Murine Bone Marrow-Derived Mast Cells Express Chemoattractant Receptor-Homologous Molecule Expressed on T-Helper Class 2 Cells (Crth2)

Home , Cell surface receptor, Chemokine receptor

Murine bone marrow-derived mast cells express chemoattractant receptor-homologous molecule expressed on T-helper class 2 cells (CRTh2)

Stefen A. Boehme1, Karin Franz-Bacon1, Edward P. Chen1, Tai Wei Ly1, Yuko Kawakami2 and Kevin B. Bacon1 Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021 1Actimis Pharmaceuticals, Inc., 10835 Road to the Cure, Suite 200, San Diego, CA 92121, USA 2La Jolla Institute for Allergy and Immunology, La Jolla, CA, USA

Keywords: allergy, chemotaxis, inﬂammation, prostaglandin D2

Abstract Mast cells are bone marrow-derived effector cells that can initiate inflammatory responses to infectious organisms or allergens by releasing a multitude of pro-inflammatory factors including prostaglandin (PG) D2. We demonstrate that primary murine bone marrow-derived mast cells (BMMCs) express the PGD2 receptor; chemoattractant receptor-homologous molecule expressed on Th class 2 cells (CRTh2). Activation of CRTh2 on BMMC by PGD2 or the CRTh2-specific agonist, 13,14- 21 dihydro-15-keto-prostaglandin D2 (DK-PGD2), resulted in signaling response including Ca mobilization and phosphorylation of the p42/p44 extracellular signal-regulated kinases (ERKs) kinases. Phosphorylation of the ERKs could be blocked by pertussis toxin, as well as a small molecule antagonist of CRTh2, Compound A. Activation of CRTh2 on BMMC also resulted in the up- regulation of CD23 and CD30 on the cell surface, as well as CD62L shedding. Finally, PGD2 and DK- PGD2 induced the migration of BMMC in vitro and in vivo in response to an intra-dermal DK-PGD2 injection. Both these processes were inhibited by the CRTh2 antagonist. These results raise the possibility that the functional consequences of the PGD2–CRTh2 interaction on mast cells may be relevant in allergic inflammation.

Introduction Mast cells are resident cells present in all organs of the commonly activated in allergic diseases. Aggregation of re- body and are known to increase in number at sites of inflam- ceptor-bound IgE molecules by polyvalent antigen triggers mation (1, 2). They play a role in host defense to helminthic a signaling cascade resulting in mast cell activation and parasites and certain bacteria and are major effectors for rapid degranulation of preformed pro-inflammatory media- the induction of inflammation and allergic reactions (3). Mast tors, which include histamine, proteases and proteoglycans. cells arise from CD34+/CD117+ pluripotent hematopoietic Protein mediators such as cytokines and chemokines are stem cells in the bone marrow and mature to committed pro- also synthesized and released, as are de novo synthesized genitors upon growth factor stimulation (4). These progeni- lipids such as leukotriene (LT) C4 and LTB4 and prostaglan- tors are released into the circulation from the bone marrow din (PG) D2. The generation and release of these factors by and subsequently migrate to various tissues of the body mast cells induces a strong inflammatory response and con- where local tissue-specific factors and cell surface interac- tributes to the pathogenesis of various allergic diseases, tions determine the mature phenotype of the mast cell ap- such as asthma, allergic rhinitis and atopic dermatitis propriate for the microenvironment (5, 6). Two major (9, 10). subtypes of mast cells have been identified, connective tis- PGD2 is an arachidonic acid metabolite that has been im- sue mast cells that are found in the skin, around blood ves- plicated in the development and progression of various aller- sels and the peritoneal cavity. Mucosal mast cells are found gic diseases. Following the conversion of arachidonic acid in the gut and the upper airways (7, 8). to PGH2 by cyclooxygenase, hematopoietic PGD2 synthase Mast cells bind IgE via expression of the high affinity IgE converts PGH2 into PGD2 (11). PGD2 is then exported from receptor FceRI, and it is via FceRI that mast cells are most the cytosol to the extracellular space by a PG transporter

