcoma; antibody-based therapy; genome-wide analysis of gene-expression profiles of FZD10; ADCC; xenograft soft-tissue sarcomas, we identified 26 genes that were commonly upregulated in SS (Nagayama et al., 2002). From among them we selected a likely candidate, Introduction Frizzled homologue 10 (FZD10), whose product belongs to the Frizzled family of seven-pass transmembrane Humanized monoclonal antibodies, such as trastuzu- receptors for molecules in the Wnt signaling pathway. mab against ErbB2 and rituximab against CD20, have Our criteria for selection were: (i) very low or absent contributed to remarkable improvement of clinical expression in vital organs including the brain, heart, outcomes in some cases of breast cancer and malignant lung, liver, kidney and bone marrow; and (ii) location of the predicted product in the plasma membrane. Upre- gulation of FZD10 has been reported in primary *Correspondence: Y Nakamura; colorectal cancers (Terasaki et al., 2002) and primary E-mail: [email protected] 6These authors contributed equally to this work gastric cancers (Kirikoshi et al., 2001) as well as SS, but Received 31 January 2005; revised 18 April 2005; accepted 22 April 2005; the precise biological behavior of FZD10 in regard to published online 27 June 2005 tumorigenesis remains obscure. FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6202 In this study, we generated a specific polyclonal This finding supported a conclusion that TT641 pAb antibody that recognized the N-terminal extracellular recognized epitope(s) of FZD10 but not other members domain (ECD), of FZD10 as a step toward development of the FZD family. of antibody-based therapy for SS. The results of our To examine the subcellular localization of FZD10 experiments, in vitro and in vivo, have led us to believe protein, we established lines of COS7-FZD10 cells (S5, that a humanized antibody against FZD10-ECD would S9, S10, S3 and S11) that stably overexpressed FZD10 have therapeutic potential for treatment of SS and other (Figure 1e). When COS7-FZD10 cells were counter- tumors that overexpress FZD10. We also demonstrated stained with Texas Red-conjugated anti-myc antibody, that suppression of FZD10 can inhibit growth of SS the red signal coincided with the green one of TT641 cells. These observations suggested that overexpression pAb (Figure 1f), confirming specific binding of TT641 of FZD10 might be a key factor for tumorigenesis of pAb to FZD10. Furthermore, the appearance of synovial sarcoma. endogenous FZD10 in HS-SY-2 and YaFuSS cells corresponded to the expression pattern in stable transfectants (Figure 1g). It is not clear why FZD10 Results appears in a dotted pattern in the cytoplasm, but we presume that mature cell-surface antigen would be Expression of FZD10 mRNA in normal adult tissues and present in relatively low concentrations, while abundant tumor samples unprocessed proteins in the cytoplasm could be detectable by immunocytochemistry. Northern blot analysis revealed that FZD10 was To clarify the question of subcellular localization, we expressed to any significant degree only in placenta performed flow cytometry using SS cell lines YaFuSS, among the normal adult human tissues examined HS-SY-2 and SYO-1 that were specifically labeled with (Figure 1a), in accordance with a previous report (Koike TT641 pAb (Figure 1h); no fluorescent signals were et al., 1999). However, this gene was expressed in SS detected in HT29 or LoVo cell lines. These observations surgical specimens SS487 and SS582, as well as in SS cell correlated with the expression levels of FZD10 observed lines HS-SY-2 and YaFuSS, at higher levels than in on Northern blots (Figure 1b). Taken together, the placenta. We found no detectable signals in colon- findings indicate that the TT641 pAb specifically cancer cell lines SW480, HT29 or LoVo (Figure 1b). recognizes the ECD of FZD10 under either native or denaturing conditions. Recognition of FZD10-ECD by a specific polyclonal To further characterize the specificity of TT641 pAb, antibody we performed epitope mapping using the SPOTs system (see Materials and methods). TT641 pAb recognized Using an affinity-purified antibody (TT641 pAb) that six different epitopes of FZD10-ECD in different recognized FZD10-ECD, we observed a single band degrees (Figure 2). The antibody showed the strongest compatible with the expected molecular size of FZD10 reactivity to the epitope representing residues 214–226, a protein in HS-SY-2, YaFuSS and HeLa cells where high sequence likely to be critical for binding of TT641 pAb levels of FZD10 transcript had been detected. This band to FZD10-ECD. was absent or hardly detectable in several colon-cancer cell lines (Figure 1c). Since other proteins in the frizzled FZD10 protein in normal adult human tissues and family are similar in size, we examined whether the primary SS specimens 68-kD band recognized by TT641 pAb was specific to FZD10. When the levels of transcription of ten FZD We designed immunohistochemical experiments to genes were examined by semiquantitative RT–PCR investigate whether TT641 pAb could specifically (Figure 1d), the pattern of FZD10 was quite similar to recognize FZD10 in normal adult human tissues and that detected by Western blotting with TT641 pAb, surgical SS specimens. Strong staining for FZD10 was especially in regard to the HeLa and LoVo cell lines. observed in placenta (Figure 3a) but, as expected from

