Molecular Mechanisms of Progesterone Withdrawal
in Human Uterine Smooth Muscle Cells
Kaiyu Lei
July 2011
Institute of Reproductive and Developmental Biology
Department of Surgery and Cancer
Division of Cancer, Faculty of Medicine
Imperial College London
This thesis is submitted for the degree of Doctor of Philosophy at
Imperial College London
- 1 -
Dedicated to my beloved parents and wife
- 2 - Abstract
Progesterone administration reduces the risk of preterm labour in high-risk women with singleton pregnancies but has no effect in women with a multiple pregnancy. However, it should be noted that it is not clear why progesterone is effective in the singleton pregnancies and in addition stretch-induced preterm labour is an attractive but not fully proven explanation. The data from my studies showed that progesterone did not inhibit stretch-induced MAPK activation or gene expression possibly explaining why progesterone is ineffective in the prevention of preterm labour in multiple pregnancies. Although stretch did reduce PR expression in a NF-κB- dependent manner, this was not sufficient to inhibit progesterone action, suggesting that it is not responsible for the functional progesterone withdrawal observed with the onset of human labour.
Progesterone is thought to reduce the risk of preterm labour by inhibiting inflammatory cytokine-induced increases in prostaglandin synthesis. Initially, I demonstrated that IL-1 inhibited progesterone-driven PRE activation via p65. Conversely, p65-driven NF-B reporter construct activity was reduced by overexpression of PR-B and this was enhanced by the addition of MPA. Both MPA and progesterone repression of IL-1-driven COX-2 expression was lost by knockdown of GR. Subsequently, a series of in vitro studies suggested that progesterone acted via progesterone-induced and GR-mediated MKP-1 activation to repress IL-1-driven COX-2 and that although the interaction between p65 and PR-B might be involved in the repression of progesterone-driven gene expression, it did not seem to be responsible for progesterone repression of IL-1-induced COX-2 expression.
Finally, the cDNA microarray analysis showed that the PR and GR regulated distinct gene networks and cellular functions in the absence or presence of ligand. However, the ability of progesterone to modulate gene expression can be mediated via both PR and GR. These data broaden our view of progesterone action and suggest alternative roles for PR and GR in human parturition.
- 3 - Statement of originality
All work presented in this thesis was performed by myself unless stated otherwise in the text.
- 4 - Acknowledgements
I would first like to express my gratitude to my supervisors: Professor Mark Johnson, for giving me this opportunity to complete my PhD study, for your unflagging support and encouragement and for your unlimited ideas; Dr. Suren (Dev) Sooranna, for your guidance and innumerable help and for sharing all my happiness and sadness; Professor Phillip Bennett, for your brilliant advice and comments.
I want to thank my labmates who have been studying and working with me over the past three years, especially the Chairman of our Communist Party Branch Dr. Chen (our cell-culture expert, should be called Prof. Chen or 陈老) for your generous help and “telling me off” all the time and the Minister of the Organization Dr. Hua (Juliet or 华老) for spending several nights with me in the animal house without complaining a single word. Many thanks to Ben for your advice in some of my studies and improving my listening with your speedy speaking; to Bronwen for guiding me in the animal work and teaching me lots of slang; to Leila for inspiring me with your hard working and the lovely Swiss dark chocolates; to Jackson for all the efforts you have made and your unlimited questions; to Johann for your suggestion about medical school and showing me what is the real social skill; to Winnie and Natasha for getting us lots of biopsies. I would also like to thank the ladies in Prof. Phillip Bennett’s group, Yooni (the PR pioneer) for showing me all the preliminary data and inviting us to the parties and lunch-time concert; Shirin for giving me your precious constructs and sharing with me your experience as a foreigner; Mandeep for teaching me the electroporation and some very “useful” English words which I could never learn from textbooks; Lynne for influencing me with your constant optimism and teaching me the posh English; Vasso for your enthusiasm and yummy hand-made cakes; Kim for your kindness, diligence and declining my food offer without any hesitation. I am also grateful to Prof. Jan Brosens and Dr. Mark Christian for your insightful ideas and advice; to Sue and Ros for all your help and concern; to my friends: Shadi (Boss II), Mady (professor-to-be), Hiro (Boss I), Keiji (CEO), Marwa (consultant), Giulia (the CHIP expert) and Beatriz (for your generosity and advice); also to those who gave me the possibility to complete this thesis. Meeting you guys was fate, and working with you has always been my great pleasure.
- 5 - I also appreciate all the patients who were willing to donate their biopsies and all the doctors and midwives who kindly helped us with tissue collection.
Last but not least, I would love to give the final thank to my family: my dear parents, parents-in-law and my beloved wife, for your constant love and support no matter where and no matter when.
- 6 - List of Publications and Conference Presentations during PhD Study
List of Publications:
1. Lei K, Chen L, Cryar BJ, Hua R, Sooranna SR, Brosens JJ, Bennett PR, Johnson MR. Uterine stretch and progesterone action. J Clin Endocrinol Metab. 2011 Mar 30. [Epub ahead of print] PubMed PMID: 21450990. 2. Chen L, Sooranna SR, Lei K, Kandola, M, Bennett PR, Liang Z, Grammatopoulos D, Johnson MR. Cyclic AMP increases COX-2 expression via mitogen activated kinase in human myometrial cells. J Cell Mol Med. 2011 Aug 19. [Epub ahead of print] PMID:21854542 3. Lei K, Chen L, Khanjani S, Sooranna SR, Brosens JJ, Bennett PR, Johnson MR. Progesterone suppression of interleukin-1β gene expression is mediated via nuclear glucocorticoid receptors and MKP-1 activation in human myometrial cells. [Submitted to EMBO Molecular Medicine]. 4. Al-Sabbagh M, Fusi L, Higham J, Lee Y, Lei K, Hanyaloglu AC, Lam EW, Christian M, Brosens JJ. NADPH Oxidase-Derived Reactive Oxygen Species Mediate Decidualization of Human Endometrial Stromal Cells in Response to Cyclic AMP Signaling. Endocrinology. 2010 Dec 15. [Epub ahead of print] PubMed PMID: 21159852.
List of Conference Presentations:
1. Lei K, Sooranna SR, Bennett PR, Johnson MR 2011 Glucocorticoid receptor is a key player that mediates progesterone action in human myometrium. Reprod Sci 18: 157A (oral) 2. Lei K, Chen L, Sooranna SR, Bennett PR, Johnson MR 2011 Mechanical stretch and progesterone action in human myometrium. Reprod Sci 18: 297A (poster) 3. Sooranna SR, Lei K, Bennett PR, Johnson MR 2011 Mechanical stretch of cultured human uterine myocytes leads to increased expression of metallothioneins and heat shock 70kDa proteins. Reprod Sci 18: 299A (poster) 4. Hua R, Lei K, Herbert B, Sooranna SR, Bennett PR, Johnson MR 2011 Uterine chemokine expression in progesterone delayed labour in mice. Reprod Sci 18: 296A (poster) 5. Al-Sabbagh M, Fusi L, Higham J, Lee Y, Lei K, Hanyaloglu AC, Lam E W-F, Christian M, Brosens JJ 2011 NAPDH oxidase-derived reactive oxygen species mediate decidualization of human endometrial stromal cells in response to cyclic AMP signalling. Reprod Sci 18: 162A (oral)
- 7 - 6. Lei K, Chen L, Sooranna SR, Bennett PR, Johnson MR 2010 The role of cyclin dependent kinase 2 in stretch-induced progesterone receptor B activation in human myometrium. Reprod Sci 17: 281A (poster) 7. Lei K, Chen L, Sooranna SR, Bennett PR, Johnson MR 2010 The effect of pro-inflammatory transcription factors on progesterone receptor B transactivation in human myometrium. Reprod Sci 17: 281A (poster) 8. Lei K, Chen L, Sooranna SR, Bennett PR, Johnson MR 2010 The effect of cytokines and prostaglandins on nuclear receptor co-regulators in human myometrium. Reprod Sci 17: 285A (poster) 9. Chen L, Lei K, Sooranna SR, Bennett PR, Liang Z, Grammatopoulos DK, Johnson MR 2010 The effect of cAMP on PRE promoter activity in presence or absence of progesterone. Reprod Sci 17: 278A (poster) 10. Khanjani S, Sooranna SR, Lei K, Bennett PR, Johnson MR 2009 Regulation of progesterone receptor by transcriptions factors in human uterine myocytes. Reprod Sci 16: 116A (poster)
- 8 - Table of Contents
ABSTRACT ...... - 3 -
STATEMENT OF ORIGINALITY ...... - 4 -
ACKNOWLEDGEMENTS ...... - 5 -
LIST OF PUBLICATIONS AND CONFERENCE PRESENTATIONS DURING PHD STUDY ...... - 7 -
TABLE OF CONTENTS ...... - 9 -
LIST OF FIGURES ...... - 12 -
LIST OF TABLES ...... - 14 -
LIST OF APPENDICES ...... - 15 -
ABBREVIATIONS ...... - 16 -
CHAPTER ONE: INTRODUCTION ...... - 19 -
1. INTRODUCTION ...... - 20 - 1.1. Human parturition ...... - 20 - 1.1.1. Term labour ...... - 21 - 1.1.2. Preterm labour ...... - 22 - 1.2. Uterine distension ...... - 24 - 1.2.1. The role of stretch in normal pregnancy ...... - 25 - 1.2.2. Uterine overdistension causes preterm labour ...... - 25 - 1.2.3. Mechanisms of preterm labour in multiple pregnancy ...... - 25 - 1.3. Intrauterine infection/inflammation ...... - 28 - 1.3.1. Inflammation and pregnancy ...... - 28 - 1.3.2. The role of inflammation/infection in preterm labour ...... - 29 - 1.3.3. Uterine cytokine and chemokine networks ...... - 30 - 1.3.4. Prostaglandins and oxytocin in human parturition ...... - 32 - 1.4. Hormonal disorders ...... - 36 - 1.4.1. Progesterone withdrawal ...... - 37 - 1.4.2. Genomic progesterone actions in functional progesterone withdrawal ...... - 40 - 1.4.3. Non-genomic progesterone actions in functional progesterone withdrawal ...... - 45 - 1.4.4. Cross-talk between steroid receptors and NF-κB ...... - 45 - 1.5. Management strategies for the prevention of preterm labour ...... - 24 - 1.6. Summary and aims ...... - 48 -
CHAPTER TWO: MATERIALS AND METHODS ...... - 50 -
2. MATERIALS AND METHODS ...... - 51 - 2.1. Materials ...... - 51 - - 9 - 2.1.1. Chemicals, Reagents and Solvents ...... - 51 - 2.1.2. Antibodies ...... - 53 - 2.1.3. Buffers, Solutions and Gels ...... - 54 - 2.1.4. Cell culture materials and media ...... - 57 - 2.1.5. Competent cells ...... - 58 - 2.1.6. Enzymes...... - 58 - 2.1.7. Inhibitors and Treatments ...... - 58 - 2.1.8. Kits ...... - 59 - 2.1.9. Plasmids ...... - 59 - 2.1.10. SDS-PAGE electrophoresis and Western blotting materials ...... - 61 - 2.1.11. siRNA and shRNA ...... - 61 - 2.2. Methods ...... - 62 - 2.2.1. Tissue specimens ...... - 62 - 2.2.2. Primary cell culture ...... - 62 - 2.2.3. Whole-cell protein extraction ...... - 63 - 2.2.4. Cytosolic/nuclear protein extraction ...... - 64 - 2.2.5. Western blot analysis ...... - 64 - 2.2.6. RNA extraction qPCR ...... - 64 - 2.2.7. Transient transfections and luciferase assays ...... - 66 - 2.2.8. Amplification of long PCR products ...... - 67 - 2.2.9. Agarose gel electrophoresis ...... - 67 - 2.2.10. DNA purification from agarose gel and concentration determination ...... - 68 - 2.2.11. Restriction enzyme digestion and Ligation reaction ...... - 68 - 2.2.12. Colony PCR ...... - 68 - 2.2.13. DNA sequencing and analysis...... - 69 - 2.2.14. Co-immunoprecipitation (Co-IP) ...... - 69 - 2.2.15. Chromatin immunoprecipitation ...... - 69 - 2.2.16. Statistical analysis ...... - 70 -
CHAPTER THREE: UTERINE STRETCH AND PROGESTERONE ACTION ...... - 72 -
3. UTERINE STRETCH AND PROGESTERONE ACTION ...... - 73 - 3.1. Introduction ...... - 73 - 3.2. Results ...... - 75 - 3.2.1. Does progesterone affect stretch-induced ERK1/2 activation and gene expression? ...... - 75 - 3.2.2. Does stretch change progesterone-responsive gene expression? ...... - 82 - 3.2.3. Stretch does not change liganded PR-B-driven PRE activation or progesterone repression of IL-1β-induced COX-2 expression ...... - 87 - 3.2.4. The effect of mechanical stretch on PR expression ...... - 90 - 3.2.5. Stretch induces unliganded PR-B-driven PRE activation via CDK2 ...... - 94 - 3.3. Summary and Discussion ...... - 99 - 3.3.1. Progesterone does not affect stretch-induced ERK1/2 activation and gene expression ...... - 99 - 3.3.2. Stretch does not affect progesterone action...... - 100 - - 10 - 3.3.3. Stretch decreases PR-total mRNA expression and PR-B protein synthesis ...... - 101 - 3.3.4. Stretch increases PR-B activity in the absence of progesterone ...... - 102 -
CHAPTER FOUR: GLUCOCORTICOID RECEPTOR IS A KEY PLAYER THAT MEDIATES PROGESTERONE ACTION ...... - 104 -
4. GLUCOCORTICOID RECEPTOR IS A KEY PLAYER THAT MEDIATES PROGESTERONE ACTION ...... - 105 - 4.1. Introduction ...... - 105 - 4.2. Results ...... - 107 - 4.2.1. The mutual repression of NF-κB and progesterone receptor activity ...... - 107 - 4.2.2. P4 acts via both PR and GR to drive gene expression...... - 115 - 4.2.3. The mechanism of P4 and MPA actions on IL-1β inhibition ...... - 116 - 4.3. Summary and Discussion ...... - 123 -
CHAPTER FIVE: GENE NETWORKS AND CELLULAR FUNCTIONS THAT REGULATED BY PROGESTERONE AND GLUCOCORTICOID RECEPTORS IN USMCS ...... - 126 -
5. GENE NETWORKS AND CELLULAR FUNCTIONS THAT REGULATED BY PROGESTERONE AND GLUCOCORTICOID
RECEPTORS IN USMCS ...... - 127 - 5.1. Introduction ...... - 127 - 5.2. Results ...... - 130 - 5.2.1. Samples preparation ...... - 130 - 5.2.2. Analysis methods and gene lists ...... - 130 - 5.2.3. Top functions of gene networks ...... - 134 - 5.2.4. Identification and validation of candidate genes ...... - 134 - 5.3. Summary and Discussion ...... - 142 -
CHAPTER SIX: FINAL SUMMARY AND DISCUSSION ...... - 147 -
APPENDICES ...... - 151 -
REFERENCES ...... - 175 -
- 11 - List of Figures
FIGURE 1-1 THE UTERINE MYOMETRIUM DURING LABOUR.
FIGURE 1-2 POTENTIAL MECHANISMS LEADING TO PRETERM BIRTH IN MULTIPLE PREGNANCIES.
FIGURE 1-3 TH1-TH2 BALANCE IN PHYSIOLOGICAL PREGNANCY AND IN GESTATIONAL DISEASES.
FIGURE 1-4 PROSTAGLANDIN SYNTHESIS AND ACTIONS.
FIGURE 1-5 INFLAMMATION AND PARTURITION.
FIGURE 1-6 EARLY STEPS OF SEX STEROID BIOSYNTHESIS.
FIGURE 1-7 SCHEMATIC MODEL OF THE GENOMIC AND NON-GENOMIC PATHWAYS BY WHICH STEROID HORMONES AFFECT
CONTRACTILITY OF THE HUMAN PREGNANCY MYOMETRIUM.
FIGURE 1-8 POST-TRANSLATIONAL MODIFICATION OF PR RESULTS IN THE REGULATION OF SPECIFIC SUBPOPULATIONS OF PR
GENES.
FIGURE 1-9 MOLECULAR SIGNALING IN PARTURITION.
FIGURE 3-1 THE FAILURE OF PROGESTERONE TO SIGNIFICANTLY REDUCE STRETCH-INDUCED ACTIVATION OF ERK1/2.
FIGURE 3-2 THE FAILURE OF PROGESTERONE TO SIGNIFICANTLY REDUCE STRETCH-INDUCED GENE EXPRESSION.
FIGURE 3-3 RU468 DOES NOT ACCENTUATE THE STRETCH-INDUCED GENE EXPRESSION.
FIGURE 3-4 THE COMPARISON OF TRANSFECION EFFICIENCY BETWEEN AMAXA (NUCLEOFECTION) AND GENE JUICE IN
USMCS. USMCS WERE TRANSIENTLY TRANSFECTED WITH A GREEN FLUORESCENT PROTEIN (GFP) EXPRESSING
PLASMID, PMAXGFP USING AMAXA (NUCLEOFECTION) OR GENE JUICE. CELLS WERE EXAMINED BY FLUORESCENCE
MICROSCOPY FROM 2 DAY POST-TRANSFECTION TO DAY 5. BF, BRIGHT FIELD.
FIGURE 3-5 PR KNOCKDOWN DOES NOT AFFECT THE STRETCH-INDUCED COX-2 EXPRESSION.
FIGURE 3-6 PROGESTERONE-RESPONSIVE GENES IN THE LITERATURE ARE NOT MODULATED BY PROGESTERONE IN USMCS.
FIGURE 3-7 STRETCH OF HUMAN USMCS DOES NOT INHIBIT THE ABILITY OF PROGESTERONE TO MODULATE GENE
EXPRESSION.
FIGURE 3-8 STRETCH OF HUMAN USMCS DOES NOT INHIBIT THE ABILITY OF PROGESTERONE TO ACTIVATE A PROGESTERONE
RESPONSE ELEMENT.
FIGURE 3-9 STRETCH OF HUMAN USMCS DOES NOT INHIBIT THE ABILITY OF PROGESTERONE TO REPRESS IL-1Β-DRIVEN
COX-2 EXPRESSION.
FIGURE 3-10 MPA REPRESSES IL-1Β-DRIVEN COX-2 EXPRESSION BUT HAS NO EFFECT ON STRETCH-INDUCED COX-2
EXPRESSION.
FIGURE 3-11 STRETCH OF USMCS RESULTS IN A REDUCTION IN PR-B, PR-TOTAL MRNA AND PR-B PROTEIN EXPRESSION.
FIGURE 3-12 STRETCH REDUCES PR-B, PR-TOTAL MRNA AND PR-B PROTEIN VIA NF-ΚB ACTIVATION.
FIGURE 3-13 MAPK ACTIVATOR INCREASES PR MRNA EXPRESSION.
FIGURE 3-14 THE EFFECT OF PKC AND PLC ACTIVATORS AND INHIBITORS ON BASAL PR EXPRESSION AND STRETCH-
REPRESSED PR EXPRESSION.
FIGURE 3-15 STRETCH INCREASES UNLIGANDED PR-B ACTIVITY.
FIGURE 3-16 MAPK INHIBITORS HAVE NO EFFECT ON STRETCH-INDUCED UNLIGANDED PR-B ACTIVATION.
- 12 - FIGURE 3-17 STRETCH OF USMCS RESULTS IN AN INCREASE OF UNLIGANDED PR-B ACTIVATION MEDIATED THROUGH CDK2.
FIGURE 3-18 CONSTITUTIVELY ACTIVE CDK2 (CDK2-TY) DOES NOT INCREASE UNLIGANDED PR-B ACTIVITY.
FIGURE 3-19 INCREASING DOSE OF CDK2-TY HAS NO EFFECT ON UNLIGANDED PR-B ACTIVITY.
FIGURE 3-20 MUTATION OF PR-B ON SER400 FAILS TO BLOCK STRETCH-INDUCED UNLIGANDED PR-B ACTIVATION.
FIGURE 4-1 THE OPITIMIZITION OF THE CONCENTRATION OF MPA AND P4.
FIGURE 4-2 IL-1Β REPRESSES P4 ACTION VIA NF-ΚB.
FIGURE 4-3 PR-B INHIBITS NF-ΚB ACTIVITY.
FIGURE 4-4 THE EFFECT OF PR MODULATION ON P4 INHIBITION OF IL-1Β-DRIVEN COX-2 EXPRESSION.
FIGURE 4-5 THE EFFECT OF PR MODULATION ON P4-RESPONSIVE GENES EXPRESSION.
FIGURE 4-6 THE MECHANISM OF ACTION OF P4 AND MPA ON IL-1Β INHIBITION.
FIGURE 4-7 A SCHEMATIC DIAGRAM OF THE INHIBITORY EFFECT OF P4 ON IL-1Β-DRIVEN COX-2 EXPRESSION IN USMCS.
FIGURE 5-1 WESTERN BLOT ANALYSIS OF PR AND GR KNOCKDOWN.
FIGURE 5-2 PRINCIPAL COMPONENT ANALYSIS MAPPING.
FIGURE 5-3 A HISTOGRAM REPRESENTING THE SIGNAL INTENSITY ACROSS ALL ARRAYS.
FIGURE 5-4 SOURCES OF VARIATION AT THE GENE LEVEL.
FIGURE 5-5 VALIDATION OF PUTATIVE MPA/P4-RESPONSIVE AND PR/GR-DEPENDENT GENES.
FIGURE 5-6 QUANTITATION ANALYSIS OF HSD3Β1 AND IL17A.
FIGURE 5-7 THE EFFECT OF GR SELECTIVE AGONIST (DEX) ON MPA/P4-RESPONSIVE GENES.
- 13 - List of Tables
TABLE 1-1 SOURCE OF STEROIDS AND MECHANISMS FOR PROGESTERONE WITHDRAWAL BEFORE PARTURITION IN SEVERAL
SPECIES.
TABLE 2-1 PRIMER PAIR SEQUENCES WITH GENE ACCESSION NUMBERS
TABLE 3-1 TOP 50 UP-REGULATED GENES BY MPA WITH GENE SYMBOL, GENE NAME, GENEBANK ACCESSION NUMBER
AND FOLD CHANGE
TABLE 3-2 TOP 50 DOWN-REGULATED GENES BY MPA WITH GENE SYMBOL, GENE NAME, GENEBANK ACCESSION NUMBER
AND FOLD CHANGE
TABLE 5-1 SUMMARY OF THE FUNCTIONS, BIOLOGIC ACTIVITIES, STRUCTURAL PROPERTIES, AND LIGANDS FOR PR.
TABLE 5-2 SUMMARY OF THE FUNCTIONS, BIOLOGIC ACTIVITIES, STRUCTURAL PROPERTIES, AND LIGANDS FOR GR.
TABLE 5-3 EXPERIMENT DESIGN FOR MICROARRAY ANALYSIS.
TABLE 5-4 FUNCTION ANALYSIS OF ELIGIBLE GENES IN EACH COMPARISON.
- 14 - List of Appendices
APPENDIX 1 TOP 50 UP-REGULATED GENES BY MPA.
APPENDIX 2 TOP 50 DOWN-REGULATED GENES BY MPA.
APPENDIX 3 TOP 50 UP-REGULATED GENES BY P4.
APPENDIX 4 TOP 50 DOWN-REGULATED GENES BY P4.
APPENDIX 5 TOP 50 UP-REGULATED GENES UPON GR KNOCKDOWN.
APPENDIX 6 TOP 50 DOWN-REGULATED GENES UPON GR KNOCKDOWN.
APPENDIX 7 TOP 50 UP-REGULATED GENES UPON PR KNOCKDOWN.
APPENDIX 8 TOP 50 DOWN-REGULATED GENES UPON PR KNOCKDOWN.
APPENDIX 9 TOP 50 UP-REGULATED GENES BY MPA IN THE ABSENCE OF GR.
APPENDIX 10 TOP 50 DOWN-REGULATED GENES BY MPA IN THE ABSENCE OF GR.
APPENDIX 11 TOP 50 UP-REGULATED GENES BY P4 IN THE ABSENCE OF GR.
APPENDIX 12 TOP 50 DOWN-REGULATED GENES BY P4 IN THE ABSENCE OF GR.
APPENDIX 13 TOP 50 UP-REGULATED GENES BY MPA IN THE ABSENCE OF PR.
APPENDIX 14 TOP 50 DOWN-REGULATED GENES BY MPA IN THE ABSENCE OF PR.
APPENDIX 15 TOP 50 UP-REGULATED GENES BY P4 IN THE ABSENCE OF PR.
APPENDIX 16 TOP 50 DOWN-REGULATED GENES BY P4 IN THE ABSENCE OF PR.
APPENDIX 17 NETWORKS AND TOP FUNCTIONS OF MPA REGULATED GENES.
APPENDIX 18 NETWORKS AND TOP FUNCTIONS OF P4 REGULATED GENES.
APPENDIX 19 NETWORKS AND TOP FUNCTIONS OF GR REGULATED GENES.
APPENDIX 20 NETWORKS AND TOP FUNCTIONS OF PR REGULATED GENES.
APPENDIX 21 NETWORKS AND TOP FUNCTIONS OF MPA REGULATED GENES IN THE ABSENCE OF GR.
APPENDIX 22 NETWORKS AND TOP FUNCTIONS OF P4 REGULATED GENES IN THE ABSENCE OF GR.
APPENDIX 23 NETWORKS AND TOP FUNCTIONS OF MPA REGULATED GENES IN THE ABSENCE OF PR.
APPENDIX 24 NETWORKS AND TOP FUNCTIONS OF P4 REGULATED GENES IN THE ABSENCE OF PR.
- 15 - Abbreviations
AA: arachidonic acid
ANOVA: analysis of variance
AP-1: activator protein-1
AR: androgen receptor cAMP: cyclic adenosine monophosphate
CAPs: contraction-associated proteins
CDK2: cyclin-dependent kinase 2 cDNA: complementary DNA
C/EBP: CAAT/enhancer binding protein
CMV: cytomegalovirus
COX: cyclo-oxygenase
CRH: corticotrophin-releasing hormone
Dex: dexamethasone
DMEM: dulbecco’s modified eagles’ medium
DMSO: dimethyl sulfoxide
DNA: deoxyribonucleic acid dNTP: deoxyribonucleoside triphosphates
E. coli: Escherichia coli
EDTA: ethylenediaminetetraacetic acid
EP: prostaglandin E receptor
ERK: extracellular-signal-regulated kinases
- 16 - FBS: fetal bovine serum
FKBP: FK506 binding protein
GAPDH: glyceraldehyde 3-phosphate dehydrogenase
GR: glucocorticoid receptor
HDAC: histone deacetylase
HEPES: 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
HSD11β1: 11β-hydroxysteroid dehydrogenase type 1
Hsp: heat shock protein
Ig: immunoglobulin
IκBα: nuclear factor-kappa B inhibitor α
IKK: inhibitory κB kinase
IL-1β: interleukin-1 beta
IFN-γ: Interferon-γ
IVF: in-vitro fertilisation
LPS: lipopolysaccharides
LSCS: lower segment caesarean section
Luc: luciferase
MAPK: mitogen-activated protein kinase
MMP: matrix metalloproteinase
MPA: Medroxyprogesterone Acetate
NF-κB: nuclear factor-kappa B
NICU: neonatal intensive care unit
- 17 - OTR: oxytocin receptor
P4: progesterone
PAF: platelet-activating factor
PBS: phosphate buffered saline
PGRMCs: progesterone receptor membrane components
PKA: protein kinase A
PKC: protein kinase C
PLC: phospholipase C
PR: progesterone receptor
PRE: progesterone responsive element qPCR: quantitative PCR
RNA: ribonucleic acid
RNA pol II: RNA polymerase II rpm: revolutions per minute
RT-PCR: reverse transcription polymerase chain reaction
SDS: sodium dodecyl sulphate siRNA: small interfering RNA
SP-A: surfactant protein-A
TBE: tris-borate buffer
TNF-α: tumor necrosis factor-α
TSS: transcription start site
USMCs: uterine smooth muscle cells
- 18 - Chapter 1: Introduction
Chapter One: Introduction
- 19 - Chapter 1: Introduction
1. Introduction
1.1. Human parturition
Parturition is defined as the process of giving birth, which is composed of five separate and independent physiological actions including increased myometrial contractility, membrane rupture, cervical maturation, placental separation, and uterine involution [1, 2]. These events occur gradually in the gestational tissues, such as uterus, decidua, placenta, and fetal membranes (Figure 1-1) [3-6]. In different species of mammals, many aspects of physiology are similar. However, reproduction is a very important exception where humans are unique [7]. For example in the chimpanzee, although almost 95% of its genomic DNA sequences are identical to those of humans, most of the genes related to reproduction are in that 5% of differences between these two species [8, 9]. Moreover, the evolution of the female pelvis, due to the upright posture and the increases in the size of the cranium, also contribute to the unique nature of human parturition [10].
Figure 1-1 The gestational tissues.
A schematic diagram of the gestational tissues. Adapted from McGraw-Hill Human Sexuality Image Bank.
- 20 - Chapter 1: Introduction
Normal human pregnancy lasts for between 37 and 42 weeks with minor variations between ethnic groups (about 38 weeks after conception or about 40 weeks from the last normal menstrual period) [11]. Until a combination of signals from both mother and fetus, both endocrine and mechanical stimulation trigger the onset of labour [12, 13]. The timing of labour has to be well controlled; any aberrations within the timing of these signals may result in the abnormalities of parturition, such as preterm labour, postterm labour and stillbirth.
1.1.1. Term labour
Physiologically, labour at term is considered to be a release from the system which maintains uterine quiescence during pregnancy rather than an active process initiated by uterine stimulants [14]. Although some evidence suggest that the fetus controls the timing of labour, the final pathway for labour must reside in the uterus. The process of human pregnancy and labour can be divided into four distinct phases [15-17]:
Phase 0 (quiescence) covers most of pregnancy and is characterised by myometrial quiescence, which is achieved predominantly by progesterone. Other factors that are considered to be involved in maintaining uterine quiescence are prostacyclin, relaxin, corticotrophin-releasing hormone (CRH), human placental lactogen, adrenomedullin, nitric oxide, parathyroid hormone-related peptide, calcitonin gene-related peptide and vasoactive intestinal peptide. Although these factors play their function in different ways, they all finally increase intracellular concentrations of cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP), which inhibit intracellular calcium release causing a reduction in myosin light chain kinase activity and, therefore, myometrial contractility.
Phase 1 (activation) is characterised by activation of uterine function, including a change in steroid environment by a rise in estrogen and mechanical stretch [16, 18, 19]. An important event in this activation phase is the up-regulation of a group of genes encoding contraction-associated proteins (CAPs), such as myometrial receptors for prostaglandins and oxytocin, connexin 43, and genes related to certain ion channels. Another important change is the increase in the number and size of gap junctions between neighboring myometrial cells, which permits the development of electrical synchrony and helps the initiation of rhythmic contractions (Figure 1-2).
- 21 - Chapter 1: Introduction
Phase 2 (stimulation) after activation, the uterus is prepared for stimulation by uterotonins, such as prostaglandins, oxytocin, and CRH. Labour finally occurs and the fetus and placenta are delivered.
Phase 3 (involution) is the last phase, which is primarily mediated by oxytocin and during which the uterus return to its pre-conception state.
In this series of events, the initiation of parturition has been described as the transition of the myometrium from quiescence (Phase 0) to activation (Phase 1) where most of mechanical and biochemical changes occur, including uterine stretch, pro- inflammatory cytokines, and prostaglandins.
Figure 1-2 The uterine myometrium during labour.
Panel A shows that in the uterine myometrium individual myocytes have relatively low connectivity. Panel B shows that the uterine myometrium is converted into a tissue with extensive physical connections during labour. The physical connections occur through pores formed by multimers of connexin 43. Biochemically, the release of prostaglandin F2α and increased intracellular calcium also contribute to these connections during labour. Through this extensive physical and biochemical connectivity, the depolarization in individual myocytes can be passed to neighboring cells in order to form extensive waves of depolarization and generate contraction over large areas of the uterus. This leads to increased intrauterine pressure, progressive dilatation of the cervix, and expulsion of the fetus. Adapted from Smith, R., N Engl J Med, 2007. 356(3): p. 271-83 [7].
1.1.2. Preterm labour
Preterm birth (less than 37 weeks of gestation [11]) is the most important cause of perinatal mortality and morbidity, accounting for 75% of neonatal deaths and more than 50% of long-term morbidity [20]. According to gestational age, it can be further divided into four subcategories: extreme prematurity (~5% of preterm births occur at less than 28 weeks’), severe prematurity (~15% at 28-31 weeks’), moderate prematurity (~20% at 32-33 weeks’), and near term (60-70% at 34-36 weeks’) [21]. In
- 22 - Chapter 1: Introduction
Europe and some other developed countries, the preterm delivery rates are generally 5-9%, whereas the situation in the US is even worse with rates of 12-13% [22, 23]. The data reported by Martin et al. show that the frequency of preterm birth in the US has increased by over 30% in the last 20 years although we have more knowledge about the risk factors and mechanisms of preterm labour and better public health system and medical interventions [24, 25]. Between 22 and 26 weeks’ gestation, 65% of babies will die at the time of delivery or in the neonatal intensive care unit (NICU), while 90% of neonates survive at 30 weeks of gestation [26, 27]. Although the survival rate has improved with the gestational age, they are at high risk of developing permanent disabilities and complications such as lung disease, cerebral palsy, disorders of behavior and emotion, blindness or deafness, and epilepsy [24, 28]. The impact of the complications of being born prematurely is far greater in terms of “disability adjusted life years” than other common chronic conditions such as ischaemic heart disease, depression and stroke [29], since the expense of preterm birth is not only in the immediate neonatal care but also in the long-term care of lasting morbidities which is potentially due to prematurity [30-33]. In the UK, besides the cost of NICU, the cumulative cost of hospital care during the first 10 years of life averaged to approximately £1 8,000 for babies born before 28 weeks of gestation, which is 10 times higher than that of those born after 37 weeks of gestation [34].
Preterm labour is better defined as a syndrome rather than a specific diagnosis because the causes are varied, such as vascular insult, uterine overdistension, abnormal allogenic recognition, and stress [35]. Physiologically, term and preterm labour maybe the same process except that they occur at different gestational ages [36], but this remains to be proven. In preterm labour, the mechanisms responsible for maintaining uterine quiescence are either short-circuited or overwhelmed [17], resulting in increased uterine contractility, cervical ripening (dilatation and effacement), and decidua/membrane activation [37]; thus, the underlying molecular mechanisms of term and preterm labour are likely to be distinct. In terms of etiology, about 30-35% of preterm births are medically indicated while most of those are spontaneous (40-45% follow spontaneous preterm labour and 25-30% follow preterm premature rupture of the membranes) [21, 38]. Until now, some pathological processes have already been demonstrated to be implicated in the preterm birth syndrome, including uterine overdistension, intrauterine infection, endocrine
- 23 - Chapter 1: Introduction disorders, uterine ischaemia, abnormal allogenic recognition, allergic-like reaction and cervical disease [35, 39].
1.2. Management strategies for the prevention of preterm labour
There are many barriers to the prevention of preterm labour including our inability to identify those women who are at increased risk of preterm birth and the failure of current treatments to stop preterm labour once it has started [40]. Current prediction of risk of preterm labour relies on the individual’s obstetric history, cervical length and biochemical markers such as fetal fibronectin in cervico-vaginal secretions [41]. However, the progress of developing effective prophylactic treatment for women considered to be at risk for preterm birth is still unsatisfactory. Many strategies, such as antibiotic therapy, bed rest and routine hospitalization have been proved to be ineffective. However, progesterone supplementation appears promising based on the hypothesis that progesterone induces uterine quiescence despite little progress being made in understanding the molecular mechanisms of how it works [42-46].
Progesterone has been used for the prevention of spontaneous abortions for more than 40 years [47]. In most of clinical trials, either natural progesterone or synthetic progestagens have been used. The latter is derived from progesterone or nortestosterone and is similar in structure to progesterone. For instance, 17-alpha- hydroxyprogesterone caproate (17P) is most commonly used, and it significantly decreased the rate of recurrent preterm birth but has no effect on multiple pregnancies-induced preterm labour [48-51]. Moreover, two recent studies indicated the potential maternal side-effects that 17P may cause, such as an increased risk of gestational diabetes [52, 53]. Although 17P may not be the best progestational agents to prevent preterm birth, it is very important to understand and determine the potential mechanisms by which progestational agents prevent preterm birth.
A better understanding of the molecular mechanisms of progesterone action and its interaction with the pathological processes suggests ways in which we can design more effective therapies and preventative approaches in the future, ultimately reducing the risks of preterm labour.
1.3. Uterine distension
- 24 - Chapter 1: Introduction
1.3.1. The role of stretch in normal pregnancy
During normal pregnancy, the action of estrogen regulates the growth of the uterus, which provides enough space for the fetus to grow. Despite the fact that the fetus and placenta increase in size during gestation, the intra-amniotic pressure stays relatively constant throughout this period [54, 55] due to the effect of progesterone and some endogenous myometrial relaxants such as nitric oxide [56] and cAMP [57], which promotes myometrial hyperplasia and hypertrophy and prevent the uterus from the influence of stretch-induced CAP gene expressions [58-60]. Toward the end of pregnancy, uterine growth halts leading to the loss of coordination between the growth of uterus and fetus and increasing tension of the uterine wall. Therefore, the effect of stretch enhances in late gestation, associating with augmented production of placental CRH and increased amniotic fluid surfactant proteins and lipids, which can lead to the onset of labour [58, 61-64].