Correspondence to: S. A. Boehme; E-mail: [email protected] Received 3 June 2008, accepted 2 March 2009 Transmitting editor: S. J. Galli Advance Access publication 3 April 2009 622 Murine bone marrow-derived mast cells express CRTh2 protein (12). Two receptors so for have been identified for ble cells were mast cells. BMMCs used for experimentation PGD2, prostanoid D1 (DP1) receptor and chemoattractant were in culture for 4–6 weeks. receptor-homologous molecule expressed on Th class 2 cells (CRTh2). Both these G protein-coupled receptors bind Reverse transcription–PCR assay PGD with nanomolar affinity; however, they share little 2 Messenger RNA from BMMCs was isolated using Oligotex amino acid homology and have different tissue expression mRNA isolation kit according to the manufacturer’s instruc- patterns and signaling pathways, suggesting distinct roles tions (Qiagen Sciences, Valencia, CA, USA). Reverse tran- in allergic and immune responses (13). The amino acid se- scription (RT)–PCR analysis of CRT 2 message expression quence of DP1 shows homology to other prostanoid recep- h was performed by standard techniques (19). Briefly, the RT tors, whereas CRT 2 shows high identity to chemoattractant h reaction was carried out using isolated RNA, oligo dT 3# pri- G-protein-coupled receptors (GPCRs). DP1 is associated mers and reverse transcriptase (Superscript III first strand with pertussis toxin (Ptx)-resistant G , whereas CRT 2 sig- as h synthesis system, Invitrogen). PCR was then performed on nals with Ptx-sensitive Gai proteins (14), similar to chemokine all the samples using CRT 2 primers (5# primer, 5# Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021 receptors (9). CRT 2 is expressed by both T 2 and a subset h h h CCTCCCCTTTAGCTCTCTGC 3# and 3# primer, 5# TGA- of T 1T cells in the mouse, as well as eosinophils and baso- h h AGCGTCTAGCGCAGTAA 3#) and actin primers (5# primer, phils (15, 16). Human basophils express both DP1 and CRT 2, h 5# TCACCGAGGCCCCCTGAAC 3# and 3# primer, 5# and treatment (Tx) with a DP1-selective agonist, BW245C, GCACGCACTGTAATTCCTC 3#). The PCR protocol used to inhibited FceRI-dependent exocytosis. In contrast, the selective amplify the CRT 2 and b-actin cDNA was 95C, 30 s; 55C, CRT 2 agonist, 13,14-dihydro-15-keto-prostaglandin D (DK- h h 2 60 s and 68C, 2 min for 35 cycles, followed by 72C for PGD ), potentiated FceRI-dependent exocytosis (16). Simi- 2 5 min. The PCR products were visualized on a 1.5% agarose larly, DK-PGD , but not BW245C, induced human eosinophil 2 gel stained with ethidium bromide. degranulation (17). Thus, expression of these two receptors on the same cell appears to be playing different and often Saturation analysis and competitive binding assay opposing roles in regulating responsiveness toward PGD2. Radioligand-binding analyses were performed according to As mast cells are the largest source of PGD2 in the body, the methods of Sugimoto et al. (20). For the competitive we investigated whether they express the CRTh2 receptor. binding assay, BMMCs were re-suspended in binding buffer We hypothesized that expression of CRTh2 by mast cells may result in a positive feedback circuit where mast cell re- (50 mM Tris–HCl, pH 7.4, 40 mM MgCl2, 0.1% BSA) at a concentration of 4 3 106 mlÀ1 at room temperature. Fifty microli- lease of PGD2 could recruit more mast cells to the sites of ters of cell suspension was incubated for 1 h at room PGD2-mediated inflammation. Moreover, CRTh2 expression may influence the activation state of mast cells upon PGD temperature with gentle shaking in the presence of 10 llof 2 3 À12 À6 stimulation. We show here the evidence that bone marrow- [ H]-PGD2 (3 nM final), 10 ll of competitor (10 –10 dose range) or buffer alone and the final volume adjusted to 100 derived mast cells (BMMCs) express the CRTh2 receptor, and using a specific and potent small molecule antagonist ll with buffer. Incubations were performed in U-bottom poly- propylene 96-well plates (Fisher Scientific, Pittsburgh, PA, demonstrate that signaling through CRTh2 results in extracellular signal-regulated kinase (ERK) kinase phosphorylation USA) for 60 min at room temperature, and the cell suspen- and mast cell chemotaxis both in vitro and in vivo. sion was transferred to filtration plates (MAFB, Millipore, Bedford, MA, USA), pre-wet with PEI (0.5%) buffer (Acros Organics, Morris Plains, NJ, USA). The cell pellets were Methods washed three times with buffer and the radioactivity was counted on a TopCount (Packard Bioscience, Meriden, CT, Materials USA). Saturation analysis was done using 10 lM DK-PGD2 3 All reagents were purchased from Sigma (St Louis, MO, for each experimental condition, and a range of [ H]-PGD2 USA) unless otherwise stated. The Institutional Animal Care (from 0.3 to 10 nM). Data analyses were performed using and Use Committee approved all animal experimentation the PrizmTM graphics program using a one-site competition prior to implementation. Compound A is a proprietary, selec- model (GraphPad Software Inc., San Diego, CA, USA). tive and highly potent CRTh2 small molecular weight antago- PGD2 and DK-PGD2 were purchased from Cayman Chemi- 3 nist that is developed as part of the Actimis cal. Radiolabeled PGD2 {PGD2 [5,6,9,8,12,14,15- H(N)]; Pharmaceuticals, Inc. portfolio of potent and selective com- specific activity 160 Ci mmolÀ1} was purchased from Perkin pounds (WO/2004/096777). Elmer (Waltham, MA, USA).

Mast cell culture Flow cytometric analysis Mast cells were cultured as described previously (18). In BMMCs were prepared and stained for flow cytometry as brief, bone marrow cells were flushed from femurs of the previously described (21). Briefly, the cells were incubated 6–10-week-old C57Bl/6 mice and cultured in RPMI 1640 me- for 10 min with Fc block (Becton Dickinson–Pharmingen) to dium (Invitrogen, Carlsbad, CA, USA) supplemented with inhibit non-specific binding. The cells were subsequently in- 10% FCS, 100 lM non-essential amino acids (Mediatech, cubated on ice and stained with FITC-conjugated anti- Herndon, VA, USA), 50 lM 2-ME and 8% conditioned me- CD62L (clone Dreg 56) mAb, PE-conjugated anti-CD30 dium of IL-3 gene-transfected cells (BMMC medium). After mAb (clone mCD30.1) or FITC-conjugated anti-CD23 mAb 4 weeks of culture, >95% of the Trypan blue-excluding via- (clone B3B4; all antibodies obtained from BD Pharmingen). Murine bone marrow-derived mast cells express CRTh2 623 The cells were washed in cold FACS buffer (PBS containing tants were isolated, boiled for 5 min in 23 Laemmli sample 1% BSA and 0.1% sodium azide) and analyzed using buffer and loaded onto 10% Tris–glycine polyacrylamide a FACScan II analyzer (Becton Dickinson, Mountain View, gels (Invitrogen). Protein was transferred onto a nitrocellulose CA, USA) and CellQuest software (Becton Dickinson). membrane using the iBlot dry blotting system (Invitrogen). Following transfer, the immunoblots were handled essentially Calcium mobilization assay as described previously (21). Briefly, the nitrocellulose membrane was incubated in 13 Tris-buffered saline [20 mM Murine BMMCs were labeled with 3 lM of indo-1AM dye Tris–HCl (pH 7.6) and 137.5 mM NaCl], 0.1% Tween 20 with (Invitrogen) for 60 min at 37C. The cells were subsequently 5% w/v non-fat dry milk (Cell Signaling Technologies, Bos- washed and re-suspended in 1 ml of HBSS containing 1% ton, MA, USA) for 1 h at 25C to block non-specific protein- BSA (fraction V, Sigma). Calcium mobilization was measured binding sites. The membrane was then incubated at 4C using a PTI fluorimeter (South Brunswick, NJ, USA) as previ- overnight with p42/p44 anti-phospho-ERK antibody (Cell ously described (22). Murine RANTES and eotaxin were Signaling Technologies) diluted 1/1000. The immunoblots obtained from R&D Systems (Minneapolis, MN, USA). A rela- Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021 were subsequently washed in TTBS [20 mM Tris–HCl (pH tively high dose (10 lM) of PGD and PGE was used to 2 2 7.6), 137.5 mM NaCl and 0.1% Tween 20] and incubated stimulate the BMMC in the Ca++ mobilization experiments with peroxidase-conjugated goat anti-rabbit IgG (Pierce) di- shown in Figs 4 and 5(D–G) in order to see a robust re- luted 1/5000 for 1 h at 25C. Phospho-MAPK was visualized sponse under the experimental conditions used. Lower using the chemiluminescent peroxidase substrate Super Sig- doses (1 lM) showed only a weak response and, in contrast nal West Femto Maximum Sensitivity Substrate (Pierce). For to the other assays, no response was detected at concentra- subsequent blotting, the membrane was stripped using Re- tions <100 nM. store Western Blot Stripping Buffer (Pierce) for 30 min at 25C. The anti-MAPK blot was conducted in the same man- Histamine release assay ner, except the primary antibody was a rabbit anti-ERK poly- BMMCs were cultured overnight in full medium (2 3 106 mlÀ1) clonal antibody at 1/1000 (Cell Signaling Technologies). The in the presence of the anti-DNP IgE antibody [H1(206)] (18). anti-CRTh2 blot was hybridized with an anti-CRTh2 poly- The cells were washed two times and re-suspended in clonal antibody from Cayman Chemical. The western blot Tyrode’s buffer [112 mM NaCl, 2.7 mM KCl, 0.4 mM results were visualized using a Kodak Gel Logic 440 Imag- NaH2PO4, 1.6 mM CaCl2, 1 mM MgCl2, 10 mM HEPES ing System (Eastman Kodak, New Haven, CT, USA). (pH 7.5), 0.05% gelatin and 0.1% glucose] at a concentration 6 À1 of 10 3 10 ml . One hundred microliter aliquots were incu- Chemotaxis assay bated at 37C for 30 min, and the BMMCs were then treated All chemotaxis assays were performed in a 48-well modified with either antigen (DNP-BSA, 100 ng mlÀ1) in the presence Boyden chamber (Neuroprobe, Cabin John, MD, USA) as de- or absence of PGD , DK-PGD or PGE or the PGs alone. 2 2 2 scribed (21). BMMCs were re-suspended in RPMI 1640 (Invitro- The stimulated cells were incubated for an additional gen) with 10% FBS (Lonza Biowhittaker, Portsmouth, NH, USA) 45 min. At this point, the supernatant was isolated by pellet- at 2 3 106 cells mlÀ1. Twenty-five microliters of medium or me- ing the cells by centrifugation, and the histamine levels were dium containing PGD or DK-PGD (Cayman Chemical) at determined by ELISA according to the manufacturer’s protocol 2 2 varying concentrations were added to the bottom of the cham- (IBL, Hamburg, Germany). ber. A 5-lm pore size polyvinyl-pyrrolidone free polycarbonate filter (Osmotics, Livermore, CA, USA) was overlayed, and Measurement of IL-6 production 1 3 105 BMMCs were added to the upper chamber. Where in- Mast cells were loaded with antigen-specific IgE as de- dicated, mast cells were pre-incubated with either PD98059 scribed above in the histamine release assay section. Fol- (Calbiochem, San Diego, CA, USA) at 10 lMorCompoundA lowing two washes, the cells were re-suspended at at indicated concentrations for 15 min at 37C. Cells were a concentration of 1 3 106 cells mlÀ1 in full medium. The allowed to migrate for 1 h at 37C, after which time the filter mast cells were then stimulated with antigen (DNP-BSA, 10 was stained in Diff-Quik (Baxter, Deerfield, IL, USA). Migrating À1 ng ml ) in the presence or absence of PGD2, DK-PGD2 or cells were quantified by microscopy, manually counting four PGE2 for 20 h at 37C. The supernatant was collected and fields per well under high power (3400). The assays were per- assayed by ELISA for IL-6 according to the manufacturer’s formed in duplicate, and the results are shown as the average directions (R&D Systems). number of cells enumerated per condition 6SEM.