Figure 1 Expression of FZD10 and specific recognition by TT641 pAb. (a) Northern blot analysis of FZD10 in eight normal adult human tissues, two SS cell lines (HS-SY-2 and YaFuSS), and two surgical SS specimens (SS487 and SS582), and (b) in three colon- cancer cell lines. (c) Western blot analyses of FZD10 protein in SS cell lines (HS-SY-2 and YaFuSS), colon-cancer lines (SW480, LoVo, DLD1, HT29, HCT116, SNU-C4 and SNU-C5), a cervical-adenocarcinoma cell line (HeLa). b-actin expression was used as a loading control. (d) Semiquantitative RT–PCR of ten FZD genes in the same tumor cell lines. Expression of b2-microglobulin gene (b2MG) served as an internal control. Members of the FZD family are listed in order of their degree of homology in amino-acid sequence with FZD10-ECD; FZD9 is the closest homologue. (e) Western blot showing stable overexpression of FZD10 in COS7 cells; S5, S9, S10, S3 and S11 are representative transfectants. The exogenously expressed products were the same size as endogenous FZD10 expressed in SS cell lines HS-SY-2 and YaFuSS. (f) Immunocytochemical staining using anti-myc antibody and TT641 pAb. The first panel shows immunostaining with Texas Red-conjugated anti-myc. The panel below it shows the same cells treated with TT641 pAb (stain: Alexa Fluor 488), and both signals are overlaid in the double-color image as a yellow signal (right). (g) Immunocytochemical staining with TT641 pAb for detection of endogenous FZD10 in two SS cell lines. (h) Flow-cytometric analysis using TT641 pAb in three SS lines (top panels) and two colon-cancer cell lines (lower panels). Solid lines show expression of the cell-surface antigen FZD10 detected by TT641 pAb; broken lines depict the fluorescent signals of cells incubated with nonimmunized rabbit IgG as a negative control

Oncogene FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6203 Northern analysis, none was detected in normal brain, bottom of the glands. Similarly, in the normal colon heart, lung or liver tissues (Figure 3b-e). In the normal (Figure 3i) epithelial cells showed strong immunoreac- kidney, however, positive staining was observed in the tivity of FZD10 only at the surface of the villi. In proximal and distal tubules (Figure 3f). In the normal contrast, cytoplasmic staining especially strong in stomach (Figure 3g and h), strong immunoreactivity epithelial tumor cells of a biphasic SS specimen, was observed in the upper portion of gastric glands, but while spindle cells showed only faint immunoreactivity the intensity was much weaker in cells located at the (Figure 3j and k). In summary, expression of FZD10

a b c HeLa YaFuSS SW480 Lovo DLD1 HCT116 SNU-C4 HS-SY-2 HT29 SNU-C5 FZD10 Liver YaFuSS Kidney Pancreas HS-SY-2 HT29 Lung Placenta SS487 SS582 LoVo SW480 HS-SY-2 YaFuSS Placenta Heart Brain Bone marrow SYO-1 β-actin

9.5 d FZD10 9.5 7.5 7.5 FZD9 4.4 4.4 FZD4

2.37 2.37 FZD8 FZD3 1.35 1.35 FZD1 FZD7 FZD6 e f FZD2 FZD5 YaFuSS S10 S11 Mock HS-SY-2 S5 S9 S3 β2MG 150 g HS-SY-2 100 YaFuSS

75 myc FZD10 50

37 merge

β-actin FZD10

h 180 200 140 YaFuSS HS-SY-2 SYO-1 150 120 160 100 120 120 80 90 60 Counts Counts 80 Counts 60 40 40 30 20

0 0 0 100 101 102 103 100 101 102 103 100 101 102 103 FL1-H FL1-H FL1-H

200 120 HT29 LoVo 160 100 80 120 60 Counts 80 Counts 40

40 20

0 0 0 1 2 3 100 101 102 103 10 10 10 10 FL1-H FL1-H Fluorescence Intensity

Oncogene FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6204 (T E Ab). Even when the target cells were incubated 115þ þ with different concentrations of TT641 pAb in different E : T ratios, cytotoxicity was induced only when both the 43 antibody and human effector cells were added at the same time. Addition of 1 mg of TT641 pAb per well induced about 100% of the cell-mediated cytotoxicity against FZD10-overexpressing cells at an E : T ratio of 61 25 : 1 (Figure 4b). This cytotoxic effect was in positive correlation with the E : T ratios and the amount of antibody present. No significant ADCC was induced by a control antibody against the target cells. These results suggested that TT641 pAb might inhibit growth of FZD10-overexpressing tumors through the ADCC mechanism. 157 Inhibition of growth of SS xenografts by TT641 pAb 174 189 The growth of SS xenografts in nude mice was attenuated by treatment with TT641 pAb, as compared 214 to treatment with nonimmunized rabbit IgG (Figure 5). At day 6 after initiation of antibody treatment, SS xenografts in mice treated with TT641 pAb were 211 216 significantly smaller than negative controls 214 GVDVYWSREDKR (P ¼ 1.71 Â 10À5; Student’s t-test). 157 EPTRGSGLFPPLFRPQ We performed TUNEL analyses to clarify the 174 PHSAQEHPLKDGGPGRGG mechanism involved. Tumor specimens treated with 43 KDIGYNMTRMPNLM TT641 pAb showed clusters of apoptotic cells (Figure 6f 61 QREAAIQLHEFA and l), which were negative for cell-proliferation marker 189 RGGCDNPGKFHHVE Ki-67 (Figure 6e and k); no such clusters were observed in tumor specimens serving as negative controls (Figure Figure 2 Epitope mapping with overlapping synthetic linear peptides. TT641 pAb recognized six different epitopes of FZD10 6c and i). Since apoptotic cells in the tumors were in different degrees, among which the epitope representing residues surrounded by many viable cells (i.e., cells positive for 214–226 showed the strongest antigenicity. Bold letters in the Ki-67 staining; Figure 6e and k), the growth-inhibitory bottom panel indicate possible core epitopes of FZD10-ECD effect of TT641 pAb on SS xenografts appeared to be insufficient to cause drastic regression of the tumors.

