Cyclindependent Kinase Inhibitor 3 (CDKN3) Novel Cell Cycle Computational Network Between Human Nonmalignancy Associated Hepatit
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Bioinformatics-Based Screening of Key Genes for Transformation of Liver
Jiang et al. J Transl Med (2020) 18:40 https://doi.org/10.1186/s12967-020-02229-8 Journal of Translational Medicine RESEARCH Open Access Bioinformatics-based screening of key genes for transformation of liver cirrhosis to hepatocellular carcinoma Chen Hao Jiang1,2, Xin Yuan1,2, Jiang Fen Li1,2, Yu Fang Xie1,2, An Zhi Zhang1,2, Xue Li Wang1,2, Lan Yang1,2, Chun Xia Liu1,2, Wei Hua Liang1,2, Li Juan Pang1,2, Hong Zou1,2, Xiao Bin Cui1,2, Xi Hua Shen1,2, Yan Qi1,2, Jin Fang Jiang1,2, Wen Yi Gu4, Feng Li1,2,3 and Jian Ming Hu1,2* Abstract Background: Hepatocellular carcinoma (HCC) is the most common type of liver tumour, and is closely related to liver cirrhosis. Previous studies have focussed on the pathogenesis of liver cirrhosis developing into HCC, but the molecular mechanism remains unclear. The aims of the present study were to identify key genes related to the transformation of cirrhosis into HCC, and explore the associated molecular mechanisms. Methods: GSE89377, GSE17548, GSE63898 and GSE54236 mRNA microarray datasets from Gene Expression Omni- bus (GEO) were analysed to obtain diferentially expressed genes (DEGs) between HCC and liver cirrhosis tissues, and network analysis of protein–protein interactions (PPIs) was carried out. String and Cytoscape were used to analyse modules and identify hub genes, Kaplan–Meier Plotter and Oncomine databases were used to explore relationships between hub genes and disease occurrence, development and prognosis of HCC, and the molecular mechanism of the main hub gene was probed using Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway analysis. -
HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal -
The Regulatory Roles of Phosphatases in Cancer
Oncogene (2014) 33, 939–953 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc REVIEW The regulatory roles of phosphatases in cancer J Stebbing1, LC Lit1, H Zhang, RS Darrington, O Melaiu, B Rudraraju and G Giamas The relevance of potentially reversible post-translational modifications required for controlling cellular processes in cancer is one of the most thriving arenas of cellular and molecular biology. Any alteration in the balanced equilibrium between kinases and phosphatases may result in development and progression of various diseases, including different types of cancer, though phosphatases are relatively under-studied. Loss of phosphatases such as PTEN (phosphatase and tensin homologue deleted on chromosome 10), a known tumour suppressor, across tumour types lends credence to the development of phosphatidylinositol 3--kinase inhibitors alongside the use of phosphatase expression as a biomarker, though phase 3 trial data are lacking. In this review, we give an updated report on phosphatase dysregulation linked to organ-specific malignancies. Oncogene (2014) 33, 939–953; doi:10.1038/onc.2013.80; published online 18 March 2013 Keywords: cancer; phosphatases; solid tumours GASTROINTESTINAL MALIGNANCIES abs in sera were significantly associated with poor survival in Oesophageal cancer advanced ESCC, suggesting that they may have a clinical utility in Loss of PTEN (phosphatase and tensin homologue deleted on ESCC screening and diagnosis.5 chromosome 10) expression in oesophageal cancer is frequent, Cao et al.6 investigated the role of protein tyrosine phosphatase, among other gene alterations characterizing this disease. Zhou non-receptor type 12 (PTPN12) in ESCC and showed that PTPN12 et al.1 found that overexpression of PTEN suppresses growth and protein expression is higher in normal para-cancerous tissues than induces apoptosis in oesophageal cancer cell lines, through in 20 ESCC tissues. -
Pharmacological Targeting of the Mitochondrial Phosphatase PTPMT1 by Dahlia Doughty Shenton Department of Biochemistry Duke