1.3.2. Uterine overdistension causes preterm labour
The rate of preterm labour increases in women with multiple pregnancy [65], polyhydramnios [66-68], and mullerian duct abnormalities [69, 70], which are associated with uterine overdistension.
Multiple pregnancy is defined as any pregnancy that carries more than one fetus. In every 80 live births, there is approximately one twins born spontaneously while triplets occurs one in every 1600 [71]. In the US, 51% of twins and 91% of triplets are born preterm, which is 6-9 times higher than that of singletons. 14% of twins and 41% of triplets are even born very preterm, whereas only 1.7% in singletons [72]. Another study based in Scotland showed that 52.2% of multiple births are preterm and 10.7% of them delivered before 32 weeks. In the UK, the neonatal mortality rate of twins is 1.8%, which is 6-7 times that of singleton pregnancies while the rate in higher order multiple pregnancies goes to 39.6%. With the development of in vitro fertilisation (IVF), it contributes over 20% of all multiple births in the UK, although only 1.3% of all births are IVF births. There is some evidence to indicate that the incidence of preterm birth is higher in IVF twins than the spontaneous ones [73].
1.3.3. Mechanisms of preterm labour in multiple pregnancy
- 25 - Chapter 1: Introduction
Clinically, progesterone administration reduces preterm labour rates in singleton but not in multiple pregnancies [49, 51, 74]. This suggests that different processes are involved in singleton and multiple preterm labour. Since multiple pregnancies have more fetuses and a larger placental mass, it is likely that the physiological stimuli, such as CRH, surfactant protein-A (SP-A), and platelet-activating factor (PAF), are greater [64, 75, 76], increasing the possibility of early delivery (Figure 1-3) [77]. TambyRaja et al. supported part of this hypothesis and found that levels of placental CRH were higher in twin pregnancies than in singleton pregnancies, but there is no difference in the CRH levels in those twins that did and did not deliver early [75]. However, it is still unknown whether the levels of SP-A and PAF are also higher in multiple pregnancy.
Some groups have tried to investigate the difference in the basic functional properties of myometrium from both singleton and multiple pregnancies. Although there was no statistically significant difference in the number of proliferating cells, the uteri from multiple pregnancies contracted more frequently than singleton controls [78, 79]. However, there was no threshold of contraction frequency could be established for the purpose of prediction. In terms of the myometrial thickness, although ultrasound evaluations showed that the lower uterine segment of twin pregnancies became thinner with increasing gestation, there was no difference comparing with singleton groups. The stretch-induced protein expression in twin pregnancies may increase the length of the uterine wall rather than the myometrial thickness [80]. These data are also consistent with an earlier study which showed myometrial thickness of the upper uterine segment in singletons remained relatively constant throughout gestation, whereas that of the lower uterine segment decreased with advancing gestational age [81].
- 26 - Chapter 1: Introduction
Figure 1-3 Potential mechanisms leading to preterm birth in multiple pregnancies.
The increased fetal and placental mass of multiple pregnancy is like to induce the levels of stimuli including stretch, placental CRH production and lung maturity factors and causes increased myometrial and fetal membrane activation. Similar or greater proportions of multiple pregnancies compared with singleton pregnancies will be seen in pathological processes such as infection, cervical insufficiency, placental dysfunction and stress. A higher incidence of iatrogenic preterm birth occurs in twins due to more frequent medical indications for delivery. Adapted from Stock, S. and J. Norman, Semin Fetal Neonatal Med, 2010. 15(6): p. 336-41 [77].
Many investigations are focused on the effect of stretch as it is considered to be one of the most important factors leading to preterm labour in multiple pregnancies. Animal studies have shown that stretch increases myometrial expression of the oxytocin receptor (OTR), cyclooxygenase-2 (COX-2), connexin-43 and activator protein-1 (AP-1) family members [58, 60, 82]. Uterine stretch not only occurs on the myometrium but also affects the fetal membranes, which adhere to the inner surface of the uterus. The in vitro studies on human myometrial and amnion epithelial cells revealed that labour-associated proteins are also up-regulated by mechanical stretch via one or more transcription factors, such as AP-1 and nuclear factor-kappa B (NF- κB) [83-87]. These transcription factors are also found to be involved in stretch- induced genes expression in other cell types including airway smooth muscle cells and endothelial cells [88, 89]. By comparison between myometrium of singleton and multiple pregnancies, another in vitro study tested the expression of gap junction
- 27 - Chapter 1: Introduction proteins, prostaglandin E receptors, and G-protein subunit Gsα and found that their expression levels were not altered by stretch [78].
The mechanisms leading to preterm birth in multiple pregnancy are still unclear, although many hypotheses have been proposed. Therefore, we still cannot fully explain why therapies that prevent preterm labour in singletons are ineffective in multiple pregnancy or may even be harmful.
1.4. Intrauterine infection/inflammation
1.4.1. Inflammation and pregnancy
Inflammation is part of the innate immune response and regarded as a process by which tissues of body respond to insults in order to recruit cells and molecules to suppress the infection, limit the degree of damage, and induce regeneration of affected tissues. It is characterized by elevated production of chemokines, cytokines and pattern recognition receptors. Clinically, inflammation is defined by the presence of five classical signs: heat, pain, redness, swelling and loss of function [90]. However, an excessive inflammatory reaction or disruption of inflammation regulation is causally associated with the development of a large variety of human diseases [91]. In the reproductive process, inflammation plays a critical role because ovulation, implantation and parturition are all inflammatory phenomena. Adverse pregnancy outcomes, such as spontaneous abortion, preeclampsia, intrauterine growth restriction and preterm labour, are usually caused by the disorder of cytokine networks [92]. Cytokines are divided into four families depending on their structure: the four-α-helix bundle family including Interleukin (IL)-2, Interferon (IFN)-γ, and IL-10; IL-1 family; IL-17 family; and small cytokines (chemokines) family such as IL-8, monocyte chemotactic protein-1 (MCP-1), and chemokine (C-C motif) ligand 5 (CCL5). Functionally, they can be grouped into those involved in cell-mediated immunity and those involved in humoral immune response. The former is regulated by T helper (Th) 1 cells where IL-1, IL-2, IL-6, IL-12, IL-15, IL-18, TNF-α and IFN- γ are mainly produced. The latter is modulated by Th2 cells, which are the source of IL-4, IL-5, IL-10, IL-13, and granulocyte-macrophage colony-stimulating factor (GM-CSF). Although the cytokines are produced by local T cells, the main sources of Th2 cytokines are non-lymphoid tissues, such as the placental/decidual tissues and
- 28 - Chapter 1: Introduction trophoblast [93]. During normal human pregnancy, Th2 initially plays the predominant role to protect the feto-maternal relationship, followed by a shift toward Th1 in the late of gestation. The balance of Th1 and Th2 cytokines can be altered abnormally by inflammation/infection processes which make Th1 predominance and initiate the production of inflammatory cytokines seen in spontaneous abortion, preeclampsia and preterm delivery (Figure 1-4) [94].
Figure 1-4 Th1-Th2 balance in physiological pregnancy and in gestational diseases.
Adapted from Challis, J.R., et al., Reprod Sci, 2009. 16(2): p. 206-15 [94].
1.4.2. The role of inflammation/infection in preterm labour
Although preterm labour can be initiated by several pathological processes as mentioned before, inflammation is a common component associating with many of these mechanisms. Since infection is a major cause of inflammation, intrauterine infection is one of the most frequent conditions leading to premature labour and delivery [95-98]. So far, it is the only pathological process which has been established a firm causal link with preterm birth [37]. To support this causal relationship, there is some evidence from both humans and animals that have been demonstrated and summarized by Romero et al. [35, 90, 91]: (1) intrauterine infection or administration of microbial products to pregnant animals can cause preterm labour [99-101]; (2) extrauterine maternal infections, such as pyelonephritis, pneumonia and malaria, are associated with preterm birth [102-104]; (3) pregnant women who have intra-amniotic infection or intrauterine inflammation in the mid-trimester are likely to delivery prematurely [105-107]; (4) antibiotic treatment of ascending intrauterine infections is able to prevent prematurity [108].
- 29 - Chapter 1: Introduction
In the most common pathway of intrauterine infection, leukocytes (neutrophils and macrophages) are first stimulated locally as microorganisms reach the decidua. Microorganisms may then cross intact membranes into the amniotic cavity to stimulate resident macrophages and other host cells. Finally, they gain access to the fetus and a systemic fetal inflammatory response is triggered. The invasion of microorganisms is normally associated with the microbial proliferation and bacterial products, such as lipopolysaccharides (LPS) (from cell wall of Gram-negative bacteria), peptidoglycans or lipoteichoic (from cell wall of Gram-positive bacteria), and endotoxin. These products, which mediate the effects of microorganisms, can be recognized by Toll-like receptors (TLR-4 recognises products from Gram-negative bacteria; TLR-2 recognises products from Gram-positive bacteria) and other pattern- recognition receptors and then stimulate the release of inflammatory cytokines and chemokines, leading to increased production of prostaglandins and matrix-degrading enzymes. These molecules can activate the processes of cervix remodeling, fetal membranes weakening and rupture, and myometrial contractility [109-111].
Although bacteria are considered to be the main cause of intrauterine inflammation leading to infection-associated preterm labour, viral infections are also found to be involved. The most common viruses in the amniotic fluid include adenovirus, cytomegalovirus, enterovirus and respiratory syncytial virus [112].
1.4.3. Uterine cytokine and chemokine networks
Due to the crucial role of uterine pro-inflammatory cytokines and chemokines in both term and preterm parturition, several studies have focused on their individual function, such as IL-1β, tumor necrosis factor-α (TNF-α), IL-8 and IL-6.
IL-1 is the first cytokine found to be involved in the onset of infection-associated preterm labour. More evidence in support of the importance of IL-1 was subsequently revealed. Romero et al. found that human decidua produced IL-1 in response to bacterial products and IL-1 stimulated prostaglandin biosynthesis in human amnion [113, 114]. In the amniotic fluid of women with preterm labour and infection, an increase in the concentration and activity of IL-1 was found [115]. Sadowsky and colleagues reported that IL-1β could stimulate uterine activity and cause preterm labour in nonhuman primates [116-118]. Another study in mice showed that systemic administration of IL-1 induced preterm labour whereas the administration of an IL-1
- 30 - Chapter 1: Introduction receptor antagonist blocked this induction [119, 120]. Although IL-1 administration was sufficient, it was not necessary for the onset of infection-induced preterm labour as was suggested by a study using IL-1 receptor knockout mice, which showed that preterm labour still occurred after bacterial exposure [121]. However, in a follow-up study, this group used another mice model lacking the type I receptors for both IL-1 and TNF and found that the rates of preterm delivery were significantly lower in double-knockout mice compared with the wild type controls suggesting the combination of both signalling pathways are crucial in this context [122].
TNF-α is a 17kDa soluble protein, which can also stimulate prostaglandin synthesis in amnion, decidua and myometrium, is increased in the amniotic fluid of women with preterm labour and intra-amniotic infection [96, 123, 124]. A number of animal studies have also supported its importance in the mechanisms of preterm parturition associated with infection [125-127].
IL-8, which is one of the major mediators of the inflammatory response, belongs to the chemokine family. As a chemokine, IL-8 is responsible for the induction of chemotaxis, which directs the migration of cells, particularly neutrophil granulocytes, to the inflammation sites. It is produced by macrophages and other cell types such as epithelial cells and present in uterine tissues, including choriodecidua, placenta, cervix and myometrium [128-131]. Its expression increases in the uterus with advancing gestational age and can be induced by many stimuli, such as IL-1β, TNF-α and stretch [130, 132, 133]. A leukocyte influx caused by IL-8 is associated with cervical ripening and also occurs in the myometrium and lower uterine segment with labour [126, 134].
Other cytokines have also been implicated in this cytokine network, such as IL-6 and IL-10. The concentrations of IL-6 in amniotic fluid are considered as a bio-marker, which is highly sensitive for prediction of intrauterine infection, but the assays for this marker has not been standardized to test amniotic fluid [135-137]. Unlike other pro- inflammatory cytokines, IL-10 plays anti-inflammatory role to maintain pregnancy. This is supported by the evidence that IL-10 expression is significantly decreased in the placental tissues at both term and preterm labour [138, 139]; COX-2 mRNA expression is inhibited by IL-10 in cultured placental explants from preterm labour deliveries [139]; IL-1β-induced uterine contractility is reduced by IL-10 and
- 31 - Chapter 1: Introduction dexamethasone treatment [116]; and the administration of IL-10 prevents endotoxin- induced preterm birth in pregnant rats [140].
1.4.4. Prostaglandins and oxytocin in human parturition
1.4.4.1. Prostaglandins, prostaglandin biosynthesis and metabolism
In human parturition, stimulatory prostaglandins such as prostaglandin (PG) E2 and
PGF2α play a central role by inducing cervical and fetal membrane remodeling and uterine contractility [1, 141, 142]. The evidence supporting their roles in the initiation and progression of labour includes: (1) the concentrations of prostaglandins and their metabolites elevate in amniotic fluid, intrauterine tissues, and maternal blood prior to and with labour [1, 143-147]; (2) administration of prostaglandins induces transformation of the uterus and cervix leading to pregnancy termination and labour [148-151]; (3) inhibition of prostaglandin biosynthesis by both non-selective and selective COX-2 inhibitors prolongs pregnancy and delays labour, although there are considerable maternal and fetal side effects [152-155]; (4) Calcium released from intracellular and extracellular stores by prostaglandins was suggested to be a trigger leading to myometrial contractions [156-158]. Therefore, the regulation of prostaglandin biosynthesis in uterine tissues is crucial for human parturition.
The biosynthetic pathway of prostaglandin can be divided into three main stages (Figure 1-5): (1) hydrolysis of membrane phospholipids by phospholipase (PL) enzymes, such as PLA2, PLC and PLD, to produce free arachidonic acid (AA); (2) COX enzymes catalyse a reaction where molecular oxygen is inserted into free AA to form an unstable intermediate (PGG2), which is rapidly converted to PGH2; (3) conversion of PGH2 to PGE2, PGF2α, PGD2, PGI2 and thromboxane by specific synthase enzymes, which determines the cell-type-specific prostaglandin profile [159].
- 32 - Chapter 1: Introduction
Figure 1-5 Prostaglandin synthesis and actions.
After the cells are activated by a host of factors such as mechanical trauma, cytokines, growth factors, or various inflammatory stimuli, arachidonic acid (AA) is released from membrane lipids by cytosolic phospholipase
(cPLA2) and metabolised by COX enzymes to the intermediate PGH2. These factors can also induce de novo COX-2 enzyme synthesis, which reinforces prostaglandin (PG) formation. In a cell-type restricted fashion, a heterogeneous family of PGH2 metabolizing enzymes can form PGE2, PGD2, PGF2α, PGI2 (prostacyclin) and TxA2 (thromboxane). After transportation from the cell through a known prostaglandin transporter (PGT) or other carriers, these prostaglandins exert autocrine or paracrine actions on a family of prostaglandin receptors EP1, EP2,
EP3, EP4, DP1, DP2, FP, IP, TPα, and TPβ depending on the cell types. Adapted from Funk, C.D., Science, 2001. 294(5548): p. 1871-5 [159].
Although a number of studies have been focusing on the function and regulation of the PLA2 enzymes and noted that two groups of PLA2 (secretory PLA2 and cytosolic
PLA2) are differentially expressed and regulated in intrauterine tissues before and during labour [160-163], COX enzymes may play more important roles in the pathway of prostaglandin production as they mediate the rate-limiting step where AA is irreversibly converted to PGH2 [145]. Three isoforms are known so far in this COX enzyme family: COX-1, COX-2, and COX-3 [also referred as prostaglandin G/H
- 33 - Chapter 1: Introduction synthase (PGHS) -1, -2, and -3 respectively]. They are generated from separate genes and controlled by different mechanisms, except that COX-3 is an mRNA-splicing isoforms from COX-1 gene. COX-1 is a constitutive enzyme expressed in most cell types while COX-2 is almost undetectable under normal physiological condition but can be induced and controlled by cytokines and growth factors in a cell and tissue specific manner [164-166]. A solid body of evidence indicates the importance of COX-2 in the onset of human parturition: (1) COX-2 mRNA and protein levels, but not COX-1, increase in intrauterine tissues at term before and during labour [167-
170]; (2) The increase of PGE2 in human amnion with the onset of labour is associated with selective induction of COX-2 gene [171, 172]; (3) a series of in vitro studies show that COX-2 expression can be induced in primary cultured cells of different gestational tissues [173-175]; (4) as mentioned before, selective COX-2 inhibitors prolong pregnancy and delay labour by suppression of prostaglandin synthesis. Therefore, the mechanisms involved in the transcriptional regulation of COX-2 gene and posttranslational modification of COX-2 protein have been focused on by researchers [176-179]. Although COX-2 promoter has already been very well characterised, which contains several pro-inflammatory transcription factor binding sites such as NF-κB, CCAAT-enhancer-binding protein (C/EBP), and AP-1 [180], the molecular mechanisms have still not been fully understood due to the multifactorial regulation system and the cell type-dependent manner [181-185].
The enzyme that controls prostaglandin metabolism is prostaglandin dehydrogenase
(PGDH), which catalyses the irreversible conversion of PGE2 and PGF2α to their biological inactive forms (15-keto-derivatives). The amnion is the major source of prostaglandins, not surprisingly it contains very low or no PGDH enzyme, which has been predominantly localized to trophoblast cells of chorion [186]. The chorion therefore becomes an important site for prostaglandin metabolism and interposes the transfer of prostaglandins from the amnion to the maternal tissues of the uterus, such as decidua and myometrium, in order to control the myometrium contraction. This suggests that the contractility of myometrium driven by exposure to PGs depends on the balance of COX-2 and PGDH in the chorion. Several studies have shown that progesterone may prevent myometrial exposure to prostaglandins by stimulating PGDH and inhibiting COX-2 whereas estrogen, CRH, cortisol and some immune
- 34 - Chapter 1: Introduction cytokines play opposing roles by increasing active prostaglandins in the myometrium [18, 187-190].
After prostaglandin biosynthesis and metabolism, prostaglandins are finally transported to the target cells and exert their effects through specific G-protein coupled receptors. There are currently ten known prostaglandin receptors on various cell types. For examples, four PGE2 receptors have been identified: EP1, EP2, EP3 and
EP4 while only one receptor, named FP, has been found for PGF2α. Among them, the
EP1 and FP cause contraction by increasing intracellular calcium whereas EP2 and EP4 are associated with relaxation by stimulating intracellular cAMP formation [191,
192]. The EP3, however, can either mediate contraction or relaxation depending on the cohort of receptor isoforms expressed, which are generated by multiple alternatively spliced transcript variants [193]. Therefore, to fully understand the mechanisms of prostaglandin function and regulation in human parturition, a thorough characterisation of the prostaglandin population in each gestational tissue is required.
1.4.4.2. Oxytocin and oxytocin receptor
Oxytocin is known to play an important role in human parturition due to its function of increasing uterine smooth muscle contractility and remain the most widely used method of inducing labour at term. The myometrium becomes increasingly sensitive to oxytocin as term approaches due to increased OTR expression [194-198]. Although this up-regulation of myometrial OTR in the early stages of labour is a general phenomenon that exists not only in human but also in several other animal species, such as rat, rabbit, guinea pig, cow and pig [198-204], the amount and character of elevation is different between human and other animals. In rats and rabbits, a sudden increase occurs just before the onset of labour whereas only about 2-fold rise of OTR concentration was found in human myometrium [198, 202, 204-206]. It has been reported that the decline of circulating progesterone and elevation of estrogen levels contribute, at least in part, to the up-regulation of OTR in the rat myometrium [198, 207]. In women, however, progesterone levels do not fall at the end of pregnancy, which suggests that the regulation of OTR expression is different in the rat and human. Recent studies by our group found that inflammatory stimuli may be involved in triggering OTR expression as several putative transcription factor-binding sites were located in the OTR promoter region, including AP-1, C/EBP and NF-κB which
- 35 - Chapter 1: Introduction are frequently associated with pro-inflammatory cytokines, such as IL-1β and IL-6 [208-210]. However, the effects of cytokines on OTR activity are still controversial and the regulation of OTR expression in human pregnancy remains unclear.
Collectively, the biochemical events involved in parturition resemble an inflammatory reaction, which affects the common pathway of parturition including uterine contractility, cervical ripening, and activation of the membranes/decidua (Figure 1-6).
Figure 1-6 Inflammation and parturition.
Adapted from Challis, J.R., et al., Reprod Sci, 2009. 16(2): p. 206-15 [94].
1.5. Endocrine disorders
It has been suggested that there is a parturition cascade, in which the steroid hormones and paracrine and autocrine factors are responsible for uterine contractions at term (Figure 1-7). Among these steroid hormones, progesterone and estrogen play central roles in the regulation of human parturition. In normal pregnancy, the interaction between these two steroids is in a dynamic balance which controls all of the - 36 - Chapter 1: Introduction components of the common pathway of parturition. Generally, maternal plasma progesterone maintains pregnancy by promoting uterine quiescence, inhibiting cervical ripening, and suppressing decidual/membranes activation. In contrast, estrogen acts in an opposite manner, inducing the transformation of the uterus and cervix to favour parturition [211]. Thus, this progesterone-estrogen balance has to be very well controlled and any disorders disrupting it will lead to an imbalance in the process of parturition.
Figure 1-7 Proposed mechanism of labour induction at term.
The parturition cascade including the major hormones and paracrine and autocrine factors responsible for the uterine contractions at term. Adapted from Norwitz, E.R., J.N. Robinson, and J.R. Challis, N Engl J Med, 1999. 341(9): p. 660-6 [17].
1.5.1. Progesterone withdrawal
Progesterone is a steroid hormone and plays essential roles in normal human physiology, not only in non-reproductive tissues such as bone, cardiovascular systems and the central nervous system, but more importantly in reproductive tissues such as - 37 - Chapter 1: Introduction uterus and ovary [212-215]. In the parturition, as its name implies (progestational steroid hormone), progesterone is crucial for establishing and maintaining pregnancy. In 1956, Csapo proposed a hypothesis about “progesterone block” which suggested that parturition was initiated by the withdrawal of the progesterone block [216]. This hypothesis was confirmed in most laboratory animals such as rats, mice, rabbits, goats, cows and sheep, in which peripheral progesterone levels dramatically decrease before the onset of labour. The phenomenon is called “the systemic withdrawal of progesterone”, accompanied by a concurrent increase in estrogen concentration. By contrast, in humans, non-human primates, and guinea pigs, maternal, fetal and amniotic progesterone levels remain elevated throughout pregnancy (Table 1-1) until the placenta is expelled suggesting that systemic progesterone withdrawal is not a prerequisite for labour at term [217-221].
Table 1-1 Source of steroids and mechanisms for progesterone withdrawal before parturition in several species.
Adapted from Romero, R., et al., BJOG, 2006. 113 Suppl 3: p. 17-42 [35].
Such difference is, at least in part, due to the different place of progesterone production. In most of those animal species, progesterone is produced principally by the corpus luteum and the onset of parturition is caused by the regression of the corpus luteum mediated by PGF2α. As shown in the FP knockout mouse, it has no corpus luteum lysis and consequently no progesterone withdrawal and fails to deliver at term [222]. Conversely, lutectomy or oophorectomy leads to abortion or the initiation of parturition. In other animal species like sheep and cow, rather than the corpus luteum, the placenta becomes the dominant source of progesterone in late pregnancy; therefore the mechanisms responsible for the switch in the progesterone to estrogen ratio are different. In sheep, for example, there is a remarkable increase in fetal adrenal cortisol production at term due to the activation of the fetal
- 38 - Chapter 1: Introduction hypothalamic-pituitary-adrenal axis, which not only stimulates the maturation of key fetal organs such as lungs and liver but also induces 17α-hydroxylase activity in the ovine placenta. Consequently, progesterone is converted to androstenedione rapidly causing progesterone withdrawal while estrogen biosynthesis rises (Figure 1-8).
Figure 1-8 Early steps of sex steroid biosynthesis.
Pregnenolone and progesterone are converted to their 17-hydroxy forms by 17α-hydroxylase. It also converts 17- hydroxypregnenolone and 17-hydroxyprogesterone to DHEA and androstenedione, respectively. Adapted from Pandey, A.V., S.H. Mellon, and W.L. Miller, J Biol Chem, 2003. 278(5): p. 2837-44 [223].
In the human, progesterone is also mainly generated by corpus luteum until between 7 and 8 weeks of gestation. In this period, either lutectomy or administration of progesterone receptor antagonist (RU486) is able to induce abortion [224, 225]. This suggests that in the early human pregnancy progesterone action is similar to that of those laboratory animals. In later pregnancy, progesterone production is taken over by placenta. However, the human placenta does not express 17α-hydroxylase, which excludes this as a potential mechanism for a systemic progesterone withdrawal. As mentioned above, although progesterone withdrawal has already been proved in many animal species, it is still unclear how it occurs in human parturition, but it seems likely that this is achieved through a functional progesterone withdrawal.
The effect of progesterone is mediated through its receptors (PRs), which act via genomic and non-genomic pathways (Figure 1-9).
- 39 - Chapter 1: Introduction
Figure 1-9 Schematic model of the genomic and non-genomic pathways by which steroid hormones affect contractility of the human pregnancy myometrium.
Adapted from Mesiano, S. and T.N. Welsh, Semin Cell Dev Biol, 2007. 18(3): p. 321-31 [226].
In the genomic pathway, several putative mechanisms have been proposed and will be discussed in the following sections including quantitative changes in PR isoforms, post-translational modifications on PR isoforms and their co-factors, alterations of PR co-regulators and co-chaperones in the steroid receptor complex, and interaction with other transcription factors. Other potential mechanisms have also been suggested: (1) reduction of the amount of free active progesterone by binding to a high affinity protein [227, 228]; (2) conversion of progesterone to an inactive form [229, 230]; (3) competition between progesterone and cortisol for binding to GR in the late pregnancy [231]. For the non-genomic progesterone actions, progesterone and its metabolites exert more rapid and direct effects and interact with a family of membrane PRs (mPRs), progesterone receptor membrane components (PGRMCs), nuclear PRs, OTR and gamma-aminobutyric acid (GABA) type A receptor to modulate myometrial cells contractility by controlling intracellular signalling pathways [226, 232, 233].
1.5.2. Genomic progesterone actions in functional progesterone withdrawal
1.5.2.1. Changes in the expression of PR isoforms
- 40 - Chapter 1: Introduction
In humans, genomic progesterone actions are mediated by the classic nuclear PRs, which are activated as transcriptional factors upon ligand binding. PR exists as two major isoforms, PR-A (~94 kDa) and PR-B (~116kDa), both of which are encoded by a single gene but independently regulated by two distinct promoters [234, 235]. PR-A is a truncated form of PR-B lacking the first 164 N-terminal amino acids, where the activator element 3 (AF3) is located [236]. As a result, PR-B is the principal transcriptional activator of progesterone responsive genes whereas PR-A is predominantly a transcriptional repressor [237-239]. Besides these two main isoforms, the existence and function of other truncated forms of PR, such as PR-C, have been proposed [240-245]. Thus, the subtype and the expression level of these PR isoforms may lead to different progesterone responsiveness. To address this hypothesis, a number of groups have investigated the levels of PR in non-pregnant and pregnant myometrium at different gestational age and indicated that there was an increase in the myometrial PR-A/PR-B expression ratio at the onset of labour [246-251]. However, the mechanisms of triggering this change are not very clear except that certain factors such as PGE2, PGF2α, and TNF-α may be involved [247, 250-252].
1.5.2.2. PR transcriptional activity is regulated by post-translational
modifications
There is increasing evidence suggesting that in order to control the activation of PR, some post-translational modifications play an essential role in either ligand-dependent or ligand-independent manner (Figure 1-10). These modifications include phosphorylation, sumoylation, ubiquitination, methylation and acetylation [253-258]. These covalent modifications can act individually or in a particular combination, which leads to functionally distinct activities. 14 serine residues in PR-B are known to be phosphorylated: 1 Casein kinase II site, 3 mitogen-activated protein kinases (MAKP) consensus sites, 8 cyclin-dependent kinase 2 (CDK2) sites and 2 unknown kinases sites [259]. Differential phosphorylation of PR-B alters its transcriptional activity [260-263], protein complex formation and target-gene specificity [254, 255, 263-268]. Some of the phosphorylation sites have been well-characterized in breast cancer cells, particularly Serine 294, 345 and 400 [269].
- 41 - Chapter 1: Introduction
Figure 1-10 Post-translational modification of PR results in the regulation of specific subpopulations of PR genes.
Different modifications of PR differentially regulate gene expressions. Upon ligand binding, three different post- translationally modified populations of PR can be generated. Besides the classical ligand-bound PR which recognizes PRE in the gene promoter region (PR-1), sumoylated PR at Lys388 and phosphorylated PR at Ser345 can also activate gene transcription at selected promoters (PR-2 and PR-4). In response to growth factors, such as EGF, activated MAPK signaling induces PR phosphorylation at Ser294 and desumoylation at Lys388 (PR-3). Phosphorylated PR by CDK2 results in increased liganded and unliganded PR activity on unknown PR target-gene promoters (PR-5). Adapted from Dressing, G.E., et al., Endocr Relat Cancer, 2009. 16(2): p. 351-61 [270].
1.5.2.3. Alterations of PR co-chaperones and co-regulators
In the absence of ligand, the receptor is transcriptionally inactive, sequestered in a large complex with heat shock proteins and other chaperone proteins; these are responsible for maintaining unliganded PR in such a state as to allow ligand binding and nuclear transport. Various in vitro studies have investigated which components of the cytoplasmic complex are essential for PR function. Minimal requirement of chaperones and co-chaperones in the PR complex are heat shock proteins Hsp40, Hsp70, Hsp90, Hsc70/Hsp90-organizing protein (Hop) and p23, which also requires adenosine triphosphate (ATP) as an energy resource [271-273]. Assembly of steroid receptor with chaperones occurs in an ordered, step-wise fashion. But this minimal five-protein system lacks the dynamics of the complete PR complexes. Therefore, other possible co-chaperones known to exist in native receptor complexes including FK506 binding protein (FKBP)51, FKBP52, BCL2-associated athanogene (Bag1), protein phosphatase 5, Hsc/Hsp70-interacting protein (Hip) and cyclophilin 40 are also required for optimal PR activity in different situations. Animal studies have - 42 - Chapter 1: Introduction revealed the physiological importance of FKBP52 in reproductive processes. Female FKBP52 knockout mice with normal PR expression and circulating progesterone levels display infertility as a result of uterine progesterone resistance [274, 275]. However, progesterone supplementation is able to rescue implantation and even achieve full-term pregnancy with a higher dose depending on the genetic background of the mouse [275]. On the other hand, there are no similar reproductive abnormalities in FKBP51-null mice. However, FKBP51 shows its importance by inhibiting glucocorticoid receptor (GR) hormone-binding affinity and glucocorticoid resistance [276, 277]. Its expression is highly inducible by glucocorticoid, progestin, and androgen [278, 279], suggesting a feedback mechanism for preventing tissue from secondary hormone exposures. Given the close relationship but opposing effect of FKBP51 and FKBP52, understanding the mechanisms by which FKBP co-chaperones selectively elevate or inhibit hormone binding affinity may lead to novel insights into steroid signaling pathways [280].
Upon ligand binding, the receptor undergoes a distinct conformational change, resulting in the dissociation of a monomeric receptor from the heat shock protein complex. Ligand-bound receptors then dimerise and translocate into the nucleus where they bind to specific response elements in the promoter region of target genes to modulate transcription. The DNA-bound receptor can then either positively or negatively drive target gene transcription depending on the co-regulatory proteins involved in the receptor multiprotein complexes. These co-regulators can be divided into two families: co-activators or co-repressors, depending on whether they act to enhance or suppress transcriptional activity [237]. In some conditions, co-regulators such as steroid receptor coactivator-2 (SRC-2) [also called glucocorticoid receptor interacting protein 1 (GRIP-1)] can transform their roles from one to the other according to the different intracellular conditions [237, 281-283]. Some other co- regulatory proteins can also remodel chromatin by catalyzing histones acetylation which opens the chromatin in order to increase access of the transcription complex into DNA [240, 244]. Thus, genomic responsiveness of myometrial cells to progesterone will be determined partially by the amount of PR expression and the cohort of co-regulators.
1.5.2.4. PR interacts with other transcription factors
- 43 - Chapter 1: Introduction
Another possible mechanism of progesterone “functional withdrawal” is the interaction between PR and other transcription factors such as NF-κB, AP-1 and C/EBP. These transcription factors function to up-regulate inflammatory response pathways and might impair PR activity. There is increasing evidence to suggest that both term and preterm labour are associated with an inflammatory response within the maternal uterus and cervix and that uterine quiescence during most of pregnancy is maintained by the anti-inflammatory actions of progesterone acting via PR. In other words, the balance between PR and pro-inflammatory transcription factors will, at least in part, determine the balance between uterine quiescence and contractility. Once initiated, the inflammatory response can be amplified by the release of further chemokines either in response to the inflammatory cytokines or mechanical stretch [87, 284] resulting in further infiltration of the myometrium, cervix, and fetal membranes by neutrophils and macrophages [64, 109, 134]. This process leads to local activation of NF-κB, which promotes the expression of labour-associated genes, including the FP [285], the gap junction protein connexin 43 [61], matrix metalloproteinase (MMPs) [286], the OTR [200], and COX-2 [176, 287]. Moreover, a negative interaction between the RelA (p65) subunit of NF-κB and PR was found in HeLa 229 and COS-1 cells, which suggests that the attenuation of PR function leading to labour may be due to their direct interaction [288]. Another possibility suggested by Condon et al. is that NF-κB contributes to a functional progesterone withdrawal by increasing PR-C expression [289]. Coversely, PR has also been shown to block NF- κB activation in human fundal myometrial cells and breast cancer (T47D) cells [290].
AP-1 activity was stimulated by unliganded PR, which cannot translocate into the nucleus by itself, suggesting a potential interaction between PR and the Jun/Fos complex in endometrial adenocarcinoma cells [291]. The C/EBP family of transcription factors is composed of six functionally related basic leucine zipper binding proteins (C/EBP, , , , ε and ). C/EBPβ contains two isforms: the full- length activator liver-enriched activatory protein (LAP) and the truncated inhibitor liver-enriched inhibitory protein (LIP), which can form heterodimers with PR-B as well as PR-A in vitro and either modulate expression of C/EBPβ-depended genes or activate progesterone response element (PRE)-driven promoters [292]. C/EBPδ was found to be up-regulated by PR-B only in human breast cancer cells [293]. In our
- 44 - Chapter 1: Introduction previous study, we found that stretch of myometrial cells reduced the expression of PR-B, which is associated with activation of both C/EBPβ and AP-1 [85, 279].
1.5.3. Non-genomic progesterone actions in functional progesterone
withdrawal
It has been known for many years that progesterone can act via the non-genomic pathway. Recently, a new family of membrane-bound PRs has been identified [294]. They are unrelated to nuclear PRs but related to G-protein coupled receptors, which have seven transmembrane regions. Three members (mPRα, -β, and γ) have been mainly studied and found to be expressed in human gestational tissues, such as myometrium, amnion, placenta and chorion [295]. However, the regulation of their expression and function in the uterus are still controversial as the results from several research groups are inconsistent [295-298]. Another group of progesterone transmembrane receptors whose structures are different from both nuclear PRs and mPRs contain two members: PGRMC-1 and -2. Animal studies suggest that their expression appears to be under the control of ovarian steroids. In granulosa cells, it has been found that the interaction of PGRMC-1 and serpine1 mRNA binding protein 1 (SERBP1) is required for the cell surface translocation of PGRMC-1 and this protein complex activates protein kinase G and decreases intracellular Ca2+ level upon progesterone binding [299]. The information regarding the biological function of PGRMC-2 is much less compared with PGRMC-1 and its ability to bind progesterone has not been assessed yet. Interestingly, nuclear PRs may also mediate some of non- genomic progesterone actions suggested by the fact that both PR-A and PR-B contain proline-rich SH3 binding region in their N terminus. This region is able to activate the Ras/Raf-1/MAPK pathway upon ligand binding [300]. Collectively, although none of the reported non-genomic PRs have been characterized in-depth and they seems to make the progesterone actions more complicated, it meanwhile increases the possibilities of understanding the progesterone regulation in pregnancy.
1.5.4. Cross-talk between steroid receptors and NF-κB
A number of studies have shown that liganded steroid receptors, especially progesterone receptor and glucocorticoid receptor, are able to inhibit the activity of NF-κB, which plays an essential role of controlling genes involved in inflammation, cell proliferation and apoptosis. This suggests the involvement of steroid receptors - 45 - Chapter 1: Introduction and NF-κB in human parturition, which is resembles an inflammatory process. As we discussed in the previous sections, the cross-talk between PR and NF-κB may have a biological significance in maintaining the uterus quiescence during pregnancy and initiating “functional” progesterone withdrawal before the onset of labour.
Given that progesterone not only activates PR, but also binds GR, although the affinity of progesterone for GR is much less than that of cortisol, some of progesterone actions might be mediated via GR. Generally, cortisol is the most important human glucocorticoid, which is the specific ligand for GR and plays anti- inflammatory effects. Unlike progesterone, cortisol does not bind to PR at physiologic concentrations [301]. In primary cultured trophoblast cells from full-gestation placentas obtained at selective cesarean section, the expression of PR is hardly detected and the inhibitory effect of progesterone on CRH is suggested to be mediated through GR [231]. This may provide an explanation for the elevated CRH level at the end of human gestation as increased cortisol in the late pregnancy can compete with progesterone for binding to GR in order to up-regulate CRH expression. Thus, there is a possibility that the cross-talk between GR and NF-κB may be also involved in human pregnancy.