protein appeared to be absent or low in normal vital Effect of FZD10-small-interfering RNAs (siRNAs) organs compared to its highly increased expression in SS on growth of synovial sarcoma cell lines tissues. Colon-cancer cells from a primary lesion (Figure 3l) and liver lesions metastasized from the colon To investigate the biological functions of FZD10, we (Figure 3m and n) were also immunostained with TT641 constructed siRNA expression vectors speciﬁc to FZD10 pAb, but no detectable signal was observed in the under the control of the U6 promoter (psiU6BX- stromal tissues of the colon or liver tissues surrounding siFZD10, nonsilencing 1) (Table 1), and transfected the metastatic lesions. them into SYO-1 and HS-SY-2 cells, both of which express high levels of FZD10. Among the siRNA Ability of TT641 pAb to mediate ADCC against constructs tested, siFZD10 effectively reduced expres- FZD10-expressing SS cells sion of FZD10 mRNA and protein compared with control siRNA (siEGFP). MTT and colony formation To examine whether TT641 pAb would induce antigen- assays revealed that the number of viable cells was dependent cell-mediated cytotoxicity (ADCC) against reduced in both cell lines in comparison with controls SS cells, we measured release of lactate dehydrogenase (Figure 7a and b). These siRNAs did not affect (LDH) from lysed SS cells. When target and effector expression of FZD9, which has the highest similarity cells were coincubated with 0.7 mg of TT641 pAb per to FZD10 in the Frizzled family. In addition, the well at an E : T ratio of 25 : 1, no cytotoxic effects effective siRNAs did not affect growth of A549 cells, occurred in the target cells (SYO-1) with TT641 pAb which do not express FZD10 (data not shown), an alone (T þ Ab), and we saw no evidence of cytotoxic indication that these siRNAs had no ‘off-target effect’. interaction between TT641 pAb and human effector cells (E þ Ab) or between the target cells and human Oligomerization of FZD10 effector cells (T þ E) (Figure 4a). In contrast, cytotoxic effects were evident when the target cells were incubated When exogenous HA-FLAG-FZD10 protein was im- with both the antibody and human effector cells munoprecipitated with an a-HA antibody, a Western

Oncogene FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6205 a b c

d e f

g h i

j k l

m n o

Figure 3 Patterns of endogenous FZD10 in various tissues, as detected by immunohistochemical analyses using TT641 pAb to stain the (a) placenta; (b) brain; (c) heart; (d) lung; (e) liver; (f) kidney; (g) and (h) stomach from those two individuals; (i) colon; (j) and (k) SS tumor cells of the same biphasic SS specimen; (l), primary colon cancer; (m) and (n) a simultaneous metastatic liver lesion from that colon cancer. Original magniﬁcation: (a–f, h, i, l) Â 100; (g, m) Â 40; (k, n) Â 200 blot analysis using an a-HA antibody revealed exogen- To investigate that hypothesis, we designed two kinds ous FZD10 protein in the form of several bands that of tagged-FZD10 constructs (Figure 8a) to examine corresponded respectively to one, two or multiples of the homo-oligomerization. HA-FLAG-FZD10 and FZD10- predicted molecular mass. That observation suggested myc-His were cotransfected into COS-7 cells and that FZD10 might form oligomers; (Kaykas et al., co-immunoprecipitated using a-HA antibody. Immuno- 2004) recently showed that Frizzled-family proteins can precipitated HA-FLAG-FZD10 yielded multiple bands do that. as well (Figure 8b). However, since co-immunoprecipi-

Oncogene FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6206 a LDH release 6 0.967

0.917 5 ADCC 0.867

0.817 4

0.767 MAX

0.717 3

0.667 Growth rate

0.617 2 T+E T+Ab E+Ab T spon Tspon Espon 1 T+E+Ab T+detergent 0 b 120 ADCC Activity -1 0 1 2 3 4 5 6 (Day)

100 Figure 5 Growth-inhibitory effect of TT641 pAb on SS xenografts in nude mice. Tumor growth was assessed as the ratio of 80 tumor volume on the indicated day to that calculated on the initial day of treatment in the experimental group (n ¼ 16) treated with TT641 pAb (ﬁlled circles) and in the control group (n ¼ 15) given 60 nonimmunized rabbit IgG (open circles). Treatment was continued 1µg for 5 consecutive days (Days 0–4). Data are expressed as means7s.d. % Cytotoxity 40

