DOCSLIB.ORG

B Number Gene Name Strand Orientation Operon ID Mrna

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
B Number Gene Name Strand Orientation Operon ID Mrna list list list sample) predicted B number Operon ID Gene Name assignment mRNA present mRNA intensity Gene description Strand orientation Membrane protein detected (total list) detected (long list) membrane sample Proteins detected - detected (short list) # of tryptic peptides # of tryptic peptides # of tryptic peptides # of tryptic peptides # of tryptic peptides Functional category detected (membrane Protein detected - total Protein detected - long Protein detected - short b0001 thrL + 1 1344 P 1 0 0 0 0 thr operon leader peptide Metabolism of small molecules b0002 thrA + 1 13624 P 39 P 18 P 18 P 18 P(m) 2 aspartokinase I, homoserine dehydrogenase I Metabolism of small molecules b0003 thrB + 1 6781 P 9 P 3 3 P 3 0 homoserine kinase Metabolism of small molecules b0004 thrC + 1 15039 P 18 P 10 P 11 P 10 0 threonine synthase Metabolism of small molecules b0008 talB + 5 20561 P 20 P 13 P 16 P 13 0 transaldolase B Metabolism of small molecules b0014 dnaK + 11 13283 P 32 P 23 P 24 P 23 0 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins Cell processes b0015 dnaJ + 11 4492 P 13 P 4 P 6 P 4 P(m) 1 chaperone with DnaK; heat shock protein Cell processes b0026 ileS + 20 4036 P 46 P 13 P 14 P 13 0 isoleucine tRNA synthetase Macromolecule metabolism b0027 lspA + 20 3643 P 6 0 0 0 0 GenProt-PHD prolipoprotein signal peptidase (SPase II) Macromolecule metabolism b0029 lytB + 20 1331 P 16 P 2 2 P 2 0 control of stringent response; involved in penicillin tolerance Global functions b0032 carA + 24 9312 P 14 P 8 P 8 P 8 0 carbamoyl-phosphate synthetase, glutamine (small) subunit Metabolism of small molecules b0033 carB + 24 7656 P 48 P 17 P 19 P 17 0 carbamoyl-phosphate synthase large subunit Metabolism of small molecules b0050 apaG - 32 2140 P 5 0 0 0 0 orf, hypothetical protein Open reading frames b0051 ksgA - 32 2240 P 10 P 1 2 P 1 0 S-adenosylmethionine-6-N',N'-adenosyl (rRNA) dimethyltransferase Cell processes b0052 pdxA - 32 1543 P 13 0 0 0 0 pyridoxine biosynthesis Metabolism of small molecules peptidyl-prolyl cis-trans isomerase (PPIase), involved in maturation of outer b0053 surA - 32 3825 P 19 P 4 P 5 P 4 P(m) 1 GenProt membrane proteins (1st module) Cell processes b0071 leuD - 44 4770 P 10 P 9 P 7 P 9 0 isopropylmalate isomerase subunit Metabolism of small molecules b0072 leuC - 44 10437 P 18 P 9 P 7 P 9 0 3-isopropylmalate isomerase (dehydratase) subunit Metabolism of small molecules b0073 leuB - 44 10273 P 12 P 8 P 8 P 8 0 3-isopropylmalate dehydrogenase Metabolism of small molecules b0074 leuA - 44 11143 P 28 P 7 P 7 P 7 0 2-isopropylmalate synthase Metabolism of small molecules b0075 leuL - 44 1458 P 1 0 0 0 0 leu operon leader peptide Metabolism of small molecules b0076 leuO + 45 158 P 15 0 0 0 0 probable transcriptional activator for leuABCD operon Metabolism of small molecules b0077 ilvI + 45 3201 P 27 P 2 2 P 2 0 acetolactate synthase III, valine sensitive, large subunit Metabolism of small molecules b0078 ilvH + 45 2778 P 9 P 2 P 5 P 2 0 acetolactate synthase III, valine sensitive, small subunit Metabolism of small molecules list list list