Pharmacological Targeting of the Mitochondrial Phosphatase PTPMT1 by Dahlia Doughty Shenton Department of Biochemistry Duke University Date: May 1 st 2009 Approved: ___________________________ Dr. Patrick J. Casey, Supervisor ___________________________ Dr. Perry J. Blackshear ___________________________ Dr. Anthony R. Means ___________________________ Dr. Christopher B. Newgard ___________________________ Dr. John D. York Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biochemistry in the Graduate School of Duke University 2009 ABSTRACT Pharmacological Targeting of the Mitochondrial Phosphatase PTPMT1 by Dahlia Doughty Shenton Department of Biochemistry Duke University Date: May 1 st 2009 Approved: ___________________________ Dr. Patrick J. Casey, Supervisor ___________________________ Dr. Perry J. Blackshear ___________________________ Dr. Anthony R. Means ___________________________ Dr. Christopher B. Newgard ___________________________ Dr. John D. York An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biochemistry in the Graduate School of Duke University 2009 Copyright by Dahlia Doughty Shenton 2009 Abstract The dual specificity protein tyrosine phosphatases comprise the largest and most diverse group of protein tyrosine phosphatases and play integral roles in the regulation of cell signaling events. The dual specificity protein tyrosine phosphatases impact multiple -
Identification of Seven Hub Genes As the Novel Biomarkers in Triple
Identication of Seven Hub Genes as the Novel Biomarkers in Triple-negative Breast Cancer and Breast Cancer Metastasis Huanxian Wu Southern Medical University Huining Lian Southern Medical University Nanfang Hospital Qianqing Chen Southern Medical University Jinlamao Yang Southern Medical University Nanfang Hospital Baofang Ou Southern Medical University Dongling Quan Southern Medical University Lei Zhou Southern Medical University Lin Lv Southern Medical University Minfeng Liu Southern Medical University Nanfang Hospital Shaoyu Wu ( [email protected] ) Guangdong Provincial Key Laboratory of New Drug Screening, School of Pharmaceutical Science, Southern Medical University, Guangzhou, Guangdong, 510515, PR China. https://orcid.org/0000-0002- 1247-5295 Research article Keywords: Triple-negative breast cancer, Metastasis, Biomarkers, Prognostic signature Posted Date: October 5th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-73076/v1 Page 1/20 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 2/20 Abstract Background: Breast cancer is one of the most common malignant tumors with the highest morbidity and mortality among women. Compared with the other breast cancer subtypes, Triple-negative breast cancer (TNBC) has a higher probability of recurrence and is prone to distant metastasis. To reveal the underlying disease mechanisms and identify more effective biomarkers for TNBC and breast cancer metastasis. Methods: Gene Ontology and KEGG pathway analysis were used for investigating the role of overlapping differentially expressed genes (DEGs). Hub genes among these DEGs were determined by the protein- protein interactions network analysis and CytoHubba. Oncomine databases were used for verifying the clinical relevance of hub genes. -
Mechanistic Rationale to Target PTEN-Deficient Tumor Cells with Inhibitors of the DNA Damage Response Kinase ATM
Mechanistic Rationale to Target PTEN-Deficient Tumor Cells with Inhibitors of the DNA Damage Response Kinase ATM McCabe, N., Hanna, C., Walker, S. M., Gonda, D., Li, J., Wikstrom, K., Savage, K. I., Butterworth, K. T., Chen, C., Harkin, D. P., Prise, K. M., & Kennedy, R. D. (2015). Mechanistic Rationale to Target PTEN-Deficient Tumor Cells with Inhibitors of the DNA Damage Response Kinase ATM. Cancer Research, 75(11), 2159-2165. https://doi.org/10.1158/0008-5472.CAN-14-3502 Published in: Cancer Research Document Version: Peer reviewed version Queen's University Belfast - Research Portal: Link to publication record in Queen's University Belfast Research Portal Publisher rights ©2015 American Association for Cancer Research. This work is made available online in accordance with the publisher’s policies. Please refer to any applicable terms of use of the publisher. General rights Copyright for the publications made accessible via the Queen's University Belfast Research Portal is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The Research Portal is Queen's institutional repository that provides access to Queen's research output. Every effort has been made to ensure that content in the Research Portal does not infringe any person's rights, or applicable UK laws. If you discover content in the Research Portal that you believe breaches copyright or violates any law, please contact [email protected]. Download date:29. Sep. 2021 PTEN-deficient tumour cells are dependent on ATM signalling Mechanistic rationale to target PTEN-deficient tumour cells with inhibitors of the DNA damage response kinase ATM Nuala McCabe 1,2*, Conor Hanna 1* Steven M. -