The mechanisms of this cross-talk have been extensively explored due to its clinical relevance in inflammation. Many potential mechanisms have been proposed as researchers realised that studies cannot be limited to these two proteins. Beyond a simple physical interaction between GR and NF-κB, more complex intracellular processes are involved, these can be grouped into two categories: nuclear models and cytoplasmic models [302].
1.5.4.1. Nuclear models
The physical interaction between GRα and NF-κB was first demonstrated in vivo in a lung epithelial cell line [303], which was thought to be an explanation for their mutual effects as the interaction could block each other’s DNA-binding functions. However, the subsequent studies showed that their binding could also occur in the cytoplasm [304] and GR-mediated repression on NF-κB did not disrupt its binding to the response element in the promoter region [305]. Rather, the recruitment of the polymerase II Ser2 C-terminal domain phosphorylating kinase pTEFb might be a prerequisite for GR repression mechanism [306]. As an important part of steroid
- 46 - Chapter 1: Introduction hormone receptor complex, some co-modulators can also bind with NF-κB, such as CREB-binding protein (CBP)/p300, nuclear receptor co-repressor (NCoR), and silencing mediator for retinoid and thyroid-hormone (SMRT), suggesting that they may have a role in the GR-NF-κB cross-talk. Based on this, Sheppard et al. hypothesize that the competition between GR and NF-κB for limited amounts of CBP/p300 could be one of the GR repression mechanisms [307]. Recently, another study showed that GRIP-1, which can bind with GR, was also recruited to the GR-p65 complex facilitating the trans-repression effect of GR on NF-κB-driven COX-2 expression [308]. In another study, histone acetylation played a role in the regulation of inflammatory genes, because histone deacetylase 2 (HDAC2) was recruited by activated GR to switch off NF-κB-driven gene expression [309].
1.5.4.2. Cytoplasmic models
At least three intracellular signalling pathways have been demonstrated to be involved in this model: nuclear factor-kappa B inhibitor α (IκBα), MAPK phophatase-1 (MKP- 1) and protein kinase A (PKA). Although there is no classical glucocorticoid response element in the promoter of IκBα, glucocorticoid could induce IκBα expression, which down-regulates NF-κB-driven genes by blocking NF-κB’s nuclear translocation. But this is not a universal mechanism as the induced up-regulation of IκBα is strictly cell type-dependent. MAPK pathways are also affected by glucocorticoid because in certain cell types including myometrium cells, MKP-1 can be up-regulated by glucocorticoid via GR [310, 311]. MKP-1 inactivates MAPK-dependent NF-κB trans- activation by dephosphorylating and inhibiting extracellular-signal-regulated kinases (ERKs) and p38 MAPK activities [310, 312]. Besides the influence on NF-κB-driven genes transcription, the stabilization of pro-inflammatory gene mRNAs (such as COX-2, IL-6 and IL-8) is also impaired by MKP-1 [312]. Another signalling pathway implicated in the GR-NF-κB cross-talk is PKA pathway, which is responsible for the phosphorylation of p65 at Ser-276. This phosphorylation has been found be to required for p65-mediated repression of GR-dependent transcription [313].
Collectively, although several mechanisms have been proposed, none of them seems to be universal and they occur in a cell/tissue- and promoter-specific manner. Moreover, in the natural condition, since GR and NF-κB are shuttling between
- 47 - Chapter 1: Introduction nucleus and cytoplasm, both models may exist dynamically and more than one mechanism may be employed in their cross-talk [308].
1.6. Summary and hypotheses
Prematurity in human parturition is still a puzzle, although many factors have been discovered as causes of preterm birth (Figure 1-11). It is important to understand and elucidate the molecular mechanisms hidden behind parturition despite the requirement of intense research. By manipulating key regulators in the labour processes, we may have a better chance of preventing or substantially reducing the rates of preterm birth.
Figure 1-11 Molecular signaling in parturition.
The normal timing of parturition is regulated by coordinated signaling through progesterone and estrogen. Stretch signaling affects the endocrine stimulation and the balance of progesterone and estrogen, especially multiple pregnancy increases the effect of mechanical stimulation. Prematurely preterm labor occurs if the normal programming is disrupted by pathological conditions, such as premature uterine stretch, inflammation or cervical aberration, or some combination of these factors. Adapted from Hirota, Y., J. Cha, and S.K. Dey, Nat Med, 2010. 16(5): p. 529-31 [314].
In this study, progesterone action was mainly investigated in two contexts: i. Clinically, progesterone administration only reduces the preterm labour rate in singleton pregnancies but is insufficient in multiple pregnancies. Our stretch model will be employed to study the mutual effects between progesterone and mechanical
- 48 - Chapter 1: Introduction stretch in uterine smooth muscle cells (USMCs). I hypothesise that progesterone does not affect stretch-induced cell signalling and gene expression, while stretch impairs progesterone action which may contribute to the progesterone functional withdrawal. ii. In humans, the onset of preterm labour is often associated with increased inflammatory and immune responses and altered prostaglandin synthesis driven by COX-2. It has been suggested that progesterone exerts its anti-inflammatory effects partially by down-regulating COX-2 expression. Therefore, it is important to understand how IL-1β impairs progesterone action and how progesterone reduce the IL-1β-induced COX-2 expression. I hypothesise that their mutual negative effects are mediated by the interaction between progesterone receptor and NF-κBp65.
- 49 - Chapter 2: Material and Methods
Chapter Two: Materials and Methods
- 50 - Chapter 2: Material and Methods
2. Materials and Methods
2.1. Materials
2.1.1. Chemicals, Reagents and Solvents
Absolute Ethanol: Fisher Scientific
Acrylamide: Roche
Agarose: Invitrogen
Ammonium Persulphate (APS): BDH
Ampicillin: Sigma-Aldrich
β-Mercaptoethanol: Sigma-Aldrich
Bench top protein marker: Invitrogen
Blot Qualified BSA: Promega
Bovine Serum Albumin (BSA): Sigma-Aldrich
Bromophenol Blue: Bio-Rad
Coelenterazine: CalBiochem
CaCl2: Sigma-Aldrich
Coomassie Brilliant Blue R250: Bio-Rad
Deoxynucleotide triphosphate (dNTP): Invitrogen
Dimethyl Sulfoxide (DMSO): Sigma-Aldrich
Dithiothreitol (DTT): Bio-Rad
DNA Ladders: Invitrogen
DNA loading dye: Invitrogen
Ethidium Bromide: Bio-Rad
- 51 - Chapter 2: Material and Methods
Ethylenediaminetetraacetic Acid (EDTA): Sigma-Aldrich
FuGENE 6 Transfection Reagent: Roche
Genejuice Transfection Reagent: Novagen
Glycerol: BDH
HEPES: Sigma-Aldrich
IPTG: Sigma-Aldrich
Isopropanol: Fisher Scientific
Kanamycin: Sigma-Aldrich
KCl: Sigma-Aldrich
LB-Agar: VWR
LB-Broth: VWR
Methanol: Fisher Scientific
MgCl2: Sigma-Aldrich
NaCl: Sigma-Aldrich
NaOH: Sigma-Aldrich
Oligo-dT random primers: Applied Biosystems
Oligonucleotides and primers: Invitrogen
Peptone: Sigma-Aldrich
RNaseZap: Ambion
Skimmed Milk Powder: Marvel
S.O.C. media: Invitrogen
SYBR Green Reagents: Applied Biosystems
SYBR Safe: Invitrogen
- 52 - Chapter 2: Material and Methods
TEMED: Sigma-Aldrich
Tris Base: Sigma-Aldrich
Triton X-100: Sigma-Aldrich
Tween 20: Sigma-Aldrich
2.1.2. Antibodies
2.1.2.1. Primary antibodies
AP-1 c-Fos: Cell Signaling, 4384
AP-1 c-Jun: Cell Signaling, 9165
α-tubulin: Santa Cruz Biochemicals, SC-8035
β-actin: Abcam, Ab6276
C/EBPβ: Cell Signaling, 3087
C/EBPδ: Santa Cruz Biochemicals, SC-636
COX-2: Santa Cruz Biochemicals, SC-1745
GR: Santa Cruz Biochemicals, SC-1003
GR (NR3C1 mAb): Abnova, MAB0119
GRIP-1: Millipore, 07-1799
Halo Tag: Promega, G9281
HSD11β1: Abcam, ab83522
PR: Leica, NCL-PGR-312
NF-κB p65: Santa Cruz Biochemicals, SC-8008
NF-kB p65- CHIP Grade: Abcam, ab7970
Phospho-NF-kB p65 (Ser536): Cell Signaling, 3031
Strep Tag: Qiagen, 34850
- 53 - Chapter 2: Material and Methods
TATA binding protein: Abcam, ab818
2.1.2.2. Secondary antibodies
Donkey anti-Goat: Santa Cruz Biochemicals, SC-2020
Anti-mouse IgG, HRP-linked Antibody: Cell Signaling, 7076
Anti-rabbit IgG, HRP-linked Antibody: Cell Signaling, 7074
2.1.3. Buffers, Solutions and Gels
TE buffer
100mM Tris-HCl, pH8.0
1mM EDTA, pH8.0
Cytosolic Buffer A
10 mM HEPES
10 mM KCl
0.1 mM EDTA
0.1 mM EGTA
2 mM DTT
1 % (v/v) NP-40
Complete protease inhibitor tablets (Roche)
Nuclear Buffer B
10 mM HEPES
10 mM KCl
0.1 mM EDTA
0.1 mM EGTA
2 mM DTT
- 54 - Chapter 2: Material and Methods
400 mM NaCl
1 % NP-40 (v/v)
Complete protease inhibitor tablets (Roche)
Polyacrylamide stacking gels
125mM Tris-HCl, pH6.8
5% Acrylamide/Bis
1% SDS
1% Ammonium persulfate
0.1% TEMED
Phosphate Buffered Saline (PBS)
140mM NaCl
2.5mM KCl
1.5mM KH2PO4, pH 7.2
10mM Na2HPO4, pH7.2
Tris Buffered Saline (TBS)
130mM NaCl
20mM Tris-HCl, pH7.6
Adjusted to pH7.4 with HCl
TBS-Tween 20 (TBS-T)
0.1% Tween 20 in TBS
Western Blocking Buffer
5% (w/v) non-fat milk in TBS-T
Western Antibody Incubation Buffer
- 55 - Chapter 2: Material and Methods
1% (w/v) non-fat milk in TBS-T co-IP Lysis buffer
5 ml 10% Triton X100 (or NP40) or 500 ul neat (final concentration 1%)
1.5 ml NaCl (final concentration 150 mM)
2.5 ml 1M Tris-HCl, pH 7.4 (Final concentration 50mM)
100 ul 0.5M EDTA (final concentration 1mM)
10% Glycerol
Make up to 50ml with water
Add standard protease (1 tablet into 10 ml) and phosphatise (1:100) inhibitors immediately before use co-IP IP buffer
Lysis buffer without Glycerol
CHIP Szak RIPA buffer
150mM NaCl
1%v/v Nonidet P-40
0.5% w/v deoxycholate
0.1% w/v SDS
50mM Tris-HCl, pH 8.0
5mM EDTA
Add standard protease (1 tablet into 10 ml), phosphotase (1:100) inhibitors, and 0.5 mM PMSF immediately before use (can also supplement with HDAC inhibitors)
CHIP Low-salt buffer
150mM NaCl
- 56 - Chapter 2: Material and Methods
0.5% Na deoxycholate
0.1% SDS
1% Nonidet P-40
1 mM EDTA, pH 8.0
50mM Tris-HCl, pH 8.0
CHIP High-salt buffer
500mM NaCl
0.5% Na deoxycholate
0.1% SDS
1% Nonidet P-40
1 mM EDTA, pH 8.0
50mM Tris-HCl, pH 8.0
CHIP Elution buffer
1% SDS
100 mM NaHCO3
2.1.4. Cell culture materials and media
Cell strainer (2 mm): Falcon
Collagenase XI or 1A: Sigma-Aldrich
Dulbecco’s Modified Eagles’ Medium: Sigma-Aldrich
Fetal Bovine Serum: Sigma-Aldrich
Filter Unit (0.20 μM): Sartorius
L-glutamine: Sigma-Aldrich
Nutrient Mixture F-12 Ham: Sigma-Aldrich
- 57 - Chapter 2: Material and Methods
Penicillin/Streptomycin: Sigma-Aldrich
Tissue Culture Plastic-ware: Corning, Falcon, Orange
Trypsin/EDTA: Sigma-Aldrich
6-well flexible-bottom plates: Flexcell International Corp.
2.1.5. Competent cells
Escherichia coli DH5α: Invitrogen
Escherichia coli TOP10: Invitrogen
2.1.6. Enzymes
Ampli-Taq Gold DNA Polymerase: Applied Biosystems
DNase I (RNase-free): Qiagen
MuLV reverse transcriptase: Applied Biosystems
Pfu DNA Polymerase: Promega
Restriction enzymes: New England Biolabs and Promega
T4 DNA Ligase: Promega
2.1.7. Inhibitors and Treatments
CDK Inhibitor roscovitine: CalBiochem
CDK2 Inhibitor II: CalBiochem
Complete Protease Inhibitors: Roche
ERK Inhibitor U0126: Sigma-Aldrich
JNK Inhibitor SP600125: Sigma-Aldrich p38 Inhibitor SB203580: Sigma-Aldrich
Halt Phosphatase Inhibitor Single-Use Cocktail Thermo
Interleukin 1β (IL-1β): Sigma-Aldrich
- 58 - Chapter 2: Material and Methods
Medroxyprogesterone Acetate (MPA): Sigma-Aldrich
Org31710: N.V. Organon
Progesterone: Sigma-Aldrich
RU486: Sigma-Aldrich
Trichostatin A (TSA): Sigma-Aldrich
2.1.8. Kits
Amaxa Nucleofector Kit: Lonza cDNA synthesis and SYBR Green for qPCR: Applied Biosystems
DNA Maxiprep/Miniprep Kit: Qiagen
Endofree Plasmid Kits: Qiagen
GenElut Gel Extraction Kit: Qiagen
MinElute Reaction Clean-up kit: Qiagen
NucBuste Protein Extraction Kit: Novagen
QIA quick PCR purification kit: Qiagen
RNeasy mini Kit: Qiagen
SteadyLite Plus Kit: PerkinElmer
Wizard SV Gel and PCR Clean-Up System: Promega
2.1.9. Plasmids pcDNA AP-1 c-Jun: Dr B. Gellersen, Hamburg, Germany pcDNA AP-1 c-Fos: Dr B. Gellersen, Hamburg, Germany pCS2: Prof. C. Lange, Minneapolis, USA pCS2-CDK2-TY: Prof. C. Lange, Minneapolis, USA pFC14A: Promega
- 59 - Chapter 2: Material and Methods pFC14A-PR-A: self-cloned pFC14A-PR-B: self-cloned pFN21A: Promega pFN21A-PR-A: self-cloned pFN21A-PR-B: self-cloned pFN22K: Promega pFN22K-PR-A: self-cloned pFN22K-PR-B: self-cloned pGL4: Promega pGL4-C/EBP: Dr S. Khanjani, Imperial College London, UK pHT2: Dr M. Christian, Imperial College London, UK pTAL-Luc: Clontech pAP-1-Luc: Clontech pNF-κB-Luc: Clontech pPRE-Luc: Dr B. Gellersen, Hamburg, Germany pQE-p65: Dr S. Khanjani, Imperial College London, UK pRL-CMV: Promega pRL-SV40: Promega pSG5: Dr J.White, Imperial College London, UK pSG5-PR-A: Dr P. Chambon, Strasbourg, France pSG5-PR-B: Dr P. Chambon, Strasbourg, France pSG5-PR-B(S294A): Prof. C. Lange, Minneapolis, USA pSG5-PR-B(S345A): Prof. C. Lange, Minneapolis, USA
- 60 - Chapter 2: Material and Methods pSG5-PR-B(S400A): Prof. C. Lange, Minneapolis, USA pSG5-PR-C301: Dr Y. Lee, Imperial College London, UK pSG5 C/EBPβ LAP: Dr B. Gellersen, Hamburg, Germany pSG5 NF-κB p65: Dr J J.White, Imperial College London, UK
2.1.10. SDS-PAGE electrophoresis and Western blotting materials
Cell Lysis buffer: Cell Signaling
ECL Plus Western Blotting Detection System: GE Healthcare
ECL hperfilm: Amersham Biosciences
Hybond ECL Nitrocellulose membrane: Amersham Biosciences
Novex Sharp Pre-stained Protein Standard: Invitrogen
NuPAGE LDS Samples buffer: Invitrogen
NuPAGE MOPS SDS running buffer: Invitrogen
SDS PAGE pre-cast gels: Invitrogen
SuperSignal West Pico Chemiluminescent Substrate: Pierce
Transfer buffer: Bio-Rad
2.1.11. siRNA and shRNA
DHARMAFECT 2 transfection reagent: Dharmacon, T-2002-0
ON-TARGET plus Non-Targeting siRNA: Dharmacon, D-001810-01-05
ON-TARGETplus SMARTpool for C/EBPβ: Dharmacon, L-006423-00-0005
ON-TARGETplus SMARTpool for C/EBPδ: Dharmacon, L-010453-00-0005
ON-TARGETplus SMARTpool for c-Fos: Dharmacon, L-003265-00-0005
ON-TARGETplus SMARTpool for c-Jun: Dharmacon, L-003268-00-0005
ON-TARGETplus SMARTpool for RelA: Dharmacon, L-003533-00-0005
- 61 - Chapter 2: Material and Methods
ON-TARGETplus SMARTpool for AR: Dharmacon, L-003400-00-0005
ON-TARGETplus SMARTpool for GR: Dharmacon, L-003424-00-0005
ON-TARGETplus SMARTpool for PR: Dharmacon, L-003433-00-0005
ON-TARGETplus SMARTpool for GRIP-1: Dharmacon, L-020159-00-0005
ON-TARGETplus SMARTpool for HSD11β1: Dharmacon, L-009910-00-0005
HuSH shRNA Cloning Vector (pRS Vector): OriGene, TR20003
Non-effective 29-mer scrambled shRNA cassette: OriGene, TR30012
HuSH 29mer shRNA Constructs against PGR: OriGene, TR320455
HuSH 29mer shRNA Constructs against PGR-B: OriGene, custom designed
2.2. Methods
2.2.1. Tissue specimens
Biopsies (0.5×0.5×0.5 cm3) of term human myometrium were collected from the upper margin of uterine incision at the time of caesarean section in Dulbecco’s modified Eagle’s Medium (DMEM, Invitrogen) medium containing 100 mU/ml penicillin and 100 µg/ml streptomycin. Samples were stored at 4˚C for no more than 3 h prior to cell preparation for culture. All specimens were obtained after fully informed, written patient consent.
2.2.2. Primary cell culture
Myometrial tissue was washed in phosphate-buffered saline (PBS) and finely dissected. Tissue samples were then digested for 1 h at 37˚C in a collagenase solution which contains 1 mg/ml collagenase 1A (Sigma) and 1 mg/ml collagenase XI (Sigma) in a mixed medium (50% DMEM and 50% Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 Ham, Invitrogen). Tissue pieces were suspended using a pasteur pipette and passed through a cell strainer (70 µm nylon cell strainer). Myocytes were then collected by centrifugation at 3000 rpm for 5 min and resuspended with DMEM medium containing 7.5% fetal calf serum, L-glutamine and 100 mU/ml penicillin and 100 g/ml streptomycin. After that cells were cultured in
- 62 - Chapter 2: Material and Methods
T25 in an atmosphere of 5% CO2:95% air at 37˚C.Myometrial cells grown in this manner have previously been characterized [87]. Myometrial cells from passage 3-4 were trypsinised in 0.25% trypsin containing 0.02% EDTA in PBS and cultured in 24- well, 6-well plates or flasks depending on the requirement. In some cases, at the end of the specified time, medium was removed and cells were frozen at -80˚C for the extraction of RNA, protein or the luciferase assay. In other cases, such as co- immunoprecipitation (co-IP), nuclear protein extraction and chromatin immunoprecipitation (CHIP), cells were harvested and processed directly after treatment.
Before treating the cells with different stimuli, old medium was removed and replaced with 2mL of fresh stripped medium (1% Charcoal and Dextran-stripped fetal calf serum, supplemented with L-glutamine, 100 mU/ml penicillin and 100 g/ml streptomycin) overnight. In some cases, cells were pre-incubated with 1µM RU486 (GR/PR antagonist, Sigma-Aldrich Company Ltd., Dorset, SP8 4XT), 1µM Org31710 (PR selective antagonist, N.V. Organ) for 2h or with 0.5µM Trichostatin A (HDAC inhibitor, Sigma-Aldrich Company Ltd., Dorset, SP8 4XT), 0.5µM sanguinarine (MKP-1 inhibitor, Tocris Cookson Ltd., Northpoint, Fourth Way, Avonmouth, Bristol, BS11 8TA) for 1h prior to other stimuli, such as IL-1β (5ng/mL), MPA (1µM), P4 (10µM) and Dex (1µM), either alone or in combination.
2.2.3. The stretch model
For mechanical stretch, cells were subjected to a static stretch of 11% for different periods using 6-well flexible-bottom plates which pre-coated with collagen type I (for more details, please see http://www.flexcellint.com/; Flexcell International Corp., McKeesport, PA). Unstretched cells grown and treated similarly were used as controls. In some cases, cells were pre-incubated with treatment like MAPK and CDK inhibitors for 1 h prior to stretch. Although this model is unable to directly reflect the difference of stretch strength between singleton and multiple pregnancies, it has been using for many years and shown to be a good method to study stretch-induced cell signaling and gene expression.
2.2.4. Whole-cell protein extraction
- 63 - Chapter 2: Material and Methods
Protein samples were prepared from monolayer myometrial cells by being lysed in Cell Lysis Buffer (Cell Signaling). The supernatant was separated from cell debris by centrifugation at 13,000×g for 20 min at 4˚C. Protein concentrations were determined by protein assay (Bio-Rad Laboratories, USA) and bovine serum albumin (BSA) reference standards. Samples were then aliquot and stored at -80˚C.
2.2.5. Cytosolic/nuclear protein extraction
Cells were harvested by trypsinization using a standard method as described before. The cell pellet was resuspended with buffer A and incubated on ice for 5-20 min. Lysates were vortexed for 10 sec at a high speed followed by centrifugation at 16,000×g for 30 sec at 4˚C. The supernatants were retained as the cytosolic protein extracts. The pellets were resuspended in buffer B, incubated for 15 min on ice with shaking (~200 rpm), and then centrifuged for 5 min at 16,000×g for at 4˚C. After the last centrifugation, the supernatant (nuclear extract) was transferred to a separate tube. It can be used immediately or stored in aliquots at -80˚C.
2.2.6. Western blot analysis
Electrophoresis was carried out on aliquots of protein samples that were denatured by adding NuPAGE LDS samples Buffer (Invitrogen) and heating for 10 min at 70˚C. Western blotting was performed following an electrophoretic transfer (126V for 95 min at 4˚C) onto a Hybond ECL nitrocellulose membrane (Amersham Pharmacia Biotech). Membranes were blocked in blocking buffer (1×TBST and 5% milk) for 1 h at room temperature, washed in 1×TBST and hybridized with the primary antibody over night at 4˚C. Membranes were washed again and then incubated with secondary antibody at a dilution of 1:2000 for 2 h at room temperature. SuperSignal West Pico Chemiluminescent Substrate (Pierce, USA) or ECL Plus was used for detection. Protein band size was determined using Novex Sharp Pre-stained Protein Standard (Invitrogen).
2.2.7. RNA extraction and qPCR
Total RNA was extracted and purified from myometrial cells grown in 6-well plates using RNeasy mini kit (Qiagen Ltd, UK). After quantification, 1.0 µg was reverse transcribed with oligo dT random primers using MuLV reverse transcriptase (Applied Biosystems Ltd, UK). Primer sets for PR and its co-modulators were designed and
- 64 - Chapter 2: Material and Methods obtained from Amersham Pharmacia Biotech. These primer sets produced amplicons of the expected size. Assays were validated for all primer sets by confirming that single amplicons of appropriate size and sequence were generated according to predictions. Quantitative PCR was performed in the presence of SYBR Green (Roche Diagnostics Ltd, UK), and amplicon yield was monitored by Rotor Gene R-G 3000 (Corbett Research, Australia) that continually measures fluorescence caused by the binding of the dye to double-stranded DNA. Pre-PCR cycle was 7 min at 95˚C followed by 35 cycles of 95˚C for 10 s and 72˚C for 10 s followed by final extension at 72˚C for 1 min. The cycle in which fluorescence reached a preset threshold (cycle threshold) was used for quantitative analyses. The cycle threshold in each assay was set at a level where the exponential increase in amplicon abundance was approximately parallel between all samples. For each set of primers, a standard curve was derived from a ten-fold dilution series of the concentrated DNA template. All mRNA abundance data were expressed relative to the amount of constitutively expressed GAPDH.
Table 2-1 Primer pair sequences with gene accession numbers
Genebank/EMBL Product Name Forward (F) and Reverse (R) primer sequence (5’-3’) Accession no. size (bp) COX-2 F: tgtgcaacacttgagtggct AY151286 297 R: actttctgtactgcgggtgg FKBP5 F: tccctcgaatgcaactctct NM_001145775 194 R: gccacatctctgcagtcaaa GAPDH F: tgatgacatcaagaaggtggtgaag BC014085 240 R: tccttggaggccatgtaggccat HSD11β1 F: accttcgcagagcaatttgt NM_005525 226 R: gccagagaggagacgacaac IL-8 F: gccttcctgattttgcagc NM_000584 150 R: cgcagtgtggtccactctca
MMP10 F: caaaatctgttccttcggga NM_002425 84 R: tctcccctcagagtgctgat OTR F: agaagcactcgcgcctctt NM_000916 102 R: aggtgatgtcccacagcaact PR-B F: aactcagcgagggactgaga X51730 151 R: gaggactggagacgcagagt PR-total F: agcccacaatacagcttcgag NM_000926 253 R: tttcgacctccaaggaccat ERRFI1 F: agccctctctctggatgaca NM_018948 238 R: tggaggaggatttggatctg DUSP1 F: cagctgctgcagtttgagtc NM_004417 161 R: aggtagctcagcgcactgtt ABCA1 F: taaatgcccagcacaattca NM_005502 213 R: catgacacatggctctttgg
- 65 - Chapter 2: Material and Methods
HSPA7 F: gaggtggagaggatggttca NR_024151 160 R: tgtcctcttcgggaatcttg IL33 F: acattgggcaaagttgcttc NM_033439 196 R: gcatccagaggtcaggtgat TNFRSF11B F: ggcaacacagctcacaagaa NM_002546 241 R: ctgggtttgcatgcctttat IL17A F: tccggctggagaagatactg NM_002190 152 R: ttgaaggatgagggttcctg IL1β F: gctgaggaagatgctggttc NM_000576 240 R: tccatatcctgtccctggag KCNE4 F: gctccaagttctgtgcttcc NM_080671 225 R: gttcagactaaccggccaaa UBQLN4 F: gagatcagccacatgctcaa NM_020131 218 R: aagggattgttgccaaactg AHSA2 F: tcaacgagttgaagcaggtg NM_152392 243 R: acagtcaattcctgggttgc HSD3β1 F: ccatgaagaagagcctctgg NM_000862 202 R: gttgttcagggcctcgttta EDA2R F: ccacatttgacactgctgct NM_021783 200 R: cacctccaattgctgaacct PPP1R8 F: aagaagcccacaccttcctt NM_014110 163 R: ggttaggatgccaggagaca KCNE2 F: cttgtgtgcaacccagaaga NM_172201 150 R: gtcttccagcgtctgtgtga
2.2.8. Transient transfections and luciferase assays
Cells were cultured in 24-well plates to about 80% confluence and then transfected by using Gene-Juice transfection reagent (Novagen) for DNA and DharmaFECT 2 (Dharmacon) for siRNA according to the manufacturer’s instructions. Expression constructs and reporter vectors were co-transfected at concentrations of 300 ng/well and SV40-Renilla vector (pRL-SV40, Promega) was used as an inner control for transfection efficiency at concentrations of 100 ng/well. The empty expression vector pSG5, pGL4 and pTAL-Luc were included as filler constructs so that the total amount of transfected DNA per well was constant. For knockdown experiments, siRNAs targeting C/EBPβ, C/EBPδ, c-Jun, c-Fos and p65 respectively were transfected. Non- targeting siRNA was used as control. Cells were treated 24 h post transfection with the specific stimulus or vehicle for another 24 h. Firefly luciferase activity was measured by using a dual firefly/renilla luciferase assay (Luclite, Packard Bell and Coelentrerazin CN Biosciences). All transfections were performed in triplicates. Results of luciferase activity was first normalized to the level of Renilla luciferase activity and then calculated as fold induction relative to either expression of vehicle- treated group, or the control empty expression vector.
- 66 - Chapter 2: Material and Methods
In order to transfect the USMCs with some expression vectors, shRNA or siRNA more efficiently, the Amaxa Nucleofector technology (Amaxa, Cologne, Germany) was used. Cells were harvested by trypsinization as described above. Approximately 1×106 cells were resuspended in 100 µl Nucleofector solution and mixed with 2 µg DNA or 30 pmol siRNA at room temperature. The cell/DNA or siRNA suspension was then transferred into certified cuvette and electroporated in the Nucleofector Cuvette Holder with the Nucleofector Program A-033. Immediately after electroporation, cells were suspended with 500 µl pre-warmed culture medium and gently transferred into 6-well plates or 10 cm petri dishes. The cells were incubated in a humidified 37˚C/5% CO2 incubator until analysis and change medium 16-18 h post Nucleofection.
2.2.9. Amplification of long PCR products
Polymerase chain reactions (PCR) were performed using DNA polymerase. A 50 μl reaction included 200 μM of each dNTP (dATP, dCTP, dGTP, dTTP), 50 nM (for the 50 μl reaction) of each sense and antisense primer, 20 ng template DNA, 1×PCR buffer containing 1-2 mM Mg2+ as supplied by the manufacturer, and 0.5 μl of Promega pfu Taq. DNA templates were initially denatured by heating the reaction to 95˚C for 2 min, the reaction mixture was then subjected to 35 thermo-cycles of 95˚C for 30 sec, primer annealing at between 60˚C for 30 sec, and primer extension at 72˚C for 5 min. This was followed by a final extension of 72˚C for 10 min. Final products were analysed by gel electrophoresis.
2.2.10. Agarose gel electrophoresis
Agarose gels of 1.5-2 % (w/v) were prepared by dissolving agarose in fresh 1×TBE and heating the suspension in a microwave oven until boiling. The solution was allowed to cool to approximately 50˚C, and poured into an appropriate gel mould after adding SYBR safe. Once set, the gel was submerged in 1×TBE buffer in a gel tank, and DNA samples containing 1×DNA loading buffer were loaded into the wells.
Electrophoresis was carried out at 120V for a variable time which depending on the size of DNA and previous experience. The size of the DNA fragments was estimated by comparing their relative mobility to that of restriction fragments of known size, typically 100 bp and 1 Kb markers. If the DNA was going to be purified, the gel was
- 67 - Chapter 2: Material and Methods visualized on a dark reader (Dark Reader transilluminator, Clare Chemical Research) and the band cut out using a scalpel.
2.2.11. DNA purification from agarose gel and concentration determination
DNA fragments were purified from agarose gels using the GenElute™ Gel Extraction Kit based on the manufacturer’s protocol. Briefly, the excised gel band was weighed and Gel Solubilisation Solution was added accordingly. The mixture was then incubated at 50-65˚C for 10 min, or until the gel slice was completely dissolved. 100 μl of isopropanol was added to the gel mixture per 100 mg of gel when the size of the target DNA fragment is less than 200 bp. After several washing steps, the column was placed in a fresh microcentrifuge tube and 50 μl ddH2O was applied to the column. The column was incubated at room temperature for 1-3 min and centrifuged for 1 min. All centrifugations were performed at 17000×g at room temperature.
DNA concentration was determined using a NanoDrop Nd-1000 spectrophotometer. 2 μl of sample was applied onto the hole of the measurement pedestal. Absorbance readings were taken at 230, 260 and 280nm. The A260:A280 ratio was expected to be in the region of 1.8 for DNA and 2.0 for RNA. If the ratio is much lower it may indicate protein contamination. The A260:A230 ratio of 2.0-2.2 was expected. If the ratio was lower it indicated possible contamination with substances, which absorb at 230 such as carbohydrates, EDTA and phenol.
2.2.12. Restriction enzyme digestion and ligation reaction
20 μl of DNA (50 ng/μl) was used for digestion, 5 μl of 10×restriction enzyme buffer,
1 μl of restriction enzyme (10 U/μl) and nuclease-free H2O to a total volume of 50 μl and incubated at 37˚C for 1-4 h. After the digestion, the reaction can be either run on an agrose gel to check the positive cloned constructs or purified by PCR purification Kit for further experiment, such as ligation.
Ligations were performed with 30-50 ng of purified DNA fragments and typically a 5:1 molar ratio of parental vector was used. A final volume of 10 μl containing 1×T4 DNA ligase buffer and 1 μl T4 DNA ligase (6 units). All reactions were incubated for 2 h at room temperature or overnight at 16˚C.
2.2.13. Colony PCR
- 68 - Chapter 2: Material and Methods
To rapidly find out the positive clone after ligation and transformation, colony PCR was performed. 20 μl of H2O was used to resuspend a colony picked from an agar plate. 5 μl was saved, so that if it is positive, it could be used to inoculate LB for the growth of minicultures, and the remaining 15 μl was heated for 5-10 minutes at 95˚C to lyse the cells. The samples were then centrifuged for 2 min at 16,000×g to remove any debris. 1 μl of the supernatant was used as template in a PCR reaction. Primers used in the cloning step were added into this reaction.
2.2.14. DNA sequencing and analysis
After the positive clone was selected, the plasmid was then sent off for sequencing, which is provided by MRC clinical sciences service, Imperial College London. The results were reported in the form of a consensus sequence and its associated chromatograms, and they were analyzed using DNAMAN software.
2.2.15. Co-immunoprecipitation (Co-IP)
All immunoprecipitation procedures were performed at 4˚C. Cells were harvested and washed twice with ice-cold PBS before lysis. Cells were lysed in lysis buffer. The lysate was pre-cleared by protein G-Agarose beads before the incubation with the antibody against the protein of interest or pre-immune IgG of the same species 1-2 h with rotation, 2% of the lysate was kept as input. This lysate/antibody mixture was subsequently incubated with protein G-Agarose beads for 1 h with rotation. The beads were pelleted by centrifugation at 1000×g for 30 sec and washed four times in IP buffer. The protein–antibody complexes that were released from beads by adding the loading buffer and heating at 70˚C for 10 min were subjected to Western blot analysis after separation by SDS–PAGE.
2.2.16. Chromatin immunoprecipitation
Cell monolayers in 10 cm dishes were treated with different stimuli after serum starvation overnight. Cells were washed with PBS, and cross-linked with 1% formaldehyde for 10 min at room temperature. 125 mM of Glycine was added and incubated for 5 min at room temperature to stop the cross-link reaction. Cells were washed twice with ice-cold PBS, scraped and pelleted at 200×g for 10 min at 4˚C. The cell pellets were resuspended with Szak RIPA buffer and incubated for at least 20 min on ice with occasional mix. While this cell lysates were sonicated, the antibody-
- 69 - Chapter 2: Material and Methods coupling dynabeads were prepared. 4 µg antibody against the protein of interest and preimmune rabbit polyclonal IgG were incubated with dynabeads for 2 h at 4˚C, respectively. The sonicated cell supernatant was diluted to 1 ml aliquots and incubated with dynabeads for 1 h at 4˚C to pre-clear. After pre-clear, 10% of cell lysates were kept as “input” positive control for the later qPCR analysis. The rest of pre-cleared cell lysates were incubated with antibody-coupling dynabeads for 2 h at 4˚C with rotation. The beads were collected with the tube on the magnet and the supernatant was discarded. The beads were washed with different buffer in the following order: 1× in Szak RIPA buffer, 2× in Low-salt buffer, 2× in High-salt buffer, and 2× in TE buffer. Each wash step was carried out with 1 ml buffer for 5 min at 4˚C with rotation. After the last wash, beads were finally incubated with Elution buffer for 15 min at room temperature to elute DNA-antibody complexes, and then collect the supernatant with the tube on the magnet. To each 120 µl eluants, 2 µl of 0.5 mg/ml RNase A and 6 µl of 5 M NaCl were added. These eluants were then incubated overnight at 65˚C with shaking to reverse the cross-links. The DNA was finally purified using QIA quick PCR purification kit according to manufacturer’s instructions, and the target sequences was amplified by qPCR with the following specific oligonucleotide primers:
Proximal NF-κB site (NF-κB 1) on COX-2 promoter (-223 to -214):
Forward primer: 5’-AGGAGAGGGAGGGATCAGAC-3’
Reverse primer: 5’- GACTGTTTCTTTCCGCCTTT-3’
Distal NF-κB site (NF-κB 2) on COX-2 promoter (-446 to -437):
Forward primer: 5’- GTCCCGACGTGACTTCCTC-3’
Reverse primer: 5’- AGCCAGTTCTGGACTGATCG-3’
2.2.17. Statistical analysis
All data were initially tested for normality using a Kolmogorov-Smirnoff test.
Normally distributed data were analysed using a Student t test for two groups and an
ANOVA followed by a Dunnett post hoc test for three groups or more. Data that were not normally distributed were analysed using a Mann–Whitney U test for non-paired
- 70 - Chapter 2: Material and Methods data and a Wilcoxon matched pairs test for paired data (two groups) and when comparing three groups or more we used a Friedman’s Test, with a Dunn's Multiple
Comparisons post hoc test. p<0.05 was considered statistically significant.