sample) predicted B number Operon ID Gene Name assignment mRNA present mRNA intensity Gene description Strand orientation Membrane protein detected (total list) detected (long list) membrane sample Proteins detected - detected (short list) # of tryptic peptides # of tryptic peptides # of tryptic peptides # of tryptic peptides # of tryptic peptides Functional category detected (membrane Protein detected - total Protein detected - long Protein detected - short b0093 ftsQ + 48 3716 P 10 0 0 0 0 GenProt-PHD cell division protein; ingrowth of wall at septum Cell processes ATP-binding cell division protein, septation process, complexes with FtsZ, b0094 ftsA + 48 4248 P 18 0 0 0 0 GenProt associated with junctions of inner and outer membranes Cell processes cell division; forms circumferential ring; tubulin-like GTP-binding protein and b0095 ftsZ + 48 9268 P 22 P 6 P 7 P 6 P(m) 2 GTPase Cell processes b0098 secA + 51 1587 P 46 P 3 P 6 P 3 P(m) 1 preprotein translocase; secretion protein Cell processes b0113 pdhR + 59 311 P 8 0 0 0 0 transcriptional regulator for pyruvate dehydrogenase complex Metabolism of small molecules b0114 aceE + 59 15349 P 44 P 24 P 24 P 24 P(m) 1 pyruvate dehydrogenase (decarboxylase component) Metabolism of small molecules b0115 aceF + 59 8150 P 34 P 13 P 12 P 13 0 pyruvate dehydrogenase (dihydrolipoyltransacetylase component) Metabolism of small molecules lipoamide dehydrogenase (NADH); component of 2-oxodehydrogenase and b0116 lpdA + 59 21822 P 17 P 15 P 10 P 15 P(m) 4 pyruvate complexes; L-protein of glycine cleavage complex Metabolism of small molecules b0118 acnB + 61 4087 P 41 P 22 P 19 P 22 0 aconitate hydrase B Metabolism of small molecules b0126 yadF - 68 17436 P 8 P 4 P 5 P 4 0 putative carbonic anhdrase (EC 4.2.1.1) Miscellaneous b0133 panC - 74 1978 P 15 P 5 P 6 P 5 0 pantothenate synthetase Metabolism of small molecules b0134 panB - 74 5716 P 6 P 3 2 P 3 0 3-methyl-2-oxobutanoate hydroxymethyltransferase Metabolism of small molecules b0154 hemL - 85 1274 P 15 P 5 P 7 P 5 0 glutamate-1-semialdehyde aminotransferase (aminomutase) Metabolism of small molecules b0161 htrA + 90 1016 P 17 P 4 P 5 P 4 P(m) 1 periplasmic serine protease Do; heat shock protein HtrA Macromolecule metabolism b0163 yaeH - 92 1127 P 7 P 5 P 7 P 5 0 putative structural protein Miscellaneous b0164 yaeI - 93 312 A 11 0 0 0 0 orf, hypothetical protein Open reading frames b0165 b0165 - 93 508 A 1 0 0 0 0 orf, hypothetical protein Open reading frames b0166 dapD - 93 4162 P 13 P 9 P 9 P 9 0 2,3,4,5-tetrahydropyridine-2-carboxylate N-succinyltransferase Metabolism of small molecules b0167 glnD - 93 982 P 51 0 0 0 0 protein PII; uridylyltransferase acts on regulator of glnA Metabolism of small molecules b0169 rpsB + 95 22176 P 11 P 10 P 8 P 10 0 30S ribosomal subunit protein S2 Structural elements b0170 tsf + 95 9865 P 18 P 13 P 9 P 13 0 protein chain elongation factor EF-Ts Macromolecule metabolism b0185 accA + 104 1969 P 18 P 6 P 5 P 6 0 acetylCoA carboxylase, carboxytransferase component, alpha subunit Metabolism of small molecules b0193 yaeF - 109 33 A 12 0 0 0 0 orf, hypothetical protein Open reading frames b0194 proS - 109 1361 P 29 P 11 P 12 P 11 0 proline tRNA synthetase Macromolecule metabolism list list list sample) predicted