Western blot analysis In vivo chemotaxis assay BMMCs were re-suspended in Tyrode’s buffer. Stimulation In vivo migration was carried out similar to that described with PGD2 or DK-PGD2 was conducted at 37C and was previously (23). C57Bl/6 mice (4- to 6-week-old female) halted by the addition of cold PBS. The cells were then (Jackson Laboratories, Bar Harbor, ME, USA) were orally centrifuged at 4C and immediately re-suspended in 13 dosed with either Compound A (10, 1 and 0.1 mg kgÀ1)or RIPA buffer (Pierce, Rockford, IL, USA) containing freshly delivery vehicle prior to having their dorsal skin shaved and added protease and phosphatase inhibitors. The cells were receiving an intra-dermal (i.d.) injection of DK-PGD2 (3 lg vortex mixed briefly, incubated on ice for 15 min and subse- DK-PGD2 dissolved in a 50 ll volume of PBS and controls quently centrifuged to pellet-insoluble material. The superna- received PBS only). A total of 2.5 3 106 BMMCs suspended 624 Murine bone marrow-derived mast cells express CRTh2 in 100 ll of Tyrode’s buffer were then intravenously (i.v.) DK-PGD2,whichisaCRTh2-specific ligand. These experi- injected into the recipient animals. One hour after the i.v. ments showed an expected Kd of 2.9 6 1.1 nM, and the Bmax transfer of BMMC, the dorsal skin surrounding the i.d. injec- was 300.5 6 50.1 pM (Fig. 2A and B). The receptor number tion was isolated and snap frozen in OCT medium (Tissue per cell was calculated to be 1065 6 167 receptor sites per Tech, Torrance, CA, USA). The skin samples were then sec- cell. This data confirm functional cell surface expression of tioned and stained with Toluidine blue to allow visualization CRTh2onBMMC. of mast cells. The number of mast cells was determined by counting the number of Toluidine blue staining cells per CRTh2 activation modulates expression of cell surface high-power field (hpf) (3400). A minimum of 9 hpf was molecules counted for each skin section by a blinded reviewer. There Murine primary BMMCs were cultured in the presence of 50 were four mice in each Tx group. The results display the nM DK-PGD2 for 15 min, and levels of CD62L (L-selectin) mean number of mast cells per hpf 6 SEM, and statistical was assessed by flow cytometry. As shown in Fig. 3(A), significance was determined by the one-way analysis of there was a reduced amount of cell surface CD62L following Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021 variance test. DK-PGD2 Tx, indicating the BMMC shed L-selectin. Incubat- ing the cells with DK-PGD2 for longer time periods (30 and Results 45 min) did not appreciably increase the amount of L-selectin shedding. When BMMCs were cultured with 50 nM DK-PGD CRT 2 mRNA and protein are expressed by BMMCs 2 h for 12 h, there was a large increase in CD23, the low affinity To investigate whether primary BMMC express the CRTh2re- IgE receptor (FceRII) cell surface expression (Fig. 3B), and ceptor, RNA isolated from these cells were subjected to RT– a modest increase in the tumor necrosis factor (TNF) recep- PCR analysis. As shown in Fig. 1(A), BMMC RNA shows tor superfamily member CD30 expression (Fig. 3C). a PCR product of the expected size (694 bp). Protein lysates DK-PGD2-mediated activation of CRTh2 did not modulate made from BMMC were analyzed by western analysis. the cell surface expression of FceRI, CD40 ligand, OX-40 A specific 62 kDa band was observed at the expected mo- ligand, 4-1BB, CD28, CD11b, CD18 or CD117 (data not lecular weight of the glycosylated form of the receptor shown). (Fig. 1B). Collectively, these results demonstrated that CRTh2 is transcribed and translated by primary BMMCs. Activation of BMMC with PGD2 results in the mobilization of intracellular calcium Pharmacological characterization of CRTh2 on BMMC As CRTh2 has been shown to be Gai-linked GPCR, we exam- Saturation analysis and competitive binding assays were per- 3 ined BMMC for the ability to mobilize intracellular calcium formed with BMMC using [ H]-labeled PGD2 and non-labeled stores as an early response in the signaling cascade upon PGD2 stimulation. As shown in Fig. 4, PGD2 stimulation resulted in a transient Ca2+ mobilization, and this response was blocked by Ptx pre-Tx (data not shown). No cross- desensitization was observed when BMMCs were first treated with PGD2 followed by the CCR3 agonist chemokine CCL5 (RANTES), or inversely, treated with RANTES prior to the ad- ++ dition of PGD2. In contrast to FceRI-induced Ca mobilization, the flux detected with either PGD2 or the chemokines RANTES and eotaxin are both transient and of relatively low magnitude. Additionally, the magnitude of the PGD2-induced ++ Ca flux can be explained by the relatively low CRTh2 expression on the cell surface, as determined by saturation analysis (Fig. 2).