- 71 - Chapter 3: Uterine stretch and progesterone action
Chapter Three: Uterine Stretch and Progesterone
Action
- 72 - Chapter 3: Uterine stretch and progesterone action
3. Uterine Stretch and Progesterone Action
3.1. Introduction
Progesterone plays an essential role in maintaining pregnancy in both humans and animals. In lower order animals, such as rats, mice, rabbits, goats and pigs, a systemic progesterone withdrawal can lead to the onset of parturition [7]. In contrast, in primates and humans, maternal, fetal and amniotic progesterone levels remain elevated throughout pregnancy suggesting that systemic progesterone withdrawal is not a prerequisite for labour at term. However, tissues of the reproductive tract become resistant to progesterone action suggesting that a functional progesterone withdrawal occurs [7]. The facts that mifepristone, which inhibits genomic progesterone action, can increase myometrial sensitivity to exogenous prostaglandins [315] and induce labour [316] and that progesterone administration reduces preterm labour rates in high-risk women [48], support the concept that in the human progesterone plays an important role in determining the onset of labour. Clinically, however, progesterone administration only reduces preterm labour rates in singleton pregnancies and has no effect in women with multiple pregnancies [49, 51, 74]. This suggests that different processes are involved in singleton and multiple preterm labour such that the risk of preterm labour in singleton pregnancies can be modulated by progesterone administration whereas the risk in multiple pregnancies cannot.
There is increasing evidence suggesting that progesterone promotes uterine relaxation, at least in part, by blocking the myometrial response to oxytocin and prostaglandins [225, 317, 318]. In human myometrium, three progesterone receptor isoforms A, B and C (PR-A, -B, -C) have been identified and all belong to the nuclear receptor family. PR-B represents the full-length functional receptor and is thought to mediate most of the progesterone effects; PR-A and PR-C are truncated versions that predominantly repress transcription; however, recent studies suggest that PR-A may also mediate some of progesterone’s effects [232]. Thus, the subtype and the expression level of these PR isoforms may lead to different progesterone responsiveness. A fall in the ratio of PR-B to PR-A/C has been proposed as one of potential mechanisms responsible for repressing the genomic actions of progesterone, leading to a functional withdrawal of progesterone action [319]. This hypothesis has
- 73 - Chapter 3: Uterine stretch and progesterone action drawn support from both primate and human data [246, 249, 319, 320]. On the other hand, the non-genomic actions of progesterone and its metabolites may also contribute to myometrial relaxation [321, 322]. With advancing gestation, the uterus is subject to increasing stretch as the pregnancy grows. Animal studies suggest that progesterone is responsible for maintaining uterine quiescence and promoting myometrial hyperplasia and hypertrophy to prevent any increase in uterine wall tension [58-60, 323]. Clinically, a relative increase in uterine volume, as seen in a unicornuate uterus, or an absolute increase, as seen in multiple pregnancy or polyhydramnios is associated with excessive uterine stretch and results in an increased risk of preterm labour [65, 66, 69]. As mentioned above, progesterone administration does not reduce this risk and despite the fact that circulating progesterone levels are high, uterine stretch, achieved by the insertion and inflation of a balloon into the uterine cavity can be used clinically to induce abortion during the second trimester of pregnancy and labour at term [324, 325]. In contrast, pregnant rats seem to be tolerant of uterine stretch when progesterone levels are maintained [59]. These data suggest that the human uterus becomes refractory to the effects of both endogenous and exogenous progesterone due to uterine stretch, implying that uterine stretch might contribute to the progesterone functional withdrawal before the onset of labour.
In previous studies by our group, the in vitro model of pregnancy-induced uterine stretch has been characterized. The stretch of USMCs increases the expression of COX-2 and IL-8 via MAPK activation and induces the expression of OTR in a MAPK-independent manner [85, 87, 133, 326, 327]. These data are consistent with earlier human and rabbit studies which found that uterine distension was associated with a prostaglandin-driven increase in uterine activity [325, 328, 329] and in vitro studies of rat myometrial strips, in which ERK1/2 was activated by stretch [330].
In this chapter, I have investigated whether progesterone is able to inhibit stretch- induced MAPK activation and gene expressions and/or whether stretch in turn affects progesterone actions in USMCs.
- 74 - Chapter 3: Uterine stretch and progesterone action
3.2. Results
3.2.1. Does progesterone affect stretch-induced ERK1/2 activation and gene
expression?
USMCs were exposed to 11% mechanical stretch for 5, 15, 30, and 60 min. The phosphorylation of ERK1/p44 was significantly increased at all last three time points compared with baseline (ANOVA=0.02, baseline vs. 15, 30 and 60 min, p<0.01, 0.05 and 0.05 respectively). For ERK2/p42, the significant increases occurred at 15 and 30 min (ANOVA=0.034, baseline vs. 15 and 30 min, p<0.05 and 0.01 respectively). There was no difference in the stretch-induced ERK1/2 activation in cells pre- incubated with MPA (Figure 3-1). Similarly, pre-incubation with MPA (0.5 and 5 μM for 48 h) did not significantly reduce the stretch-induced increases in COX-2, IL-8, and OTR (Figure 3-2). However, if the endogenous progesterone tone was high, this may have masked any repressive effect of MPA. To address this, USMCs were pre- exposed to RU486 (1 μM for 48 h) before stretch. However, the stretch-induced increases in COX-2, IL-8, and OTR mRNA expression were not enhanced by RU486; rather the trend showed attenuation in gene expression of COX-2 (p=0.0625) and OTR (p=0.09; Figure 3-3). To confirm this result, I stretched the cells after silencing PR expression by siRNA, which was delivered by optimized electroporation method (Figure 3-4), and the data indicated that the ability of stretch to increase COX-2 mRNA expression was unchanged (Figure 3-5).
- 75 - Chapter 3: Uterine stretch and progesterone action
Figure 3-1 The failure of progesterone to significantly reduce stretch-induced activation of ERK1/2.
USMCs were isolated from myometrium of non-labouring women and were pre-incubated with MPA (1 μM) for 48 h before being exposed to 11% stretch for between 0 and 60 min. Protein was extracted and the western blots performed as described in Materials and Methods. A typical example of the western analysis is shown at the top of the figure with the densitometry below. The data are expressed as median, the 25th and 75th percentiles and the range and compared using an ANOVA and Dunnett’s post test for longitudinal data and a paired t test for matched data. * indicates a significant difference of p<0.05; and **, p<0.01, compared with baseline (n=6). This experiment was done by Ben Cryar.
- 76 - Chapter 3: Uterine stretch and progesterone action
Figure 3-2 The failure of progesterone to significantly reduce stretch-induced gene expression. - 77 - Chapter 3: Uterine stretch and progesterone action
USMCs were isolated as described above and pre-incubated with MPA (0.5 and 5.0 μM) for 48 h before being exposed to 11% stretch for 60 min. mRNA was extracted and the levels of COX-2, IL-8, and OTR mRNA were measured using qPCR. Data are shown as the median, the 25th and 75th percentiles and the range and were compared using Wilcoxon matched pairs test. ** indicates a significant difference of p<0.01 (n=10).
- 78 - Chapter 3: Uterine stretch and progesterone action
Figure 3-3 RU468 does not accentuate the stretch-induced gene expression.
USMCs were isolated as described above and pre-incubated with RU486 (1 µM) for 48 h before being exposed to 11% stretch for 60 minutes. mRNA was extracted and the levels of COX-2, IL-8 and OTR mRNA were measured using qPCR. Data are shown as the median, the 25th and 75th percentiles and the range and were compared using Wilcoxon matched pairs test. * indicates a significant difference of p<0.05 vs. control (n=6).
- 79 - Chapter 3: Uterine stretch and progesterone action
Figure 3-4 The comparison of transfecion efficiency between Amaxa (nucleofection) and Gene Juice in USMCs. USMCs were transiently transfected with a green fluorescent protein (GFP) expressing plasmid, pmaxGFP using Amaxa (nucleofection) or Gene Juice. Cells were examined by fluorescence microscopy from 2 day post-transfection to day 5. BF, bright field.
- 80 - Chapter 3: Uterine stretch and progesterone action
Figure 3-5 PR knockdown does not affect the stretch-induced COX-2 expression.
USMCs were isolated as described above, and total PR was knocked down using siRNA before being exposed to 11% stretch for 60 minutes. mRNA was extracted and the levels of COX-2 mRNA were measured using qPCR. Data are shown as the median and the range (n=3).
- 81 - Chapter 3: Uterine stretch and progesterone action
3.2.2. Does stretch change progesterone-responsive gene expression?
In the literature, several genes have been identified as progesterone-responsive, including secretory leukocyte peptidase inhibitor (SLPI), calcitonin gene related peptide (CGRP), nitric oxide synthase 3 (eNOS), relaxin receptor 1 (LGR7), uteroglobin, inhibitor of kappa B (IκB), and nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB). So I investigated whether progesterone affected their expression in USMCs. However, none of them were modulated by MPA treatment (Figure 3-6). Consequently, a microarray analysis was performed comparing PR knockdown group with control group and four genes were found to be strongly regulated, matrix metallopeptidase 10 (MMP10), carbonic anhydrase XII (CA12), fibronectin leucine rich transmembrane protein 3 (FLRT3), potassium inwardly- rectifying channel, subfamily J, member 2 (KCNJ2), but only MMP10 showed a consistent decrease in response to MPA. Furthermore, when I performed another microarray on USMCs comparing MPA-treated cells (exposure to MPA for 48 h) and vehicle, several genes were identified to be progesterone-responsive (Table 3-1, Table 3-2). However, after I used the more stringent Benjamini-Hochberg Correction on these data, only three genes were shown to be significantly modulated by MPA [Six- transmembrane epithelial antigen of prostate 4 (STEAP4), 11β-Hydroxysteroid dehydrogenase (HSD11β1), and FK506 binding protein 5 (FKBP5)]. Use qPCR to confirm these results and found that only FKBP5 and HSD11β1 responded consistently to MPA. So after combining two sets of microarray data, three progesterone-responsive genes were identified in USMCs; amongst these, MMP10 was down-regulated whereas both FKBP5 and HSD11β1 were up-regulated by MPA. Stretch was found not to alter either the basal or the MPA-induced change in the expression of these 3 genes (Figure 3-7).
- 82 - Chapter 3: Uterine stretch and progesterone action
Figure 3-6 Progesterone-responsive genes in the literature are not modulated by progesterone in USMCs.
USMCs were isolated from myometrial biopsies obtained from women at the time of pre-labour lower segment cesarian section (LSCS). Cells were pre-incubated with MPA (1 µM) for 48 h. mRNA was then extracted and the mRNA levels of various progesterone-responsive genes were measured using qPCR. Data are shown as the median, the 25th and 75th percentiles and the range, and were compared using Wilcoxon matched pairs test (n=6).
- 83 - Chapter 3: Uterine stretch and progesterone action
Table 3-1 Top 50 up-regulated genes by MPA with gene symbol, gene name, GeneBank accession number and fold change
Gene symbol Gene name GeneBank accession no. Fold change
STEAP4 STEAP family member 4 NM_024636 -5.327 FKBP5 FK506 binding protein 5 NM_001145775 -4.30804 ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide NM_000668 -4.15886 HSD11B1 hydroxysteroid (11-beta) dehydrogenase 1 NM_005525 -4.14498 CORIN corin, serine peptidase NM_006587 -3.99429 GRIA1 glutamate receptor, ionotropic, AMPA 1 NM_000827 -3.56978 MAOA monoamine oxidase A NM_000240 -3.16342 OMD osteomodulin NM_005014 -3.13773 CRISPLD2 cysteine-rich secretory protein LCCL domain containing NM_031476 -2.91513 MAOB monoamine oxidase B NM_000898 -2.87449 RORB RAR-related orphan receptor B NM_006914 -2.87273 C7 complement component 7 NM_000587 -2.81362 ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 NM_006208 -2.58711 AOX1 aldehyde oxidase 1 NM_001159 -2.30587 CCDC68 coiled-coil domain containing 68 NM_025214 -2.28405 FMO2 flavin containing monooxygenase 2 (non-functional) NM_001460 -2.28082 LMO3 LIM domain only 3 (rhombotin-like 2) NM_018640 -2.17594 SYNPO2 synaptopodin 2 NM_133477 -2.15819 GCNT1 glucosaminyl (N-acetyl) transferase 1 NM_001490 -2.09552 IMPA2 inositol(myo)-1(or 4)-monophosphatase 2 NM_014214 -2.01049 P2RY14 purinergic receptor P2Y, G-protein coupled, 14 NM_014879 -1.94793 SYTL4 synaptotagmin-like 4 NM_080737 -1.94427 RNF182 ring finger protein 182 NM_152737 -1.93839 ERRFI1 ERBB receptor feedback inhibitor 1 NM_018948 -1.92055 CYP7B1 cytochrome P450, family 7, subfamily B, polypeptide 1 NM_004820 -1.91402 FAM19A2 family with sequence similarity 19 NM_178539 -1.90505 SORBS1 sorbin and SH3 domain containing 1 NM_001034954 -1.884 CD226 CD226 molecule NM_006566 -1.8602 PRUNE2 prune homolog 2 NM_015225 -1.84631 DKFZP564O0823 DKFZP564O0823 protein NM_015393 -1.82917 ADH1C alcohol dehydrogenase 1C NM_000669 -1.8003 TSC22D3 TSC22 domain family, member 3 NM_198057 -1.78509 FAM105A family with sequence similarity 105, member A NM_019018 -1.76203 MATN2 MATN2 NM_002380 -1.75105 C5orf23 chromosome 5 open reading frame 23 BC022250 -1.73304 SLC24A3 solute carrier family 24 NM_020689 -1.68371 PHF17 PHD finger protein 17 NM_199320 -1.65895 GLUL glutamate-ammonia ligase NM_002065 -1.65882 GPM6B glycoprotein M6B NM_001001995 -1.64214 ADH1A alcohol dehydrogenase 1A NM_000667 -1.64047 RASL11A RAS-like, family 11, member A NM_206827 -1.62452 DUSP1 dual specificity phosphatase 1 NM_004417 -1.61945 ACSL1 acyl-CoA synthetase long-chain family member 1 NM_001995 -1.61094 GFPT2 glutamine-fructose-6-phosphate transaminase 2 NM_005110 -1.60649 MOBKL2B MOB1, Mps One Binder kinase activator-like 2B NM_024761 -1.60496 ADRA2C adrenergic, alpha-2C NM_000683 -1.59029 SLCO4C1 solute carrier organic anion transporter family NM_180991 -1.57083 ODZ3 ten-m homolog 3 NM_001080477 -1.56596 RPL7A ribosomal protein L7a NR_000017 -1.55156 CA8 carbonic anhydrase VIII NM_004056 -1.55022
- 84 - Chapter 3: Uterine stretch and progesterone action
Table 3-2 Top 50 down-regulated genes by MPA with gene symbol, gene name, GeneBank accession number and fold change
Gene symbol Gene name GeneBank Accession no. Fold Change
MMP10 matrix metallopeptidase 10 NM_002425 3.9034 DIO2 deiodinase, iodothyronine, type II NM_013989 3.57657 SYTL5 synaptotagmin-like 5 NM_138780 3.3714 ITGA8 integrin, alpha 8 NM_003638 2.6605 CD24 CD24 molecule NM_013230 2.61073 SERPINB7 serpin peptidase inhibitor, clade B NM_003784 2.48935 MMP11 matrix metallopeptidase 11 NM_005940 2.42556 KCNMB2 potassium large conductance calcium-activated channel NM_005832 2.38572 ZNF711 zinc finger protein 711 NM_021998 2.11108 EGR2 early growth response 2 NM_000399 2.04323 GRIA4 glutamate receptor, ionotrophic, AMPA 4 NM_000829 2.04202 SLC14A1 solute carrier family 14 (urea transporter), member 1 NM_001128588 2.02716 ATP6V0D2 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2 NM_152565 1.93544 H19 H19, imprinted maternally expressed transcript NR_002196 1.93198 CYYR1 cysteine/tyrosine-rich 1 NM_052954 1.91243 WNT2 wingless-type MMTV integration site family member 2 NM_003391 1.9121 KLHL4 kelch-like 4 NM_019117 1.84201 DACH1 dachshund homolog 1 NM_080759 1.82225 LOC401097 Similar to LOC166075 ENST00000326474 1.81298 HMCN1 hemicentin 1 NM_031935 1.79146 AFAP1L2 actin filament associated protein 1-like 2 NM_001001936 1.78916 FGF9 fibroblast growth factor 9 NM_002010 1.78754 TNNT2 troponin T type 2 NM_000364 1.78262 CLSTN2 calsyntenin 2 NM_022131 1.78205 C5orf13 chromosome 5 open reading frame 13 NM_004772 1.77996 FAM46C family with sequence similarity 46, member C NM_017709 1.7651 RARRES2 retinoic acid receptor responder (tazarotene induced) 2 NM_002889 1.75464 IGF1 insulin-like growth factor 1 NM_001111283 1.73159 GPR39 G protein-coupled receptor 39 NM_001508 1.72622 LAMP3 lysosomal-associated membrane protein 3 NM_014398 1.72367 ZNF704 zinc finger protein 704 NM_001033723 1.70278 CPA4 carboxypeptidase A4 NM_016352 1.70155 UNQ565 UNQ565 BC040288 1.69181 IGFBP3 insulin-like growth factor binding protein 3 NM_001013398 1.68453 KRT18 keratin 18 NM_000224 1.68018 IL6 interleukin 6 NM_000600 1.67977 B3GALT1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase NM_020981 1.67742 PLA2G4A phospholipase A2, group IVA NM_024420 1.66087 RASSF9 Ras association (RalGDS/AF-6) domain family NM_005447 1.64334 BMP6 bone morphogenetic protein 6 NM_001718 1.64126 DGKB diacylglycerol kinase NM_004080 1.63946 TMEM130 transmembrane protein 130 NM_001134450 1.62963 IGJ immunoglobulin J polypeptide NM_144646 1.6187 DKK2 dickkopf homolog 2 NM_014421 1.61117 C6orf141 chromosome 6 open reading frame 141 NM_001145652 1.60936 SLC44A5 solute carrier family 44, member 5 NM_152697 1.60717 MYLIP myosin regulatory light chain interacting protein NM_013262 1.60701 OR2J1 olfactory receptor, family 2, subfamily J, member 1 ENST00000377171 1.6019 CCL11 chemokine (C-C motif) ligand 11 NM_002986 1.60141 TPD52L1 tumor protein D52-like 1 NM_001003395 1.5991
- 85 - Chapter 3: Uterine stretch and progesterone action
FKBP5 800 ** 600 **
400
200 FKBP5:GAPDH mRNA Ratio
0
none none
none (MPA)
none (stretch) none (MPA+stretch) HSD11β 1 200 * * 150
100
50 HSD11B:GAPDH mRNA Ratio
0
none none
none (MPA)
none (stretch) none (MPA+stretch) 150 MMP10
100 * *
50 MMP10:GAPDH mRNA Ratio
0
none none
none (MPA)
none (stretch) none (MPA+stretch)
Figure 3-7 Stretch of human USMCs does not inhibit the ability of progesterone to modulate gene expression.
USMCs were isolated from myometrial biopsies obtained from women at the time of pre-labour LSCS. Cells were pre-incubated with MPA (1 µM) for 24 h before being exposed to 11% stretch for 60 min. mRNA was then extracted and the mRNA levels of various progesterone-sensitive genes measured using qPCR. Data are shown as the median, the 25th and 75th percentiles and the range; and were compared using Wilcoxon matched pairs test. * indicates a significant difference of p<0.05, and **, of p<0.01 (n=6).
- 86 - Chapter 3: Uterine stretch and progesterone action
3.2.3. Stretch does not change liganded PR-B-driven PRE activation or
progesterone repression of IL-1β-induced COX-2 expression
Mechanical stretch did not affect PR-B-driven progesterone response element (PRE) activation in the presence of MPA (Figure 3-8). MPA not only reduced the basal level of COX-2 expression also reduced the IL-1β-induced increase in COX-2 mRNA expression and protein synthesis. In the cells that were pre-stretched for 24 h, the ability of MPA to repress IL-1β-induced increase in COX-2 mRNA expression and protein synthesis was unchanged (Figure 3-9). To further clarify the statement that MPA reduces the IL-1β-driven COX-2 expression and also to detect a possibility that MPA may simply have reduced the baseline level of COX-2 such that the total COX- 2 after combined treatment was less than that in the experiment using IL-1β alone, I carried out an analysis to see whether the IL-1β-induced COX-2 increase is different between in the presence and absence of MPA. As shown in Figure 3-10, A and B, the ability of IL-1β inducing COX-2 expression is attenuated in the presence of MPA compared with in the absence of MPA (n=16, p<0.0001 at mRNA level and n=6, p=0.0117 at protein level). However, MPA shows no effect on stretch-induced COX-2 expression (Figure 3-10, C) and stretch does not affect MPA to repress the basal level of COX-2 expression (Figure 3-10, D), which are consistent with my previous results.
Figure 3-8 Stretch of human USMCs does not inhibit the ability of progesterone to activate a progesterone response element.
USMCs were transiently co-transfected with a PRE, with or without progesterone receptor (PR-B). SG5 was used as control. MPA was added 24 h post transfection and the cells were either stretched or not for another 24 h before
- 87 - Chapter 3: Uterine stretch and progesterone action luciferase assay. Data are expressed as median, 25th and 75th percentiles and range and were analyzed using a Wilcoxon matched pairs test. * indicates a significant difference of p<0.05 (n=6).
Figure 3-9 Stretch of human USMCs does not inhibit the ability of progesterone to repress IL-1β-driven COX-2 expression.
USMCs were stretched for 30 h; in the last 6 h, the cells were exposed to different stimuli, IL-1β or MPA, alone or in combination. mRNA was then extracted and the COX-2 mRNA levels were measured using qPCR. Protein was extracted and the western blotting performed as described in Materials and Methods. Data are expressed as median, 25th and 75th percentiles and range and compared using ANOVA and Dunnett’s post test and paired t test for other comparisons. NS, non-stretched cells; S, stretch-cells. * indicates a significant difference of p<0.05, and ***, p<0.001 vs. baseline; §, p<0.05, and §§, p<0.01 between samples exposed to IL-1β alone or with stretch incubated with or without MPA; ##, p<0.01 vs. samples exposed to IL-1β alone or with stretch (n=5-6).
- 88 - Chapter 3: Uterine stretch and progesterone action
A 150 B 150
100 100 * ***
50 50
COX-2 Relative Intensity Relative COX-2 COX-2:GAPDH mRNA Ratio mRNA COX-2:GAPDH
0 0
Vehicle & IL-1β & Vehicle
Vehicle & IL-1β
MPA & & IL-1β+MPAMPA
MPA & IL-1β+MPA & MPA
10000 C 200 D
150 1000
100 100
50 Intensity Relative COX-2 COX-2 Relative Intensity Relative COX-2
0 10
NS NS &S
S & S (MPA) S & S
NS & NS (MPA) NS & NS
NS+MPA & NS+MPA S+MPA
Figure 3-10 MPA represses IL-1β-driven COX-2 expression but has no effect on stretch-induced COX-2 expression.
Data were analyzed by using delta value of (vehicle and IL-1β) and (non-stretch and stretch) in the presence or absence of MPA. NS, non-stretched cells; S, stretch-cells. Data are expressed as median, 25th and 75th percentiles and range and were analyzed using a Wilcoxon matched pairs test. * indicates a significant difference of p<0.05 (n=6), and ***, p<0.001 (n=16).
- 89 - Chapter 3: Uterine stretch and progesterone action
3.2.4. The effect of mechanical stretch on PR expression
Although stretch did not affect progesterone action, stretch down-regulated PR-B and PR-total mRNA expression (p<0.05 and p<0.01 respectively) as well as PR-B protein level (Figure 3-11). To further investigate how stretch represses PR expression, inhibitors of MAPK and IKK signaling pathways were employed. After UMSCs were pre-incubated with these inhibitors, basal level of PR-total was significantly reduced by all three MAPK inhibitors whereas basal expression of PR-B was unaffected (Friedman’s test, p=0.027, Dunn’s multiple comparison for each inhibitor, p<0.05). Only the IKK inhibitor resulted in a significant reversal of the stretch-induced inhibition of PR-B and PR-total mRNA expression (Figure 3-12; Friedman’s test, p=0.02, Dunn’s multiple comparison for IKK inhibitor p<0.01). The addition of anisomycin (0.2 µM for 2 h), a MAPK activator, increased the PR-B expression in an ERK- and p38 dependent manner (paired t test, p<0.05, ANOVA=0.0099, ERK and p38 inhibitors <0.05) and a trend of increasing PR-total (p=0.08) in an ERK- dependent manner (Figure 3-13; ANOVA=0.036, ERK inhibitor <0.05). In the literature, PKC and PLC have been reported to be involved in the stretch-induced changes in gene expression [331, 332]. However, activators of PKC and PLC did not affect the basal mRNA levels of PR, and their inhibitors had no effect on the stretch- induced reduction in PR mRNA expression (Figure 3-14).
- 90 - Chapter 3: Uterine stretch and progesterone action
Figure 3-11 Stretch of USMCs results in a reduction in PR-B, PR-total mRNA and PR-B protein expression.
USMCs were isolated from myometrial biopsies obtained from women at the time of pre-labour LSCS. Cells were exposed to 11% stretch for 60 min. mRNA was then extracted and the levels of PR-B and PR-total mRNA were measured using qPCR. In an independent experiment, USMCs were exposed to stretch for 30 hours, protein was extracted and the western blots were performed as described in Materials and Methods. Data are shown as median, the 25th and 75th percentiles and the range and were compared using Wilcoxon matched pairs test. * indicates a significant difference of p<0.05, and ** of p<0.01 compared with paired sample (n=24 for mRNA data; n=6 for protein data). - 91 - Chapter 3: Uterine stretch and progesterone action
Figure 3-12 Stretch reduces PR-B, PR-total mRNA and PR-B protein via NF-κB activation.
USMCs were isolated from myometrial biopsies obtained from women at the time of pre-labour LSCS. Cells were pre-incubated with specific inhibitors of MAPK and IKK, the cells were then either processed or exposed to 11% stretch for 60 min. mRNA was extracted and the levels of PR-B and PR-total mRNA were measured using qPCR. Data are shown as median, 25th and 75th percentiles and range and were compared using Wilcoxon matched pairs test for control vs. stretch. * indicates a significant difference of p<0.05 vs. control. Friedman’s Test, with a Dunn's Multiple Comparisons post hoc test was used to compare the stretched sample with those pre-incubated with specific inhibitors before stretch, §, Significant difference of p<0.05, and §§, of p<0.01 (n=6-7). This part of work was collaborated with Renyi Hua.
- 92 - Chapter 3: Uterine stretch and progesterone action
Figure 3-13 MAPK activator increases PR mRNA expression.
USMCs were isolated from myometrial biopsies obtained from women at the time of pre-labour LSCS. Cells were incubated with the MAPK activator, anisomycin 0.2µM for 2 h in the presence or absence of specific MAPK inhibitors. Cells were then processed, mRNA was extracted and the levels of PR-B and PR-total mRNA were measured using qPCR. Data are shown as median, 25th and 75th percentiles and range; and were compared using paired t test for control vs. anisomycin. * indicates a significant difference of p<0.05. An ANOVA, with a Dunnett’s post test, was used to compare the sample exposed to anisomycin alone with those pre-incubated with specific inhibitors before anisomycin exposure. #, Significant difference of p<0.05, and ##, of p<0.01 (n=6).
Figure 3-14 The effect of PKC and PLC activators and inhibitors on basal PR expression and stretch- repressed PR expression.
USMCs were isolated from myometrial biopsies obtained from women at the time of pre-labour LSCS. Cells were pre-incubated with specific activators, SC10 and 3M3FBS, of PKC and PLC respectively. Other cells were pre- incubated with the inhibitors, GF109203x and U73122, of PKC and PLC, respectively, before exposure to 11% stretch for 60 min. mRNA was extracted and the levels of PR-B and PR-total mRNA were measured using qPCR. Data are shown as median, 25th and 75th percentiles and range; and were compared using Wilcoxon matched pairs test for control vs. stretch. * indicates a significant difference of p<0.05. Friedman’s Test, with a Dunn's Multiple Comparisons post hoc test, was used to compare the control sample and those exposed to SC10 and 3M3FBS and to compare the stretched cells alone with those pre-incubated with specific inhibitors GF109203x and U73122 (n=6). - 93 - Chapter 3: Uterine stretch and progesterone action
3.2.5. Stretch induces unliganded PR-B-driven PRE activation via CDK2
As mentioned above, mechanical stretch had no effect on the PR-B-driven PRE activation in the presence of MPA (Figure 3-8). Surprisingly, stretch significantly increased the activity of unliganded PR-B (Figure 3-15). In our previous study, stretch was found to increase gene expression through activation of different components of the MAPK cascade in USMCs [326]. Moreover, phosphorylation by kinases is one of the important PR post-translational modifications, which regulates PR activity. To examine whether the MAPK pathway was also implicated in stretch-induced unliganded PR-B activation, specific MAPK inhibitors (ERK 1/2, U0126; JNK 1/2/3, SP600125; p38, SB203580) were used and stretch-induced activation of unliganded PR-B was assessed. As shown in Figure 3-16, none of the three inhibitors blocked PR-B activation in the absence of MPA suggesting that stretch-induced PR-B activation was not mediated via MAPK, although it is possible that there is crossover in the different MAPK subtype activities such that a combination or all 3 would have to be inhibited in order to block the effect of stretch on PR-B activity. Since CDK2 is also known to be involved in PR-B phosphorylation, the CDK inhibitor (roscovatine) and CDK2 selective inhibitor were tested. The result showed that both inhibitors abolished the significant increase in unliganded PR-B activity in response to stretch, suggesting that phosphorylation by CDK2 was essential for PR-B activation in the absence of ligand (Figure 3-17). To further determine the influence of CDK2 on PR-B transcriptional activity, a construct encoding an active CDK2 double mutant (CDK2- TY), in which Thr14 and Tyr15 had been mutated to Ala and Phe respectively, was used to generate constitutively active CDK2. However, the activity of PR-B was not increased by CDK2-TY in the absence of MPA (Figure 3-18) even with increasing concentrations (Figure 3-19), suggesting that either CDK2 alone is not sufficient to induce PR-B activity or there might be some other factors blocking CDK2 function in vivo.
The regulation of human PR transcriptional activity in a ligand-independent manner is rarely reported. Although there are 8 out 14 CDK2 phosphorylation sites on PR-B, only Ser400 site was characterized to be the target of ligand-independent PR-B activation in human breast cancer cells [261]. Since I have already determined that CDK2 was involved in the activation of unliganded PR-B by stretch, to identify whether Ser400 was also the target, either wild type (W) or mutant PR-B (S400A)
- 94 - Chapter 3: Uterine stretch and progesterone action were transfected into USMCs along with PRE. As shown in Figure 3-20, Ser400 mutant PR-B did not block the stretch-induced increase in PR-B activity, suggesting that Ser400 site was not the essential phosphorylation site in this context.
1500 ***
1000
500
Percentage Change in Luc/Renilla Ratio Luc/Renilla in Change Percentage 0
SG5+PRE
PRB+PRE
SG5+PRE (Stretch) SG5+PRE PRB+PRE (Stretch) PRB+PRE
Figure 3-15 Stretch increases unliganded PR-B activity.
USMCs were transiently co-transfected with a PRE, with or without progesterone receptor (PR-B). SG5 was used as control. One day after transfection, cells were either stretched or not for another 24 h before luciferase assay. Data are expressed as median, 25th and 75th percentiles and range and were analyzed using a Wilcoxon matched pairs test. *** indicates a significant difference of p<0.001 (n=19).
- 95 - Chapter 3: Uterine stretch and progesterone action
1500 *
1000
500
Percentage Change in Luc/Renilla Ratio Luc/Renilla in Change Percentage 0
SG5+PRE
PRB+PRE
SG5+PRE(p38i)
PRB+PRE(p38i)
SG5+PRE(JNKi)
PRB+PRE(JNKi)
SG5+PRE(ERKi)
PRB+PRE(ERKi)
SG5+PRE(Stretch)
PRB+PRE(Stretch)
SG5+PRE(p38i+Stretch)
PRB+PRE(p38i+Stretch)
SG5+PRE(JNKi+Stretch)
PRB+PRE(JNKi+Stretch) SG5+PRE(ERKi+Stretch) PRB+PRE(ERKi+Stretch)
Figure 3-16 MAPK inhibitors have no effect on stretch-induced unliganded PR-B activation.
USMCs were transiently co-transfected with PR-B and PRE. SG5 was empty expression vector used as control. Cells were pre-incubated with specific inhibitors of ERK, JNK and p38 respectively for 1 hour at 24 h post transfection and then stretch was performed for another 24 h before luciferase assay. Data are expressed as median, 25th and 75th percentiles and range and were analyzed using a Wilcoxon matched pairs test. * indicates a significant difference of p<0.05 (n=5).
1500 ** **
1000
500
Percentage Change in Luc/Renilla Ratio Luc/Renilla in Change Percentage 0
SG5+PRE
PRB+PRE
SG5+PRE(CDKi)
PRB+PRE(CDKi)
SG5+PRE(CDK2i)
PRB+PRE(CDK2i)
SG5+PRE(Stretch)
PRB+PRE(Stretch)
SG5+PRE(CDKi+Stretch)
PRB+PRE(CDKi+Stretch) SG5+PRE(CDK2i+Stretch) PRB+PRE(CDK2i+Stretch)
Figure 3-17 Stretch of USMCs results in an increase of unliganded PR-B activation mediated through CDK2.
USMCs were transiently co-transfected with PR-B and PRE. SG5 was empty expression vector used as control. Cells were pre-incubated with CDK inhibitor or selective CDK2 inhibitor for 1 hour at 24 h post transfection and
- 96 - Chapter 3: Uterine stretch and progesterone action then stretch was performed for another 24 h before luciferase assay. Data are expressed as median, 25th and 75th percentiles and range and were analyzed using a Wilcoxon matched pairs test. ** indicates a significant difference of p<0.01 (n=6).
10000
1000
100
Percentage Change in Luc/Renilla Ratio Luc/Renilla in Change Percentage 10
SG5+pCS2+PRE
PRB+pCS2+PRE
SG5+CDK2-TY+PRE
PRB+CDK2-TY+PRE
SG5+pCS2+PRE(MPA)
PRB+pCS2+PRE(MPA) SG5+CDK2-TY+PRE(MPA) PRB+CDK2-TY+PRE(MPA)
Figure 3-18 Constitutively active CDK2 (CDK2-TY) does not increase unliganded PR-B activity.
USMCs were transiently co-transfected with PR-B, PRE and mutant CDK2-TY. SG5 and pCS2 were empty expression vectors used as control. MPA was added 24 h post transfection and cells were incubated for another 24 h before luciferase assay. Data are expressed as median, 25th and 75th percentiles and range and were analyzed using a Wilcoxon matched pairs test, (n=4).
140
120
100
80
Percentage Change in Luc/Renilla Ratio Luc/Renilla in Change Percentage 60
PRB+pCS2+PRE
PRB+CDK2-TY(1.0)+PRE PRB+CDK2-TY(1.5)+PRE PRB+CDK2-TY(0.5)+PRE
Figure 3-19 Increasing dose of CDK2-TY has no effect on unliganded PR-B activity.
- 97 - Chapter 3: Uterine stretch and progesterone action
USMCs were transiently co-transfected with PR-B and PRE, along with increasing amounts of mutant CDK2-TY (0.5 μg, 1.0 μg, 1.5 μg). pCS2 were parental vector of CDK2-TY used as control (1.5μg) or filler so that the total amount of transfected DNA per well was constant. Cells were performed luciferase assay at 48 h post-transfection. Data are expressed as median, 25th and 75th percentiles and range and were analyzed using a Wilcoxon matched pairs test, (n=4).
2000
1500
1000
500
Percentage Change in Luc/Renilla Ratio Luc/Renilla in Change Percentage 0
SG5+PRE
PRB(W)+PRE
PRB(S400A)+PRE
SG5+PRE (Stretch) SG5+PRE
PRB(W)+PRE (Stretch) PRB(W)+PRE PRB(S400A)+PRE (Stretch) PRB(S400A)+PRE
Figure 3-20 Mutation of PR-B on Ser400 fails to block stretch-induced unliganded PR-B activation.
USMCs were transiently co-transfected with either wild type (W) PR-B or mutant PR-Bs (S400A, S294A and S345A) and PRE. SG5 was empty expression vector used as control. Cells were incubated for 24 h after transfection and then stretch was performed for another 24 h before luciferase assay. Data are expressed as means ± SD, n=2.
- 98 - Chapter 3: Uterine stretch and progesterone action
3.3. Summary and Discussion
In this chapter, I investigated the relationship between progesterone action and mechanical stretch in USMCs and found that progesterone did not inhibit stretch- induced MAPK activation or gene expression and that although stretch reduced PR expression in a NF-κB-dependent manner and increased unliganded PR-B-driven PRE activity, it did not appear to affect progesterone action. These results provide an explanation for the ineffectiveness of progesterone to prevent preterm labour in multiple pregnancy, but also suggest that uterine stretch is not responsible for the process of functional progesterone withdrawal seen with the onset of human labour.