0.7µg 20 0.5µg 1998; Frustaci et al., 2001; Edmonson et al., 2002). SS is 0.7µg IgG characterized biologically by the presence of a SYT-SSX 0 fusion gene, which is useful for distinguishing SS from 25:1 12.5:1 6.25:1 3.125:1 spindle-cell sarcomas that resemble it morphologically E : T (Clark et al., 1994; van de Rijn et al., 1999). Although Figure 4 ADCC against FZD10-overexpressing cells, mediated by the SYT-SSX fusion product may be closely involved in TT641 pAb. (a) Assay of cytotoxicity by quantitative measurement tumorigenesis of SS, the relevant signaling pathway of LDH released upon cell lysis, when target and effector cells were remains to be clarified (dos Santos et al., 2001; Nagai coincubated with 7 mg/ml of TT641 pAb at an E : T ratio of 25 : 1. T, target cells (SYO-1); E, effector cells (PBMCs); T spon, et al., 2001); in any case, since the fusion product is a spontaneous release of LDH from target cells; E spon, spontaneous nuclear protein, an antibody-based approach to target release of LDH from effector cells; Ab, TT641 pAb. (b) Cell- this cancer-specific molecule is not likely to be success- mediated cytotoxicity against FZD10-overexpressing cells at ful. Instead, a vaccine directed against certain peptides, several E : T ratios, indicating a positive correlation with the including fusion points, has been developed (Worley amount of TT641 pAb, 1 mg (filled circles), 0.7 mg (open triangles and filled triangles), 0.5 mg (open circles) and mouse IgG (filled et al., 2001). However, since peptides processed from squares) added to the medium SYT-SSX fusion protein need to be expressed on cell surfaces in association with HLA to be recognized by specific T cells, vaccination therapy will not be clinically applicable for some SS patients due to HLA restriction tation of homo-oligomer was not observed when lysates (Sato et al., 2002). Therefore, from the perspective of from cells transfected with HA-FLAG-FZD10 or clinical application we think an antibody targeted FZD10-myc were mixed before immunoprecipitation against a tumor-specific cell-surface molecule would (data not shown), we concluded that FZD10 is able to carry greater therapeutic potential than a vaccine. constitute a homo-oligomer complex only in living cells. In this study, almost all of the SS surgical specimens and cell lines we examined showed very high levels of FZD10 transcription, whereas expression was absent or Discussion very low in the normal brain, heart, lung, liver and kidney. The relatively exclusive distribution of FZD10 Although various regimens of chemotherapy have been expression prompted us to investigate prospects for tested in recent clinical trials involving SS patients, development of a new therapeutic modality based on a clinical outcomes have not improved and alternative specific antibody against FZD10. Among possible therapies, including molecular targeting, should be epitopes of FZD10-ECD detected by epitope mapping, eagerly explored (Antman et al., 1993; Patel et al., residues 214–225 and 43–56 had similarities to FZD9 of

Oncogene FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6207 abc

def

ghi

jkl

Figure 6 TUNEL analysis and Ki-67 staining in antibody-treated xenografts. Two days after completion of treatment, TUNEL analysis (c, f, i, l) and immunohistochemical staining for Ki-67, a reliable indicator of cell-proliferation ability (b, e, h, k). Serial sections of parafﬁn-embedded specimens from tumors were treated with nonimmunized rabbit antibody (a–c, g–i) or with TT641 pAb (d–f, j–l). (a, d, g, j), HE staining. Original magniﬁcations: (a–f), Â 40; (g–l), Â 200; inset in (l), Â 400

72.7 and 71.4%, respectively, but we demonstrated that The kidney, however, showed different degrees of TT641 pAb did not react with any FZD protein other immunoreactivity to FZD10 from one individual to than FZD10. Therefore, monoclonal antibodies raised another (data not shown), although no kidney signals against these epitopes should be promising for develop- had been detected on a Northern blot analysis ment of molecular-targeted therapy for SS patients. (Figure 1a). Wnt-FZD signal transduction plays a Immunohistochemical analyses conﬁrmed that endo- critical role in the development of the kidney (Stark genous FZD10 protein was almost absent in normal et al., 1994; Kispert et al., 1998), and we presume that a vital organs (brain, heart, lung and liver). This ﬁnding remnant of FZD protein was still reactive to TT641 pAb would underscore an advantage of antibody-based in the kidney tissues we examined. Alternatively, turn- therapy, in that adverse reactions would be minimized. over of the protein may be slower in the kidney than in

Oncogene FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6208 Table 1 Sequences of speciﬁc double-stranded oligonucleotides inserted into siRNA expression vector psi-U6BX-non-silencing1 50-CACCCAGCAGCTACTTCCACCTGTTCAAGAGACAGGTGGAAGTAGCTGCTG-30 50-AAAACAGCAGCTACTTCCACCTGTCTCTTGAACAGGTGGAAGTAGCTGCTG-30

psi-U6BX-FZD10 50-CACCGACTCTGCAGTCCTGGCAGTTCAAGAGACTGCCAGGACTGCAGAGTC-30 50-AAAAGACTCTGCAGTCCTGGCAGTCTCTTGAACTGCCAGGACTGCAGAGTC-30

psi-U6BX-EGFP 50-CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTC-30 50-AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTGCTTC-30

The speciﬁc sequences to FZD10 are underlined

0.8 SYO-1 0.7 siEGFP non-silencing siFZD10

FZD10 0.6

β-actin 0.5 490

OD 0.4 FZD10 0.3 FZD9 0.2 β2MG 0.1

0 siEGFP siFZD10

siEGFP non-silencing siFZD10 non-silencing

1.8 HS-SY-2

siEGFP non-silencigng siFZD10 1.6 FZD10 1.4 β-actin 1.2 1 FZD10 490

OD 0.8 FZD9 0.6 β2MG 0.4 0.2 0 siEGFP siFZD10 siEGFP non-silencing siFZD10 non-silencing Figure 7 Growth-inhibitory effects of FZD10-siRNA in SS cell lines. (a), SYO-1 and (b), HS-SY-2. Semiquantitative RT–PCR and Western blotting results show expression of endogenous FZD10 4 or 3 days after transfection, respectively; expression of b-actin and b2MG served as an internal control, respectively. Expression of FZD9 was not affected by either siRNA. MTT Assays (right-hand panels) were performed 7 days after transfection; colony-formation assays were performed 13 days after transfection