PGD2 does not augment antigen-mediated degranulation or cytokine production Activation of mast cells via polyvalent antigen cross-linking of IgE bound to FceRI receptors results in degranulation and cytokine production and the prostanoid PGE2 has previously been shown to enhance both responses (25–27). The Fig. 1. BMMCs express CRTh2 mRNA and protein. (A) Total RNA was PGE receptor, EP3, and CRT 2 are both G -linked G pro- isolated from BMMC, reverse transcribed and amplified by PCR using 2 h ai tein-coupled receptors and we investigated whether PGD2 CRTh2 or actin specific primers. A control PCR containing RNA that did not undergo a reverse transcriptase reaction was negative. could modify these responses also. As shown in Fig. 5(A), Importantly, this demonstrates that the product amplified is not from neither PGD2 nor PGE2 caused histamine release by mast contaminating DNA, which is a possibility since the coding region of cells when added in the absence of antigen. However, when CRTh2 is contained on one exon (24). (B) Western analysis of protein lysates were made from either BMMC or HELA cells and hybridized given together with antigen to BMMC loaded with IgE, the with an anti-CRTh2 polyclonal antibody, revealing a 62 kDa band co-administration of PGE2 caused an increased release of corresponding to the glycosylated form of the receptor. histamine compared with antigen alone. On the other hand, Murine bone marrow-derived mast cells express CRTh2 625

3 Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021 Fig. 2. Pharmacological characterization of the CRTh2 receptor on BMMC. (A) Saturation analysis of [ H]-PGD2 binding to CRTh2 on BMMC. 3 Cells were incubated with various concentrations of [ H]-PGD2 in the absence (total binding) or presence (non-specific binding) of DK-PGD2. Each data point was repeated in duplicate. The specific binding is shown and this was calculated as the difference between total binding and non-specific binding. The Kd and Bmax were determined using a one-site-binding model using GraphPad Prizm software. (B) Competitive binding 3 analysis of BMMC incubated with [ H]-PGD2 in the presence of various concentrations of DK-PGD2. Each data point was done in triplicate. Representative data from two independent saturation analysis experiments are shown, and the average 6 SEM of two separate competitive binding assays are displayed.

Fig. 3. DK-PGD2 Tx induces CD62L shedding and CD23 and CD30 up-regulation in BMMC as determined by ﬂow cytometry. (A) Mast cells were cultured with 50 nM DK-PGD2 for 15 min, and cell surface expression of CD62L (L-selectin) was examined. The expression of CD62L following incubation with DK-PGD2 is shown in bold, and no Tx shown in the light line. The gray ﬁlled area represents the isotype control antibody. Incubation of the mast cells with DK-PGD2 for 30 or 45 min did not induce any further CD62L shedding. (B and C) Mast cells were cultured with 50 nM DK-PGD2 for 12 h and the levels of CD23 (B) and CD30 (C) are up-regulated (bold lines) in comparison with untreated cells (light lines). The isotype control antibody staining is shown in gray. Representative FACS plots from three independent experiments are shown.

neither PGD2 nor DK-PGD2 had any signiﬁcant effect on an- observed that PGE2 stimulation of BMMC resulted in IL-6 tigen-mediated histamine release. We investigated this fur- production, whereas PGD2 or DK-PGD2 did not (Fig. 5B). In ther by next examining IL-6 production. IL-6 has been contrast to PGE2, the addition of PGD2 together with antigen reported to be released by mast cells upon PGE2 stimulation did not increase IL-6 production in IgE-loaded BMMCs when alone, as well as after FceRI-mediated activation (26). We compared with antigen Tx alone (Fig. 5C). We also observed 626 Murine bone marrow-derived mast cells express CRTh2 Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021

Fig. 4. Bone marrow-derived primary mast cells mobilize intracellular calcium in response to PGD2 stimulation. Mast cells were loaded with indo- 1AM and examined for the ability to release intracellular calcium in response to receptor activation. In the left panel, cells were stimulated ﬁrst with 2+ PGD2 (10 lM) (lower trace). After ;90 s, the cells were re-stimulated with 100 nM CCL5 (RANTES) and as expected, an additive Ca ﬂux was observed indicating that no receptor cross-desensitization occurred. The inverse experiment is shown on the right panel with consistent results. Representative results from three experiments are shown.