3.3.1. Progesterone does not affect stretch-induced ERK1/2 activation and
gene expression
Clinically, progesterone administration is the only way to reduce the preterm labour rates in singleton pregnancy but has no effect in multiple pregnancy [49, 51, 74]. This is consistent with our finding that MPA did not inhibit stretch-induced ERK1/2 activation and labour-associated gene expression. To exclude the possibility that these data are due to the presence of a high basal level of endogenous progesterone activity masking the effect of exogenous progesterone, I treated the cells with RU486. However, no significant change was found in stretch-induced increases in gene expression. Rather than accentuating the effect of stretch, interestingly, the trend of the effect of RU486 was to reduce stretch-induced COX-2, IL-8, and OTR, which might be due to its partial agonist activity in the absence of ligand [333, 334]. In singleton pregnancy, the ability of progesterone to reduce the risk of preterm labour is at least partially due to its anti-inflammatory effect, best illustrated by its ability to block IL-1β-induced up-regulation in COX-2 mRNA expression by reducing NF-κB binding to the COX-2 promoter in hTERT myometrial cell line [290]. More recently, our group found that NF-κB can be activated by stretch in USMCs and inhibiting NF- κB activation by blocking IKK represses the stretch-induced increase in COX-2 mRNA and protein expression. Given that progesterone has been shown to inhibit IL- 1β-induced NF-κB activation and COX-2 expression [290, 335], it might have been expected a similar effect in the context of stretch. However, this effect is clearly not seen which suggests that progesterone does not impair stretch-induced gene
- 99 - Chapter 3: Uterine stretch and progesterone action expression and the mechanisms involved in singleton and multiple pregnancies are different.
3.3.2. Stretch does not affect progesterone action
I then assessed whether stretch could alter progesterone action in terms of progesterone-regulated gene expression, liganded PR-B-driven PRE activity and the ability of progesterone to repress IL-1β-induced COX-2 mRNA expression and protein synthesis. Firstly, I identified some putative progesterone-responsive genes from the literature. However, none of them showed any consistent response to MPA in USMCs. I then detected some genes which were identified to be PR sensitive from a microarray study done by one of my colleague comparing PR knockdown group with control. Although this experiment was done in human USMCs, I found that of the four most strongly modulated genes by MPA only MMP10 expression was consistently regulated. These data indicate that PR and progesterone-regulated genes are different from each other despite some overlap. Simply silencing PR may have other effects, including the altering the availability of co-regulators or releasing transcription factors that may otherwise have been bound to PR. In my microarray study, I identified three genes which were highly modulated by MPA according to stringent statistical analysis. In completely independent experiments, two genes (FKBP5 and HSD11β1) were validated to be up-regulated by MPA. Finally, I used these three genes (FKBP5, HSD11β1, and MMP10) as candidates to assess the hypothesis that stretch alters the ability of progesterone to drive gene expression. The results demonstrated that mechanical stretch did not change the ability of MPA to induce the expression of FKBP5 and HSD11β1 or to repress the expression of MMP10.
Similarly, when I used a luciferase reporter assay, I found that stretch did not alter the ability of liganded PR-B-driven PRE activation. Also stretch had no effect on the ability of MPA to repress IL-1β-driven COX-2 expression, which is primarily mediated through NF-κB [176]. All these data suggest that the genomic activity of progesterone is not affected by mechanical stretch; therefore, stretch may not be responsible for the progesterone functional withdrawal before the onset of human labour. However, it is known that progesterone can also maintain uterine quiescence
- 100 - Chapter 3: Uterine stretch and progesterone action through a non-genomic mechanism where stretch might have a negative effect on progesterone action.
Despite the fact that prolonged stretch increased COX-2 mRNA expression from the basal level, it had no further enhancement on the IL-1β-driven COX-2 mRNA expression. Interestingly, however, it enhanced the IL-1β-driven COX-2 protein synthesis, which might be mediated through more efficient post-transcriptional translation of COX-2 mRNA as has been recently described for COX-2 protein synthesis in cardiac muscle via a p38-dependent mechanism [336, 337].
3.3.3. Stretch decreases PR-total mRNA expression and PR-B protein
synthesis
There are several putative mechanisms of progesterone functional withdrawal that have been proposed in the literature and the ratio change of different PR isoforms is one of them [338]. To support this hypothesis, Mesiano et al. found that both PR-A and PR-B mRNA expression increased in the samples obtained at the time of active labour compared with non-labouring myometrial samples, but that the increase in PR- A was much greater, resulting in an increase in the ratio of PR-A/PR-B [249], although the primers for PR-B and the methodology of deriving the PR-A can be disputed, these data were supported by changes in protein levels of two PR isoforms [246, 319]. Condon et al. have also demonstrated that PR-B and PR-C mRNA expression increased, but that the increase in PR-C was relatively more marked [289]. Both studies implied that increases in the truncated PR-B isoforms would cause a functional withdrawal of progesterone action. In my work, I assessed the effects of stretch on PR mRNA expression and found that stretch-induced a decline in both PR- B and PR-total (PR-A, -B, and -C) mRNA expression and these changes were reflected in a reduction in PR protein levels. The different pattern of change in PR mRNA and protein suggests that stretch is not responsible for the labour-induced changes proposed by both authors [249, 289]. Furthermore, I found that NF-κB mediated the stretch-induced changes in both PR-B and PR-total. Interestingly, basal PR-total mRNA expression decreased in the presence of MAPK inhibitors, whereas the MAPK activator, anisomycin, increased PR expression, suggesting that MAPK is involved in the up-regulation of basal PR expression. Previously, we showed that the up-regulation of labour-associated genes by stretch and IL-1β required both MAPK
- 101 - Chapter 3: Uterine stretch and progesterone action and NF-κB activation [85], but my data suggest that they have opposing effects in the case of PR expression.
3.3.4. Stretch increases PR-B activity in the absence of progesterone
These data indicate a novel link between mechanical stretch and unliganded PR-B transcriptional activity in a cell cycle mediator-dependent fashion. Up to now, despite the increasing importance of the unliganded PR, there are very few studies of hormone-independent activation of human PR and its downstream targets. AP-1 activity was first reported to be stimulated by unliganded PR in human endometrial adenocarcinoma cells while the addition of MPA impaired the unliganded PR-induced AP-1 activation [291]. More recently, a study by Carol Lange et al. not only demonstrated that the activation of CDK2 can increase PR-B transcriptional activity by phosphorylation, but also identified that phosphorylation of the serine 400 site mediated this effect. Interestingly, they found that two out of three cell lines displayed a CDK2-induced increased in PR-B activity. However, the last cell line showed completely no response to increasing concentrations of constitutively active CDK2. This cell line expresses a high level of p27 (a natural CDK inhibitor), which physically interacts with cyclin A/CDK2 [339]. This might explain the failure of constitutively active CDK2 to increase PR-B activity. My study indicates that mechanical stretch can induce PR-B activation through CDK2-driven PR phosphorylation in USMCs. However, overexpression of CDK2 failed to elevate the PR-B transcriptional activity even with increasing concentrations, suggesting that USMCs might also express relatively high basal levels of CDK inhibitors, such as p27 and p21. In this case, stretch might induce a decline in p27 and/or p21, which may then liberate CKD2 to activate unliganded PR-B. Additionally, a PR-B construct with a mutation at Serine 400 site showed similar effects as wild-type PR-B, indicating that the PR-B serine 400 site is not a key point in this stretch-induced PR-B activation. This suggests that the ability of CDK2 to increase PR activity may occur at other PR- B phosphorylation sites or may even be independent of PR-B phosphorylation, for example mediated through a PR co-activator SRC-1, alternatively, linker histones have also been reported to be the targets of CDK2 [259, 267, 340-342].
To conclude, these data show that progesterone does not inhibit stretch-induced changes in intracellular signalling and gene expression and that stretch does not affect
- 102 - Chapter 3: Uterine stretch and progesterone action the ability of progesterone to regulate gene expression, to bind to its response element, or to repress IL-1β-induced gene expression, although stretch does reduce PR expression and induce unliganded PR-B activation. These results may help us understand clinically why progesterone is ineffective in the prevention of stretch- induced preterm labour but also suggest that stretch is probably not responsible for the functional progesterone withdrawal seen with the onset of human labour.
- 103 - Chapter 4: GR mediates progesterone action
Chapter Four: Glucocorticoid Receptor is A Key
Player that Mediates Progesterone Action
- 104 - Chapter 4: GR mediates progesterone action
4. Glucocorticoid Receptor is a Key Player that Mediates
Progesterone Action
4.1. Introduction
Progesterone is widely used in several different formulations to reduce the risk of preterm labour in high-risk singleton pregnancies [48, 343, 344]. However, the mechanisms underpinning this effect are unclear. The precipitous fall in systemic progesterone levels that occurs before the onset of labour in virtually all non-primates does not occur in the human. Nevertheless, the seminal work of Csapo [317], who showed that progesterone was essential for the maintenance of early pregnancy, and the observation of Frydman et al, that mifepristone, the progesterone antagonist, can be used to induce labour [316], suggest that progesterone does play an important role in the maintenance of pregnancy in the human too. Animal studies suggest that progesterone acts predominantly to allow the uterus to tolerate stretch; in its absence uterine distension (with a pregnancy or artificially) up-regulates the expression of prolabour factors such as oxytocin receptor [59] and connexin-43 [58], stimulating the onset of labour. Progesterone does not seem to have a similar role in the human since randomised studies of progesterone administration in multiple pregnancies failed to show any prolongation of pregnancy [49, 74] and in vitro studies failed to show any effects on stretch-induced gene expression [279]. This suggests that in the human progesterone acts through different pathways to delay the onset of labour.
A mutual repression is thought to exist between NF-κB and PR in reproductive tissues, which determines the timing of the onset of labour [13]. Initial work by Kalkhoven et al reported that the trans-repression between PR and NF-κB occurred independently of PR isoform, reporter construct or cell type and, since PR and RelA interacted in vitro, suggested that the mutual repression was due to a direct interaction between the proteins [288]. This work was performed in Hela, Cos and the human breast cancer, T47D, cell lines, with overexpression of PR-B, PR-A and RelA and using PRE, MMTV and NF-κB reporter constructs [288]. Later studies by our group, in amnion cells, showed that IL-1β was able to repress progesterone-activation of a PRE and that overexpression of PR repressed the activity of an NF-κB reporter
- 105 - Chapter 4: GR mediates progesterone action construct [176]. More recently Mendelson’s group using immortalized human fundal myometrial cells found that progesterone suppressed the IL-1β-induced expression of COX-2 mRNA, and that this effect was blocked by RU486 [290]. Using chromatin immunoprecipitation, they showed that the IL-1β-induced an increase in p65 binding to both proximal and distal NF-κB binding elements of the COX-2 promoter was reduced by progesterone [290]. They also found that progesterone induced the expression of IκB, which binds to p65 in the cytoplasm, and concluded that this was the mechanism likely to be responsible for progesterone repression of IL-1β activity [290]. These and our earlier data are weakened by the use of overexpression of PR and/or p65 and by the use of cell lines, making it uncertain whether these data can be extrapolated to the in vivo situation. Consequently, uncertainty remains as to the true nature of the relationship between progesterone, its receptors and NF-κB.
In this chapter, I have re-examined the evidence in support of the existence of a mutual repression between PR and NF-κB and investigated potential alternative explanations for the inhibition of inflammatory cytokine-driven COX-2 expression by progesterone. Key differences in this work in comparison to previous work is the use of progesterone and NF-κB-responsive genes to assess the degree of mutual repression and TF:TF arrays, complimented by knockdown studies as well as studies using reporter constructs and the overexpression of PR and NF-κB.
- 106 - Chapter 4: GR mediates progesterone action
4.2. Results
4.2.1. The mutual repression of NF-κB and progesterone receptor activity
4.2.1.1. IL-1β represses progesterone action via NF-κB
Firstly, the concentration of MPA and progesterone (P4) was optimized and 1 µM of MPA and 10 µM of P4 were chosen in my following experiments (Figure 4-1). Using primary USMCs transfected with a PRE, the overexpression of PR-B in the presence of MPA increased PRE activation and this was repressed by IL-1β (p<0.05; Figure 4-2, A). Overexpression of p65 alone repressed MPA/PR-B-driven PRE activity and this effect was more marked in the presence of IL-1β (both p<0.05; Figure 4-2, A). Knockdown of p65 inhibited the ability of IL-1β to repress MPA/PR-B activation of the PRE (Figure 4-2, B). This repression was evident in the similar increase seen in FKBP5 mRNA expression in response to MPA and P4 in IL-1β treated cells (Figure 4-2, C).
Figure 4-1 The opitimizition of the concentration of MPA and P4.
USMCs were exposed to different stimuli, IL-1β (5 ng/µl), MPA (1 µM, 10 µM and 100 µM) and P4 (1 µM, 10 µM and 100 µM), either alone or in combination. mRNA was then extracted, and the COX-2 mRNA levels were measured using qPCR. Data are expressed as mean ± SEM (n=3).
- 107 - Chapter 4: GR mediates progesterone action
A * B 500 * 200 NS * 400 150 300 * 100 200 * 50
100 Percentage Change in Luc/Renilla Ratio Luc/Renilla in Change Percentage
Percentage Change in Luc/Renilla Ratio Luc/Renilla in Change Percentage 0 0
) ) ) ) )
SG5+PRE(MPA)
PR-B+PRE(MPA)
PR-B+PRE+p65(MPA)
SG5+PRE(MPA+IL-1
PR-B+PRE+siNT(MPA)
PR-B+PRE(MPA+IL-1
PR-B+PRE+sip65(MPA)
PR-B+PRE+p65(MPA+IL-1
PR-B+PRE+siNT(MPA+IL-1 PR-B+PRE+sip65(MPA+IL-1
** C ** 15000 150 * *** ** *** *** 10000 100
5000 50
Percentage Change in FKBP5:GAPDH in Change Percentage Percentage Change in FKBP5:GAPDH in Change Percentage
0 0
P4
+P4
+P4
MPA
IL-1
+MPA
+MPA
control
IL-1
IL-1
& IL-1
& IL-1
Δ Δ vehicle & P4
Δ Δ vehicle & MPA
Δ Δ IL-1 Δ Δ IL-1
Figure 4-2 IL-1β represses MPa and P4 action via NF-κB.
A, USMCs were transiently co-transfected with a progesterone response element (PRE), with or without progesterone receptor B (PR-B) and p65. SG5 was used as control. MPA and IL-1β were added 24 h after transfection and the cells were incubated for another 24 h before luciferase assay. B, USMCs were transfected with either siRNA for p65 (sip65) or a non-targeting siRNA (siNT) as control. After 72 h, cells were co-transfected with PR-B and PRE. MPA and IL-1β were added at day 4 post-transfection and cells were then incubated for another 24
- 108 - Chapter 4: GR mediates progesterone action h before luciferase assay. C, USMCs were exposed to different stimuli, IL-1β, MPA and P4, either alone or in combination. mRNA was then extracted, and the FKBP5 mRNA levels were measured using qPCR. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using Wilcoxon matched pairs test. * indicates a significant difference of p<0.05, **, of P<0.01, and ***, of P<0.001; NS indicates no statistic significant difference (n=6-12).
4.2.1.2. PR-B inhibits NF-κB activity
Conversely, overexpression of PR-B alone inhibited p65-driven activation of an NF- κB reporter construct (p<0.01) and this effect was enhanced by MPA (p<0.01; Figure 4-3, A). Similarly, MPA and P4 repressed IL-1β-driven COX-2 mRNA expression (Figure 4-4, C-E). The mutual repression was possibly explained by the ability of PR- B and p65 to bind to each other as shown by the immunoprecipitation of C-terminal Halo-tagged PR-B and Strep-tagged p65 (Figure 4-3, B) and the increased binding of activated p65 to PR-B in IL-1β-stimulated cells in a TF:TF array (Figure 4-3, C).
200 A ** * 150 ** 100
50
Percentage Change in Luc/Renilla Ratio Luc/Renilla in Change Percentage 0
B-Luc+SG5+p65
B-Luc+PR-B+p65
NF-
NF-
B-Luc+SG5+p65(MPA)
B-Luc+PR-B+p65(MPA)
NF- NF-
- 109 - Chapter 4: GR mediates progesterone action
Figure 4-3 PR-B inhibits NF-κB activity.
A, USMCs were transiently co-transfected with a NF-κB luciferase construct (NF-κB-Luc) and p65, with or without PR-B. SG5 was used as control. MPA were added 24 h after transfection and the cells were incubated for another 24 h before luciferase assay. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using paired t test. * indicates a significant difference of p<0.05 and **, of P<0.01 (n=6). B, Strep-tagged
- 110 - Chapter 4: GR mediates progesterone action p65 (Strep-p65) and Halo-tagged PR-A (with Halo tag linked on the C terminus, HcA) or PR-B (with Halo tag linked on the N terminus, HnB; with Halo tag linked on the C terminus, HcB) were transfected into USMCs as indicated. Parental halo-tag construct (HT2) was used as control. Cell lysates were then immunoprecipitated using anti-Strep antibody. The immunoprecipitates were examined by Western blotting using anti-Halo antibody. Input represented 10% of cell lysates used in the co-IP experiment. C, TF:TF array. The nuclear extracts were isolated from USMCs that were untreated and treated with IL-1β for 6 h. Each transcription factor (TF) is represented in four spots on the blot in a 2*2 grouping of two rows and two columns. The first row consists of DNA spotted normally, and the second row consists of DNA diluted 1:10. Array analysis of TFs binding to p65 in IL-1β simulated USMCs was carried out using a Panomics TransSignal TF-TF array system. Both the left and right panel show hybridization signals of TFs binding to p65 using anti-p65 antibody, and normal IgG was used as control. The table show the identities of TFs in the array that bind to p65 after treatment. The most prominent NF-κB binding TFs detected in the array are underlined. The TF:TF array was done by Shirin Khanjani.
4.2.1.3. Effect of PR modulation on progesterone inhibition of IL-1β-driven
COX-2 expression
Neither overexpressed PR-B or PR-A enhanced the ability of MPA to repress IL-1β- driven COX-2 mRNA expression (Figure 4-4, A and B). The progesterone antagonist, Org31710, also failed to block this effect, whereas RU486, which inhibits both P4 and glucocorticoid activity, was able to reverse the MPA and P4 inhibition of IL-1β- driven COX-2 mRNA expression (Figure 4-4, C). Similarly when PR and AR were silenced, it had no effect on either MPA or P4 inhibition of IL-1β, only GR knockdown reversed their ability to block IL-1β-driven COX-2 mRNA expression (Figure 4-4, D). To exclude the possibility that the action of P4 was mediated though increased HSD11β1 expression and the consequent increased conversion of cortisone to cortisol, the knockdown of HSD11β1 was performed, but again this had no effect on MPA/P4 inhibition of IL-1β activity (Figure 4-4, E). I then confirmed that glucocorticoid (dexamethasone, Dex) acted exclusively via GR but not PR to repress IL-1β-driven COX-2 expression (Figure 4-4, F).
- 111 - Chapter 4: GR mediates progesterone action
A NS 500 * * * * 400
300
200
100 Percentage Change in COX-2:GAPDH in Change Percentage
0
MPA MPA
IL-1 IL-1
vehicle vehicle
MPA+IL-1 MPA+IL-1 control PR-B
B NS 1000 * 800 ** * 600 **
400
200 Percentage Change in COX-2:GAPDH in Change Percentage
0
MPA MPA
IL-1 IL-1
vehicle vehicle
MPA+IL-1 MPA+IL-1 control PR-A
C * * 6000 * * * * NS 4000 *
2000 Percentage Change in COX-2:GAPDH in Change Percentage
0
) )
P4
+P4
+P4) +P4)
MPA
IL-1
+MPA
+MPA) +MPA)
vehicle
RU-486
IL-1
Org31710
IL-1
RU-486 (P4) RU-486
RU-486 (MPA) RU-486
Org31710(P4)
RU-486 (IL-1 RU-486
Org31710(MPA)
Org31710(IL-1
RU-486 (IL-1 RU-486
RU-486 (IL-1 RU-486 Org31710(IL-1 Org31710(IL-1
- 112 - Chapter 4: GR mediates progesterone action
** D 5000 ** ** 4000 ** ** *** NS ** *** 3000 *** **
2000
1000
PercentageChange in COX-2:GAPDH 0
) ) ) )
+P4) +P4) +P4) +P4)
siNT
siPR
siAR
siGR
+MPA) +MPA) +MPA) +MPA)
siNT (P4)
siPR (P4)
siAR (P4)
siGR (P4)
siNT (MPA)
siPR (MPA)
siAR (MPA)
siNT (IL-1
siGR (MPA)
siPR (IL-1
siAR (IL-1
siGR (IL-1
siNT (IL-1
siPR (IL-1
siAR (IL-1
siGR (IL-1
siNT (IL-1
siPR (IL-1
siAR (IL-1 siGR (IL-1
150 150 150
100 100 100
50 50 50
RelativeIntensity
RelativeIntensity RelativeIntensity
0 0 0
siNT siGR siNT siAR
PR-B PR-A siNT siPR
- 113 - Chapter 4: GR mediates progesterone action
* F 2000 * * * * 1500 *
1000
# #
500 Percentage Change in COX-2:GAPDH in Change Percentage
0
) ) )
siNT
siPR
siGR
+Dex) +Dex) +Dex)
siNT(Dex)
siPR(Dex)
siGR(Dex)
siNT(IL-1
siPR(IL-1
siGR(IL-1
siNT(IL-1
siPR(IL-1 siGR(IL-1
Figure 4-4 The effect of PR modulation on P4 inhibition of IL-1β-driven COX-2 expression.
A and B, USMCs were transfected with PR-B or PR-A. SG5 was used as control. MPA and IL-1β, either alone or in combination were added 48 h after transfection and the cells were incubated for another 6 h. mRNA was then extracted, and the COX-2 mRNA levels were measured using qPCR. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using Wilcoxon matched pairs test. * indicates a significant difference of p<0.05 and **, of P<0.01; NS indicates no statistic significant difference (n=6). C, USMCs were pre-incubated
- 114 - Chapter 4: GR mediates progesterone action with Org31710 (1 μM) or RU486 (1 μM) for 2 h before being exposed to different stimuli, IL-1β, MPA and P4, either alone or in combination. mRNA was then extracted, and the COX-2 mRNA levels were measured using qPCR. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using paired t test. * indicates a significant difference of p<0.05; NS indicates no statistic significant difference (n=6). D, USMCs were transfected with different siRNAs against PR (siPR), GR (siGR) and AR (siAR), respectively. Non-targeting siRNA (siNT) was used as control. After transfection, cells were incubated for 96 h before being exposed to different stimuli, IL-1β, MPA and P4, either alone or in combination. mRNA was then extracted, and the COX-2 mRNA levels were measured using qPCR. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using paired t test. ** indicates a significant difference of p<0.01 and ***, of P<0.001; NS indicates no statistic significant difference (n=6). E, USMCs were transfected with siRNA against HSD11β1 (siHSD11β1). siNT was used as control. After transfection, cells were incubated for 96 h before being exposed to different stimuli, IL-1β, MPA, P4 and Dex, either alone or in combination. mRNA was then extracted, and the COX-2 mRNA levels were measured using qPCR. Data are expressed as mean ± SEM (n=3). F, USMCs were transfected with different siRNAs against PR and GR. siNT was used as control. After transfection, cells were incubated for 96 h before being exposed to different stimuli, IL-1β and Dex, either alone or in combination. mRNA was then extracted, and the COX-2 mRNA levels were measured using qPCR. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using Wilcoxon matched pairs test. * indicates a significant difference of p<0.05 and # of P<0.05 between samples exposed to both IL-1β and Dex with or without GR knockdown (n=6).
4.2.2. P4 acts via both PR and GR to drive gene expression
P4 increased FKBP5 mRNA expression via a combination of PR and GR, but the increase of HSD11β1 mRNA is via PR alone (Figure 4-5, A and B). In contrast, MPA acted via GR exclusively to increase both FKBP5 and HSD11β1 mRNA (Figure 4-5, C and D).
- 115 - Chapter 4: GR mediates progesterone action
A ** B 1500 * 250 *** ** 200 ** 1000 150
100 500
50 Percentage Change in FKBP5:GAPDH in Change Percentage
0 HSD11B1:GAPDH in Change Percentage 0
siNT
siNT
siNT (P4) siNT
siNT(P4)
siPR (P4) siPR (P4) siAR
siPR(P4) siAR(P4)
siGR (P4) siGR siGR(P4)
C 15000 *** D 500 *** *** *** 400 10000 300
200 5000
100 Percentage Change in FKBP5:GAPDH in Change Percentage
0 HSD11B1:GAPDH in Change Percentage 0
siNT
siNT
siNT(MPA)
siNT(MPA)
siPR(MPA) siAR(MPA)
siPR(MPA) siAR(MPA)
siGR(MPA) siGR(MPA)
Figure 4-5 The effect of PR modulation on P4-responsive genes expression.
A-D, USMCs were transfected with different siRNAs against PR (siPR), GR (siGR) and AR (siAR), respectively. Non-targeting siRNA (siNT) was used as control. After transfection, cells were incubated for 96 h before being exposed to MPA or P4. mRNA was then extracted, and the mRNA levels of FKBP5 and HSD11β1 were measured using qPCR. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using Wilcoxon matched pairs test. * indicates a significant difference of p<0.05, **, of P<0.01, and ***, of P<0.001 (n=6-12).
4.2.3. The mechanism of P4 and MPA actions on IL-1β inhibition
It was confirmed that GR could bind p65 in USMCs using immunoprecipitation (Figure 4-6, A). To assess whether activation of GR and p65 mutually changed their nuclear translocation, nuclear and cytosolic protein were extracted and showed that neither MPA nor P4 repressed IL-1β-induced p65 phosphorylation and nuclear translocation and similarly, nor did IL-1β repress MPA/P4 induced nuclear translocation of GR (Figure 4-6, B and C).
I then assessed whether MPA/P4 altered p65 binding to both proximal and distal NF- κB binding elements of the COX-2 promoter and no change was found, however, GR knockdown enhanced p65 binding to both elements (Figure 4-6, D), but this was not
- 116 - Chapter 4: GR mediates progesterone action associated with an increase in COX-2 mRNA expression (Figure 4-4, D). HDAC inhibitors have been shown to partially reverse glucocorticoid inhibition of IL-1β- induced expression of GM-CSF [309], however, TSA did not change the MPA inhibition of IL-1β-driven COX-2 expression and actually tended to enhance the effect of P4 (Figure 4-6, E). The ability of GR to inhibit LPS-induced COX-2 expression was found to be associated with increased GR/GRIP-1 recruitment to the p65 DNA complex and increased MKP-1 activity, which reduced AP-1 activity [308]. Therefore, to address the importance of GRIP-1 in this context, GRIP-1 knockdown was carried out in USMCs, but the result showed that this did not alter the MPA/P4 inhibition of IL-1β-driven COX-2 expression (Figure 4-6, F). However, when the MKP-1 activity was inhibited, the ability of MPA/P4 to inhibit IL-1β activity was significantly reduced (Figure 4-6, G); interestingly, both P4 and MPA increased MKP-1 expression, which was mediated by GR (Figure 4-6, H).
- 117 - Chapter 4: GR mediates progesterone action
- 118 - Chapter 4: GR mediates progesterone action
D
60000
40000 B 1 (%1 B Input)
20000 NF-
0
) ) ) ) ) )
siNT
siGR
siNT (IL-1
siGR (IL-1
siNT (P4+IL-1
siGR (P4+IL-1
siNT (MPA+IL-1 siGR (MPA+IL-1
400000
300000
200000
B 2 (%2 B Input)
100000 NF-
0
) ) ) ) ) )
siNT
siGR
siNT (IL-1
siGR (IL-1
siNT (P4+IL-1
siGR (P4+IL-1
siNT (MPA+IL-1 siGR (MPA+IL-1
E 1500 * * ** # NS 1000 NS
500 Percentage Change in COX-2:GAPDH in Change Percentage
0
+P4
TSA
IL-1
+TSA
+MPA
vehicle
IL-1
+P4+TSA
IL-1
IL-1
+MPA+TSA
IL-1 IL-1 - 119 - Chapter 4: GR mediates progesterone action
** 2500 *** G ** *** ** # 2000 ** ## 1500 ## 1000
500
## Percentage Change in COX-2:GAPDH in Change Percentage
0
+P4 +P4
IL-1
Sang
+MPA +MPA
vehicle
IL-1
IL-1
Sang+IL-1 Sang+IL-1
Sang+IL-1
- 120 - Chapter 4: GR mediates progesterone action
*** H 800 ### **
600
400 ##
200 Percentage Change in MKP-1:GAPDH in Change Percentage
0
siNT
siPR
siGR
siNT(P4)
siPR(P4)
siGR(P4)
siNT(MPA) siPR(MPA) siGR(MPA)
Figure 4-6 The mechanism of action of P4 and MPA on IL-1β inhibition.
A, In vivo co-IP experiment was carried out in USMCs cells. Cell lysates from cells treated with or without IL-1β and MPA for 30 min, 1 h, and 2 h, respectively, were incubated with anti-GR antibody. For Western blotting of immunoprecipitates, anti-p65 antibody was used. Input represented 10% of cell lysates used in the co-IP experiment. B and C, USMCs were exposed to different stimuli, IL-1β, MPA or P4, either alone or in combination for 0 min, 30 min, 1 h, 2 h and 6 h. Cytosolic and nuclear extracts were prepared as described in the Materials and Methods and analysed by Western blotting using antibodies directed against total p65, phosphor-p65 (Ser536) and GR. TATA-bind protein (TBP) and α-tubulin were used as the internal controls for cytosolic and nuclear fraction, respectively. D, USMCs were transfected with siGR. siNT was used as control. After transfection, cells were incubated for 96 h before being exposed to different stimuli, IL-1β, MPA and P4, either alone or in combination for 1 h. The cells were then treated with 1% formaldehyde to cross-link chromatin, which was sonicated and immunoprecipitated using anti-p65 antibody. DNA was isolated and two NF-κB binding sites were measured by qPCR. Data are expressed as mean ± SEM (n=3). E, USMCs were pre-incubated with Trichostatin A (TSA, 0.5 μM) for 1 h before being exposed to different stimuli, IL-1β, MPA and P4, either alone or in combination. mRNA was then extracted, and the COX-2 mRNA levels were measured using qPCR. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using paired t test. * indicates a significant difference of p<0.05 and **, of P<0.05; #, of p<0.05 vs. baseline (n=6). F, USMCs were transfected with siRNA against GRIP-1 (siGRIP-1). siNT was used as control. After transfection, cells were incubated for 96 h before being exposed to different stimuli, IL-1β, MPA and P4, either alone or in combination. mRNA was then extracted, and the COX-2 mRNA levels were measured using qPCR. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using paired t test. * indicates a significant difference of p<0.05 and **, of P<0.01 (n=6). G, USMCs were pre-incubated with sanguinarine (Sang, 0.5 μM) for 30 min before being exposed to different stimuli, IL-1β, MPA and P4, either alone or in combination. mRNA was then extracted, and the COX-2 mRNA levels were measured using qPCR. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using paired t test. ** indicates a significant difference of p<0.01 and ***, of P<0.001; #, of p<0.05 and ##, of p<0.01 between samples exposed to the same stimuli but with or without Sang (n=6). H, USMCs were transfected with siPR or siGR. Non-targeting siRNA (siNT) was used as control. After transfection, cells were incubated for 96 h before being exposed to MPA or P4. mRNA was then extracted, and the MKP-1 mRNA levels were measured - 121 - Chapter 4: GR mediates progesterone action using qPCR. Data are expressed as median, 25th and 75th percentiles and range, and were analysed using paired t test. ** indicates a significant difference of p<0.01 and ***, of P<0.001; ##, of p<0.01 and ###, of P<0.001 vs. baseline (n=12).
Figure 4-7 A schematic diagram of the inhibitory effect of P4 on IL-1β-driven COX-2 expression in USMCs.
Progesterone inhibits IL-1β-induced COX-2 expression via GR-mediated MKP-1 activation, whereas the phosphorylation, nuclear translocation and DNA binding activity of p65, the HDAC activation and the recruitment of GRIP-1 on GR-p65 protein complex are not involved.
- 122 - Chapter 4: GR mediates progesterone action
4.3. Summary and Discussion
These data suggest that P4 inhibition of IL-1-driven COX-2 expression in USMC is independent of any inhibition of p65 activity, but rather is mediated via a GR-induced activation of MKP-1. However, the ability of IL-1 to inhibit MPA/PR-B-driven PRE activation and gene expression is probably mediated through an inhibition of PR action by p65.
In the first study to identify a mutual inhibition between PR and NF-κB, Kalkhoven et al found that this effect was independent of PR isoform, reporter construct, or cell type used and demonstrated a direct interaction between PR and p65 in vitro [288]. In addition, they found that TNFα treatment repressed PR activity, and that conversely PR repressed TNFα-induced NF-κB activation [288]. These findings were replicated in primary amnion cells [176] and in my current study, a similar response was found in primary USMCs and the effect of IL-1β on PR-B activity was mediated via p65. The interaction of p65 and PR-B was also confirmed by immunoprecipitation with over expressed Halo-tagged PR-B, but p65 did not bind to Halo-tagged PR-A. It was also shown that activated p65 bound to PR in non-transfected primary USMCs, indicating that this interaction occurs endogenously. These data were consistent with the mutual inhibition identified by Kalkhoven et al [288] and consequently, I expected that the increased PR-B levels by transient transfection might lead to an enhanced inhibition of IL-1β-driven COX-2 expression. However, overexpression of PR-B (or of PR-A) had no effect on either P4 or MPA inhibition of IL-1β activity. Then I used the specific P4 antagonist Org31710 to block the effects of P4, but this agent had no effect, in contrast to the PR/GR antagonist RU486, which reduced the inhibitory effect of both MPA and P4. Org31710 has a similar affinity for PR as RU486, but a 30-fold lower affinity for GR [345], suggesting that neither P4 nor MPA were acting via PR, rather the effect of RU486 suggested that their actions were mediated via GR. Indeed, the knockdown study confirmed that both P4 and MPA were acting via GR. Since it has been previously observed that progesterone enhanced the expression of HSD11β1 in USMCs [279], it was possible that P4’s GR dependency was mediated via enhanced expression of HSD11β1 and the consequent increased conversion of cortisone to cortisol. However, knockdown of HSD11β1 had no effect on the ability of P4 or MPA to repress IL-1β-induced COX-2 expression, making it more likely that
- 123 - Chapter 4: GR mediates progesterone action
P4 and MPA are acting directly via GR to mediate their effects on IL-1β-driven COX- 2 expression. Indeed, P4 has been suggested to act via GR to inhibit placental CRH synthesis [231] and 20α-hydroxysteroid dehydrogenase expression in the rat corpus luteum [346] and to down-regulate the TLR4-mediated activation of macrophages [347]. However, the evidence in these papers was based on the absence of detectable PR and the ability of RU486 to block the P4 effects [231, 346] and the inability of a specific PR agonist to down-regulate TLR4 actions [347]. In contrast, my results from the antagonist study are supported by knockdown of PR and GR, which proved that P4 acted via GR to inhibit IL-1β-driven COX-2 expression. It also showed that P4 acted via both PR and GR to up-regulate FKBP5 and only via PR to up-regulate HSD11β1 mRNA expression in USMCs, whereas the effects of MPA were mediated exclusively via GR.
Activated GR has been shown to inhibit NF-κB activity through a variety of mechanisms including delaying the nuclear translocation of activated p65 [304], HDAC activation [309], the incorporation of GR and GRIP-1 into the transcriptional complex [308] and the inhibition of MKP-1 activation [308, 348, 349]. Interestingly, although GR was confirmed to interact with p65 in USMCs, there was relatively little delay in the nuclear translocation of either of them, suggesting that this does not account either for the P4/GR repression of IL-1β activity or the p65 repression of GR action in USMCs. The IL-1β-induced p65 binding to COX-2 promoter was also unaffected by P4.
HDAC inhibitors in their own right have been shown to be potent anti-inflammatory agents, inhibiting both LPS-induced TNFα expression and TNFα-induced expression of inflammatory genes [350]. The anti-inflammatory effects of glucocorticoid have been related to GR-regulated inhibition of histone acetylation by repressing CBP- associated HAT activity and also by recruiting HDAC2 to the p65-CBP HAT complex [309]. However, I found that HDAC inhibition did not alter the ability of MPA and tended to enhance the ability of P4 to inhibit IL-1β suggesting that P4/GR repression of IL-1β is not mediated via HDAC activation in USMCs. These observations are consistent with those of Condon et al, who found that histone acetylation decreased in myometrial samples with advancing gestation in the mouse and human and that the administration of the HDAC inhibitor, TSA, prolonged mouse gestation [351]. - 124 - Chapter 4: GR mediates progesterone action
GRIP-1 can function as both a co-repressor and a co-activator by binding to nuclear receptors. In a recent paper, GR bound GRIP-1 was recruited to the p65 DNA complex and repressed the LPS-induced COX-2 expression, confirmed by the fact that GRIP1 knockdown reduced the glucocorticoid inhibition of LPS-induced COX-2 expression [308]. However, the knockdown of GRIP1 had no effect on P4/GR inhibition of IL-1β activity in my study. Finally, since GR has been shown to act via MKP-1 to repress AP-1 activity in a variety of tissues [308, 348, 349], I inhibited MKP-1 activity and found that the ability of P4/GR to repress IL-1β activity was attenuated, suggesting that this maybe the mechanism through which P4 inhibits IL- 1-induced COX-2 expression in USMCs.
These data show that while p65 does repress PR activity, P4 acts via GR-induced MKP-1 activation to repress p65 induced gene expression. Thus, only half of the proposed mutual inhibition between PR and NF-κB appears to be active in USMCs. Nevertheless, the ability of NF-κB to repress PR may be sufficient to explain the withdrawal of P4 action with the onset of human labour.