B number Operon ID Gene Name assignment mRNA present mRNA intensity Gene description Strand orientation Membrane protein detected (total list) detected (long list) membrane sample Proteins detected - detected (short list) # of tryptic peptides # of tryptic peptides # of tryptic peptides # of tryptic peptides # of tryptic peptides Functional category detected (membrane Protein detected - total Protein detected - long Protein detected - short b0222 gmhA + 126 3000 P 10 P 4 P 4 P 4 0 phosphoheptose isomerase Structural elements b0237 pepD - 137 1500 P 19 P 8 P 7 P 8 0 aminoacyl-histidine dipeptidase (peptidase D) Macromolecule metabolism b0242 proB + 142 2446 P 22 P 1 3 P 1 0 gamma-glutamate kinase Metabolism of small molecules b0243 proA + 142 794 P 20 P 4 P 5 P 4 0 gamma-glutamylphosphate reductase Metabolism of small molecules b0273 argF - 161 3188 P 13 P 6 P 5 P 6 0 ornithine carbamoyltransferase 2, chain F Metabolism of small molecules b0325 yahK + 193 2065 P 16 P 5 P 7 P 5 0 putative oxidoreductase Miscellaneous b0336 codB + 202 8160 P 4 P 1 0 0 P(m) 1 GenProt-PHD cytosine permease/transport Cell processes b0337 codA + 202 6804 P 12 P 5 P 5 P 5 0 cytosine deaminase Metabolism of small molecules b0426 yajQ + 256 3822 P 10 P 3 P 5 P 3 0 orf, hypothetical protein Open reading frames b0436 tig + 261 7545 P 24 P 17 P 12 P 17 0 trigger factor; a molecular chaperone involved in cell division Cell processes ATP-dependent proteolytic subunit of clpA-clpP serine protease, heat shock b0437 clpP + 262 4300 P 7 0 1 0 0 protein F21.5 Macromolecule metabolism b0438 clpX + 262 2012 P 22 P 8 P 11 P 8 0 ATP-dependent specificity component of clpP serine protease, chaperone Macromolecule metabolism b0439 lon + 263 3719 P 37 P 8 P 8 P 8 0 DNA-binding, ATP-dependent protease La; heat shock K-protein Global functions b0473 htpG + 288 970 P 37 P 14 P 16 P 14 0 chaperone Hsp90, heat shock protein C 62.5 Cell processes adenylate kinase activity; pleiotropic effects on glycerol-3-phosphate b0474 adk + 289 7814 P 13 P 4 P 4 P 4 0 acyltransferase activity Metabolism of small molecules b0480 ushA + 295 1930 P 21 P 4 P 5 P 4 0 UDP-sugar hydrolase (5'-nucleotidase) Metabolism of small molecules b0492 ybbN - 304 2692 P 12 P 4 P 6 P 4 0 putative thioredoxin-like protein Miscellaneous b0493 ybbO - 304 879 P 14 0 0 0 0 putative oxidoreductase Miscellaneous b0494 tesA - 304 1200 P 12 P 1 2 P 1 0 acyl-CoA thioesterase I; also functions as protease I Metabolism of small molecules phosphoribosylaminoimidazole carboxylase = AIR carboxylase, CO(2)-fixing b0522 purK - 319 1507 P 12 P 2 P 4 P 2 0 subunit Metabolism of small molecules phosphoribosylaminoimidazole carboxylase = AIR carboxylase, catalytic b0523 purE - 319 3543 P 5 0 1 0 0 PHD subunit Metabolism of small molecules b0526 cysS + 321 745 P 19 P 4 P 4 P 4 0 cysteine tRNA synthetase Macromolecule metabolism b0578 nfnB - 354 2638 P 11 P 4 P 4 P 4 0 oxygen-insensitive NAD(P)H nitroreductase Cell processes b0605 ahpC + 372 38698 P 9 P 9 P 6 P 9 0 alkyl hydroperoxide reductase, C22 subunit; detoxification of hydroperoxides Cell processes list list list sample) predicted B number Operon ID Gene Name assignment mRNA present mRNA
Load more

Recommended publications