a similar lack of a PGD2 or DK-PGD2 effect on TNF-a and IL-2 in part, the inability of PGD2 to modulate FceRI-mediated production (data not shown). These results show a clear histamine release and cytokine production. functional difference between the prostanoids PGD2 and CRT 2 activation leads to the phosphorylation of ERK1 and PGE2 on IgE-loaded BMMC. To explore this further, we ex- h ++ ERK2 in primary BMMC amined the ability of PGD2 and PGE2 to induce Ca mobilization in IgE-loaded BMMC and as a side-by-side control, We next investigated whether CRTh2 stimulation could result non-IgE-loaded BMMC. As shown in Fig. 4 (PGD2) and Fig. in the phosphorylation of p42/44 ERK kinases. It has previ- 5(D) (PGD2 and PGE2), stimulation of non-IgE-loaded ously been shown for chemokine receptor activation and BMMCs with either PGD2 or PGE2 resulted in mobilization of subsequent cellular migration that MEK-mediated ERK phos- intracellular Ca++. Strikingly, IgE-loaded BMMC only mobi- phorylation is a necessary event for actin rearrangement and lized calcium in response to PGE2 and not PGD2 (Fig. 5E). chemotaxis (21). The PGD2–CRTh2 interaction has been We further examined whether the addition of PGD2 could demonstrated to induce the chemotaxis of T lymphocytes, modulate calcium mobilization induced by FceRI-mediated eosinophils and basophils. As shown in Fig. 6(A), the addi- activation. Figure 5(F) shows an antigen dose titration show- tion of either PGD2 or DK-PGD2 induces ERK phosphoryla- ing FceRI-induced Ca++ mobilization results in a robust and tion, whereas pre-Tx of the cells for 15 min with the MEK more sustained calcium flux than either of the prostanoids inhibitor PD98059 greatly reduced the levels of ERK phos- or chemokines examined. A possible reason for this differ- phorylation. Kinetic analysis showed that the ERKs are phos- ence is that G protein-coupled receptors linked to Gai re- phorylated within 1 min after the addition of DK-PGD2, lease only intracellular Ca++ stores in response to activation. reaching a maximum at 15 min (Fig. 6B). Dose titration anal- FceRI, on the other hand, also induces a Ca++ ion influx via ysis demonstrated that a concentration as low as 10À10 M SOCC channels, resulting in a much more robust and sus- of DK-PGD2 is sufficient for BMMC to phosphorylate the tained flux (28, 29). As the amount of antigen decreased, p42/44 ERK kinases, and the level of phosphorylation in- the magnitude of the calcium flux both decreased and was creased through 10À7 M. These results demonstrate that delayed (Fig. 5F). We tested whether PGD2 or PGE2 could BMMC phosphorylation of the ERK kinases due to DK-PGD2 modulate calcium mobilization at the lowest dose of antigen stimulation is both time and dose dependent, and this acti- tested. As shown in Fig. 5(G), the addition of PGE2 and 0.1 vation occurs via a MEK-dependent pathway. À1 ng ml antigen resulted in a more rapid calcium flux, where We next asked whether Compound A could inhibit CRTh2 PGD2 had no significant effect. The inability of PGD2 to ef- activation-dependent ERK phosphorylation. BMMC were fect calcium mobilization by IgE-loaded BMMC is entirely pre-treated with various concentrations of Compound A for À7 consistent with the absence of a PGD2 effect on histamine 10 min prior to the addition of 10 M DK-PGD2. As shown release and IL-6 production. The non-responsiveness of in Fig. 6(C), Compound A inhibited ERK phosphorylation fol- BMMC loaded with IgE overnight may be due to CRTh2 lowing an incubation with DK-PGD2 for 15 min, and the inhi- down-regulation, as human Th2 T lymphocytes down-modu- bition seen was dose dependent. The level of ERK late CRTh2 mRNA expression upon TCR ligation (30). As no phosphorylation was reduced to background levels following À8 anti-mouse CRTh2 antibody is available for FACS analysis, Tx of BMMC with 10 M of the CRTh2 antagonist. Similar we examined CRTh2 mRNA levels in untreated BMMC and results were seen when the BMMCs were stimulated with À7 BMMC loaded with IgE for 18 h (Fig. 5H). RT–PCR analysis 10 M PGD2 (Fig. 6D). As Compound A is specific for revealed that CRTh2 mRNA levels are dramatically CRTh2, in contrast with PGD2 which can bind and activate decreased upon IgE binding, and this may explain, at least both the CRTh2 and DP1 receptors, these results Murine bone marrow-derived mast cells express CRTh2 627 Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021

Fig. 5. PGD2 does not augment FceRI-mediated histamine release or IL-6 production. (A) BMMCs were loaded overnight with an excess of antigen-specific IgE, and histamine release was measured after a 45-min incubation with either PGD2 (1 lM), DK-PGD2 (1 lM) or PGE2 (1 lM) À1 alone or in combination with polyvalent antigen (100 ng ml ). (B and C) IL-6 production was measured after BMMCs were incubated with PGD2 À1 (1 lM), DK-PGD2 (1 lM) or PGE2 (1 lM) for 20 h (B) or IgE-loaded BMMC treated with antigen (10 ng ml ) in the absence or presence of PGD2, DK-PGD2 or PGE2 (C). (D–G) Calcium mobilization was measured in BMMC (D) or IgE-loaded BMMC (E) stimulated with PGD2 (10 lM) and PGE2 (10 lM). Panel (F) shows the calcium response of IgE-loaded BMMC in response to various doses of antigen, and (G) shows the response of IgE- À1 loaded BMMC stimulated with 0.1 ng ml antigen and either PGD2 (10 lM) or PGE2 (10 lM). The BMMCs were stimulated with a 10 lM dose of ++ either PGD2 or PGE2 in the Ca mobilization experiments to induce a robust response under the experimental conditions used. (H) RT–PCR analysis of CRTh2 expression in either BMMC or BMMC loaded with IgE overnight. Actin levels are shown as a control. All results shown are from representative experiments from a minimum of two independent experiments (n = 2–5). demonstrate that BMMC ERK phosphorylation in response to a dose-dependent manner (Fig. 7A). Interestingly, DK- À9 PGD2 stimulation occurs via CRTh2-mediated pathway. PGD2-mediated chemotaxis was maximal at 10 M, À8 whereas maximal PGD2-induced migration occurred at 10 M. CRTh2 activation induces chemotaxis of bone marrow-derived The decreased efficacy seen with PGD2 may be due to DP1 mast cells receptor expression on BMMC, as activation of DP1 has As CRTh2 activation can induce signaling responses in pri- been shown to inhibit chemotaxis of other cells (31). In line mary BMMCs that are necessary for chemotaxis in other cell with this, pre-Tx of BMMC with Ptx prior to CRTh2 activation types (21), we examined whether PGD2 or DK-PGD2 stimula- by either PGD2 or DK-PGD2 blocked all chemotaxis tion can induce a chemotactic response. Chemotaxis (Fig. 7A). As the DP1 receptor is linked to Gas, and is not assays, using a modified Boyden chamber, demonstrated Ptx sensitive, this provides further evidence that CRTh2, that both ligands could elicit directed migration of BMMC in which is Gai coupled, is mediating the chemotaxis observed. 628 Murine bone marrow-derived mast cells express CRTh2 Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021

Fig. 6. Immunoblot analysis showing PGD2 and DK-PGD2 stimulation of BMMC results in phosphorylation of ERK kinases, and this can be inhibited by a CRTh2-specific antagonist, Compound A. (A) BMMCs were stimulated with 100 nM PGD2 or DK-PGD2 with or without a 15-min pre-incubation with the MEK inhibitor PD98059 (10 lM). Western analysis of the BMMC lysates were probed with antibodies specific for the phosphorylated forms of p42 and p44 ERK kinases. The immunoblot was reprobed with antibodies specific for ERK1 and ERK2 to show equal loading of cell lysate in each À7 lane. (B) BMMCs were incubated with 10 M of DK-PGD2 for the indicated times, and the lysates were examined for phospho-ERK. Additionally, the BMMCs were treated with various concentrations of DK-PGD2 for 15 min and examined for phosphorylation of the ERK kinases. The blots were reprobed with anti-p42/p44 ERK to control for equal loading of the protein lysates. (C and D) BMMCs were incubated with various concentrations of À7 À7 Compound A for 10 min prior to stimulation with 10 M DK-PGD2 (C) or 10 MPGD2 (D). After 15 min, the cells were harvested and the protein lysates were examined for ERK kinase phosphorylation by western blotting. The blots were then reprobed for total ERK kinase protein. Experiment 6A was repeated twice, and experiments 6B, C and D repeated a minimum of three times and representative western blots are shown.