Oncogene FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6209 a HA-FLAG plasma membrane, mediated by antibodies. The me- 7 TM KTxxxW TCV chanisms by which apoptotic signals were induced in the HA-FLAG-FZD10 xenografts might be elucidated by in vitro analysis of three-dimensional cultures. Based on the results of our FZD10-Myc/His ADCC assays, we believe that cytotoxic effects would be much greater if the main effector cells were purified from Myc/His peripheral blood mononuclear cells (PBMCs) and administered together with humanized antibody, b IP: HA although the precise involvement of PBMCs in ADCC FZD10-Myc/His -+ remains to be determined. In addition, we confirmed HA-FLAG-FZD10 -+ that apoptotic cells merged positive cells with antima- Running gel top crophage antibody (anti-HAM56 antibody) staining in oligomer 250 tumor specimens of xenografts treated with TT641 pAb, dimer 150 suggesting that macrophage might be involved in IB: α-HA 100 ADCC of TT641 pAb as effector cells (data not shown). Moreover, our analysis of expression profiles in 75 Monomer human colon cancers metastasized to liver revealed IgG 50 frequent overexpression of the FZD10 gene in the metastatic lesions (data not shown). Although expres- Running gel top 250 sion of FZD10 was almost absent in the normal adult 150 liver, it was present in a metastatic lesion from the liver of a patient with FZD10-overexpressing colon cancer 100 IB: α-myc (Figure 3m and n). These findings suggest that this 75 antibody might also be useful for detecting the presence of micrometastases in liver, and for treating FZD10- IgG 50 positive liver lesions via the hepatic artery with minimal Figure 8 Homodimer and oligomer formation of FZD10. (a) adverse effects. Schematic diagram of HA-FLAG-FZD10 and FZD10-myc/His. RNAi experiments in human SS cell lines demon- 7TM ; Seven trans-membrane region. (b) Immunoprecipitation strated that the knock-down of FZD10 transcript analysis of mock and FZD10-myc/His- and HA-FLAG-FZD10- resulted in suppression of tumor cell-growth. Further- transfected COS-7 cells more, although FZD10 protein has been revealed to form homo-oligomers, there is the possibility of hetero- other tissues. From the perspective of clinical applica- oligomerization among endogenous FZD10 and other tion, the finding that FZD10 may be expressed in the FZD family members because several groups have kidney of some individuals should be kept in mind when reported that the Frizzled family of Wnt receptors form assessing the possibility of adverse effects. specific homo- and hetero-oligomers (refer Antman Expression of the transcript and the level of FZD10 et al., 1993; Clark et al., 1994; Angers et al., 2000; Crist protein were elevated in surgical specimens as well as in et al., 2001). In addition, although dimerization has SS cell lines, suggesting that transduced FZD10 signals been documented for several GPCRs, the functional may play an important role in the pathogenesis of SS. significance of that process is unclear. The beta- Although the precise function of FZD10 remains to be adrenergic receptor undergoes ligand-dependent dimer- discovered, our immunohistochemical study may pro- ization and activation, suggesting that dimerization vide some clues to understanding this important leads to receptor/G-protein coupling (Angers et al., molecule. Epithelial tumor cells were predominantly 2000). The biological significance of FZD10 oligomer- stained in a biphasic SS specimen, and differentiated ization needs to be investigated. cells in the epithelia of normal colon and stomach also In conclusion, we successfully produced antibodies showed clear immunoreactivity to FZD10, suggesting highly specific to FZD10-ECD, which were able to the possible involvement of this protein in epithelization induce cell-mediated cytotoxic reactions in FZD10- or polarization of cells. overexpressing cells in vitro and to attenuate growth of In vivo experiments demonstrated attenuated growth SS xenografts in vivo. Although our data were achieved of xenografts in nude mice after intra-tumoral injection with a polyclonal preparation, we believe that anti- of TT641 pAb, presumably due to induction of FZD10 antibody has great potential for development of apoptosis, even though the antibody had no cytotoxic novel drug therapies for treatment of SS and other or growth-inhibitory effects on SS monolayers in vitro tumors that overexpress FZD10. (data not shown). Furthermore, histological examina- tion of the xenografts revealed only mild invasion of antibody-treated tumor tissues by inflammatory cells. Materials and methods These findings suggested that TT641 pAb alone might exert a cytotoxic effect on SS cells in vivo through Cell lines, tissue specimens and transfection stronger interactions between antigen and antibody and/ Cell lines derived from SS (HS-SY-2, YaFuSS and SYO-1), or enhanced aggregation of target molecules in the colon cancers (SW480, LoVo, DLD1, HT29, HCT116, SNU-

Oncogene FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6210 C4 and SNU-C5), a cervical adenocarcinoma (HeLa), TAA-30 and 50-TAGGCCCCACCTCCTTCTAT-30. The pro- HEK293 and COS7 cells were grown in monolayers in duct was purified and cloned into pCR plasmid vector using a appropriate media supplemented with 10% fetal bovine serum TA cloning kit, according to the supplier’s protocol (Invitro- and 1% antibiotic/antimycotic solution, and maintained at gen). A BamHI, XhoI-digested fragment containing the snRNA 371C in air containing 5% CO2. Primary SS samples were U6 gene was purified and cloned into pcDNA3.1( þ ) between obtained after informed consent, and either snap-frozen in nucleotides 1257 and 1256; then amplified by PCR using liquid nitrogen immediately after resection and stored at –801C primers 50-TGCGGATCCAGAGCAGATTGTACTGAGA until preparation of RNA, or fixed in 10% formalin and GT-30 and 50- CTCTATCTCGAGTGAGGCGGAAAGAA routinely processed for paraffin embedding. The Cell-line CCA-30. This ligated DNA was used as the template for PCR Nucleofectort kit V (Amaxa Biosystems, Cologne, Germany) with primers 50-TTTAAGCTTGAAGACTATTTTTACATC was used for transfection of SYO-1 and HS-SY-2 cells; AGGTTGTTT TTCT-30 and 50-TTTAAGCTTGAAGACA FuGene6 (Roche) was used for other cell lines. Except CGGTGTTTCGTCCTTTCCACA-30 (underline indicates the for growth assays, all cells were assayed 48–72 h after Hind III site). After digestion with HindIII, the product self- transfection. ligated to produce a vector plasmid, psiU6BX3.0.