  • The Global Architecture Shaping the Heterogeneity and Tissue-Dependency of the MHC Class I Immunopeptidome Is Evolutionarily Conserved
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.28.317750; this version posted September 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The Global Architecture Shaping the Heterogeneity and Tissue-Dependency of the MHC Class I Immunopeptidome is Evolutionarily Conserved Authors Peter Kubiniok†1, Ana Marcu†2,3, Leon Bichmann†2,4, Leon Kuchenbecker4, Heiko Schuster1,5, David Hamelin1, Jérome Despault1, Kevin Kovalchik1, Laura Wessling1, Oliver Kohlbacher4,7,8,9,10 Stefan Stevanovic2,3,6, Hans-Georg Rammensee2,3,6, Marian C. Neidert11, Isabelle Sirois1, Etienne Caron1,12* Affiliations *Corresponding and Leading author: Etienne Caron ([email protected]) †Equal contribution to this work 1CHU Sainte-Justine Research Center, Montreal, QC H3T 1C5, Canada 2Department of Immunology, Interfaculty Institute for Cell Biology, University of Tübingen, Tübingen, Baden-Württemberg, 72076, Germany. 3Cluster of Excellence iFIT (EXC 2180) "Image-Guided and Functionally Instructed Tumor Therapies", University of Tübingen, Tübingen, Baden-Württemberg, 72076, Germany. 4Applied Bioinformatics, Dept. of Computer Science, University of Tübingen, Tübingen, Baden- Württemberg, 72074, Germany. 5Immatics Biotechnologies GmbH, Tübingen, 72076, Baden-Württemberg, Germany. 6DKFZ Partner Site Tübingen, German Cancer Consortium (DKTK), Tübingen, Baden- Württemberg, 72076, Germany. 7Institute for Bioinformatics and Medical Informatics,
    [Show full text]
  • Restriction Endonucleases
    Molecular Biology Problem Solver: A Laboratory Guide. Edited by Alan S. Gerstein Copyright © 2001 by Wiley-Liss, Inc. ISBNs: 0-471-37972-7 (Paper); 0-471-22390-5 (Electronic) 9 Restriction Endonucleases Derek Robinson, Paul R. Walsh, and Joseph A. Bonventre Background Information . 226 Which Restriction Enzymes Are Commercially Available? . 226 Why Are Some Enzymes More Expensive Than Others? . 227 What Can You Do to Reduce the Cost of Working with Restriction Enzymes? . 228 If You Could Select among Several Restriction Enzymes for Your Application, What Criteria Should You Consider to Make the Most Appropriate Choice? . 229 What Are the General Properties of Restriction Endonucleases? . 232 What Insight Is Provided by a Restriction Enzyme’s Quality Control Data? . 233 How Stable Are Restriction Enzymes? . 236 How Stable Are Diluted Restriction Enzymes? . 236 Simple Digests . 236 How Should You Set up a Simple Restriction Digest? . 236 Is It Wise to Modify the Suggested Reaction Conditions? . 237 Complex Restriction Digestions . 239 How Can a Substrate Affect the Restriction Digest? . 239 Should You Alter the Reaction Volume and DNA Concentration? . 241 Double Digests: Simultaneous or Sequential? . 242 225 Genomic Digests . 244 When Preparing Genomic DNA for Southern Blotting, How Can You Determine If Complete Digestion Has Been Obtained? . 244 What Are Your Options If You Must Create Additional Rare or Unique Restriction Sites? . 247 Troubleshooting . 255 What Can Cause a Simple Restriction Digest to Fail? . 255 The Volume of Enzyme in the Vial Appears Very Low. Did Leakage Occur during Shipment? . 259 The Enzyme Shipment Sat on the Shipping Dock for Two Days.