Inhibition of CRTh2 by the speciﬁc antagonist, Compound BMMC can migrate to DK-PGD2 in vivo and this response can A, was able to block both PGD2- and DK-PGD2-induced be abrogated by Compound A chemotaxis (Fig. 7B). Compound A was effective at concen- We subsequently wanted to test whether i.v. injected BMMC trations ranging from 1 to 100 nM, demonstrating that CRTh2 could localize to areas of high DK-PGD2 concentration is the receptor responsible for regulating PGD2-mediated in vivo. As BMMCs migrated in response to CRTh2 activation chemotaxis of BMMC. in vitro, we hypothesized that they should be able to so Murine bone marrow-derived mast cells express CRTh2 629 Both the 10 and 1 mg kgÀ1 doses were effective at blocking BMMC migration to the exogenously administered DK-PGD2 in each experiment. Coupled with the in vitro chemotaxis experiments, these studies show that primary BMMCs have the ability to respond functionally to CRTh2 activation by migrating speciﬁcally to PGD2 or DK-PGD2.

Discussion

This study shows that mast cells both express the CRTh2re- ceptor and respond functionally to this receptor’s ligands, endogenous PGD2 and the CRTh2-specific ligand DK-PGD2. 2+ CRTh2 activation results in intracellular Ca mobiliza- Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021 tion (Fig. 4), phosphorylation of the p42/p44 ERK kinases (Fig. 6), shedding of L-selectin (Fig. 3A) and chemotaxis (Fig. 7). If the responses of BMMCs are like those of mast cells in tissues in situ, then these responses may be part of a cascade necessary for in vivo migration of mast cells into tissues. Activation of mast cells by polyvalent antigen cross-linking of cell surface-bound IgE molecules coupled with subsequent release of potent mediators make mast cells pivotal players in the initiation and maintenance of various inflammatory conditions as well as allergic responses. Further- more, mast cell hyperplasia has been noted in various inflammatory conditions such as asthma (32), atopic dermatitis (33), allergic rhinitis (34), psoriasis (35) and rheumatoid arthritis (36). Whether this is due to mast cell proliferation or recruitment is not well understood. Neither is the process of mast cell recruitment to inflamed tissues nor the chemotactic factors regulating this process for specific inflammatory conditions have not been defined. Some chemoattractants that have the ability to induce in vitro chemotaxis of murine BMMC include stem cell factor, IL-3, MCP-1 (CCL2), MIP-1a (CCL3), RANTES (CCL5) and LTB4 (23, 37, 38, 39). We Fig. 7. Chemotaxis of BMMC in response to PGD2 and DK-PGD2 and demonstrate here that murine BMMCs were able to localize this can be inhibited by Compound A. (A) BMMCs migrated in in the skin from the circulation in response to i.d. injected response to with various concentrations of PGD2 or DK-PGD2.As a control, BMMCs were pre-incubated with 100 ng mlÀ1 Ptx for 1 h DK-PGD2 (Fig. 8). Furthermore, the response could be before stimulation. BMMCs were incubated with DK-PGD2 (B) or inhibited by the oral administration of potent and selective PGD2 (C) in the presence of varying concentrations of Compound A CRTh2 antagonist. Although the experiment carried out here À9 À7 (10 –10 M). For each experiment, each experimental condition represents an artificial experimental system as mature was performed in duplicate, 4 hpfs were counted per Tx (8 hpfs per experimental condition), and the average number of migrated cells BMMCs are not ordinarily found in the circulation, these per hpf is shown 6SEM. The experiment was repeated three inde- results can be taken to suggest that PGD2 may be another pendent times and representative chemotaxis assays are presented. chemoattractant utilized to recruit mast cells to the sites of inflammation where PGD2 is released. This attribute may play a role in exacerbating diseases such as asthma, atopic in vivo. Further, Compound A would be expected to block dermatitis and allergic rhinitis. this recruitment. To test this, C57Bl/6 mice were orally dosed Mast cells release the arachidonic acid metabolite PGD2 with either drug vehicle or Compound A at various doses following activation and are the greatest producers of PGD2 (10, 1 and 0.1 mg kgÀ1) prior to receiving an i.d. injection of in the body. This raises the notion that activation-induced re- DK-PGD2 into the dorsal skin (control mice received PBS lease of PGD2 may result in the recruitment of mast cells to i.d.). Primary BMMCs were then i.v. injected into the tail vein the inflammatory sites. The ability of chemoattractants to at- of the dosed recipient mice. After 1 h, the skin surrounding tract cells expressing counter receptors into inflamed tissues the i.d. injection site was excised, sectioned and stained has well been established. PGD2 has been shown to be with Toluidine blue. Toluidine blue stains mast cell granules a chemotactic for eosinophils, basophils and Th2 helper and allows visualization of mast cells on the skin sections. T cells, and this could inhibited by the antagonism of CRTh2 Enumeration of mast cells showed that BMMC can indeed (13, 20). Collectively, it is plausible that the PGD2-CRTh2 migrate from the bloodstream to the site of the i.d. DK-PGD2 system acts as an autocrine feedback loop that can attract injection (Fig. 8A and B). Strikingly, this in vivo migration mast cells to the sites of inflammation and PGD2 release, could be blocked by orally administered Compound A. resulting in amplification of the inflammatory response. 630 Murine bone marrow-derived mast cells express CRTh2 Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021

Fig. 8. In vivo migration of BMMCs in response to i.d. DK-PGD2 is inhibited by Compound A. (A) Mice received Compound A (0.1, 1 or 10 mg À1 kg ) or delivery vehicle (saline) orally in a 100 ll volume, followed by an i.d. injection of DK-PGD2 (3 lg) and i.v. delivery of BMMCs. One hour after the i.d. DK-PGD2 injection, the skin surrounding the site was isolated and stained with Toluidine blue to allow for enumeration of mast cells. A blinded reviewer counted the number of mast cells from a minimum of 9 hpf per section. Three to four sections were made from each mouse, and there were four mice per Tx group. The average number of mast cells per hpf 6 SEM is shown. Two independent replicates of this experiment are shown. (B) Toluidine blue-stained skin sections were isolated from the area where DK-PGD2 was i.d. injected. The mice received either PBS or BMMC injected i.v. 1 h prior to harvesting the skin.