Preparation of recombinant extracellular domain (rECD) Plasmid construction of FZD10 To generate the HA-FLAG tag, a following set of oligonu- FZD10 rECD (residues 1–225) DNA fragment was generated cleotides, 50-ACGTGTCGACTACCCATACGACGTCCCA by PCR amplification with the following primers; 50-AAA GACTACGCTATGGACTACAAGGACGACGATGACAA GAATTCATGCAGCGCCCGGGC-30 and 50-AAAAAGC GCTCGAGATGC-30 (underline indicates SalIsite) and 5 0- TTTCAGCGCTTGTCCTCGCGGCT-30. The PCR products GCATCTCGAGCTTGTCATCGTCGTCCTTGTAGTCCA were digested with EcoRIand HindIII, and ligated into pET- TAGCGTAGTCTGGGACGTCGTATGGGTAGTCGTAT 28a( þ ) (Novagen). Recombinant His-tagged protein was GGGTAGTCGACACGT-30 (underline indicates the XhoI expressed in Escherichia coli strain BL21 codonplus (DE3) site) was annealed and digested with SalIand XhoI. Fragments (Stratagene). After induction with 0.5 mM isopropyl-b-D- containing residues 1–217 and 218-stop codon (or C-terminal thiogalactopyranoside (IPTG), the bacteria pellet was sus- deletion) were individually amplified by PCR; after digestion pended with lysis buffer under denaturing conditions, 100 mM with SalIand XhoI, the products were ligated sequentially into sodium phosphate, 10 mM Tris, 6 M guanidine-HCl and pCAGGS/neo expression vector. An HA-FLAG tag, also 10 mM imidazole, pH 8.0, and were purified with Ni-NTA digested with SalIand XhoI, was ligated in-frame between superflow (Qiagen) following the manufacturer’s instructions. nucleotides 651 and 652. The protein was eluted with 100mM sodium phosphate, Plasmids expressing siRNAs specific to FZD10 were 10 mM Tris, 8 M urea and 300 mM imidazole, pH 8.0. The prepared by cloning the double-stranded oligonucleotides into eluted protein was dialysed against 100 mM sodium phosphate, psiU6BX3.0 vector (Table 1). Complementary oligonucleo- 10 mM Tris, 8 M urea and 20 mM imidazole, pH 8.0, tides were each phosphorylated by incubation with T4- and further purified with TALONt Superflowt Metal polynucleotide kinase at 37oC for 30 min, followed by boiling Affinity Resin (BD Clontech) following the manufacturer’s and then slow cooling to room temperature to anneal the two instructions. The denatured protein was refolded by oligonucleotides. Each product was ligated into psiU6BX3.0 to gradual removal of urea by means of stepwise dialysis from construct an FZD10-siRNA expression vectors. The gene- 8 to 0.5 M. silencing effect of each vector was verified by semiquantitative RT–PCR. Polyclonal antibody against FZD10 Semiquantitative RT–PCR and Northern blot analysis Polyclonal anti-FZD10 antibodies (TT641 pAb) were raised in rabbits against a purified FZD10-rECD (residues 1–225) For RT–PCR experiments, total RNAs were extracted from recombinant protein (Medical and Biological Laboratories, cell lines and from frozen surgical specimens using TRIzol Nagoya, Japan). The high-titer antiserum was affinity-purified reagent (Invitrogen, Carlsbad, CA, USA), and a 3-mg aliquot using the FZD10-rECD-coupled support (Affigel 15; BioRad, of each total RNA was reverse-transcribed. PCR amplification Hercules, CA, USA). was performed using the cDNAs as templates and the following primers: 50-TATCGGGCTCTTCTCTGTGC-30 0 0 0 Epitope mapping and 5 -GACTGGGCAGGGATCTCATA-3 for FZD10; 5 - CTGCACGCTGGTCTTCCTCT-30 and 50-CCGATCTTG A series of 10-residue linear synthetic peptides overlapping by ACCATGAGCTTC-30 for FZD9; and 50-TTAGCTGTGCT one amino acid and covering the entire FZD10-ECD were CGCGCTACT-30 and 50-TCACATGGTTCACACGGCAG- covalently bound to a cellulose membrane (SPOTs; Sigma 30 for b2-microglobulin (b2MG), the internal control. For Genosys, Woodlands, TX, USA). The membrane, containing Northern blot analysis, a 1-mg aliquot of each mRNA isolated 216 peptide spots, was hybridized with TT641 pAb overnight using Micro-FastTrack (Invitrogen), and human normal-tissue at 41C. After incubation with anti-rabbit HRP-conjugated IgG polyA( þ ) RNAs (Clontech, Palo Alto, CA, USA), was (Amersham Bioscience, Piscataway, NJ, USA), the spots were separated on a 1% denaturing agarose gel, transferred to a visualized with 3-amino-9-ethylcarbazole. nylon membrane, and probed using a32P-dCTP-labeled FZD10 cDNA. Construction of siRNA expression vector, psiU6X3.0 Cell-growth assays The snRNA U6 gene is transcribed by RNA polymerase III to produce short transcripts with uridines at the 30 end. We SYO-1 and HS-SY-2 cells transfected with psiU6 plasmids amplified by PCR a genomic fragment containing the were maintained in media containing appropriate concen- promoter region of snRNA U6, using human placental DNA trations of geneticin. Cell viability was measured by MTT as a template and primers 50-GGGGATCAGCGTTTGAG assay 7 days later, using cell-counting kit8 (Dojindo). For