    [Show full text]
  • 35 Disorders of Purine and Pyrimidine Metabolism
    35 Disorders of Purine and Pyrimidine Metabolism Georges van den Berghe, M.- Françoise Vincent, Sandrine Marie 35.1 Inborn Errors of Purine Metabolism – 435 35.1.1 Phosphoribosyl Pyrophosphate Synthetase Superactivity – 435 35.1.2 Adenylosuccinase Deficiency – 436 35.1.3 AICA-Ribosiduria – 437 35.1.4 Muscle AMP Deaminase Deficiency – 437 35.1.5 Adenosine Deaminase Deficiency – 438 35.1.6 Adenosine Deaminase Superactivity – 439 35.1.7 Purine Nucleoside Phosphorylase Deficiency – 440 35.1.8 Xanthine Oxidase Deficiency – 440 35.1.9 Hypoxanthine-Guanine Phosphoribosyltransferase Deficiency – 441 35.1.10 Adenine Phosphoribosyltransferase Deficiency – 442 35.1.11 Deoxyguanosine Kinase Deficiency – 442 35.2 Inborn Errors of Pyrimidine Metabolism – 445 35.2.1 UMP Synthase Deficiency (Hereditary Orotic Aciduria) – 445 35.2.2 Dihydropyrimidine Dehydrogenase Deficiency – 445 35.2.3 Dihydropyrimidinase Deficiency – 446 35.2.4 Ureidopropionase Deficiency – 446 35.2.5 Pyrimidine 5’-Nucleotidase Deficiency – 446 35.2.6 Cytosolic 5’-Nucleotidase Superactivity – 447 35.2.7 Thymidine Phosphorylase Deficiency – 447 35.2.8 Thymidine Kinase Deficiency – 447 References – 447 434 Chapter 35 · Disorders of Purine and Pyrimidine Metabolism Purine Metabolism Purine nucleotides are essential cellular constituents 4 The catabolic pathway starts from GMP, IMP and which intervene in energy transfer, metabolic regula- AMP, and produces uric acid, a poorly soluble tion, and synthesis of DNA and RNA. Purine metabo- compound, which tends to crystallize once its lism can be divided into three pathways: plasma concentration surpasses 6.5–7 mg/dl (0.38– 4 The biosynthetic pathway, often termed de novo, 0.47 mmol/l). starts with the formation of phosphoribosyl pyro- 4 The salvage pathway utilizes the purine bases, gua- phosphate (PRPP) and leads to the synthesis of nine, hypoxanthine and adenine, which are pro- inosine monophosphate (IMP).
    [Show full text]
  • Adaptive Laboratory Evolution Enhances Methanol Tolerance and Conversion in Engineered Corynebacterium Glutamicum
    ARTICLE https://doi.org/10.1038/s42003-020-0954-9 OPEN Adaptive laboratory evolution enhances methanol tolerance and conversion in engineered Corynebacterium glutamicum Yu Wang 1, Liwen Fan1,2, Philibert Tuyishime1, Jiao Liu1, Kun Zhang1,3, Ning Gao1,3, Zhihui Zhang1,3, ✉ ✉ 1234567890():,; Xiaomeng Ni1, Jinhui Feng1, Qianqian Yuan1, Hongwu Ma1, Ping Zheng1,2,3 , Jibin Sun1,3 & Yanhe Ma1 Synthetic methylotrophy has recently been intensively studied to achieve methanol-based biomanufacturing of fuels and chemicals. However, attempts to engineer platform micro- organisms to utilize methanol mainly focus on enzyme and pathway engineering. Herein, we enhanced methanol bioconversion of synthetic methylotrophs by improving cellular tolerance to methanol. A previously engineered methanol-dependent Corynebacterium glutamicum is subjected to adaptive laboratory evolution with elevated methanol content. Unexpectedly, the evolved strain not only tolerates higher concentrations of methanol but also shows improved growth and methanol utilization. Transcriptome analysis suggests increased methanol con- centrations rebalance methylotrophic metabolism by down-regulating glycolysis and up- regulating amino acid biosynthesis, oxidative phosphorylation, ribosome biosynthesis, and parts of TCA cycle. Mutations in the O-acetyl-L-homoserine sulfhydrylase Cgl0653 catalyzing formation of L-methionine analog from methanol and methanol-induced membrane-bound transporter Cgl0833 are proven crucial for methanol tolerance. This study demonstrates the importance of