CD30 is a cell surface receptor that belongs to the tumor with IgE overnight (Fig. 5D–G). Thus, the occupancy of the necrosis receptor superfamily, and is up-regulated on high affinity IgE receptor with IgE drastically decreased BMMC treated with DK-PGD2 (Fig. 3C). Ligation of CD30 by BMMC responsiveness to PGD2 in vitro. Our preliminary data CD30 ligand has been shown to result in the release of IL-8, indicate that this may reflect a down-regulation of CRTh2in MIP-1a and MIP-1b, and this process was found to be inde- such cells after exposure to IgE, at least at the mRNA level pendent of IgE (40). Hence, CRTh2-mediated recruitment of (Fig. 5H). Down-regulation of CRTh2 mRNA upon IgE bind- mast cells may also prime BMMC for CD30-induced cyto- ing in BMMC is similar to Th2 T lymphocytes transiently kine and chemokine production. down-regulating CRTh2 mRNA and cell surface levels imme- During the course of this study, we also examined whether diately following TCR ligation (30). Additionally, CRTh2 may PGD2 or DK-PGD2 could modulate the release of granule act similarly to other Gai-linked chemoattractant GPCRs in components, specifically histamine, or cytokine secretion, which activation elicits a chemotactic response with no ap- such as IL-6, TNF-a and IL-2, upon antigen-induced cross- parent effect on FceRI-mediated degranulation (41–43). In linking of IgE-loaded BMMC. It has previously been shown either case, if the observed decreased BMMC responsive- that PGE2 could potentiate IgE-mediated cytokine release ness to PGD2 in response to occupancy of the high affinity and in some reports been shown to induce IL-6 and GM- IgE receptor with IgE seen in vitro were to occur in human CSF production by PGE2 Tx alone (25–27). These effects mast cells in vivo, then such mast cells may give little or no were thought to be mediated by the Gai-linked EP3 receptor. response to stimulation with PGD2. Taken together, our We found no effect of PGD2 or DK-PGD2 stimulation on ei- results suggest that CRTh2 activation may prime mast cells ther of these processes in contrast to PGE2, used a side-by- with no, or perhaps minimal, FceRI occupancy with IgE for side control (Fig. 5A–C). Further, BMMC lost the ability to the release of inflammatory mediators, but PGD2 does not ++ flux Ca in response to PGD2 when the cells were loaded appear to control their release directly. Murine bone marrow-derived mast cells express CRTh2 631 In summary, these results show that primary BMMCs ex- their role in inflammation in the lung and gut. Immunology press CRT 2 and that the endogenous ligand, PGD ,isa 105:375. h 2 9 Boyce, J. A. 2007. Mast cells and eicosanoid mediators: a system chemotactic factor both in vitro and in vivo via activation of of reciprocal paracrine and autocrine regulation. Immunol. Rev. the CRTh2 receptor. Mast cells are potent pro-inflammatory 217:168. cells that play a key role in allergic diseases, such as atopic 10 Kim, N. and Luster, A. D. 2007. Regulation of immune cells by dermatitis and asthma, and their numbers are increased at eicosanoid receptors. Scientific World Journal 7:1307. the sites of inflammation. As mast cells also synthesize and 11 Urade, Y., Ujihara, M., Horiguchi, Y. et al. 1990. Mast cells contain spleen-type prostaglandin D synthetase. J. Biol. Chem. release PGD2 in response to activation, the CRTh2-PGD2 265:371. system may result in an autocrine feedback loop recruiting 12 Lu, R., Kanai, N., Bao, Y. and Schuster, V. L. 1996. Cloning, in vitro greater numbers of mast cells to the sites of inflammation. expression, and tissue distribution of a human prostaglandin These observations together suggest that antagonism of transporter cDNA(hPGT). J. Clin. Invest. 98:1142. CRT 2 may be a rational therapeutic course for the Tx of 13 Pettipher, R., Hansel, T. T. and Armer, R. 2007. Antagonism of the h prostaglandin D2 receptors DP1 and CRTH2 as an approach to allergic diseases.