PDK1 Regulates the Maintenance of Cell Body and the Development of Dendrites of Purkinje Cells by Ps6 and Pkcc
The Journal of Neuroscience, July 15, 2020 • 40(29):5531–5548 • 5531 Development/Plasticity/Repair PDK1 Regulates the Maintenance of Cell Body and the Development of Dendrites of Purkinje Cells by pS6 and PKCc Rui Liu,1* Min Xu,1* Xiao-Yang Zhang,3 Min-Jie Zhou,1 Bing-Yao Zhou,1 Cui Qi,1 Bo Song,3 Qi Fan,1 Wei-Yan You,1 Jing-Ning Zhu,3 Zhong-Zhou Yang,4 and Jun Gao1,2 1Department of Neurobiology, Key Laboratory of Human Functional Genomics of Jiangsu, Nanjing Medical University, Nanjing 211166, Jiangsu, People’s Republic of China, 2Department of Rehabilitation Medicine, Jiangsu Shengze Hospital Affiliated with Nanjing Medical University, Suzhou 215228, Jiangsu, People’s Republic of China, 3Key Laboratory of Pharmaceutical Biotechnology, Department of Physiology, and Institute for Brain Sciences, School of Life Sciences, Nanjing University, Nanjing 210023, People’s Republic of China, and 4State Key Laboratory of Pharmaceutical Biotechnology, Department of Cardiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School and MOE Key Laboratory of Model Animal for Disease Study, Model Animal Research Center, Nanjing University, Nanjing, 210061, People’s Republic of China 3-Phosphoinositide-dependent protein kinase-1 (PDK1) plays a critical role in the development of mammalian brain. Here, we investigated the role of PDK1 in Purkinje cells (PCs) by generating the PDK1-conditional knock-out mice (cKO) through fl/fl crossing PV-cre or Pcp2-cre mice with Pdk1 mice. The male mice were used in the behavioral testing, and the other experi- ments were performed on mice of both sexes. -
Loss of the Forkhead Transcription Factor Foxm1 Causes Centrosome Amplification and Mitotic Catastrophe
Research Article Loss of the Forkhead Transcription Factor FoxM1 Causes Centrosome Amplification and Mitotic Catastrophe Diane R. Wonsey and Maximillian T. Follettie Department of Discovery Medicine, Wyeth Research, Cambridge, Massachusetts Abstract with a targeted deletion of FoxM1 in the liver show decreased Expression of the forkhead transcription factor FoxM1 bromodeoxyuridine (BrdUrd) incorporation and fewer mitotic cells correlates with proliferative status in a variety of normal compared with wild-type controls following partial hepatectomy (6). and transformed cell types. Elevated expression of FoxM1 has Conversely, premature expression of FoxM1 in transgenic mice been noted in both hepatocellular carcinoma and basal cell accelerates hepatocyte DNA replication and the expression of cell carcinoma. However, whether FoxM1 expression is essential cycle regulatory proteins following partial hepatectomy (7). for the viability of transformed cells is unknown. We report Consistent with a role in proliferation, elevated expression of here that the expression of FoxM1 is significantly elevated in FoxM1 has been reported in both basal cell carcinoma (8) and in primary breast cancer. Microarray analysis shows that FoxM1 hepatocellular carcinoma (9). In addition, FoxM1 expression is re- regulates genes that are essential for faithful chromosome quired for the proliferative expansion of hepatocellular carcinoma segregation and mitosis, including Nek2, KIF20A, and CENP-A. in a mouse model of tumor induction (10). The observation that a p19ARF peptide fragment physically interacts with FoxM1, sup- Loss of FoxM1 expression generates mitotic spindle defects, delays cells in mitosis, and induces mitotic catastrophe. Time- presses FoxM1 transcriptional activity, and inhibits FoxM1- lapse microscopy indicates that depletion of FoxM1 generates enhanced anchorage-independent growth (10) suggests that cells that enter mitosis but are unable to complete cell FoxM1 may be an attractive target for cancer therapy. -
PRODUCTS and SERVICES Target List
PRODUCTS AND SERVICES Target list Kinase Products P.1-11 Kinase Products Biochemical Assays P.12 "QuickScout Screening Assist™ Kits" Kinase Protein Assay Kits P.13 "QuickScout Custom Profiling & Panel Profiling Series" Targets P.14 "QuickScout Custom Profiling Series" Preincubation Targets Cell-Based Assays P.15 NanoBRET™ TE Intracellular Kinase Cell-Based Assay Service Targets P.16 Tyrosine Kinase Ba/F3 Cell-Based Assay Service Targets P.17 Kinase HEK293 Cell-Based Assay Service ~ClariCELL™ ~ Targets P.18 Detection of Protein-Protein Interactions ~ProbeX™~ Stable Cell Lines Crystallization Services P.19 FastLane™ Structures ~Premium~ P.20-21 FastLane™ Structures ~Standard~ Kinase Products For