    [Show full text]
  • Metabolism of Nucleotides
    METABOLISM OF NUCLEOTIDES Tomáš Kuˇcera Ústav lékaˇrské chemie a klinické biochemie 2. lékaˇrská fakulta, Univerzita Karlova v Praze 2013 NUKLEOTIDY rocy t e c l e e − − − h O O O N −O P O P O P O O O O O O H H H H OH OH heterocycle = nucleobase the name is historic pyrimidine purine nicotinamide, flavine PYRIMIDINE BASES AND NUCLEOSIDES PURINE BASES AND NUCLEOSIDES SOME LESS USUAL BASES AND NUCLEOSIDES 5-formylcytosine 6-methyladenine 4-methylcytosine FUNCTION OF NUCLEOTIDES precursors of DNA and RNA ATP, GTP, CTP, UTP, dATP, dGTP, dCTP, dTTP components of enzyme cofactors NAD(P), FAD, FMN, CoA [(P)APS – (phospho)adenosylphosphosulphate] macroergic “energy quanta” carriers ATP, GTP activated intermediates in biosyntheses UDP-sugars, CDP-diacylglycerols, S-adenosylmethionine second messengers in signal transduction cAMP, cGMP allosteric regulators ATP, ADP, AMP GAINING NUCLEOTIDES pancreatic (deoxy)ribonucleases and intestinal polynucleotidases: NA ! nucleotides nucleotidase of epithelial cells of the intestine: nucleotides ! nucleosides in the intestinal epithelial cells, nucleosides are used intact hydrolyzed by nucleoside (phosphoryl)ases: nucleoside ! base + pentose(-1-phosphate) + [phosphate] — salvage for the cells own need — transport to the blood about 5 % of digested nucleotides into the blood as bases and nucleosides low dietary uptake ) need of biosynthesis PYRIMIDINE NUCLEOSIDES BIOSYNTHESIS 1 PYRIMIDINE NUCLEOSIDES BIOSYNTHESIS 2 UTP SYNTHESIS nucleosidmonophosphate- UMP + ATP kinase UDP + ADP nucleosiddiphosphate- UDP + ATP
    [Show full text]
  • Yeast Genome Gazetteer P35-65
    gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal
    [Show full text]
  • Serine Proteases with Altered Sensitivity to Activity-Modulating
    (19) & (11) EP 2 045 321 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 08.04.2009 Bulletin 2009/15 C12N 9/00 (2006.01) C12N 15/00 (2006.01) C12Q 1/37 (2006.01) (21) Application number: 09150549.5 (22) Date of filing: 26.05.2006 (84) Designated Contracting States: • Haupts, Ulrich AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 51519 Odenthal (DE) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Coco, Wayne SK TR 50737 Köln (DE) •Tebbe, Jan (30) Priority: 27.05.2005 EP 05104543 50733 Köln (DE) • Votsmeier, Christian (62) Document number(s) of the earlier application(s) in 50259 Pulheim (DE) accordance with Art. 76 EPC: • Scheidig, Andreas 06763303.2 / 1 883 696 50823 Köln (DE) (71) Applicant: Direvo Biotech AG (74) Representative: von Kreisler Selting Werner 50829 Köln (DE) Patentanwälte P.O. Box 10 22 41 (72) Inventors: 50462 Köln (DE) • Koltermann, André 82057 Icking (DE) Remarks: • Kettling, Ulrich This application was filed on 14-01-2009 as a 81477 München (DE) divisional application to the application mentioned under INID code 62. (54) Serine proteases with altered sensitivity to activity-modulating substances (57) The present invention provides variants of ser- screening of the library in the presence of one or several ine proteases of the S1 class with altered sensitivity to activity-modulating substances, selection of variants with one or more activity-modulating substances. A method altered sensitivity to one or several activity-modulating for the generation of such proteases is disclosed, com- substances and isolation of those polynucleotide se- prising the provision of a protease library encoding poly- quences that encode for the selected variants.