- 125 - Chapter 5: Affymetrix microarray analysis
Chapter Five: Gene Networks and Cellular Functions
that Regulated by Progesterone and Glucocorticoid
Receptors in USMCs
- 126 - Chapter 5: Affymetrix microarray analysis
5. Gene networks and cellular functions that regulated
by progesterone and glucocorticoid Receptors in
USMCs
5.1. Introduction
The progesterone receptor, glucocorticoid receptor, androgen receptor, and mineralocorticoid receptor are classic type I receptors in nuclear receptor superfamily. They are structurally conserved, ligand-dependent intracellular transcription factors, regulating the transcription of target genes upon ligand binding [352, 353]. Physiologically, they play crucial roles in a variety of fundamental biological processes such as metabolism, immune function, development, homeostasis, and reproduction. As the ligands of these steroid receptors, progesterone, glucocorticoid, androgen, and mineralocorticoid can freely across the plasma membrane without the help from membrane receptors due to their lipophilic nature [302]. The classic genomic mechanism of these steroid receptors to regulate gene expression has already been characterized [255]. Upon binding to their hormonal ligand, the receptors release chaperone proteins, such as heat shock proteins and immunophilins, translocate from the cytoplasm into the nucleus, directly regulate their responsive gene by contacting promoters/enhancers at sequence-specific DNA response elements. However, there is growing evidence that steroid receptors can also regulate gene expression via protein- protein interactions with other transcription factor such as NF-κB (through interaction with p65 subunit), AP-1 (fos/jun), C/EBPβ, and Stat5 [288, 291, 292, 354, 355]. Both mechanisms require ligand activation and exchange of chaperone proteins and co- regulators [356-360].
Inflammation plays a central role in many human diseases. Several nuclear receptors have been found as key regulators in response to inflammatory processes. Human parturition resembles an inflammatory reaction, where progesterone and progesterone receptors have already been demonstrated to suppress contraction-associated gene expression [232]. In my study, GR also showed the ability to mediate progesterone’s anti-inflammatory effect. In fact, there are many similarities between PR and GR in hormone-regulated events. For instance, both of them recognize the same DNA - 127 - Chapter 5: Affymetrix microarray analysis binding sequence; they rely on HATs and several common co-regulators for its activity [361-363]. Despite these similarities, clear differences have been observed in their binding to the HRE region of MMTV promoter [364], suggesting that the DNA binding of these two receptors not only depends on the specific DNA sequence, but is also influenced by other factors such as sets of co-regulators, chromatin state, cell type-specific transcription factors, and signaling pathways [365, 366]. Their functions, biologic activities, structural properties, and ligands are summarized in Table 5-1 and Table 5-2, respectively.
Table 5-1 Summary of the functions, biologic activities, structural properties, and ligands for PR.
Receptor nomenclature NR3C3 Other names PGR, progesterone receptor Molecular information Hs: 933aa, P06401; Rn: 923aa, Q63449; Mm: 923aa, Q00175. DNA binding Homodimer; HRE core sequence: GGTACANNNTGTTCT Partners HSP90: cellular localization; HMGB: DNA binding; Src family kinases: activation of rapid signalling cascades, independent of PR DNA binding. Agonists Progesterone (P4), Levonorgestrel, medroxyprogesterone, promegestone (R5020), dydrogesterone, norethisterone Antagonists Asoprisnil, mifepristone (RU486), Org31710 Biologically important isoform PR-A (Hs, Mm, Rn): N-terminally truncated isoform that is a weak transcriptional activator of specific target genes in a cell type-dependent manner and a strong repressor of transactivation by PR-B and other steroid receptors; PRB (Hs): full-length protein that strongly activates target genes. Tissue distribution Mammary gland, uterus, brain, muscle, testis, ovary (Hs, Mm, Rn) Functional assay Inhibition of proliferation in endometrial cells caused by treatment of ovariectomized (estrogen-treated) mice with progesterone (Mm); Proliferation in PR-positive breast cancer cells and normal breast epithelial cells (Hs); Mammary gland ductal tree branching and lobuloalveolar development in ovariectomized (estrogen- treated) mice treated with progesterone (Mm). Main target genes Activated: FSHβ, multidrug resistance 1B (Mm), Stat5A (Hs), 11β-hydroxysteroid dehydrogenase (Hs), Indian hedgehog (Mm) Mutant phenotype Disruption of both PR-A and PR-B isoforms results in impaired sexual behavior, anovulation, uterine dysfunction, and reduced ductal branching and lobuloalveolar development in the mammary gland (Mm) [knockout]; Targeted overexpression of PR-A in the mammary gland results in reduced induction of apoptosis (Mm) [overexpression]. Human disease Pseudocorpus luteum insufficiency: due to decreased PR expression; Breast cancer: higher PR-A/PR-B ratio correlates with increased tumor grade; Endometriosis: due to reduced expression of PR-B (not PR-A) in diseased tissue; Endometrial cancer: increased risk caused by polymorphisms in the PR promoter favoring expression of PR-B. Adapted from Challis Lu, N.Z., et al., Pharmacol Rev, 2006. 58(4): p. 782-97 [367].
- 128 - Chapter 5: Affymetrix microarray analysis
Table 5-2 Summary of the functions, biologic activities, structural properties, and ligands for GR.
Receptor nomenclature NR3C1 Other names PGR, progesterone receptor Molecular information Hs: 777aa, P04150; Rn: 795aa, P06536; Mm: 783aa, P06537. DNA binding Homodimer; HRE core sequence: GGTACANNNTGTTCT Partners HSP90: cellular localization; HMGB: DNA binding; AP-1, NF-κB: transactivation; 14-3-3ζ: cellular localization, transactivation. Agonists Dexamethasone, triamcinolone acetonide, prednisolone, triamcinolone, cortisol, corticosterone Antagonists RU-486 Biologically important isoform GRα (Hs, Mm, Rn): main isoform1; GRβ (Hs): widely expressed alternative splicing variant lacking ligand binding, associated with several diseases; GR-A, B, C, D (Hs, Mm, Rn): alternative translation initiation isoforms with distinct transcriptional activities and tissue distribution patterns. Tissue distribution Ubiquitous (Hs, Mm, Rn) Functional assay Suppression of endogenous cortisol level by exogenous dexamethasone (Hs); Apoptosis of thymocytes in the thymus (Rn); Elevated blood glucose level by intravenous injection of glucocorticoids (Hs). Main target genes Activated: MKP-1 (Mm), lipocortin-1 (Hs); Repressed: IL-8 (Hs), TNF-α (Hs). Mutant phenotype GR-/- mice die within hours because of respiratory failure. They have atelectatic lungs, impaired liver function, impaired HPA axis, increased plasma levels of ACTH and corticosterone and enlarged adrenal glands that produce no adrenaline (Mm) [knockout]; Mice expressing type II GR antisense RNA exhibit impaired T-cell function, disrupted HPA axis, increased plasma levels of ACTH and corticosterone, reduced GR binding, and alterations in thymocyte migration (Mm) [antisense oligonucleotide]. Human disease Glucocorticoid resistance: due to various SNPs; Glucocorticoid hypersensitivity: due to an N363 polymorphism; Asthma and acute childhood lymphoblastic leukemia: due to a receptor mutation. Adapted from Challis Lu, N.Z., et al., Pharmacol Rev, 2006. 58(4): p. 782-97 [367].
Results from the last chapter indicate that the progesterone actions, including progesterone-induced gene expression and progesterone’s anti-inflammatory effect, are mediated by PR, GR or both. Consequently, I performed microarray studies in USMCs to identify more genes that are regulated by P4/MPA through PR and/or GR and that are simply regulated by PR or GR, whereby it is possible to gain a broader view and help us understand the role of PR and GR in human parturition.
- 129 - Chapter 5: Affymetrix microarray analysis
5.2. Results
5.2.1. Samples preparation
Six term non-labouring human myometrium biopsies were collected at the time of caesarean section. Cells were cultured and transfected with siRNA as described in the Materials and Methods. Four days after transfection, cells were exposed to different stimuli (Table 5-3) for 6 h, and then total RNA and protein were extracted from each culture. The concentration and purity of RNA were determined by value of OD260:280. The effectiveness and selectiveness of PR and GR knockdown were assessed by western blot (Figure 5-1). Three samples (B, D, and F) were chosen as representatives for Affymetrix Human Genome U133 plus 2.0 Array. Among them, Sample D has the lowest endogenous PR level, whereas their GR levels are similar.
Table 5-3 Experiment design for microarray analysis.
7. siNT (vehicle) 9. siNT (MPA) 10. siNT (P4) 13. siPR (vehicle) 15. siPR (MPA) 16. siPR (P4) 19. siGR (vehicle) 21. siGR (MPA) 22. siGR (P4)
Figure 5-1 Western blot analysis of PR and GR knockdown.
USMCs were isolated from myometrium of non-labouring women. PR and GR were knocked down using siRNA before being exposed to MPA, P4 or vehicle. Protein was extracted and the western blotting performed as described in Materials and Methods. siNT, non-target siRNA; siNR, siRNA for PR (upper panel) and GR (middle panel); A-F, the sample ID (n=6).
5.2.2. Analysis methods and gene lists
After general array Quality Control (QC) and data export, the data were normalized using Robust Multichip Average (RMA) and imported into Partek. Array data were then checked for any outliers and overall grouping/separation using Principal
- 130 - Chapter 5: Affymetrix microarray analysis
Component Analysis (PCA). The PCA was plotted (Figure 5-2) depending on cell samples (B, D, and F) and also for the 9 different conditions (these are described as 7, 9, 10, 13, 15, 16, 19, 21, and 22). The plot shows that the Sample D is differentiating from the other two groups, which is also distinct according to the endogenous PR level (Figure 5-1). But at this stage there was no real outlier that I could exclude from further analysis.
At the gene level, exon data were summarized by mean value to obtain one expression value per gene. This data were then analyzed using the ANOVA statistical model to determine significance in gene expression for each gene between control and test groups. Figure 5-3 shows that signal intensity across the samples is comparable and there is no outlier in this plot. Figure 5-4 shows that the majority of variation in this experiment cannot be attributed to external error but is inherent within the samples, therefore, the variation observed in groups is more likely to be real (dependents on the p value). However, majority of the variation in this comes from the attribute (cell groups B, D, and F) rather than the condition (7, 9, 10, 13, 15, 16, 19, 21, and 22). Comparison of this data was carried out and gene lists were generated to check for any significant differentially expressed genes between treatment groups (Appendix 1 to Appendix 16).
- 131 - Chapter 5: Affymetrix microarray analysis
Figure 5-2 Principal Component Analysis mapping.
- 132 - Chapter 5: Affymetrix microarray analysis
Left, the PCA plot for the three different cell sample (B, D, and F) groupings based on colour. Right, the PCA plot for the 9 different conditions (7, 9, 10, 13, 15, 16, 19, 21, and 22) is based on colour and cell grouping (B, D, and F) is based on shape.
Figure 5-3 A histogram representing the signal intensity across all arrays.
Figure 5-4 Sources of Variation at the gene level.
- 133 - Chapter 5: Affymetrix microarray analysis
5.2.3. Top functions of gene networks
A web based microarray pathway analysis program called Ingenuity was used to characterise the expression pattern of the regulated genes, their location within cellular pathways and functions in each gene network. Eight gene lists were generated by combining of top 50 up-regulated and top 50 down-regulated genes from each comparison (Table 5-4 Function analysis of eligible genes in each comparison.). In each list, genes were further filtered based on the p value. Only the genes with p value less than 0.05 were eligible to be analysed.
Table 5-4 Function analysis of eligible genes in each comparison.
Name of the Top functions Details comparison siNT vs. siNT (MPA) 1. Cardiovascular System Development and Function, Connective Tissue Appendix 17 Development and Function, Organismal Development 2. Cell Death, Hematological System Development and Function, Gene Expression 3. Cellular Assembly and Organization, Gene Expression, Cellular Movement 4. Cell Death, Renal Necrosis/Cell Death, Cell-To-Cell Signaling and Interaction siNT vs. siNT (P4) 1. Cellular Development, Cellular Growth and Proliferation, Appendix 18 Hematological System Development and Function 2. Cellular Assembly and Organization, Lipid Metabolism, Small Molecule Biochemistry siNT vs. siGR 1. Gene Expression, Cellular Movement, Neurological Disease Appendix 19 siNT vs. siPR 1. Cell-To-Cell Signaling and Interaction, Cellular Growth and Appendix 20 Proliferation, Skeletal and Muscular System Development and Function 2. Inflammatory Response, Cell-To-Cell Signaling and Interaction, Cellular Growth and Proliferation 3. Cell Death, DNA Replication, Recombination, and Repair, Tumor Morphology siNT vs. siGR (MPA) 1. Cell Death, Lipid Metabolism, Small Molecule Biochemistry Appendix 21 2. Immunological Disease, Cardiac Arrythmia, Cardiovascular Disease siNT vs. siGR (P4) 1. Infection Mechanism, Cell Death, Gene Expression Appendix 22 2. Protein Trafficking, Cardiovascular Disease, Lipid Metabolism siNT vs. siPR (MPA) 1. Connective Tissue Development and Function, Organismal Functions, Appendix 23 Skeletal and Muscular System Development and Function 2. Carbohydrate Metabolism, Molecular Transport, Small Molecule Biochemistry 3. Cell Cycle, Neurological Disease, Cellular Development 4. Cellular Movement, Hematological System Development and Function, Immune Cell Trafficking siNT vs. siPR (P4) 1. Lipid Metabolism, Small Molecule Biochemistry, Vitamin and Mineral Appendix 24 Metabolism 2. Lipid Metabolism, Small Molecule Biochemistry, Endocrine System Development and Function
5.2.4. Identification and validation of candidate genes
Based on the fold change, the function analysis and the signaling pathways which are known to be involved in human parturition, several genes were selected from the microarray results. They were FKBP5, ERBB receptor feedback inhibitor 1 (ERRFI1), dual specificity phosphatase 1 (DUSP1), ATP-binding cassette, sub-family
- 134 - Chapter 5: Affymetrix microarray analysis
A, member 1 (ABCA1) and HSD11β1 [MPA and/or P4 up-regulated]; heat shock 70kDa protein 7 (HSPA7), interleukin 33 (IL33), tumor necrosis factor receptor superfamily, member 11b (TNFRSF11B), interleukin 17A (IL17A) and COX-2 [MPA and/or P4 down-regulated]; IL-1β, potassium voltage-gated channel subfamily E member 4 (KCNE4), hydroxy-delta-5-steroid dehydrogenase, 3 beta (HSD3β1) and ectodysplasin A2 receptor (EDA2R) [siPR and/or siGR up-regulated]; protein phosphatase 1, regulatory (inhibitor) subunit 8 (PPP1R8), ubiquilin 4 (UBQLN4), potassium voltage-gated channel subfamily E member 2 (KCNE2) and AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (AHSA2) [siPR and/or siGR down-regulated]. To confirm the results from this cDNA microarray, independent studies by qPCR was performed on the candidate genes (Figure 5-5). In total, twelve cDNA samples coming from different cell preps, which were first transfected with non-target, PR, or GR siRNA and then exposed to MPA or P4 for 6 h, were used for this validation.
FKBP5, ERRFI1, DUSP1 and HSD11β1 can be up-regulated by both MPA and P4, whereas ABCA1 seems to be a pure progesterone-responsive gene and not affected by MPA (Figure 5-5, A-E). The pathways of MPA/P4 to increase these genes expression showed different patterns. For instance, GR mediated the effect of MPA/P4 on both ERRFI1 and DUSP1 as only GR knockdown blocked the MPA/P4-driven these two genes expression (Figure 5-5, B and C). In the case of HSD11β1, the effect of MPA was mediated by GR, while P4 played its role via PR (Figure 5-5, E). Similarly, the effect of MPA on FKBP5 expression was also mediated by GR but P4-induced increase in FKBP5 was distinct as both PR and GR were shown to be implicated (Figure 5-5, A). Intriguingly, the up-regulation of ABCA1 by P4 was not attenuated by the knockdown of either PR or GR; rather the trend was for it to enhance P4’s effect (Figure 5-5, D).
Another five genes were identified as MPA/P4 repressed genes. Among them, HSPA7 and IL33 were only down-regulated by MPA in a GR-dependent manner (Figure 5-5, I and J). GR also mediated the negative effect of MPA and P4 on COX-2 and TNFRSF11B expression (Figure 5-5, K and L). Both PR and GR were involved in the down-regulation of IL-1β by MPA and P4 (Figure 5-5, F).
- 135 - Chapter 5: Affymetrix microarray analysis
Interestingly, not all identified target genes were regulated in a ligand-dependent manner. For instance, ABAC1, HSPA7 and IL-1β mRNA levels remained unchanged in the absence of GR, yet transfection of PR siRNA resulted in significant increases in their transcript levels (Figure 5-5, D, F and I). In contrast, GR silencing increased the expression of KCNE4 and EDA2R while PR knockdown had no effect (Figure 5-5, G, and H). This suggests that even unliganded PR and GR play a role in regulating gene expression in human USMCs.
Although several genes showed inconsistent results with the microarray, some of them displayed a completely distinct pattern, in which the differences occurred among cell preps rather than conditions. In one set of experiment containing cDNAs from six different cell preps, the mRNA levels of HSD3β1 and IL17A in three cell preps were remarkably higher than the others (Figure 5-6).
To dissect out the role of GR in mediating MPA/P4-responsive genes, USMCs were treated with dexamethasone (Dex), a relatively GR-preferential agonist. I found that all five identified MPA/P4-repressed genes (COX-2, IL-1β, TNFRSF11B, IL33 and HSPA7) were also down-regulated by Dex. These reductions were only abolished by the knockdown of GR but not PR (Figure 5-7, A-E). On the other hand, GR also mediated Dex-induced increases of FKBP5, HSD11β1, DUSP1 and ERRFI1, which were also induced by MPA and P4 (Figure 5-7, F-I). ABCA1, which is a putative progesterone-responsive gene, had no change upon the treatment of Dex compared with baseline; however, in the absence of GR, Dex significantly induced its expression (Figure 5-7, J).
- 136 - Chapter 5: Affymetrix microarray analysis
100000 *** A *** 800 B * :GAPDH ** *** :GAPDH 10000 * ***
600 FKBP5 *** ERRFI1 1000 400 ** 100 200
10
Percentage in Change 0
Percentage Change in
NT
NT
siPR
siGR
siPR
siGR
NT (P4) NT
NT (P4) NT
siPR (P4) siPR
siGR (P4) siGR
NT (MPA) NT
siPR (P4) siPR
siGR (P4) siGR
NT (MPA) NT
siPR (MPA) siPR
siGR (MPA) siGR
siPR (MPA) siPR siGR (MPA) siGR
*** 400 C 800 *** D :GAPDH *** :GAPDH ** 300 600 ***
ABCA1 ** DUSP1 200 400 ** ** 200 100
0 0
Percentage in Change
Percentage in Change
NT
NT
siPR
siGR
siPR
siGR
NT (P4) NT
NT (P4) NT
siPR(P4)
siGR (P4) siGR
NT (MPA) NT
siPR (P4) siPR
siGR (P4) siGR
NT (MPA) NT
siPR(MPA)
siGR (MPA) siGR
siPR (MPA) siPR siGR (MPA) siGR * ** *** 250 **
E 500 * F * :GAPDH
:GAPDH 200 1 *** * 400 IL-1 150
HSD11 300 100 200 * *** *** 100 50
0 Percentage Change in 0
Percentage Change in
NT
NT
siPR
siPR
siGR
siGR
NT NT (P4)
NT(P4)
siPR (P4) siPR
siGR (P4) siGR
siPR (P4) siPR
NT NT (MPA)
siGR(P4)
NT(MPA)
siPR (MPA) siPR
siGR (MPA) siGR
siPR (MPA) siPR siGR(MPA)
G 250 H 300 :GAPDH :GAPDH 200
200 * EDA2R KCNE4 150 ** 100 100 50
0 0
Percentage in Change Percentage Change in
NT
NT
siPR
siPR
siGR
siGR
NT(P4)
NT (P4) NT
siPR (P4) siPR
siPR (P4) siPR
siGR(P4)
NT(MPA)
siGR (P4) siGR
NT (MPA) NT
siPR (MPA) siPR
siPR (MPA) siPR siGR(MPA) siGR (MPA) siGR
- 137 - Chapter 5: Affymetrix microarray analysis
I 400 *** 250
J ** :GAPDH
*** :GAPDH 200
300 IL33
HSPA7 150 200 100 ** * ** 100 50
0 Percentage in Change 0
Percentage in Change
NT NT
siPR siPR
siGR siGR
NT (P4) NT (P4) NT
siPR (P4) siPR (P4) siPR
siGR (P4) siGR (P4) siGR
NT (MPA) NT (MPA) NT
siPR (MPA) siPR (MPA) siPR
siGR (MPA) siGR (MPA) siGR
*** * K 200 200
*** L ***
:GAPDH :GAPDH 150 150
COX-2 ** TNFRSF11B 100 100 *** *** *** 50 50
0 0
Percentage Change in
Percentage Change in
NT
NT
siPR
siPR
siGR
siGR
NT (P4) NT
NT(P4)
siPR (P4) siPR
siPR (P4) siPR
siGR (P4) siGR
NT (MPA) NT
siGR(P4)
NT(MPA)
siPR (MPA) siPR
siPR (MPA) siPR
siGR (MPA) siGR siGR(MPA)
M 200 N 200
:GAPDH :GAPDH
150 150
PPP1R8 UBQLN4 100 100
50 50
0 0
Percentage in Change
Percentage in Change
NT NT
siPR siPR
siGR siGR
NT (P4) NT (P4) NT
siPR (P4) siPR (P4) siPR
siGR (P4) siGR (P4) siGR
NT (MPA) NT (MPA) NT
siPR (MPA) siPR (MPA) siPR siGR (MPA) siGR
O 300 (MPA) siGR P 500 :GAPDH :GAPDH 400
200 AHSA2 KCNE2 300
* 200 100 100
0 0
Percentage in Change Percentage in Change
NT NT
siPR siPR
siGR siGR
NT (P4) NT (P4) NT
siPR (P4) siPR (P4) siPR
siGR (P4) siGR (P4) siGR
NT (MPA) NT (MPA) NT
siPR (MPA) siPR (MPA) siPR
siGR (MPA) siGR (MPA) siGR
Figure 5-5 Validation of putative MPA/P4-responsive and PR/GR-dependent genes.
For microarray validation, USMC cultures were first transfected with non-target, PR, or GR siRNA and then treated with MPA or P4 for 6 h, and mRNA levels of candidate genes were measured using qPCR. Data are shown as the median, the 25th and 75th percentiles and the range, and were compared using Wilcoxon matched pairs test for data that were not normally distributed and paired t test for data that were normally distributed. * indicates a significant difference of p<0.05, **, of p<0.01, and ***, of p<0.001. * on top of a condition indicates the
- 138 - Chapter 5: Affymetrix microarray analysis comparison between that condition and baseline; * on top of a capped line indicates the comparison between that two conditions (n=12).
Figure 5-6 Quantitation analysis of HSD3β1 and IL17A. mRNA levels of HSD3β1(top panel) and IL17A (bottom panel) were measured by qPCR. Amplification curve of each sample was shown in log scale. The curves were separated into two groups and marked with black circles and squares (n=6).
- 139 - Chapter 5: Affymetrix microarray analysis
A 150 F 5000 * :GAPDH :GAPDH * 4000 *
100 COX-2
FKBP5 * 3000
* 2000 50 * 1000
0 0
Percentage in Change
Percentage in Change
NT NT
NT (Dex)NT (Dex)NT
siPR (Dex)siPR (Dex)siPR
siGR(Dex) siGR(Dex)
200
B * G 300 *
:GAPDH :GAPDH
1 *
150
IL-1 200 * 100 HSD11
** 100 50 **
Percentage in Change 0 0
Percentage Change in
NT
NT
NT(Dex)
NT (Dex)NT
siPR(Dex)
siGR(Dex)
siPR (Dex)siPR siGR(Dex)
150 * 2000
C :GAPDH H
:GAPDH * 1500 *
100 * DUSP1
TNFRSF11B 1000
50 * * 500
0 0
Percentage in Change
Percentage in Change
NT
NT
NT (Dex)NT
NT (Dex)NT
siPR (Dex)siPR
siPR (Dex)siPR
siGR(Dex) siGR(Dex)
150 800
D * I * :GAPDH
:GAPDH * 600 *
IL33 100 * ERRFI1 400 * 50 200
Percentage in Change 0 0
Percentage in Change
NT NT
NT (Dex)NT (Dex)NT
siPR (Dex)siPR (Dex)siPR
siGR(Dex) siGR(Dex)
E 150 * J 250 ** :GAPDH :GAPDH 200 **
100 ABCA1 HSPA7 * 150
100 50 50
0 0
Percentage in Change Percentage in Change
NT NT
NT (Dex)NT (Dex)NT
siPR (Dex)siPR (Dex)siPR
siGR(Dex) siGR(Dex)
Figure 5-7 The effect of GR selective agonist (Dex) on MPA/P4-responsive genes. - 140 - Chapter 5: Affymetrix microarray analysis
USMC cultures were first transfected with non-target, PR, or GR siRNA and then treated with Dex for 6 h, and mRNA levels of candidate genes were measured using qPCR. Data are shown as the median, the 25th and 75th percentiles and the range, and were compared using Wilcoxon matched pairs test for data that were not normally distributed and paired t test for data that were normally distributed. * indicates a significant difference of p<0.05, and **, of p<0.01. * on top of a condition indicates the comparison between that condition and baseline; * on top of a capped line indicates the comparison between that two conditions (n=6).
- 141 - Chapter 5: Affymetrix microarray analysis
5.3. Summary and Discussion
As one of the pleiotropic hormones, progesterone plays an essential role in regulating all aspects of female reproduction, including ovulation, embryo implantation and parturition. The actions of progesterone in gestational tissues appear to be predominantly mediated by PRs, which function as ligand-activated modulators of gene expression. In humans, elevated progesterone levels suggest a functional progesterone withdrawal at the onset of labour by the alteration of PR. However, some studies indicate that GR is also involved in regulating labour-associated gene expression [231, 368], which implies an important role of GR in human parturition. Given that GR can also be activated by progesterone binding, some of progesterone actions may also be mediated by GR.
The myometrium is maintained in a quiescent state by progesterone for most of the pregnancy, but once activated, it is said to become one of the strongest muscles in the human body, which contracts until birth is achieved [369]. Thus, understanding the mode of action of progesterone on the myometrium is a very important topic. It appears that progesterone relaxes the myometrium by down-regulating the expression of genes encoding CAPs, which induce labour. Although it has been suggested that there is an interaction between PR and other transcription factors on the promoters of CAP genes and a production of specific micro-RNAs [369], more studies are still required to uncover the true molecular mechanisms.
In this chapter, gene networks and cellular functions regulated by P4 or MPA in the presence or absence of PR and GR in USMCs were investigated by microarray analysis. A number of candidate genes were selected and the validation was performed by qPCR. Eight genes were confirmed to be regulated by P4. Among them, only one gene (HSD11β1) was purely mediated by PR, whereas four genes (ERRFI1, DUSP1, COX-2 and TNFRSF11B) were GR dependent. FKBP5 and IL-1β were shown to be mediated by both steroid receptors. The up-regulation of ABCA1 by P4 was not affected by either GR or PR knockdown, although silencing PR increased its expression from the basal level, supporting the concept that its regulation is via a distinct mechanism.
MPA, a 17-OH P4 derivative, is widely used to simulate progesterone action in many in vitro studies. As expected, almost all the P4-responsive genes, except ABCA1, - 142 - Chapter 5: Affymetrix microarray analysis were also regulated by MPA in USMCs and most of their expression regulations shared the same mechanism as seen in response to P4. However, besides the progestogenic property, MPA also has glucocorticoid effects [370], suggesting that some genes might be differentially regulated compared with P4. This is most clearly demonstrated in the case of FKBP5 and HSD11β1, for which the effect of MPA is mediated by GR; whereas P4 induces their expression mainly via PR. MPA also acts specifically via GR to up-regulate IL33 and HSPA7, which are unaffected by P4. These data suggest that GR mediates P4 effects on some progesterone-responsive genes in USMCs.
To further confirm GR function, cells were exposed to Dex, which is GR specific agonist, and the expressions of GR-mediated genes were detected by qPCR. The results indicated that Dex drives the same GR-mediated genes as defined in response to MPA and P4 and also in a GR-dependent manner. Although ABCA1 is not mediated by both steroid receptors and is only response to P4, GR knockdown significantly increased its expression in the presence of Dex, implying that Dex, like P4, might be able to act through other mechanisms in the absence of its receptor.
All the P4-responsive genes can be generally divided into two groups based on the up- regulation or down-regulation by progesterone. It appears that the P4-repressed genes are all inflammation-related. IL-1β (a very important pro-inflammatory cytokine) and COX-2 (the central enzyme responsible for the prostaglandin biosynthesis) have already been discussed in the previous chapters. TNFRSF11B, also named osteoprotegerin (OPG), is another P4 down-regulated gene, which belongs to the TNF-receptor superfamily. It acts as a decoy receptor for the receptor activator of nuclear factor kappa B ligand (RANKL), which plays a crucial role for bone remodeling. Clinically, the OPG level in maternal plasma is higher in the third trimester than in the first trimester of pregnancy, suggesting its involvement in the regulation of bone turnover in order to meet the demands of fetal skeleton development during pregnancy [371]. In contrast, to perform the formation and activation of osteoclasts and bone resorption, RANKL needs to bind with RANK (receptor activator of nuclear factor kappa B). Given its importance, this OPG/RANKL/RANK system has been extensively studied. A number of cytokines and hormones were found to be able to modulate this system, such as IL-1β and TNF- α (increased RANKL) [372], glucocorticoids (increased RANKL and decreased OPG - 143 - Chapter 5: Affymetrix microarray analysis expression) [373, 374], and estrogen (increased OPG expression) [374, 375]. Similarly, a reduction of OPG by Dex was shown in my data. Compared with the increasing effect of estrogen on OPG, progesterone decreased its expression in USMCs, which also appears to be consistent with their opposing roles in controlling uterine contractility.
I have previously discussed the function of FKBP5, HSD11β1 and DUSP1 (also named MKP-1) in the other chapters. Here two other genes were found to be up- regulated by P4, ERRFI1 and ABCA1. ERRFI1 (also known as Mig-6) is an immediate early response gene, which increases in response to various mitogens [376, 377]. It functions as a negative regulator of epidermal growth factor receptor (EGFR)- mediated mitogenic signaling. Several studies have identified it to be a tumor suppressor gene [378-381], but very little is known about its role in reproductive biology. Recently, Mig-6 was found to be regulated by progesterone in mice [382] and its expression was down-regulated in endometrial RNA taken from women with endometriosis [383]. Another animal study reported an important role of Mig-6 in uterine physiology by showing that it can regulate the ability of progesterone to attenuate estrogen signaling [384]. More importantly, this study demonstrated that the regulatory effect of progesterone on Mig-6 was mediated by PR and SRC-1 in all compartments of the endometrium including the epithelium and stroma but not myometrium [384]. This supports my data in which Mig-6 was GR dependently regulated by both P4 and MPA in USMCs.
ABCA1, which has a unique regulatory pattern in my list of progesterone-responsive genes, is a member of the ATP-binding cassette transporter superfamily. It mainly functions as a cholesterol efflux pump mediating the transport of cholesterol, phospholipids, and other lipophilic molecules across cellular membranes [385]. It is highly expressed in various human tissues, such as uterus, prostate and placenta [386]. More recently, a number of cell types in human placenta have been found to express ABCA1, such as cytotrophoblast cells, amnion epithelial cells, and macrophages [387], which suggests its involvement in maternal-fetal cholesterol delivery. As the precursors of steroid hormone biosynthesis (Figure 1-8), cholesterol and its derivatives might be affected by aberrations in ABCA1 leading to the alteration of steroid homeostasis. In a rat smooth muscle cell line, the expression of ABCA1 was found to be up-regulated by cAMP via the increased expression of prolactin - 144 - Chapter 5: Affymetrix microarray analysis regulatory element-binding (PREB) protein, which is a transcription factor that regulates prolactin promoter activity [388]. Given that progesterone can increase cAMP release in human myometrium [389], it could be possible that in my study the increase of ABCA1 in response to P4 was mediated through cAMP/PREB pathway.
Although HSD3β1 and IL17A did not pass the validation, they displayed a very intriguing result with remarkable difference among cell preps, which suggested that their expression was more likely to be affected by the factors inherit in the patient rather than any exogenous stimuli which the cells were exposed to. HSD3β1 is one of 3β-hydroxysteroid dehydrogenase (3βHSD) isoforms, which play a crucial role in the steroid hormone biosynthesis [390]. It is primarily expressed in the placenta, whereas the other isoform HSD3β2 mainly localizes in the ovary, adrenal gland, and testis [390-392]. Given that placenta becomes the source of progesterone production after 7- 8 weeks of gestation, HSD3β1 appears to be essential for the placental progesterone biosynthesis and the maintenance of human pregnancy. The regulation of this enzyme was first investigated in mouse trophoblast cells and two transcription factors: AP-2γ and Dix-3 were identified to determine its expression [392]. In humans, although the corresponding AP-2γ and Dix-3 binding sites were also found in the promoter, neither of them was involved in regulating its expression. Instead, transcription enhance factor (TEF)-5 and GATA-like protein were demonstrated to control HSD3β1 expression in human trophoblast cells by site-specific mutations [393]. The difference in the regulation of the placental-specific HSD3β1 expression between humans and mice might reflect the different mechanism of progesterone withdrawal in these two species.
IL17A belongs to IL17 family, which consists of several related cytokines (IL17A-F). The major source of IL17A is memory T lymphocytes, but it has also been detected in some other cell types, such as eosinophiles, neutrophils and splenocytes [394-396]. As a pro-inflammatory cytokine, IL17A activates NF-κB and stimulates the production of other inflammatory cytokines and chemokines including IL-6, IL-8, GM-CSF and MCP-1 [397-399]. Recently, the expression of IL17A has been found in the human placenta [400] and preterm delivery has shown to be associated with low maternal serum IL17 [401], suggesting the involvement of this cytokine in human pregnancy. The regulation of IL17 has been widely investigated and two patterns have been identified. In the first pattern, IL23 mediates IL17 production via the activation of - 145 - Chapter 5: Affymetrix microarray analysis
Jak2, PI3K/Akt, STAT3 and NF-κB signaling pathways. In contrast, the second pattern is IL23 independent, which was found in TGF-β and IL-6-induced IL17 expression. However, further studies are required to understand the role of HSD3β1 and IL17A in human myometrium and how the difference among cell preps correlates with different patients.
In summary, I have shown that the MPA and P4 generally regulate distinct gene networks and cellular functions in USMCs due to, at least in part, the glucocorticoid effect of MPA [370, 402], while only a small proportion of genes are sensitive to both MPA and P4. Interestingly, in comparison to PR, GR governs the expression of the majority of progesterone-responsive genes, suggesting a more important role of GR in regulating myometrium function in human parturition. More studies are required to define the role played by GR in human myometrium and to elucidate the molecular mechanisms involved. Although animal studies have been providing some clues, the differences in progesterone withdrawal between humans and laboratory animals limit their importance. Therefore, by using primary cultured USMCs, the gene lists generated from this microarray could provide more direct and valuable information for future studies.
- 146 - Chapter 6: Final summary and discussion
Chapter Six: Final Summary and Discussion
- 147 - Chapter 6: Final summary and discussion
Preterm labour is one of the major problems in obstetrics and the most important cause of perinatal mortality and morbidity. Currently, no effective treatment has been found because the mechanisms of controlling the process of human birth are still unclear, although progesterone administration can reduce the risk of preterm labour in singleton pregnancy. Nevertheless, it has been suggested that the changes of endocrine, mechanical and biochemical events occurring throughout the pregnancy affect the transformation of the uterus from relative quiescence to contractility and control the timing of labour. In line with this suggestion, the studies in this thesis have focused on investigating the actions of progesterone in human myometrium and how these actions and the mechanical and biochemical events interact with each other during pregnancy and labour.
Firstly, the mutual effects between progesterone and mechanical stretch in USMCs were investigated. The data showed that progesterone did not inhibit stretch-induced ERK1/2 activation and gene expression including COX-2, IL-8 and OTR. This suggested that different mechanisms are probably involved in stretch- and IL-1β- induced COX-2 expression and may explain why progesterone is ineffective in the prevention of preterm labour in multiple pregnancy. In another series of in vitro experiments, I found that the mechanical stretch can reduce PR-B expression via NF- κB signalling pathway and increase unliganded PR-B-driven PRE activity. However, this was not sufficient to affect the ability of progesterone to regulate gene expression, drive PR-B activity and repress IL-1β-induced COX-2 expression, suggesting that stretch may not be responsible for the functional progesterone withdrawal seen with the onset of labour.