Oncogene FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6211 colony-formation assays, 13 days (SYO-1) or 8 days (HS- ENVISION Polymer Reagent (DAKO) was added and SY-2) after geneticin selection the cells were ﬁxed with 4% visualized with peroxidase substrate (3, 30-diaminobenzidine paraformaldehyde and stained with giemsa solution. tetrahydrochloride).

Immunoprecipitation ADCC assay Transfected COS-7 cells were washed twice with cold PBS(À) Cytotoxicity was assayed by quantitative measurement of and lysed in IPP buffer (10 mM Tris-HCl pH8.0, 150 mM NaCl, LDH, using the CytoTox96 Nonradioactive Cytotoxicity 0.1% NP-40, 1 mM NaF and appropriate protease inhibitors). Assay (Promega, Madison, WI, USA). Fresh effector cells The cell lysates were incubated with anti-HA F7 antibody were isolated from heparinized peripheral blood of a healthy (Santa Cruz) and protein G-sepharose (Sigma). Bound donor by Ficoll-Plaque (Amersham Bioscience). Effector cells proteins were washed five times with IPP buffer and eluted (E) and target cells (T) (each, 5 Â 103/well) were coincubated with SDS-sample buffer. Eluted proteins were analysed by for 6 h at 371C in quadruplicate at various E : T ratios, together SDS–PAGE and Western blotting. with TT641 pAb or nonimmunized rabbit IgG, in 100 ml of phenol red-free RPMI1640 supplemented with 5% FBS in a Western blotting 96-well-plate. LDH released in the culture supernatants was determined by absorbance at 490 nm. The percentage of Cell lysates and immunoprecipitates were separated on 10% specific cytotoxicity was calculated according to the manufac- SDS–polyacrylamide gels and transferred to nitrocellulose turer’s instructions. Controls included target and effector cells membranes, followed by incubation with TT641 pAb, anti- incubated separately with TT641 pAb. myc 9E10 monoclonal antibody, or anti-HA F7 antibody. After incubation with anti-rabbit HRP-conjugated IgG or anti-mouse HRP-conjugated IgG (Amersham Bioscience), Treatment of SS xenografts with antibody signals were visualized with an ECL kit (Amersham In vivo experiments were performed in our animal facility in Bioscience). b-actin (clone AC-15, Sigma) served as a loading accordance with institutional guidelines. A 0.1-ml aliquot of control for proteins. suspended SYO-1 cells (5 Â 106 cells) was injected subcuta- neously into the flanks of 6-week-old female athymic mice Immunocytochemistry (BALB/cA Jcl-nu). Tumor volumes were determined using the formula: 0.5 Â (larger diameter) Â (smaller diameter)2. When COS7 cells were transfected with pCAGGS-FZD10-Myc-His the xenografts were 40–75 mm3 in size, animals were randomly mixed with FuGene6 reagent (Roche, Basel, Switzerland). divided into two groups. One group (n ¼ 16) received COS7-derived stable transfectants were fixed with 4% intratumoral injection of 10 mg of TT641 pAb for 5 consecutive paraformaldehyde and left unpermeabilized, to minimize lysis. days. The other group (n ¼ 15) received nonimmunized rabbit Following incubation with mouse anti-c-myc antibody (9E10) IgG (DAKO) as a control. Tumor growth was assessed by and with the TT641 pAb (2 mg/ml), primary antibodies were calculating the ratio of tumor volume on the indicated day to double-stained with anti-mouse (Texas Red) and anti-rabbit the volume calculated on the initiation of treatment. The (Alexa Fluor 488) fluorescent antibodies, stained with DAPI, tumors were removed at designated times, and paraffin- and visualized with an ECLIPSE E600 microscope (Nikon, embedded slides were stained for TUNEL assays using the Tokyo, Japan). SS cell lines were immunostained with TT641 ApopTag Apoptosis Detection Kit (Intergen). The prolifera- pAb in the same manner to detect endogenous expression of tive ability of the cells was assessed by immunohistochemical FZD10. staining with anti-Ki-67 mouse monoclonal antibody (MIB-1, DAKO). Flow cytometry Suspensions of 5 Â 106 cells were incubated with 1.5 mgof TT641 pAb or nonimmunized rabbit IgG (DAKO, Kyoto, Abbreviations Japan) for 30 min at 4oC. After washing with PBS, 2 mgof SS, synovial sarcoma; FZD10, frizzled homologue 10; siRNA, fluorescent anti-rabbit IgG (Alexa Fluor 488, Molecular small-interfering RNA; ADCC, antibody-dependent cell- Probes, Eugene, OR, USA) was added, and the cell suspension mediated cytotoxicity; ECD, extracellular domain. was incubated for 30 min at 41C for analysis by FACScan (Becton Dickinson, San Jose, CA, USA). Acknowledgements We gratefully thank Ms Kie Naito and Ms Kyoko Kijima for Immunohistochemical staining technical assistance; Drs Hiroshi Sonobe and Akira Kawai Slides of paraffin-embedded normal adult human tissues for kindly providing SS cell lines; and Dr Kazuhisa Ohgaki for (BioChain, Hayward, CA, USA) and surgical SS specimens preparing tumor samples. This work was supported in part by were processed for antigen retrieval by microwave treatment, Research for the Future Program Grant #00L01402 from the and incubated with 5 mg/ml TT641 pAb. Subsequently, rabbit Japan Society for the Promotion of Science.