    [Show full text]
  • Supplemental Materials Supplemental Table 1
    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2016 Supplemental Materials Supplemental Table 1. The differentially expressed proteins from rat pancreas identified by proteomics (SAP vs. SO) No. Protein name Gene name ratio P value 1 Metallothionein Mt1m 3.35 6.34E-07 2 Neutrophil antibiotic peptide NP-2 Defa 3.3 8.39E-07 3 Ilf2 protein Ilf2 3.18 1.75E-06 4 Numb isoform o/o rCG 3.12 2.73E-06 5 Lysozyme Lyz2 3.01 5.63E-06 6 Glucagon Gcg 2.89 1.17E-05 7 Serine protease HTRA1 Htra1 2.75 2.97E-05 8 Alpha 2 macroglobulin cardiac isoform (Fragment) 2.75 2.97E-05 9 Myosin IF (Predicted) Myo1f 2.65 5.53E-05 10 Neuroendocrine secretory protein 55 Gnas 2.61 7.60E-05 11 Matrix metallopeptidase 8 Mmp8 2.57 9.47E-05 12 Protein Tnks1bp1 Tnks1bp1 2.53 1.22E-04 13 Alpha-parvin Parva 2.47 1.78E-04 14 C4b-binding protein alpha chain C4bpa 2.42 2.53E-04 15 Protein KTI12 homolog Kti12 2.41 2.74E-04 16 Protein Rab11fip5 Rab11fip5 2.41 2.84E-04 17 Protein Mcpt1l3 Mcpt1l3 2.33 4.43E-04 18 Phospholipase B-like 1 Plbd1 2.33 4.76E-04 Aldehyde dehydrogenase (NAD), cytosolic 19 2.32 4.93E-04 (Fragments) 20 Protein Dpy19l2 Dpy19l2 2.3 5.68E-04 21 Regenerating islet-derived 3 alpha, isoform CRA_a Reg3a 2.27 6.74E-04 22 60S acidic ribosomal protein P1 Rplp1 2.26 7.22E-04 23 Serum albumin Alb 2.25 7.98E-04 24 Ribonuclease 4 Rnase4 2.24 8.25E-04 25 Cct-5 protein (Fragment) Cct5 2.24 8.52E-04 26 Protein S100-A9 S100a9 2.22 9.71E-04 27 Creatine kinase M-type Ckm 2.21 1.00E-03 28 Protein Larp4b Larp4b 2.18 1.25E-03
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • SUPPLEMENTARY INFORMATION in Silico Signature Prediction
    SUPPLEMENTARY INFORMATION In Silico Signature Prediction Modeling in Cytolethal Distending Toxin-Producing Escherichia coli Strains Maryam Javadi, Mana Oloomi*, Saeid Bouzari Department of Molecular Biology, Pasteur Institute of Iran, Tehran 13164, Iran http://www.genominfo.org/src/sm/gni-15-69-s001.pdf Supplementary Table 6. Aalphabetic abbreviation and description of putative conserved domains Alphabetic Abbreviation Description 17 Large terminase protein 2_A_01_02 Multidrug resistance protein 2A0115 Benzoate transport; [Transport and binding proteins, Carbohydrates, organic alcohols] 52 DNA topisomerase II medium subunit; Provisional AAA_13 AAA domain; This family of domains contain a P-loop motif AAA_15 AAA ATPase domain; This family of domains contain a P-loop motif AAA_21 AAA domain AAA_23 AAA domain ABC_RecF ATP-binding cassette domain of RecF; RecF is a recombinational DNA repair ATPase ABC_SMC_barmotin ATP-binding cassette domain of barmotin, a member of the SMC protein family AcCoA-C-Actrans Acetyl-CoA acetyltransferases AHBA_syn 3-Amino-5-hydroxybenzoic acid synthase family (AHBA_syn) AidA Type V secretory pathway, adhesin AidA [Cell envelope biogenesis] Ail_Lom Enterobacterial Ail/Lom protein; This family consists of several bacterial and phage Ail_Lom proteins AIP3 Actin interacting protein 3; Aip3p/Bud6p is a regulator of cell and cytoskeletal polarity Aldose_epim_Ec_YphB Aldose 1-epimerase, similar to Escherichia coli YphB AlpA Predicted transcriptional regulator [Transcription] AntA AntA/AntB antirepressor AraC AraC-type
    [Show full text]
  • Leishmania (L.) Amazonensis Peptidase Activities Inside the Living Cells and in Their Lysates