Secondly, I have investigated the relationship between progesterone and the pro- inflammatory cytokine IL-1β as the biochemical events involved in parturition resemble an inflammatory reaction including pro-inflammatory cytokines production and the prostaglandin biosynthesis. The results from luciferase studies showed that IL-1β repress the MPA-induced PR-B-driven PRE activity in a NF-κB-dependent manner. This was supported by both NF-κBp65 overexpression and knockdown. Furthermore, the physical interaction between p65 and liganded PR-B was confirmed by co-immunoprecipitation studies in USMCs, suggesting that the reduction of liganded PR-B activity by IL-1β is via the trans-repression effect of p65. Conversely, progesterone also inhibited IL-1β-driven COX-2 mRNA expression. The mechanism - 148 - Chapter 6: Final summary and discussion has been reported in cell lines pointing to a crucial role of PR in this process [290]. However, GR, but not PR, was found to mediate the negative effect of progesterone on IL-1β-driven COX-2 expression in primary cultured USMCs by using steroid receptor antagonists and gene silencing. The regulation of a progesterone-responsive gene, FKBP5, further confirmed the ability of GR to mediate progesterone action. To understand the mechanism of how progesterone-activated GR represses IL-1β- induced increase in COX-2, several hypotheses were tested. Although there is also a physical interaction between GR and p65, IL-1β-induced p65 phosphorylation, nuclear translocation and NF-κB DNA binding activity on COX-2 promoter were not affected by progesterone-activated GR. It was also suggested that GRIP-1 was recruited to p65-GR-DNA complex and contributed to COX-2 repression [308]. However, the silencing of GRIP-1 did not alter progesterone action in this context. Nevertheless, the inhibition of MKP-1 reversed the ability of P4/GR to repress IL-1β activity, suggesting that this explains at least in part the P4/GR inhibition of IL-1β- induced COX-2 expression in USMCs.
Subsequently, microarray analysis was performed to further explore gene networks and cellular functions regulated by progesterone via PR and/or GR in USMCs. In order to simplify the information, the large amount of data obtained was filtered according to the p value and the fold change and the top 50 genes were listed from each comparison. Several of the most interesting genes, which are known to be relevant to human parturition, were validated by qPCR. The expression of the majority of these genes in response to progesterone was mediated by GR, suggesting that the cross-talk between progesterone and GR may play an essential role in governing myometrial functions. Additionally, the database generated from this microarray study and the one from Chapter 3 will help us uncover the gene networks involved in both the short- and long-term progesterone response of USMCs.
In conclusion, the data presented in this thesis suggest that progesterone actions mainly affect the biochemical events rather than the mechanical events in human labour and in turn, these biochemical events may play the major role in the functional progesterone withdrawal.
Based on the findings in this thesis, a list of my future potential work is as follows:
- 149 - Chapter 6: Final summary and discussion
1. Investigate the mechanism of stretch to enhance IL-1β-driven COX-2 protein synthesis in USMCs. 2. Identify the target transcription factors of MKP-1 on COX-2 promoter in USMCs. 3. Detect the levels of PR, GR and other genes of interest obtained from the microarray in myometrial tissue samples. 4. Generate the Cre/loxP mice in which PR or GR can be specifically deleted in myometrium at any given time point. 5. Investigate the role of PR and GR in myometrium by combining the prolonged pregnancy mouse model and the Cre/loxP mouse model.
- 150 - Appendices
Appendices
Appendix 1 Top 50 up-regulated genes by MPA.
[siNT down vs. gene_assignment Gene Symbol RefSeq siNT (MPA)] FK506 binding protein 5 FKBP5 NM_001145775 -10.1806 ERBB receptor feedback inhibitor 1 ERRFI1 NM_018948 -4.7261 glutamate-ammonia ligase GLUL NM_002065 -3.92993 carboxypeptidase M CPM NM_001874 -3.34205 serpin peptidase inhibitor, clade E SERPINE1 NM_000602 -3.17567 LIM domain only 3 LMO3 NM_018640 -3.02374 acyl-CoA synthetase long-chain family member 1 ACSL1 NM_001995 -3.00662 TSC22 domain family, member 3 TSC22D3 NM_198057 -2.95099 ADAM metallopeptidase with thrombospondin type 1 ADAMTS1 NM_006988 -2.87867 leucine rich repeat containing 16A LRRC16A NM_017640 -2.85091 metallothionein 1X MT1X NM_005952 -2.77447 dual specificity phosphatase 1 DUSP1 NM_004417 -2.67883 chromosome 13 open reading frame 15 C13orf15 NM_014059 -2.67738 forkhead box O3B pseudogene FOXO3B NR_026718 -2.62036 LIM and cysteine-rich domains 1 LMCD1 NM_014583 -2.60417 leucine rich repeat (in FLII) interacting protein 1 LRRFIP1 NM_001137550 -2.51611 FYVE, RhoGEF and PH domain containing 4 FGD4 NM_139241 -2.47239 LOC100131826 LOC100131826 AY358789 -2.38424 glucosaminyl (N-acetyl) transferase 1 GCNT1 NM_001490 -2.38064 amyloid beta (A4) precursor protein-binding, family B APBB2 NM_004307 -2.3805 LAG1 homolog, ceramide synthase 6 LASS6 NM_203463 -2.3765 fibulin 5 FBLN5 NM_006329 -2.37051 stomatin STOM NM_004099 -2.36929 monoamine oxidase A MAOA NM_000240 -2.35942 metallothionein 1E MT1E NM_175617 -2.3566 enolase 1, (alpha) ENO1 NM_001428 -2.34723 cysteine-rich secretory protein LCCL domain CRISPLD2 NM_031476 -2.30339 hypothetical protein DKFZp686O24166 DKFZp686O24166 NR_026750 -2.30305 integrin, alpha 5 ITGA5 NM_002205 -2.27655 slingshot homolog 2 SSH2 NM_033389 -2.2759 PHD finger protein 17 PHF17 NM_199320 -2.2746 laminin, beta 1 LAMB1 NM_002291 -2.27239 interleukin-1 receptor-associated kinase 3 IRAK3 NM_007199 -2.26938 podoplanin PDPN NM_006474 -2.26006 adaptor protein, phosphotyrosine interaction APPL2 NM_018171 -2.25611 hippocampus abundant transcript-like 1 HIATL1 NM_032558 -2.2281 nidogen 1 NID1 NM_002508 -2.19888 ribosomal protein L10 RPL10 NR_026898 -2.14762 peptidase domain containing associated with muscle regeneration PAMR1 NM_015430 -2.12378 fibrillin 2 FBN2 NM_001999 -2.07049 transforming growth factor, beta receptor II TGFBR2 NM_001024847 -2.06922 glucosidase, alpha; neutral AB GANAB NM_198335 -2.06723 24-dehydrocholesterol reductase DHCR24 NM_014762 -2.06649 midline 2 MID2 NM_012216 -2.0651 immunoglobulin heavy constant alpha 1 IGHA1 AK128476 -2.06414 transforming growth factor, beta receptor III TGFBR3 NM_003243 -2.05633 platelet-derived growth factor receptor, alpha PDGFRA NM_006206 -2.04788 solute carrier family 7 SLC7A2 NM_003046 -2.0312 tubulin, beta polypeptide 4, member Q TUBB4Q NM_020040 -2.01811 NHP2 non-histone chromosome protein 2-like 1 NHP2L1 NM_005008 -2.00347
- 151 - Appendices
Appendix 2 Top 50 down-regulated genes by MPA.
[siNT up vs. gene_assignment Gene Symbol RefSeq siNT (MPA)] Similar to LOC166075 LOC401097 NM_001168214 8.93239 tumor necrosis factor receptor superfamily, member 11b TNFRSF11B NM_002546 3.14793 interleukin 33 IL33 NM_033439 3.13668 cytochrome c oxidase subunit VIIb COX7B NM_001866 3.12023 chemokine (C-C motif) ligand 7 CCL7 NM_006273 2.89512 regulator of G-protein signaling 4 RGS4 NM_001102445 2.80386 fibroblast growth factor 9 FGF9 NM_002010 2.52337 histone cluster 1 HIST1H2AJ NM_021066 2.48431 zinc finger protein 594 ZNF594 NM_032530 2.4486 pleckstrin homology domain containing, family A PLEKHA3 NM_019091 2.28099 chemokine (C-X-C motif) ligand 10 CXCL10 NM_001565 2.25363 integrin, beta 8 ITGB8 NM_002214 2.23566 matrix metallopeptidase 16 MMP16 AL136588 2.21571 keratinocyte growth factor-like protein 1 KGFLP1 NR_003674 2.21059 similar to tumor protein, translationally-controlle LOC389787 XM_001717250 2.16611 CD209 molecule CD209 NM_021155 2.14151 zinc finger protein 552 ZNF552 NM_024762 2.14084 transient receptor potential cation channel, subfamily A, TRPA1 NM_007332 2.12316 histidine triad nucleotide binding protein 3 HINT3 NM_138571 2.11933 hyaluronan synthase 2 HAS2 NM_005328 2.11382 tumor necrosis factor, alpha-induced protein 6 TNFAIP6 NM_007115 2.10245 protein phosphatase 1, regulatory (inhibitor) subunit 3C PPP1R3C NM_005398 2.07711 small nucleolar RNA, H/ACA box 73A SNORA73A NR_002907 2.05823 microRNA let-7a-2 MIRLET7A2 NR_029477 2.05731 small Cajal body-specific RNA 9 SCARNA9 NR_002569 2.05246 chemokine (C-C motif) receptor-like 1 CCRL1 NM_178445 2.05087 prostaglandin-endoperoxide synthase 2 PTGS2 NM_000963 2.01315 zinc finger protein 737 ZNF737 NM_001159293 1.99689 corepressor interacting with RBPJ, 1 CIR1 NM_004882 1.98874 zinc finger protein 277 ZNF277 ENST00000421043 1.95975 epithelial cell adhesion molecule EPCAM NM_002354 1.9583 microRNA 181b-1 MIR181B1 NR_029612 1.9518 5-hydroxytryptamine (serotonin) receptor 2B HTR2B NM_000867 1.95012 small nucleolar RNA, C/D box 13 SNORD13 NR_003041 1.9483 small nucleolar RNA, C/D box 47 SNORD47 NR_002746 1.94199 guanine nucleotide binding protein (G protein), gamma 2 GNG2 NM_053064 1.93202 zinc finger and BTB domain containing 38 ZBTB38 NM_001080412 1.92741 proteasome (prosome, macropain) subunit, alpha type, 3 PSMA3 NM_002788 1.92135 deleted in lymphocytic leukemia 2 DLEU2 NR_002612 1.91282 progesterone immunomodulatory binding factor 1 PIBF1 NM_006346 1.91097 chromosome 4 open reading frame 46 C4orf46 NM_001008393 1.89835 centrosomal protein 170kDa CEP170 NM_014812 1.89833 RNA binding motif protein 7 RBM7 NM_016090 1.89793 N-myc (and STAT) interactor NMI NM_004688 1.89785 heat shock 70kDa protein 7 (HSP70B) HSPA7 NR_024151 1.89072 latexin LXN NM_020169 1.88829 stanniocalcin 1 STC1 NM_003155 1.88245 RNA binding motif protein, Y-linked, family 1, member A1 RBMY1A1 NM_005058 1.87843 R-spondin 3 homolog RSPO3 NM_032784 1.85957 chromosome 21 open reading frame 34 C21orf34 NR_027790 1.85644
- 152 - Appendices
Appendix 3 Top 50 up-regulated genes by P4.
[siNT down gene_assignment Gene Symbol RefSeq vs. siNT(P4)] ATP-binding cassette, sub-family A (ABC1), member 1 ABCA1 NM_005502 -2.75844 FK506 binding protein 5 FKBP5 NM_001145775 -2.72812 LOC100131826 LOC100131826 AY358789 -2.64534 small nucleolar RNA, C/D box 26 SNORD26 NR_002564 -2.50998 hippocampus abundant transcript-like 1 HIATL1 NM_032558 -2.23635 ENST0000042802 vaccinia related kinase 2 VRK2 1 -2.10109 ERBB receptor feedback inhibitor 1 ERRFI1 NM_018948 -2.09597 small nucleolar RNA, H/ACA box 70G SNORA70G NR_033335 -2.06689 hypothetical protein DKFZp686O24166 DKFZp686O24166 NR_026750 -2.06126 mitochondrial ribosomal protein L45 MRPL45 NM_032351 -2.05865 transmembrane protein 199 TMEM199 NM_152464 -2.04879 postmeiotic segregation increased 2-like 1 pseudogene PMS2L1 NR_003613 -2.03471 transmembrane protein 111 TMEM111 NM_018447 -2.00364 microRNA 622 MIR622 NR_030754 -1.99393 fatty acid binding protein 3, muscle and heart FABP3 NM_004102 -1.99212 cirrhosis, autosomal recessive 1A CIRH1A NM_032830 -1.98269 small nuclear ribonucleoprotein polypeptide A SNRPA1 NM_003090 -1.97423 adaptor-related protein complex 4, beta 1 subunit AP4B1 NM_006594 -1.97143 solute carrier family 31 (copper transporters), member 1 SLC31A1 NM_001859 -1.94897 eukaryotic translation initiation factor 3, subunit L EIF3L NM_016091 -1.94246 solute carrier family 37 SLC37A3 NM_207113 -1.9315 polymerase (RNA) II (DNA directed) polypeptide G POLR2G NM_002696 -1.92569 cytochrome b5 reductase 1 CYB5R1 NM_016243 -1.91244 retinol dehydrogenase 11 RDH11 NM_016026 -1.91228 Niemann-Pick disease, type C1 NPC1 NM_000271 -1.912 amyloid beta (A4) precursor protein-binding, family B APBB2 NM_004307 -1.90965 acetyl-CoA carboxylase alpha ACACA NM_198839 -1.90307 membrane protein, palmitoylated 1 MPP1 NM_002436 -1.90278 NHP2 non-histone chromosome protein 2-like 1 NHP2L1 NM_005008 -1.8907 presenilin associated, rhomboid-like PARL NM_018622 -1.87751 glutamic-oxaloacetic transaminase 1 GOT1 NM_002079 -1.86537 zinc finger protein 90 ZNF90 AK298173 -1.85633 Der1-like domain family, member 1 DERL1 NM_024295 -1.85021 eukaryotic translation initiation factor 3, subunit I EIF3I NM_003757 -1.84026 elongation factor Tu GTP binding domain containing 1 EFTUD1 NM_024580 -1.83168 3-hydroxy-3-methylglutaryl-CoA reductase HMGCR NM_000859 -1.82625 bifunctional apoptosis regulator BFAR NM_016561 -1.82429 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase SMG1 NM_015092 -1.82221 LAG1 homolog, ceramide synthase 5 LASS5 NM_147190 -1.81841 transforming growth factor, beta receptor II TGFBR2 NM_001024847 -1.815 adaptor-related protein complex 3, mu 2 subunit AP3M2 NM_001134296 -1.81218 excision repair cross-complementing rodent repair deficiency ERCC3 NM_000122 -1.80516 peptidase domain containing associated with muscle regeneration PAMR1 NM_015430 -1.79952 sushi, von Willebrand factor type A SVEP1 NM_153366 -1.78903 keratin 18 KRT18 NM_000224 -1.78758 Williams Beuren syndrome chromosome region 22 WBSCR22 NM_017528 -1.78287 trafficking protein particle complex 4 TRAPPC4 NM_016146 -1.78025 tubby like protein 3 TULP3 NM_003324 -1.7782 X-prolyl aminopeptidase (aminopeptidase P) 3 XPNPEP3 NM_022098 -1.77432 karyopherin alpha 2 KPNA2 NM_002266 -1.7725
- 153 - Appendices
Appendix 4 Top 50 down-regulated genes by P4.
[siNT up vs. gene_assignment Gene Symbol RefSeq siNT(P4)] P antigen family, member 2B PAGE2B NM_001015038 2.28506 ubiquilin 4 UBQLN4 NM_020131 2.10163 heat shock 70kDa protein 7 HSPA7 NR_024151 1.88413 hypothetical LOC644903 FLJ38668 AK095987 1.82833 small nucleolar RNA, C/D box 82 SNORD82 NR_004398 1.8244 hypothetical LOC29075 HSPC072 AF161557 1.79756 FLJ35934 FLJ35934 ENST00000407600 1.78747 hypothetical protein LOC644714 LOC644714 BC047037 1.70843 espin ESPN NM_031475 1.69171 keratin associated protein 9-2 KRTAP9-2 ENST00000318329 1.68136 deleted in lymphocytic leukemia 2 DLEU2 NR_002612 1.67862 microRNA 520c MIR520C NR_030198 1.66648 Src homology 2 domain containing F SHF NM_138356 1.65105 glioma tumor suppressor candidate region gene 2 GLTSCR2 NM_015710 1.64847 Meis homeobox 3 MEIS3 NM_020160 1.61703 LOC10012836 hypothetical LOC100128364 4 AK096229 1.61476 lectin, galactoside-binding, soluble, 9B LGALS9B NM_001042685 1.61059 histone cluster 1, H4d HIST1H4D NM_003539 1.60916 chromosome 12 open reading frame 68 C12orf68 NM_001013635 1.60534 zinc finger protein 257 ZNF257 NM_033468 1.60445 vault RNA 1-3 VTRNA1-3 NR_026705 1.60179 LOC10013314 similar to zinc finger protein 208 2 XM_001718400 1.58483 histone cluster 1, H2aj HIST1H2AJ NM_021066 1.58158 similar to cDNA sequence BC021523 LOC441956 AK125677 1.57678 hypothetical gene supported by AK131040 LOC388022 AK131040 1.57601 cytochrome P450, family 1, subfamily B, polypeptide 1 CYP1B1 NM_000104 1.57088 chromosome 20 open reading frame 107 C20orf107 BC105792 1.56979 killer cell lectin-like receptor subfamily C, member 2 KLRC2 NM_002260 1.56674 chromosome 20 open reading frame 106 C20orf106 NM_001012971 1.55923 gamma-glutamyltransferase light chain 1 GGTLC1 NM_178311 1.55603 Similar to LOC166075 LOC401097 NM_001168214 1.55556 G patch domain containing 3 GPATCH3 NM_022078 1.5555 glutamate dehydrogenase 1 GLUD1 NM_005271 1.55502 chromosome 21 open reading frame 32 C21orf32 ENST00000430662 1.55114 LOC10013486 hypothetical LOC100134868 8 NR_004846 1.54482 myosin XVB pseudogene MYO15B NR_003587 1.54327 fibroblast growth factor 9 (glia-activating factor) FGF9 NM_002010 1.54266 olfactory receptor, family 1, subfamily A, member 2 OR1A2 NM_012352 1.53729 interleukin 17A IL17A NM_002190 1.53559 TAF13 RNA polymerase II TAF13 NM_005645 1.53426 CMT1A duplicated region transcript 1 CDRT1 NM_006382 1.53405 chloride channel 7 CLCN7 NM_001287 1.53363 zinc finger protein 724 (pseudogene) ZNF724P AK301230 1.52592 catenin (cadherin-associated protein), alpha 3 CTNNA3 NM_013266 1.5221 zinc finger protein 492 ZNF492 NM_020855 1.52102 chromosome 14 open reading frame 156 C14orf156 NM_031210 1.51983 phospholipase A2, group IIA PLA2G2A NM_000300 1.51819 zinc finger protein 277 ZNF277 ENST00000421043 1.51681 transmembrane protein 130 TMEM130 NM_001134450 1.51529 chromosome 21 open reading frame 70 C21orf70 AF391113 1.51414
- 154 - Appendices
Appendix 5 Top 50 up-regulated genes upon GR knockdown.
[siNT down gene_assignment Gene Symbol RefSeq vs. siGR] LOC100131826 LOC100131826 AY358789 -2.66404 hippocampus abundant transcript-like 1 HIATL1 NM_032558 -2.17914 peptidase domain containing associated with muscle regeneration PAMR1 NM_015430 -2.15581 Williams Beuren syndrome chromosome region 22 WBSCR22 NM_017528 -2.06406 small nucleolar RNA, H/ACA box 70G (retrotransposed) SNORA70G NR_033335 -2.05113 leucine rich repeat (in FLII) interacting protein 1 LRRFIP1 NM_001137550 -2.04784 mitochondrial ribosomal protein L45 MRPL45 NM_032351 -2.04637 eukaryotic translation initiation factor 3, subunit I EIF3I NM_003757 -2.03477 ENST0000042802 vaccinia related kinase 2 VRK2 1 -1.97789 enolase 1, (alpha) ENO1 NM_001428 -1.96122 ribosomal protein L10 RPL10 NR_026898 -1.95797 eukaryotic translation initiation factor 3, subunit L EIF3L NM_016091 -1.93887 hypothetical LOC100130876 LOC100130876 AK130278 -1.93783 cytochrome b5 reductase 1 CYB5R1 NM_016243 -1.93773 translocase of outer mitochondrial membrane 22 homolog TOMM22 NM_020243 -1.91193 cirrhosis, autosomal recessive 1A (cirhin) CIRH1A NM_032830 -1.90791 postmeiotic segregation increased 2-like 1 pseudogene PMS2L1 NR_003613 -1.89599 NHP2 non-histone chromosome protein 2-like 1 NHP2L1 NM_005008 -1.88529 killer cell immunoglobulin-like receptor, three domains KIR3DL1 NM_013289 -1.86571 solute carrier family 31 (copper transporters), member 1 SLC31A1 NM_001859 -1.86351 small nucleolar RNA, C/D box 38B SNORD38B NR_001457 -1.85059 transmembrane protein 199 TMEM199 NM_152464 -1.84846 DKFZp686O2416 hypothetical protein DKFZp686O24166 6 NR_026750 -1.83728 small nucleolar RNA, C/D box 26 SNORD26 NR_002564 -1.83699 elongation factor Tu GTP binding domain containing 1 EFTUD1 NM_024580 -1.8342 ribosomal protein L13a pseudogene 20 RPL13AP20 NR_003932 -1.83138 coiled-coil domain containing 127 CCDC127 NM_145265 -1.82979 transmembrane protein 147 TMEM147 NM_032635 -1.8266 CMT1A duplicated region transcript 1 CDRT1 NM_006382 -1.82497 ectodysplasin A2 receptor EDA2R NM_021783 -1.82253 cytochrome b5 reductase 2 CYB5R2 NM_016229 -1.81952 tRNA methyltransferase 11-2 homolog TRMT112 NM_016404 -1.81408 family with sequence similarity 38, member B FAM38B NM_022068 -1.81383 polymerase (RNA) II (DNA directed) polypeptide G POLR2G NM_002696 -1.80587 ubiquinol-cytochrome c reductase hinge protein UQCRH NM_006004 -1.80528 cathepsin K CTSK NM_000396 -1.80314 zinc finger protein 90 ZNF90 AK298173 -1.80217 WD repeat and FYVE domain containing 1 WDFY1 NM_020830 -1.79332 mitochondrial ribosomal protein L21 MRPL21 NM_181515 -1.79058 presenilin associated, rhomboid-like PARL NM_018622 -1.78157 transmembrane protein 111 TMEM111 NM_018447 -1.77568 LAG1 homolog, ceramide synthase 5 LASS5 NM_147190 -1.77156 microRNA 622 MIR622 NR_030754 -1.76545 solute carrier family 5 SLC5A3 NM_006933 -1.76342 glutathione S-transferase mu 5 GSTM5 NM_000851 -1.76315 exosome component 1 EXOSC1 NM_016046 -1.75751 phosphogluconate dehydrogenase PGD NM_002631 -1.75538 hexosaminidase A (alpha polypeptide) HEXA NM_000520 -1.75003 membrane protein, palmitoylated 1 MPP1 NM_002436 -1.74775 succinate dehydrogenase complex assembly factor 2 SDHAF2 NM_017841 -1.74426
- 155 - Appendices
Appendix 6 Top 50 down-regulated genes upon GR knockdown.
[siNT up vs. gene_assignment Gene Symbol RefSeq siGR] nuclear receptor subfamily 3, group C, member 1 NR3C1 NM_000176 2.69052 ankyrin repeat domain 11 ANKRD11 NM_013275 2.06678 histone cluster 1, H2aj HIST1H2AJ NM_021066 2.0578 zinc finger protein 594 ZNF594 NM_032530 2.03485 small nucleolar RNA, C/D box 13 SNORD13 NR_003041 2.00297 P antigen family, member 2B PAGE2B NM_001015038 1.98419 ubiquilin 4 UBQLN4 NM_020131 1.94736 golgin A6 family, member A GOLGA6A NM_001038640 1.84525 similar to cDNA sequence BC021523 LOC441956 AK125677 1.83595 small nucleolar RNA, C/D box 13 pseudogene 1 SNORD13P1 X58061 1.8187 ENST0000042104 zinc finger protein 277 ZNF277 3 1.80439 late cornified envelope 4A LCE4A NM_178356 1.79481 ENST0000036707 chromosome 6 open reading frame 99 C6orf99 3 1.78552 hypothetical LOC339674 LOC339674 NR_024355 1.72782 CMT1A duplicated region transcript 1 CDRT1 NM_006382 1.71721 RNA binding motif protein, Y-linked, family 1, member A1 RBMY1A1 NM_005058 1.71568 similar to TRIMCyp LOC392352 XM_002342942 1.6943 glycerol-3-phosphate acyltransferase, mitochondrial GPAM AK172782 1.67198 apolipoprotein B mRNA editing enzyme APOBEC3B NM_004900 1.67076 ENST0000043066 chromosome 21 open reading frame 32 C21orf32 2 1.6535 tubulin, beta 2C TUBB2C NM_006088 1.62898 Rho GTPase activating protein 23 ARHGAP23 NM_020876 1.61649 microRNA let-7c MIRLET7C NR_029480 1.61633 ENST0000031832 keratin associated protein 9-2 KRTAP9-2 9 1.61159 cysteine-rich secretory protein 1 CRISP1 NM_001131 1.60557 zinc finger protein 578 ZNF578 NM_001099694 1.60107 potassium voltage-gated channel, Isk-related family KCNE2 NM_172201 1.5986 hypothetical protein FLJ25715 FLJ25715 AK098581 1.58952 killer cell lectin-like receptor subfamily C, member 2 KLRC2 NM_002260 1.58759 chromosome 20 open reading frame 107 C20orf107 BC105792 1.5873 ENST0000045616 hypothetical protein PRO2268 PRO2268 5 1.58405 deleted in lymphocytic leukemia 2 DLEU2 NR_002612 1.58108 non-protein coding RNA 164 NCRNA00164 NR_027020 1.58084 double homeobox, 4-like LOC441056 NM_001177376 1.57909 CD209 molecule CD209 NM_021155 1.57521 espin ESPN NM_031475 1.57364 small nucleolar RNA, H/ACA box 58 SNORA58 NR_002985 1.5697 hypothetical FLJ36000 FLJ36000 NR_027084 1.566 TPTE pseudogene psiTPTE22 NR_001591 1.56254 microRNA 122 MIR122 NR_029667 1.54716 BCL2-antagonist/killer 1 BAK1 NM_001188 1.54674 histone cluster 1, H2bn HIST1H2BN NM_003520 1.54659 glucuronidase, beta-like 2 GUSBL2 NR_003660 1.54461 ENST0000031054 family with sequence similarity 86, member A hCG_1990547 2 1.54285 RNA, U5B small nuclear 1 RNU5B-1 NR_002757 1.5423 non-protein coding RNA 87 NCRNA00087 NR_024493 1.54205 zinc finger protein 552 ZNF552 NM_024762 1.54159 G-protein signaling modulator 3 GPSM3 NM_022107 1.53931 glutamate dehydrogenase 1 GLUD1 NM_005271 1.53663 ENST0000040760 FLJ35934 protein FLJ35934 0 1.53555
- 156 - Appendices
Appendix 7 Top 50 up-regulated genes upon PR knockdown.
[siNT down gene_assignment Gene Symbol RefSeq vs. siPR] kinesin family member 5A KIF5A AF063608 -2.56705 protease, serine, 2 (trypsin 2) PRSS2 NM_002770 -2.08498 LOC100131826 LOC100131826 AY358789 -2.07857 family with sequence similarity 38, member B FAM38B NM_022068 -2.07243 glutathione S-transferase mu 5 GSTM5 NM_000851 -1.98719 SPHK1 interactor, AKAP domain containing SPHKAP NM_001142644 -1.98557 olfactory receptor, family 52, subfamily K, member 3 pseudogene OR52K3P AF143328 -1.97554 DnaJ (Hsp40) homolog, subfamily B, member 7 DNAJB7 NM_145174 -1.96945 KIAA0146 KIAA0146 AK301677 -1.95189 SPANX family, member N3 SPANXN3 NM_001009609 -1.92531 misato homolog 2 pseudogene MSTO2P NR_024117 -1.87231 ribosomal protein L13a pseudogene 20 RPL13AP20 NR_003932 -1.82195 immunoglobulin superfamily, member 9B IGSF9B NM_014987 -1.80567 centromere protein C 1 CENPC1 NM_001812 -1.78448 chromosome 8 open reading frame 48 C8orf48 NM_001007090 -1.77602 glutathione S-transferase mu 1 GSTM1 NM_000561 -1.76971 ribosomal protein L10 RPL10 NR_026898 -1.74806 acyloxyacyl hydrolase (neutrophil) FAM183B NR_028347 -1.73801 tetratricopeptide repeat domain 30B TTC30B NM_152517 -1.73036 RAB43, member RAS oncogene family RAB43 NM_198490 -1.73028 tripartite motif-containing 50 TRIM50 NM_178125 -1.71605 interleukin 1, beta IL1B NM_000576 -1.70918 aldo-keto reductase family 1, member C3 AKR1C3 NM_003739 -1.69892 TNFAIP3 interacting protein 3 TNIP3 NM_024873 -1.69679 hydroxy-delta-5-steroid dehydrogenase, 3 beta HSD3B1 NM_000862 -1.69622 embigin homolog EMB NM_198449 -1.69459 family with sequence similarity 169, member A FAM169A NM_015566 -1.69324 actin, gamma-like LOC100130331 NR_027247 -1.6884 RFT1 homolog RFT1 NM_052859 -1.68699 methyltransferase like 1 METTL1 NM_005371 -1.68493 ubiquitin-conjugating enzyme E2M pseudogene 1 UBE2MP1 NR_002837 -1.66442 myeloproliferative disease associated tumor antigen 5 LOC613206 AY567967 -1.65717 2'-5'-oligoadenylate synthetase 3 OAS3 NM_006187 -1.65618 chromosome 3 open reading frame 47 C3orf47 NR_026991 -1.65344 zinc finger protein 676 ZNF676 NM_001001411 -1.65258 ENST0000041541 hypothetical LOC402483 tcag7.907 8 -1.65157 RNA binding motif protein 8A RBM8A BC017770 -1.64952 similar to cytochrome b LOC100288871 XR_078322 -1.63961 tripartite motif-containing 56 TRIM56 NM_030961 -1.63741 ataxin 7-like 1 ATXN7L1 NM_020725 -1.6319 defensin, beta 128 DEFB128 NM_001037732 -1.63087 potassium voltage-gated channel, Isk-related family KCNE4 NM_080671 -1.62848 trypsinogen C TRY6 NR_001296 -1.62609 ENST0000032786 zinc finger protein 730 ZNF730 7 -1.62522 regulated endocrine-specific protein 18 RESP18 NM_001007089 -1.62023 eyes shut homolog EYS NM_001142800 -1.61916 IMP1 inner mitochondrial membrane peptidase-like IMMP1L NM_144981 -1.61616 chromosome 6 open reading frame 226 C6orf226 NM_001008739 -1.61464 AP2 associated kinase 1 AAK1 NM_014911 -1.61283 carbonic anhydrase VB pseudogene CA5BP NR_026551 -1.61195
- 157 - Appendices
Appendix 8 Top 50 down-regulated genes upon PR knockdown.
[siNT up gene_assignment Gene Symbol RefSeq vs. siPR] hypothetical gene supported by AK131040 LOC388022 AK131040 2.51838 G protein-coupled receptor 125 GPR125 NM_145290 2.29523 small nucleolar RNA, H/ACA box 73A SNORA73A NR_002907 2.18471 translocase of inner mitochondrial membrane 8 homolog B TIMM8B NR_028383 2.17127 succinate dehydrogenase complex, subunit C SDHC NM_003001 2.16311 heat shock 70kDa protein 7 (HSP70B) HSPA7 NR_024151 2.14913 hCG2040210 LOC391169 XR_039983 2.12863 Meis homeobox 3 MEIS3 NM_020160 2.06567 RAS p21 protein activator 4 RASA4 NM_006989 1.99159 small nucleolar RNA, C/D box 30 SNORD30 NR_002561 1.98027 POM121 membrane glycoprotein POM121 NM_172020 1.95553 protein phosphatase 1, regulatory (inhibitor) subunit 8 PPP1R8 NM_014110 1.93407 RNA binding motif, single stranded interacting protein 2 RBMS2 NM_002898 1.89745 galactosidase, alpha GLA NM_000169 1.88688 N-acylsphingosine amidohydrolase ASAH2 NM_019893 1.85337 zinc finger protein 737 ZNF737 NM_001159293 1.84508 microtubule-associated protein, RP/EB family, member 1 MAPRE1 NM_012325 1.82659 palmitoyl-protein thioesterase 1 PPT1 NM_000310 1.82099 apolipoprotein B mRNA editing enzyme APOBEC3B NM_004900 1.80125 chromosome 21 open reading frame 70 C21orf70 AF391113 1.80047 potassium channel tetramerisation domain containing 18 KCTD18 NM_152387 1.79299 phosphoribosyl pyrophosphate synthetase 2 PRPS2 NM_001039091 1.79118 microRNA 199a-2 MIR199A2 NR_029618 1.78989 transmembrane protein 203 TMEM203 NM_053045 1.78536 LOC10013087 hypothetical LOC100130876 6 AK130278 1.77639 ADP-ribosylation factor-like 2 binding protein ARL2BP NM_012106 1.77626 HAUS augmin-like complex, subunit 6 HAUS6 NM_017645 1.77178 etoposide induced 2.4 mRNA EI24 NM_004879 1.76761 P antigen family, member 2B PAGE2B NM_001015038 1.75586 tRNA-yW synthesizing protein 1 homolog B TYW1B NM_001145440 1.75586 chromosome 17 open reading frame 42 C17orf42 NM_024683 1.74701 RNA binding motif protein 12B RBM12B NM_203390 1.74385 Rho GTPase activating protein 11B ARHGAP11B NM_001039841 1.74223 popeye domain containing 3 POPDC3 NM_022361 1.74009 CMT1A duplicated region transcript 1 CDRT1 NM_006382 1.7291 TIMELESS interacting protein TIPIN NM_017858 1.71928 small nucleolar RNA, C/D box 13 SNORD13 NR_003041 1.71344 matrix-remodelling associated 7 MXRA7 NM_198530 1.71212 small nucleolar RNA, H/ACA box 50 SNORA50 NR_002980 1.70681 glutaredoxin 5 GLRX5 NM_016417 1.70108 AHA1, activator of heat shock 90kDa protein ATPase homolog AHSA2 NM_152392 1.701 RNA, U1 small nuclear 1 RNU1-1 NR_004430 1.69291 transmembrane protein 194B TMEM194B NM_001142645 1.68884 murine retrovirus integration site 1 homolog MRVI1 NM_130385 1.68847 solute carrier family 40 SLC40A1 NM_014585 1.68727 golgin A6 family, member A GOLGA6A NM_001038640 1.68629 chromosome 20 open reading frame 107 C20orf107 BC105792 1.68512 chromosome 15 open reading frame 44 C15orf44 AK296134 1.68262 programmed cell death 7 PDCD7 NM_005707 1.67892 betaine--homocysteine S-methyltransferase 2 BHMT2 NM_017614 1.67872
- 158 - Appendices
Appendix 9 Top 50 up-regulated genes by MPA in the absence of GR.
[siGR down vs. gene_assignment Gene Symbol RefSeq siGR (MPA)] FK506 binding protein 5 FKBP5 NM_001145775 -2.26051 small nucleolar RNA, H/ACA box 29 SNORA29 NR_002965 -2.11718 ENST0000036707 chromosome 6 open reading frame 99 C6orf99 3 -2.04625 ankyrin repeat domain 11 ANKRD11 NM_013275 -1.91261 family with sequence similarity 131, member C FAM131C NM_182623 -1.89378 fatty acid binding protein 4, adipocyte FABP4 NM_001442 -1.86499 glycerol-3-phosphate acyltransferase, mitochondrial GPAM AK172782 -1.85959 taste receptor, type 2, member 19 TAS2R19 NM_176888 -1.71187 coiled-coil domain containing 85C CCDC85C NM_001144995 -1.70621 nuclear receptor co-repressor 1 pseudogene C20orf191 NR_003678 -1.69295 killer cell lectin-like receptor subfamily A, member 1 KLRA1 NR_028045 -1.6901 small nucleolar RNA, C/D box 45B SNORD45B NR_002748 -1.68869 replication factor C (activator 1) 3 RFC3 NM_002915 -1.6699 KIAA1586 KIAA1586 NM_020931 -1.66562 ENST0000045655 LOC400986 LOC400986 6 -1.66405 hypothetical LOC339674 LOC339674 NR_024355 -1.62956 HAUS augmin-like complex, subunit 6 HAUS6 NM_017645 -1.62207 similar to RAN binding protein 1 LOC389842 XM_942610 -1.6183 microRNA 122 MIR122 NR_029667 -1.60252 olfactory receptor, family 2, subfamily M, member 5 OR2M5 NM_001004690 -1.59486 male-specific lethal 3-like 2 MSL3L2 NM_001166217 -1.5855 fibroblast growth factor 14 FGF14 NM_175929 -1.57522 interleukin-1 receptor-associated kinase 3 IRAK3 NM_007199 -1.5726 double homeobox, 4-like LOC441056 NM_001177376 -1.56615 cholinergic receptor, muscarinic 4 CHRM4 NM_000741 -1.55025 dihydrofolate reductase DHFR BC000192 -1.54617 zinc finger protein 501 ZNF501 NM_145044 -1.54163 eukaryotic translation initiation factor 4A2 EIF4A2 AB209021 -1.53972 solute carrier family 29 SLC29A4 NM_001040661 -1.53103 isopentenyl-diphosphate delta isomerase 1 IDI1 NM_004508 -1.52612 family with sequence similarity 105, member A FAM105A NM_019018 -1.52191 karyopherin alpha 5 KPNA5 NM_002269 -1.5192 phosphatidylinositol glycan anchor biosynthesis, class H PIGH NM_004569 -1.51566 ATP/GTP binding protein 1 AGTPBP1 NM_015239 -1.50881 small nucleolar RNA, H/ACA box 20 SNORA20 NR_002960 -1.50783 sterol-C5-desaturase SC5DL NM_006918 -1.50729 THAP domain containing 9 THAP9 NM_024672 -1.5062 keratin 81 KRT81 NM_002281 -1.50411 double C2-like domains, beta DOC2B NM_003585 -1.50213 dual specificity phosphatase 5 pseudogene DUSP5P AK055963 -1.50201 epididymal protein 3B EDDM3B NM_022360 -1.50178 non-metastatic cells 5 NME5 NM_003551 -1.50157 1-acylglycerol-3-phosphate O-acyltransferase 9 AGPAT9 NM_032717 -1.49908 olfactory receptor, family 10, subfamily A, member 2 OR10A2 NM_001004460 -1.49795 dynein, axonemal, light chain 1 DNAL1 NM_031427 -1.49381 protease, serine, 48 PRSS48 NM_183375 -1.49214 microRNA let-7c MIRLET7C NR_029480 -1.4887 taste receptor, type 2, member 46 TAS2R46 NM_176887 -1.48456 centromere protein Q CENPQ NM_018132 -1.48345 chromosome 20 open reading frame 203 C20orf203 NM_182584 -1.48286
- 159 - Appendices
Appendix 10 Top 50 down-regulated genes by MPA in the absence of GR.