details of products, please see "PRODUCTS AND SERVICES" on page 1~3. Tyrosine Kinases Note: Please contact us for availability or further information. Information may be changed without notice. Expression Protein Kinase Tag Carna Product Name Catalog No. Construct Sequence Accession Number Tag Location System HIS ABL(ABL1) 08-001 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) BTN BTN-ABL(ABL1) 08-401-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ABL(ABL1) [E255K] HIS ABL(ABL1)[E255K] 08-094 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) HIS ABL(ABL1)[T315I] 08-093 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) [T315I] BTN BTN-ABL(ABL1)[T315I] 08-493-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ACK(TNK2) GST ACK(TNK2) 08-196 Catalytic domain -
The Role of Cdks and Cdkis in Murine Development
International Journal of Molecular Sciences Review The Role of CDKs and CDKIs in Murine Development Grace Jean Campbell , Emma Langdale Hands and Mathew Van de Pette * Epigenetic Mechanisms of Toxicology Lab, MRC Toxicology Unit, Cambridge University, Cambridge CB2 1QR, UK; [email protected] (G.J.C.); [email protected] (E.L.H.) * Correspondence: [email protected] Received: 8 July 2020; Accepted: 26 July 2020; Published: 28 July 2020 Abstract: Cyclin-dependent kinases (CDKs) and their inhibitors (CDKIs) play pivotal roles in the regulation of the cell cycle. As a result of these functions, it may be extrapolated that they are essential for appropriate embryonic development. The twenty known mouse CDKs and eight CDKIs have been studied to varying degrees in the developing mouse, but only a handful of CDKs and a single CDKI have been shown to be absolutely required for murine embryonic development. What has become apparent, as more studies have shone light on these family members, is that in addition to their primary functional role in regulating the cell cycle, many of these genes are also controlling specific cell fates by directing differentiation in various tissues. Here we review the extensive mouse models that have been generated to study the functions of CDKs and CDKIs, and discuss their varying roles in murine embryonic development, with a particular focus on the brain, pancreas and fertility. Keywords: cyclin-dependent kinase; CDK inhibitors; mouse; development; knock-out models 1. Introduction Cyclin-dependent kinases (CDKs) are proteins that, by definition, require the binding of partner cyclin proteins in order to phosphorylate a series of target proteins. -
Differences in Gene Expression Profiles and Carcinogenesis Pathways Involved in Cisplatin Resistance of Four Types of Cancer
596 ONCOLOGY REPORTS 30: 596-614, 2013 Differences in gene expression profiles and carcinogenesis pathways involved in cisplatin resistance of four types of cancer YONG YANG1,2, HUI LI1,2, SHENGCAI HOU1,2, BIN HU1,2, JIE LIU1,3 and JUN WANG1,3 1Beijing Key Laboratory of Respiratory and Pulmonary Circulation, Capital Medical University, Beijing 100069; 2Department of Thoracic Surgery, Beijing Chao-Yang Hospital, Capital Medical University, Beijing 100020; 3Department of Physiology, Capital Medical University, Beijing 100069, P.R. China Received December 23, 2012; Accepted March 4, 2013 DOI: 10.3892/or.2013.2514 Abstract. Cisplatin-based chemotherapy is the standard Introduction therapy used for the treatment of several types of cancer. However, its efficacy is largely limited by the acquired drug Cisplatin is primarily effective through DNA damage and is resistance. To date, little is known about the RNA expression widely used for the treatment of several types of cancer, such changes in cisplatin-resistant cancers. Identification of the as testicular, lung and ovarian cancer. However, the ability RNAs related to cisplatin resistance may provide specific of cancer cells to become resistant to cisplatin remains a insight into cancer therapy. In the present study, expression significant impediment to successful chemotherapy. Although profiling of 7 cancer cell lines was performed using oligo- previous studies have identified numerous mechanisms in nucleotide microarray analysis data obtained from the GEO cisplatin resistance, it remains a major problem that severely database. Bioinformatic analyses such as the Gene Ontology limits the usefulness of this chemotherapeutic agent. Therefore, (GO) and KEGG pathway were used to identify genes and it is crucial to examine more elaborate mechanisms of cisplatin pathways specifically associated with cisplatin resistance.