    Molecular & Biochemical Parasitology 184 (2012) 82–89 Contents lists available at SciVerse ScienceDirect Molecular & Biochemical Parasitology Leishmania (L.) amazonensis peptidase activities inside the living cells and in their lysates a a b c a Elide E. Caroselli , Diego M. Assis , Clara L. Barbiéri , Wagner A.S. Júdice , Maria A. Juliano , d a,∗ Marcos L. Gazarini , Luiz Juliano a Department of Biophysics, Escola Paulista de Medicina, Universidade Federal de São Paulo, SP, Brazil b Department of Microbiology, Immunology and Parasitology, Escola Paulista de Medicina, Universidade Federal de São Paulo, SP, Brazil c Centro Interdisciplinar de Investigac¸ ão Bioquímica, Universidade de Mogi das Cruzes, Av. Dr. Cândido Xavier de Almeida Souza 200, 08780-911 Mogi das Cruzes, Brazil d Department of Biosciences, Universidade Federal de São Paulo, Santos, Brazil a r t i c l e i n f o a b s t r a c t Article history: In this study we investigated the peptidase activity in Leishmania (L.) amazonensis live amastigote by con- Received 24 November 2011 focal microscopy using peptidyl-MCA as substrates, the hydrolysis of which releases the MCA fluorophore Received in revised form 13 March 2012 inside the cells. Cell pre-treatment with peptidase inhibitors indicated the presence of cysteine and ser- Accepted 27 April 2012 ine peptidases. It was noteworthy that Leishmania amastigotes incorporate only substrates (Z-FR-MCA, Available online 6 May 2012 Z-RR-MCA) or inhibitors (E64, TLCK) containing positively charged groups. The peptidase activities in the supernatants of amastigotes and promastigotes lysates were also evaluated with the same peptidyl-MCA Keywords: substrates and inhibitors in the pH range 4.5–9.0.
    [Show full text]
  • Open Matthew R Moreau Ph.D. Dissertation Finalfinal.Pdf
    The Pennsylvania State University The Graduate School Department of Veterinary and Biomedical Sciences Pathobiology Program PATHOGENOMICS AND SOURCE DYNAMICS OF SALMONELLA ENTERICA SEROVAR ENTERITIDIS A Dissertation in Pathobiology by Matthew Raymond Moreau 2015 Matthew R. Moreau Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy May 2015 The Dissertation of Matthew R. Moreau was reviewed and approved* by the following: Subhashinie Kariyawasam Associate Professor, Veterinary and Biomedical Sciences Dissertation Adviser Co-Chair of Committee Bhushan M. Jayarao Professor, Veterinary and Biomedical Sciences Dissertation Adviser Co-Chair of Committee Mary J. Kennett Professor, Veterinary and Biomedical Sciences Vijay Kumar Assistant Professor, Department of Nutritional Sciences Anthony Schmitt Associate Professor, Veterinary and Biomedical Sciences Head of the Pathobiology Graduate Program *Signatures are on file in the Graduate School iii ABSTRACT Salmonella enterica serovar Enteritidis (SE) is one of the most frequent common causes of morbidity and mortality in humans due to consumption of contaminated eggs and egg products. The association between egg contamination and foodborne outbreaks of SE suggests egg derived SE might be more adept to cause human illness than SE from other sources. Therefore, there is a need to understand the molecular mechanisms underlying the ability of egg- derived SE to colonize the chicken intestinal and reproductive tracts and cause disease in the human host. To this end, the present study was carried out in three objectives. The first objective was to sequence two egg-derived SE isolates belonging to the PFGE type JEGX01.0004 to identify the genes that might be involved in SE colonization and/or pathogenesis.
    [Show full text]