References

Angers S, Salahpour A, Joly E, Hilairet S, Chelsky D, Dennis Clamond GH and Baker LH. (1993). J. Clin. Oncol., 11, M and Bouvier M. (2000). Proc. Natl. Acad. Sci. USA, 97, 1276–1285. 3684–3689. Clark J, Rocques PJ, Crew AJ, Gill S, Shipley J, Chan AM, Antman K, Crowley J, Balcerzak SP, Rivkin SE, Weiss GR, Gusterson BA and Cooper CS. (1994). Nat. Genet., 7, 502–508. Elias A, Natale RB, Cooper RM, Barlogie B, Trump DL, Crist WM, Anderson JR, Meza JL, Fryer C, Raney RB, Doroshow JH, Aisner J, Pugh RP, Weiss RB, Cooper BA, Ruymann FB, Breneman J, Qualman SJ, Wiener E, Wharam

Oncogene FZD10; novel molecuar target for synovial sarcoma therapy S Nagayama et al 6212 M, Lobe T, Webber B, Maurer HM and Donaldson SS. Nagai M, Tanaka S, Tsuda M, Endo S, Kato H, Sonobe H, (2001). J. Clin. Oncol., 19, 3091–3102. Minami A, Hiraga H, Nishihara H, Sawa H and Nagashima dos Santos NR, de Bruijn DR and van Kessel AG. (2001). K. (2001). Proc. Natl. Acad. Sci. USA, 98, 3843–3848. Genes Chromosomes Cancer, 30, 1–14. Nagayama S, Katagiri T, Tsunoda T, Hosaka T, Nakashima Edmonson JH, Petersen IA, Shives TC, Mahoney MR, Rock Y, Araki N, Kusuzaki K, Nakayama T, Tsuboyama T, MG, Haddock MG, Sim FH, Maples WJ, O’Connor MI, Nakamura T, Imamura M, Nakamura Y and Toguchida J. Gunderson LL, Foo ML, Pritchard DJ, Buckner JC and (2002). Cancer Res., 62, 5859–5866. Stafford SL. (2002). Cancer, 94, 786–792. Patel SR, Vadhan-Raj S, Burgess MA, Plager C, Papadopo- Fendly BM, Winget M, Hudziak RM, Lipari MT, Napier MA lous N, Jenkins J and Benjamin RS. (1998). Am. J. Clin. and Ullrich A. (1990). Cancer Res., 50, 1550–1558. Oncol., 21, 317–321. Ferguson WS and Goorin AM. (2001). Cancer Invest., 19, Sato Y, Nabeta Y, Tsukahara T, Hirohashi Y, Syunsui R, 292–315. Maeda A, Sahara H, Ikeda H, Torigoe T, Ichimiya S, Frustaci S, Gherlinzoni F, De Paoli A, Bonetti M, Azzarelli A, Wada T, Yamashita T, Hiraga H, Kawai A, Ishii T, Comandone A, Olmi P, Buonadonna A, Pignatti G, Barbieri Araki N, Myoui A, Matsumoto S, Umeda T, Ishii S, E, Apice G, Zmerly H, Serraino D and Picci P. (2001). Kawaguchi S and Sato N. (2002). J. Immunol., 169, J. Clin. Oncol., 19, 1238–1247. 1611–1618. Kaykas A, Yang-Snyder J, Heroux M, Shah KV, Bouvier M Stark K, Vainio S, Vassileva G and McMahon AP. (1994). and Moon RT. (2004). Nat. Cell Biol., 6, 52–58. Nature, 372, 679–683. Kirikoshi H, Sekihara H and Katoh M. (2001). Int. J. Oncol., Terasaki H, Saitoh T, Shiokawa K and Katoh M. (2002). Int. 19, 767–771. J. Mol. Med., 9, 107–112. Kispert A, Vainio S and McMahon AP. (1998). Development, van de Rijn M, Barr FG, Collins MH, Xiong QB and Fisher C. 125, 4225–4234. (1999). Am. J. Clin. Pathol., 112, 43–49. Koike J, Takagi A, Miwa T, Hirai M, Terada M and Katoh Worley BS, van den Broeke LT, Goletz TJ, Pendleton CD, M. (1999). Biochem. Biophys. Res. Commun., 262, 39–43. Daschbach EM, Thomas EK, Marincola FM, Helman LJ Maloney DG, Grillo-Lopez AJ, White CA, Bodkin D, Schilder and Berzofsky JA. (2001). Cancer Res., 61, 6868–6875. RJ, Neidhart JA, Janakiraman N, Foon KA, Liles TM, Wunder JS, Paulian G, Huvos AG, Heller G, Meyers PA Dallaire BK, Wey K, Royston I, Davis T and Levy R. and Healey JH. (1998). J. Bone Joint Surg. Am., 80, (1997). Blood, 90, 2188–2195. 1020–1033.

Oncogene