treat allergic diseases. Nat. Rev. Drug Discov. 6:313. Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021 14 Boie, Y., Sawyer, N., Slipetz, D. M., Metters, K. M. and Abramovitz, M. 1995. Molecular cloning and characterization of the human Acknowledgements prostanoid DP receptor. J. Biol. Chem. 270:18910. Conflict of interest statement: S.A.B., E.P.C., T.W.L. and K.B.B. are 15 Nagata, K., Tanaka, K., Ogawa, K. et al. 1999. Selective Actimis Pharmaceuticals shareholders. All other authors have no expression of a novel surface molecule by human Th2 cells conflicting interests. in vivo. J. Immunol. 162:1278. 16 Yoshimura-Uchiyama, C., Iikura, M., Yamaguchi, M. et al. 2004. Differential modulation of human basophil functions through Abbreviations prostaglandin D2 receptors DP and chemoattractant receptor- BMMC bone marrow-derived mast cell homologous molecule expressed on Th2 cells/DP2. Clin. Exp. Allergy 34:1283. CRTh2 chemoattractant receptor-homologous molecule expressed on T class 2 cell 17 Gervais, F. G., Cruz, R. P., Chateauneuf, A. et al. 2001. Selective h modulation of chemokinesis, degranulation, and apoptosis in DK-PGD2 13,14-dihydro-15-keto-prostaglandin D2 DP1 prostanoid D1 receptor eosinophils through the PGD2 receptors CRTH2 and DP. J. Allergy ERK extracellular signal-regulated kinase Clin. Immunol. 108:982. GPCR G-protein-coupled receptor 18 Nishimoto, H., Lee, S. W., Hong, H. et al. 2005. Costimulation of hpf high-power field mast cells by 4-1BB, a member of the tumor necrosis factor i.d. intra-dermal receptor superfamily, with the high-affinity IgE receptor. Blood i.v. intravenous 106:4241. LT leukotriene 19 Boehme, S. A. and Lenardo, M. J. 1996. TCR-mediated death of PG prostaglandin mature T lymphocytes occurs in the absence of p53. J. Immunol. Ptx pertussis toxin 156:4075. RT reverse transcription 20 Sugimoto, H., Shichijo, M., Iino, T. et al. 2003. An orally bioavail- TNF tumor necrosis factor able small molecule antagonist of CRTH2, ramatroban (BAY Tx treatment u3405), inhibits prostaglandin D2-induced eosinophil migration in vitro. J. Pharmacol. Exp. Ther. 305:347. 21 Boehme, S. A., Sullivan, S. K., Crowe, P. D. et al. 1999. Activation of mitogen-activated protein kinase regulates eotaxin-induced References eosinophil migration. J. Immunol. 163:1611. 1 Wedemeyer, J., Tsai, M. and Galli, S. J. 2000. Roles of mast cells 22 Franz-Bacon, K., Dairaghi, D. J., Boehme, S. A. et al. 1999. and basophils in innate and acquired immunity. Curr. Opin. Human thymocytes express CCR-3 and are activated by eotaxin. Immunol. 12:624. Blood 93:3233. 2 Gurish, M. F. and Boyce, J. A. 2006. Mast cells: ontogeny, homing, 23 Weller, C. L., Collington, S. J., Brown, J. K. et al. 2005. Leukotriene and recruitment of a unique innate effector cell. J. Allergy Clin. B4, an activation product of mast cells, is a chemoattractant for Immunol. 117:1285. their progenitors. J. Exp. Med. 201:1961. 3 Marshall, J. S. 2004. Mast-cell responses to pathogens. Nat. Rev. 24 Hata, A. N., Zent, R., Breyer, M. D. and Breyer, R. M. 2003. Immunol. 4:787. Expression and molecular pharmacology of the mouse CRTH2 4 Kirshenbaum, A. S., Goff, J. P., Semere, T., Foster, B., Scott, L. M. receptor. J. Pharmacol. Exp. Ther. 306:463. and Metcalfe, D. D. 2007. Demonstration that human mast cells 25 Kuehn, H. S., Beaven, M. A., Ma, H. T., Kim, M. S., Metcalfe, D. D. arise from a progenitor cell population that is CD34(+), c-kit(+), and Gilfillan, A. M. 2008. Synergistic activation of phospholipases Cc and Cb: a novel mechanism for PI3K-independent enhance- and expresses aminopeptidase N (CD13). Blood 6:313. ment of FceRI-induced mast cell mediator release. Cell. Signal. 5 Nakano, T., Sonoda, T., Hayashi, C. et al. 1985. Fate of bone 20:625. marrow-derived cultured mast cells after intracutaneous, intraper- 26 Gomi, K., Zhu, F. G. and Marshall, J. S. 2000. Prostaglandin E2 itoneal, and intravenous transfer into genetically mast cell- selectively enhances IgE-mediated production of IL-6 and deficient W/Wv mice. Evidence that cultured mast cells can give granulocyte-macrophage colony-stimulating factor by mast cells rise to both connective tissue type and mucosal mast cells. J. Exp. through an EP1/EP3-dependent mechanism. J. Immunol. Med. 162:1025. 165:6545. 6 Kitamura, Y., Go, S. and Hatanaka, K. 1978. Decrease of mast 27 Nguyen, M. T., Solle, M., Audoly, L. P. et al. 2002. Receptors and cells in W/Wv mice and their increase by bone marrow trans- signaling mechanisms required for prostaglandin E2-mediated plantation. Blood 52:447. regulation of mast cell degranulation and IL-6 production. 7 Reynolds, D. S., Stevens, R. L., Lane, W. S., Carr, M. H., Austen, K. F. J. Immunol. 169:4586. and Serafin, W. E. 1990. Different mouse mast cell populations 28 Turner, H. and Kinet, J. P. 1999. Signalling through the high-affinity express various combinations of at least six distinct mast cell serine IgE receptor Fc epsilonRI. Nature 402:B24. proteases. Proc. Natl Acad. Sci. USA 87:3230. 29 Hirasawa, N., Scharenberg, A., Yamamura, H., Beaven, M. A. and 8 Miller, H. R. and Pemberton, A. D. 2002. Tissue-specific Kinet, J. P. 1995. A requirement for Syk in the activation of the expression of mast cell granule serine proteinases and microtubule-associated protein kinase/phospholipase A2 pathway 632 Murine bone marrow-derived mast cells express CRTh2 by Fc epsilon R1 is not shared by a G protein-coupled receptor. 37 Meininger, C. J., Yano, H., Rottapel, R., Bernstein, A., Zsebo, K. M. J. Biol. Chem. 270:10960. and Zetter, B. R. 1992. The c-kit receptor ligand functions as 30 Tanaka, K., Hirai, H., Takano, S., Nakamura, M. and Nagata, K. a mast cell chemoattractant. Blood 79:958. 2004. Effects of prostaglandin D2 on helper T cell functions. 38 Matsuura, N. and Zetter, B. R. 1989. Stimulation of mast cell Biochem. Biophys. Res. Commun. 316:1009. chemotaxis by interleukin 3. J. Exp. Med. 170:1421. 31 Hammad, H., de Heer, H. J., Soullie, T., Hoogsteden, H. C., 39 Lundeen, K. A., Sun, B., Karlsson, L. and Fourie, A. M. 2006. Trottein, F. and Lambrecht, B. N. 2003. Prostaglandin D2 inhibits Leukotriene B4 receptors BLT1 and BLT2: expression and function airway dendritic cell migration and function in steady state conditions by selective activation of the D prostanoid receptor 1. in human and murine mast cells. J. Immunol. 177:3439. J. Immunol. 171:3936. 40 Fischer, M., Harvima, I. T., Carvalho, R. F. et al. 2006. Mast cell 32 Okayama, Y., Ra, C. and Saito, H. 2007. Role of mast cells in CD30 ligand is upregulated in cutaneous inflammation and airway remodeling. Curr. Opin. Immunol. 19:687. mediates degranulation-independent chemokine secretion. J. 33 Leung, D. Y. 1999. Pathogenesis of atopic dermatitis. J. Allergy Clin. Invest. 116:2748. Clin. Immunol. 104:S99. 41 Taub, D., Dastych, J., Inamura, N. et al. 1995. Bone marrow- 34 Juliusson, S., Pipkorn, U., Karlsson, G. and Enerba¨ck, L. 1992. derived murine mast cells migrate, but do not degranulate, in

Mast cells and eosinophils in the allergic mucosal response to response to chemokines. J. Immunol. 154:2393. Downloaded from https://academic.oup.com/intimm/article/21/6/621/701631 by guest on 28 September 2021 allergen challenge: changes in distribution and signs of activation 42 Papadopoulos, E. J., Fitzhugh, D. J., Tkaczyk, C. et al. 2000. Mast in relation to symptoms. J. Allergy Clin. Immunol. 90:898. cells migrate, but do not degranulate, in response to fractalkine, 35 Jiang, W. Y., Chattedee, A. D., Raychaudhuri, S. P., Raychaudhuri, S. K. and Farber, E. M. 2001. Mast cell density and IL-8 a membrane-bound chemokine expressed constitutively in di- expression in nonlesional and lesional psoriatic skin. Int. verse cells of the skin. Eur. J. Immunol. 30:2355. J. Dermatol. 40:699. 43 Kuehn, H. S. and Gilfillan, A. M. 2007. G protein coupled receptors 36 Nigrovic, P. A. and Lee, D. M. 2005. Mast cells in inflammatory and the modification of FceRI-mediated mast cell activation. arthritis. Arthritis Res. Ther. 7:1. Immunol. Lett. 113:59.