[siGR up vs. gene_assignment Gene Symbol RefSeq siGR (MPA)] family with sequence similarity 120A FAM120A NM_014612 2.29936 FLJ44896 protein FLJ44896 AK126844 2.02038 eukaryotic translation initiation factor 3, subunit I EIF3I NM_003757 1.97887 ribosomal protein L10 RPL10 NM_006013 1.95987 eukaryotic translation initiation factor 3, subunit K EIF3K NM_013234 1.88149 peroxiredoxin 5 PRDX5 NM_012094 1.8784 mediator complex subunit 27 MED27 NM_004269 1.86931 ribosomal protein L13a pseudogene 5 RPL13AP5 NR_026712 1.847 NKF3 kinase family member SGK269 NM_024776 1.82084 processing of precursor 7 POP7 NM_005837 1.81033 fibroblast growth factor (acidic) intracellular binding protein FIBP NM_198897 1.80722 small nucleolar RNA, C/D box 13 SNORD13 NR_003041 1.80579 keratin 18 KRT18 NM_000224 1.78054 ankyrin repeat domain 20B ANKRD20B NR_003366 1.77696 zinc finger, DHHC-type containing 16 ZDHHC16 NM_198046 1.77424 solute carrier family 16, member 2 SLC16A2 NM_006517 1.76735 ectodysplasin A2 receptor EDA2R NM_021783 1.76108 GRB2-related adaptor protein GRAP NM_006613 1.75985 ariadne homolog 2 ARIH2 NM_006321 1.75912 ubiquitin-conjugating enzyme E2Z UBE2Z NM_023079 1.75911 enolase 1 ENO1 NM_001428 1.7535 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 ATP6V0D1 NM_004691 1.75027 ubiquinol-cytochrome c reductase hinge protein UQCRH NM_006004 1.74176 aldo-keto reductase family 1, member B1 AKR1B1 NM_001628 1.73684 ERGIC and golgi 3 ERGIC3 NM_198398 1.7329 D4, zinc and double PHD fingers family 2 DPF2 NM_006268 1.73089 peptidase domain containing associated with muscle regeneration 1 PAMR1 NM_015430 1.73048 ribosomal protein L13a pseudogene 20 RPL13AP20 NR_003932 1.72806 histone cluster 1, H2bk HIST1H2BK NM_080593 1.72465 tubulin, alpha 1c TUBA1C NM_032704 1.72416 hypothetical protein LOC728690 LOC728690 AK094642 1.71863 trafficking protein particle complex 3 TRAPPC3 NM_014408 1.71509 retinoic acid receptor responder (tazarotene induced) 2 RARRES2 NM_002889 1.71002 tubulin, beta TUBB NM_178014 1.70874 small nucleolar RNA, C/D box 95 SNORD95 NR_002591 1.70805 RAB5C, member RAS oncogene family RAB5C NM_201434 1.69167 prolactin regulatory element binding PREB NM_013388 1.6916 lectin, galactoside-binding, soluble, 1 LGALS1 NM_002305 1.68865 ATP synthase, H+ transporting, mitochondrial F0 complex ATP5I NM_007100 1.6846 inhibitor of kappa light polypeptide gene enhancer in B- cell IKBKB NM_001556 1.68218 casein kinase 2, beta polypeptide CSNK2B NM_001320 1.67748 KIAA1199 KIAA1199 NM_018689 1.67581 glutaminyl-tRNA synthetase QARS NM_005051 1.6729 sialidase 1 (lysosomal sialidase) NEU1 NM_000434 1.67199 splicing factor 3b, subunit 3 SF3B3 NM_012426 1.67148 succinate dehydrogenase complex assembly factor 2 SDHAF2 NM_017841 1.67118 ornithine decarboxylase antizyme 1 OAZ1 NM_004152 1.66594 extended synaptotagmin-like protein 1 ESYT1 NM_015292 1.66325 alanyl-tRNA synthetase AARS NM_001605 1.66323 IQ motif containing with AAA domain 1-like IQCA1L XR_018506 1.66275
- 160 - Appendices
Appendix 11 Top 50 up-regulated genes by P4 in the absence of GR.
[siGR down vs. gene_assignment Gene Symbol RefSeq siGR (P4)] ENST0000036707 chromosome 6 open reading frame 99 C6orf99 3 -2.37857 glycerol-3-phosphate acyltransferase, mitochondrial GPAM AK172782 -2.18778 microRNA 122 MIR122 NR_029667 -1.90711 transmembrane protein 120B TMEM120B NM_001080825 -1.83974 killer cell lectin-like receptor subfamily A, member 1 KLRA1 NR_028045 -1.82658 fumarylacetoacetate hydrolase domain containing 2A FAHD2A NM_016044 -1.78151 zinc finger protein 502 ZNF502 NM_033210 -1.74475 developmental pluripotency associated 3 DPPA3 NM_199286 -1.73821 family with sequence similarity 181, member B FAM181B NM_175885 -1.6901 isopentenyl-diphosphate delta isomerase 1 IDI1 NM_004508 -1.68368 THAP domain containing, apoptosis associated protein 2 THAP2 NM_031435 -1.68341 family with sequence similarity 159, member B FAM159B NM_001164442 -1.67978 hypothetical LOC441233 LOC441233 AK128010 -1.67358 sterol-C4-methyl oxidase-like SC4MOL NM_006745 -1.65975 ENST0000042324 dynamin 1 pseudogene C15orf51 8 -1.6446 LOC10028966 ENST0000042673 LOC100289668 8 0 -1.6446 glucosaminyl (N-acetyl) transferase 4 GCNT4 NM_016591 -1.6418 kinesin family member 27 KIF27 NM_017576 -1.62629 olfactory receptor, family 2, subfamily T, member 4 OR2T4 NM_001004696 -1.61899 nucleophosmin (nucleolar phosphoprotein B23, numatrin) NPM1 NM_001037738 -1.61561 microRNA let-7c MIRLET7C NR_029480 -1.61499 olfactory receptor, family 4, subfamily A, member 47 OR4A47 NM_001005512 -1.60108 LOC10013307 hypothetical LOC100133075 5 XR_039086 -1.59776 golgin A6 family, member A GOLGA6A NM_001038640 -1.59662 chromosome 1 open reading frame 146 C1orf146 NM_001012425 -1.59457 paraneoplastic antigen like 6A PNMA6A NM_032882 -1.58528 3-hydroxy-3-methylglutaryl-CoA synthase 1 HMGCS1 NM_001098272 -1.58154 coiled-coil domain containing 85C CCDC85C NM_001144995 -1.57529 protogenin homolog PRTG NM_173814 -1.57508 beta-1,3-glucuronyltransferase 3 B3GAT3 NM_012200 -1.56872 double homeobox, 4-like LOC441056 NM_001177376 -1.56811 LOC10013309 hypothetical LOC100133091 1 NR_029411 -1.56197 linker for activation of T cells LAT NM_014387 -1.55944 La ribonucleoprotein domain family, member 1B LARP1B NM_018078 -1.55222 solute carrier family 28 SLC28A3 NM_022127 -1.5444 TBC1 domain family, member 2B TBC1D2B NM_144572 -1.544 chemokine (C-C motif) receptor 2 CCR2 NM_001123041 -1.53778 hypothetical LOC645188 LOC645188 BC042039 -1.53429 ENST0000042104 zinc finger protein 277 ZNF277 3 -1.52958 sterol-C5-desaturase SC5DL NM_006918 -1.5244 high mobility group AT-hook 2 HMGA2 NM_003483 -1.52342 yrdC domain containing YRDC NM_024640 -1.52154 chorionic somatomammotropin hormone 2 CSH2 NM_022644 -1.52123 glucuronidase, beta-like 2 GUSBL2 NR_003660 -1.52053 acyloxyacyl hydrolase FAM183B NR_028347 -1.51803 mitogen-activated protein kinase kinase kinase kinase 3 MAP4K3 NM_003618 -1.50906 ENST0000034046 coiled-coil domain containing 29 CCDC29 0 -1.50782 small nucleolar RNA, C/D box 42A SNORD42A NR_000014 -1.49931 kelch domain containing 1 KLHDC1 NM_172193 -1.49754 excision repair cross-complementing rodent repair deficiency ERCC6L NM_017669 -1.49203
- 161 - Appendices
Appendix 12 Top 50 down-regulated genes by P4 in the absence of GR.
[siGR up vs. gene_assignment Gene Symbol RefSeq siGR (P4)] thioredoxin interacting protein TXNIP NM_006472 3.80321 translocase of outer mitochondrial membrane 22 homolog TOMM22 NM_020243 3.04636 ubiquinol-cytochrome c reductase hinge protein UQCRH NM_006004 2.67655 tRNA methyltransferase 11-2 homolog TRMT112 NM_016404 2.24388 keratin associated protein 5-5 KRTAP5-5 NM_001001480 2.20555 small nucleolar RNA, C/D box 13 SNORD13 NR_003041 2.19215 LOC10013087 hypothetical LOC100130876 6 AK130278 2.14199 hCG2040210 LOC391169 XR_039983 2.1341 ribosomal protein, large, P0 RPLP0 NM_053275 2.12651 actin related protein 2/3 complex, subunit 1A ARPC1A NM_006409 2.08493 peroxiredoxin 5 PRDX5 NM_012094 2.03943 CDC-like kinase 4 CLK4 BC063116 2.03346 peptidase domain containing associated with muscle regeneration PAMR1 NM_015430 2.03292 epithelial cell adhesion molecule EPCAM NM_002354 2.02553 eukaryotic translation initiation factor 3, subunit K EIF3K NM_013234 2.01347 TH1-like TH1L NM_198976 2.0116 NKF3 kinase family member SGK269 NM_024776 1.98983 small nuclear ribonucleoprotein 40kDa SNRNP40 NM_004814 1.98015 golgin A6 family, member A GOLGA6A NM_001038640 1.97203 histone deacetylase 1 HDAC1 NM_004964 1.95149 leucine rich repeat (in FLII) interacting protein 1 LRRFIP1 NM_001137550 1.93405 small nucleolar RNA, C/D box 38B SNORD38B NR_001457 1.92079 stromal cell-derived factor 2 SDF2 NM_006923 1.90643 GRB2-related adaptor protein GRAP NM_006613 1.90484 casein kinase 2, beta polypeptide CSNK2B NM_001320 1.90441 hypothetical gene supported by AK131040 LOC388022 AK131040 1.89081 myxovirus (influenza virus) resistance 1 MX1 NM_002462 1.88331 ENST0000042363 coiled-coil-helix-coiled-coil-helix domain CHCHD3 5 1.87937 serpin peptidase inhibitor, clade F SERPINF1 NM_002615 1.86458 enolase 1 ENO1 NM_001428 1.86296 coatomer protein complex, subunit zeta 2 COPZ2 NM_016429 1.84096 eukaryotic translation initiation factor 3, subunit I EIF3I NM_003757 1.83196 intraflagellar transport 46 homolog IFT46 NM_020153 1.82494 endogenous retroviral sequence 3 ERV3 NM_001007253 1.8216 polymerase (RNA) II (DNA directed) polypeptide G POLR2G NM_002696 1.81417 glutathione S-transferase mu 1 GSTM1 NM_000561 1.81379 polymerase (RNA) II (DNA directed) polypeptide H POLR2H NM_006232 1.80569 mitochondrial ribosomal protein L21 MRPL21 NM_181515 1.80113 KIAA0174 KIAA0174 NM_014761 1.80072 solute carrier family 31 (copper transporters), member 1 SLC31A1 NM_001859 1.79853 glycoprotein Ib (platelet), beta polypeptide GP1BB L20860 1.79724 interleukin enhancer binding factor 2 ILF2 NM_004515 1.7955 ERGIC and golgi 3 ERGIC3 NM_198398 1.7917 ribosomal protein L13a pseudogene 5 RPL13AP5 NR_026712 1.783 dynein, light chain, LC8-type 1 DYNLL1 NM_001037495 1.78192 solute carrier family 5 SLC5A3 NM_006933 1.78155 ubiquitin B UBB NM_018955 1.78061 zinc finger protein 512 ZNF512 NM_032434 1.77348 capping protein (actin filament) muscle Z-line, beta CAPZB NM_004930 1.76875 exosome component 1 EXOSC1 NM_016046 1.76456
- 162 - Appendices
Appendix 13 Top 50 up-regulated genes by MPA in the absence of PR.
[siPR down vs. gene_assignment Gene Symbol RefSeq siPR (MPA)] NM_00114577 FK506 binding protein 5 FKBP5 5 -10.1159 ERBB receptor feedback inhibitor 1 ERRFI1 NM_018948 -6.63831 glutamate-ammonia ligase GLUL NM_002065 -5.89311 LIM domain only 3 LMO3 NM_018640 -3.89801 chromosome 13 open reading frame 15 C13orf15 NM_014059 -3.77166 LOC10013087 hypothetical LOC100130876 6 AK130278 -3.36431 carboxypeptidase M CPM NM_001874 -3.17945 acyl-CoA synthetase long-chain family member 1 ACSL1 NM_001995 -3.07627 POM121 membrane glycoprotein POM121 NM_172020 -2.98084 stomatin STOM NM_004099 -2.96571 leucine rich repeat containing 16A LRRC16A NM_017640 -2.93314 FYVE, RhoGEF and PH domain containing 4 FGD4 NM_139241 -2.90072 interleukin-1 receptor-associated kinase 3 IRAK3 NM_007199 -2.89105 metallothionein 1X MT1X NM_005952 -2.88986 ADAM metallopeptidase with thrombospondin type 1 motif ADAMTS1 NM_006988 -2.86363 fibulin 5 FBLN5 NM_006329 -2.84262 serpin peptidase inhibitor, clade E SERPINE1 NM_000602 -2.7836 G protein-coupled receptor 125 GPR125 NM_145290 -2.73952 cysteine dioxygenase, type I CDO1 NM_001801 -2.64144 TSC22 domain family, member 3 TSC22D3 NM_198057 -2.6248 histone deacetylase 1 HDAC1 NM_004964 -2.61596 glucosaminyl (N-acetyl) transferase 1 GCNT1 NM_001490 -2.6043 cirrhosis, autosomal recessive 1A CIRH1A NM_032830 -2.54408 B-cell CLL/lymphoma 6 BCL6 NM_001706 -2.49069 adaptor protein, phosphotyrosine interaction APPL2 NM_018171 -2.48071 G protein-coupled receptor 126 GPR126 NM_020455 -2.45737 forkhead box O3B pseudogene FOXO3B NR_026718 -2.4136 LIM and cysteine-rich domains 1 LMCD1 NM_014583 -2.4114 fibrillin 2 FBN2 NM_001999 -2.40784 LAG1 homolog, ceramide synthase 6 LASS6 NM_203463 -2.39707 peroxisomal biogenesis factor 11 beta PEX11B NM_003846 -2.39443 chromosome 21 open reading frame 70 C21orf70 AF391113 -2.3832 loss of heterozygosity, 3, chromosomal region 2, gene A LOH3CR2A AF086709 -2.37937 carbohydrate (chondroitin 4) sulfotransferase 11 CHST11 NM_018413 -2.37287 casein kinase 2, beta polypeptide CSNK2B NM_001320 -2.37025 midline 2 MID2 NM_012216 -2.36795 transmembrane protein 203 TMEM203 NM_053045 -2.33974 hypothetical gene supported by AK131040 LOC388022 AK131040 -2.33913 hydroxysteroid (11-beta) dehydrogenase 1 HSD11B1 NM_005525 -2.33503 phosphogluconate dehydrogenase PGD NM_002631 -2.32956 glycoprotein Ib (platelet), beta polypeptide GP1BB L20860 -2.32928 MpV17 mitochondrial inner membrane protein MPV17 NM_002437 -2.31987 hippocampus abundant transcript-like 1 HIATL1 NM_032558 -2.28787 coatomer protein complex, subunit zeta 2 COPZ2 NM_016429 -2.27636 solute carrier family 35, member B1 SLC35B1 NM_005827 -2.26821 translocase of inner mitochondrial membrane 8 homolog B TIMM8B NR_028383 -2.26488 etoposide induced 2.4 mRNA EI24 NM_004879 -2.26084 NM_00108043 fat mass and obesity associated FTO 2 -2.24308 thioredoxin interacting protein TXNIP NM_006472 -2.2419 aldehyde oxidase 1 AOX1 NM_001159 -2.24154
- 163 - Appendices
Appendix 14 Top 50 down-regulated genes by MPA in the absence of PR.
[siPR up vs. gene_assignment Gene Symbol RefSeq siPR (MPA)] Similar to LOC166075 LOC401097 NM_001168214 6.34696 tumor necrosis factor receptor superfamily, member 11b TNFRSF11B NM_002546 3.0884 histone cluster 1, H2aj HIST1H2AJ NM_021066 2.77566 matrix metallopeptidase 16 MMP16 AL136588 2.51035 SPANX family, member N3 SPANXN3 NM_001009609 2.45283 ENST0000042104 zinc finger protein 277 ZNF277 3 2.37781 interleukin 33 IL33 NM_033439 2.31366 microRNA 122 MIR122 NR_029667 2.29423 microRNA let-7c MIRLET7C NR_029480 2.25849 chemokine (C-C motif) ligand 7 CCL7 NM_006273 2.25345 histone cluster 1, H2bb HIST1H2BB NM_021062 2.24877 kinesin family member 5A KIF5A AF063608 2.22863 ENST0000045616 hypothetical protein PRO2268 PRO2268 5 2.19858 SPHK1 interactor SPHKAP NM_001142644 2.15687 regulator of G-protein signaling 4 RGS4 NM_001102445 2.10579 deleted in lymphocytic leukemia 2 DLEU2 NR_002612 2.1015 heterogeneous nuclear ribonucleoprotein C-like 1 HNRNPCL1 NM_001013631 2.1014 LOC10013486 hypothetical LOC100134868 8 NR_004846 2.08943 tripartite motif-containing 50 TRIM50 NM_178125 2.08241 ENST0000042332 MST131 MST131 2 2.02693 protein phosphatase 1, regulatory (inhibitor) subunit 3C PPP1R3C NM_005398 2.01722 TNFAIP3 interacting protein 3 TNIP3 NM_024873 1.99493 tumor necrosis factor, alpha-induced protein 6 TNFAIP6 NM_007115 1.99372 interferon-induced protein with tetratricopeptide repeats IFIT2 NM_001547 1.9797 MADD domain containing 2C DENND2C BC063894 1.9696 vault RNA 1-3 VTRNA1-3 NR_026705 1.95371 RNA binding motif protein, Y-linked, family 1, member A1 RBMY1A1 NM_005058 1.948 chemokine (C-C motif) receptor 2 CCR2 NM_001123041 1.93529 LOC10013374 ENST0000044768 hypothetical LOC100133746 6 2 1.92526 small nucleolar RNA, C/D box 42A SNORD42A NR_000014 1.92442 R-spondin 3 homolog RSPO3 NM_032784 1.92366 SPANX family, member B1 SPANXB1 NM_032461 1.91683 tetratricopeptide repeat domain 30B TTC30B NM_152517 1.91367 prostaglandin-endoperoxide synthase 2 PTGS2 NM_000963 1.89635 N-myc (and STAT) interactor NMI NM_004688 1.89347 acetyl-CoA acyltransferase 1 ACAA1 AK127051 1.88458 fibroblast growth factor 9 FGF9 NM_002010 1.87029 leucine zipper protein 2 LUZP2 NM_001009909 1.869 olfactory receptor, family 4, subfamily N, member 4 OR4N4 NM_001005241 1.86646 zinc finger protein 676 ZNF676 NM_001001411 1.84163 similar to hCG1645603 LOC732275 NR_024406 1.82722 RNA binding motif protein 8A RBM8A BC017770 1.82288 ENST0000044740 high mobility group protein B3-like protein-like LOC441795 8 1.82265 lectin, galactoside-binding, soluble, 9 LGALS9 NM_009587 1.81871 olfactory receptor, family 52, subfamily E, member 2 OR52E2 NM_001005164 1.81489 regulator of G-protein signaling like 1 RGSL1 NM_001137669 1.81108 protease, serine, 2 PRSS2 NM_002770 1.80636 transmembrane protein 200A TMEM200A NM_052913 1.80151 ribosomal RNA processing 7 homolog B RRP7B BC014647 1.79571 zinc finger protein 705A ZNF705A NM_001004328 1.77323
- 164 - Appendices
Appendix 15 Top 50 up-regulated genes by P4 in the absence of PR.
[siPR down vs. gene_assignment Gene Symbol RefSeq siPR (P4)] G protein-coupled receptor 125 GPR125 NM_145290 -3.73773 hippocampus abundant transcript-like 1 HIATL1 NM_032558 -3.05889 ERBB receptor feedback inhibitor 1 ERRFI1 NM_018948 -2.87891 POM121 membrane glycoprotein POM121 NM_172020 -2.74985 phosphogluconate dehydrogenase PGD NM_002631 -2.74369 cirrhosis, autosomal recessive 1A CIRH1A NM_032830 -2.71681 transmembrane protein 203 TMEM203 NM_053045 -2.58123 solute carrier family 37 SLC37A3 NM_207113 -2.55911 karyopherin alpha 2 KPNA2 NM_002266 -2.50193 ATP-binding cassette, sub-family A (ABC1), member 1 ABCA1 NM_005502 -2.49884 fibulin 5 FBLN5 NM_006329 -2.49172 ubiquitin specific peptidase 10 USP10 NM_005153 -2.43718 Niemann-Pick disease, type C1 NPC1 NM_000271 -2.41787 histone deacetylase 1 HDAC1 NM_004964 -2.41731 eukaryotic translation initiation factor 3, subunit L EIF3L NM_016091 -2.38501 PMS2 postmeiotic segregation increased 2 PMS2 NM_000535 -2.37466 tetraspanin 5 TSPAN5 NM_005723 -2.35328 hypothetical LOC100130876 LOC100130876 AK130278 -2.32835 solute carrier family 35, member B1 SLC35B1 NM_005827 -2.3209 rhomboid domain containing 1 RHBDD1 NM_032276 -2.31595 nuclear receptor coactivator 1 NCOA1 NM_147223 -2.30522 hypothetical gene supported by AK131040 LOC388022 AK131040 -2.30388 fat mass and obesity associated FTO NM_001080432 -2.30341 phosphatidylserine synthase 1 PTDSS1 NM_014754 -2.30022 ectonucleotide pyrophosphatase/phosphodiesterase 2 ENPP2 NM_006209 -2.29343 seryl-tRNA synthetase SARS NM_006513 -2.28538 glycosyltransferase 8 domain containing 2 GLT8D2 NM_031302 -2.28407 CAP, adenylate cyclase-associated protein, 2 CAP2 NM_006366 -2.28386 X-prolyl aminopeptidase (aminopeptidase P) 1 XPNPEP1 NM_020383 -2.2703 casein kinase 2, beta polypeptide CSNK2B NM_001320 -2.26343 3-hydroxy-3-methylglutaryl-CoA reductase HMGCR NM_000859 -2.23692 LETM1 domain containing 1 LETMD1 NM_015416 -2.23593 splicing factor 3b, subunit 3 SF3B3 NM_012426 -2.23234 GTPase activating protein and VPS9 domains 1 GAPVD1 NM_015635 -2.20793 microtubule-associated protein, RP/EB family, member 1 MAPRE1 NM_012325 -2.19452 B-cell CLL/lymphoma 6 BCL6 NM_001706 -2.18445 COP9 constitutive photomorphogenic homolog subunit 6 COPS6 NM_006833 -2.17584 asparagine-linked glycosylation 9 ALG9 NM_024740 -2.1716 chromosome 16 open reading frame 62 C16orf62 BC050464 -2.16771 etoposide induced 2.4 mRNA EI24 NM_004879 -2.1573 translocase of outer mitochondrial membrane 22 homolog TOMM22 NM_020243 -2.15256 bifunctional apoptosis regulator BFAR NM_016561 -2.14648 fatty acid binding protein 3 FABP3 NM_004102 -2.13338 death associated protein 3 DAP3 NM_033657 -2.1283 ubiquitination factor E4B UBE4B NM_001105562 -2.12227 transcription factor B1, mitochondrial TFB1M NM_016020 -2.12045 N-acylsphingosine amidohydrolase ASAH2 NM_019893 -2.10834 coatomer protein complex, subunit alpha COPA NM_001098398 -2.10365 exportin 6 XPO6 NM_015171 -2.08761 enolase 1 ENO1 NM_001428 -2.08683
- 165 - Appendices
Appendix 16 Top 50 down-regulated genes by P4 in the absence of PR.
[siPR up vs. gene_assignment Gene Symbol RefSeq siPR (P4)] protease, serine, 2 (trypsin 2) PRSS2 NM_002770 2.39632 Similar to LOC166075 LOC401097 NM_001168214 2.38528 hypothetical LOC100134868 LOC100134868 NR_004846 2.28232 kinesin family member 5A KIF5A AF063608 2.13542 lipocalin 8 LCN8 ENST00000371686 2.10698 hypothetical protein PRO2268 PRO2268 ENST00000456165 2.08432 deleted in lymphocytic leukemia 2 DLEU2 NR_002612 1.99468 similar to hCG1645603 LOC732275 NR_024406 1.97356 hypothetical LOC100133746 LOC100133746 ENST00000447682 1.9655 hypothetical locus LOC388666 FLJ36116 AK093435 1.96017 tetratricopeptide repeat domain 30B TTC30B NM_152517 1.95007 tripartite motif-containing 50 TRIM50 NM_178125 1.94585 zinc finger protein 277 ZNF277 ENST00000421043 1.92161 adenosine deaminase domain containing 2 ADAD2 NM_139174 1.89948 small nucleolar RNA, C/D box 13 SNORD13 NR_003041 1.89413 IMP1 inner mitochondrial membrane peptidase-like IMMP1L NM_144981 1.88556 SPANX family, member B1 SPANXB1 NM_032461 1.87733 paired box 5 PAX5 NM_016734 1.86679 matrix metallopeptidase 16 MMP16 AL136588 1.86306 hypothetical LOC100133091 LOC100133091 NR_029411 1.84865 claudin 23 CLDN23 NM_194284 1.83546 immunoglobulin lambda-like polypeptide LOC91316 NR_024448 1.82493 zinc finger protein 257 ZNF257 NM_033468 1.82346 FLJ16171 protein FLJ16171 AK131247 1.81449 hypothetical LOC645188 LOC645188 BC042039 1.8116 small nucleolar RNA, H/ACA box 71D SNORA71D NR_003018 1.79584 cytochrome P450, family 1, subfamily B, polypeptide 1 CYP1B1 NM_000104 1.78877 translocase of inner mitochondrial membrane 8 homolog A TIMM8A NM_004085 1.77713 high mobility group protein B3-like protein-like LOC441795 ENST00000447408 1.77247 olfactory receptor, family 4, subfamily N, member 4 OR4N4 NM_001005241 1.77007 histone cluster 1, H2aj HIST1H2AJ NM_021066 1.76901 coiled-coil domain containing 88C CCDC88C NM_001080414 1.76134 histone cluster 1, H2bb HIST1H2BB NM_021062 1.75681 protein immuno-reactive with anti-PTH polyclonal LOC400986 ENST00000456556 1.75568 CCCTC-binding factor (zinc finger protein)-like CTCFL BC137482 1.75503 small nucleolar RNA, C/D box 13 pseudogene 1 SNORD13P1 X58061 1.74873 Nmicrotubule-associated protein 1 light chain 3 gamma MAP1LC3C NM_001004343 1.74525 ribosomal RNA processing 7 homolog B RRP7B BC014647 1.74275 hypothetical locus FLJ25758 FLJ25758 NR_024372 1.73679 small nucleolar RNA, C/D box 116-6 SNORD116-6 NR_003321 1.73393 olfactory receptor, family 52, subfamily K, member 3 pseu OR52K3P AF143328 1.73334 leucine zipper protein 2 LUZP2 NM_001009909 1.72544 KIAA1586 KIAA1586 NM_020931 1.72088 vault RNA 1-3 VTRNA1-3 NR_026705 1.71624 LOC100131508 LOC100131508 ENST00000431141 1.7076 family with sequence similarity 169, member A FAM169A NM_015566 1.70434 microRNA let-7c MIRLET7C NR_029480 1.70299 KIAA0146 KIAA0146 AK301677 1.70018 microRNA 302a MIR302A NR_029835 1.69811 chemokine (C-C motif) receptor 2 CCR2 NM_001123041 1.68386
- 166 - Appendices
Appendix 17 Networks and top functions of MPA regulated genes.
- 167 - Appendices
Appendix 18 Networks and top functions of P4 regulated genes.
- 168 - Appendices
Appendix 19 Networks and top functions of GR regulated genes.
- 169 - Appendices
Appendix 20 Networks and top functions of PR regulated genes.
- 170 - Appendices
Appendix 21 Networks and top functions of MPA regulated genes in the absence of GR.
- 171 - Appendices
Appendix 22 Networks and top functions of P4 regulated genes in the absence of GR.
- 172 - Appendices
Appendix 23 Networks and top functions of MPA regulated genes in the absence of PR.
- 173 - Appendices
Appendix 24 Networks and top functions of P4 regulated genes in the absence of PR.
- 174 - References
References
1. Gibb, W., The role of prostaglandins in human parturition. Ann Med, 1998. 30(3): p. 235-41. 2. Olson, D.M., J.E. Mijovic, and D.W. Sadowsky, Control of human parturition. Semin Perinatol, 1995. 19(1): p. 52-63. 3. Lopez Bernal, A., et al., Preterm labour: a pharmacological challenge. Trends Pharmacol Sci, 1995. 16(4): p. 129-33. 4. Chibbar, R., F.D. Miller, and B.F. Mitchell, Synthesis of oxytocin in amnion, chorion, and decidua may influence the timing of human parturition. J Clin Invest, 1993. 91(1): p. 185-92. 5. Gude, N.M., et al., Growth and function of the normal human placenta. Thromb Res, 2004. 114(5-6): p. 397-407. 6. Parry, S. and J.F. Strauss, 3rd, Premature rupture of the fetal membranes. N Engl J Med, 1998. 338(10): p. 663-70. 7. Smith, R., Parturition. N Engl J Med, 2007. 356(3): p. 271-83. 8. Cheng, Z., et al., A genome-wide comparison of recent chimpanzee and human segmental duplications. Nature, 2005. 437(7055): p. 88-93. 9. Initial sequence of the chimpanzee genome and comparison with the human genome. Nature, 2005. 437(7055): p. 69-87. 10. Rosenberg, K.R. and W.R. Trevathan, The evolution of human birth. Sci Am, 2001. 285(5): p. 72-7. 11. Steer, P., The epidemiology of preterm labour. BJOG, 2005. 112 Suppl 1: p. 1-3. 12. Challis, J.R., et al., Fetal signals and parturition. J Obstet Gynaecol Res, 2005. 31(6): p. 492-9. 13. Mendelson, C.R., Minireview: fetal-maternal hormonal signaling in pregnancy and labor. Mol Endocrinol, 2009. 23(7): p. 947-54. 14. Lopez Bernal, A., et al., Parturition: activation of stimulatory pathways or loss of uterine quiescence? Adv Exp Med Biol, 1995. 395: p. 435-51. 15. Challis, J.R.G., et al., Endocrine and paracrine regulation of birth at term and preterm. Endocr Rev, 2000. 21(5): p. 514-50. 16. Casey, M.L. and P.C. MacDonald, The endocrinology of human parturition. Ann N Y Acad Sci, 1997. 828: p. 273-84. 17. Norwitz, E.R., J.N. Robinson, and J.R. Challis, The control of labor. N Engl J Med, 1999. 341(9): p. 660-6. 18. Challis, J.R., et al., Prostaglandins and mechanisms of preterm birth. Reproduction, 2002. 124(1): p. 1-17. 19. Bedford, C.A., et al., The role of oestrogens and progesterone in the onset of parturition in various species. J Reprod Fertil Suppl, 1972. 16: p. Suppl 16:1- 23. 20. McCormick, M.C., The contribution of low birth weight to infant mortality and childhood morbidity. N Engl J Med, 1985. 312(2): p. 82-90. 21. Goldenberg, R.L., et al., Epidemiology and causes of preterm birth. Lancet, 2008. 371(9606): p. 75-84. 22. Slattery, M.M. and J.J. Morrison, Preterm delivery. Lancet, 2002. 360(9344): p. 1489-97.
- 175 - References
23. Hamilton, B.E., J.A. Martin, and S.J. Ventura, Births: preliminary data for 2005. Natl Vital Stat Rep, 2006. 55(11): p. 1-18. 24. Martin, J.A., et al., Births: final data for 2005. Natl Vital Stat Rep, 2007. 56(6): p. 1-103. 25. Goldenberg, R.L. and D.J. Rouse, Prevention of premature birth. N Engl J Med, 1998. 339(5): p. 313-20. 26. Magowan, B.A., et al., Neonatal mortality amongst Scottish preterm singleton births (1985-1994). Br J Obstet Gynaecol, 1998. 105(9): p. 1005-10. 27. Wood, N.S., et al., Neurologic and developmental disability after extremely preterm birth. EPICure Study Group. N Engl J Med, 2000. 343(6): p. 378-84. 28. Moster, D., R.T. Lie, and T. Markestad, Long-term medical and social consequences of preterm birth. N Engl J Med, 2008. 359(3): p. 262-73. 29. Murray, C.J. and A.D. Lopez, Global mortality, disability, and the contribution of risk factors: Global Burden of Disease Study. Lancet, 1997. 349(9063): p. 1436-42. 30. Yoon, B.H., et al., Fetal exposure to an intra-amniotic inflammation and the development of cerebral palsy at the age of three years. Am J Obstet Gynecol, 2000. 182(3): p. 675-81. 31. Dammann, O. and A. Leviton, Maternal intrauterine infection, cytokines, and brain damage in the preterm newborn. Pediatr Res, 1997. 42(1): p. 1-8. 32. Vigneswaran, R., Infection and preterm birth: evidence of a common causal relationship with bronchopulmonary dysplasia and cerebral palsy. J Paediatr Child Health, 2000. 36(4): p. 293-6. 33. Bracci, R. and G. Buonocore, Chorioamnionitis: a risk factor for fetal and neonatal morbidity. Biol Neonate, 2003. 83(2): p. 85-96. 34. Petrou, S., The economic consequences of preterm birth during the first 10 years of life. BJOG, 2005. 112 Suppl 1: p. 10-5. 35. Romero, R., et al., The preterm parturition syndrome. BJOG, 2006. 113 Suppl 3: p. 17-42. 36. Romero, R. and M. Mazor, Infection and preterm labor. Clin Obstet Gynecol, 1988. 31(3): p. 553-84. 37. Romero, R., et al., The preterm labor syndrome. Ann N Y Acad Sci, 1994. 734: p. 414-29. 38. Moutquin, J.M., Classification and heterogeneity of preterm birth. BJOG, 2003. 110 Suppl 20: p. 30-3. 39. Goldenberg, R.L., J.C. Hauth, and W.W. Andrews, Intrauterine infection and preterm delivery. N Engl J Med, 2000. 342(20): p. 1500-7. 40. McLean, M., W.A. Walters, and R. Smith, Prediction and early diagnosis of preterm labor: a critical review. Obstet Gynecol Surv, 1993. 48(4): p. 209-25. 41. Vidaeff, A.C. and S.M. Ramin, Management strategies for the prevention of preterm birth: Part II - Update on cervical cerclage. Curr Opin Obstet Gynecol, 2009. 21(6): p. 485-90. 42. Simcox, R., et al., Prophylactic antibiotics for the prevention of preterm birth in women at risk: a meta-analysis. Aust N Z J Obstet Gynaecol, 2007. 47(5): p. 368-77. 43. Sosa, C., et al., Bed rest in singleton pregnancies for preventing preterm birth. Cochrane Database Syst Rev, 2004(1): p. CD003581. 44. Fox, N.S., et al., Does hospitalization prevent preterm delivery in the patient with a short cervix? Am J Perinatol, 2007. 24(1): p. 49-53.
- 176 - References
45. Meis, P.J. and N. Connors, Progesterone treatment to prevent preterm birth. Clin Obstet Gynecol, 2004. 47(4): p. 784-95; discussion 881-2. 46. Beck, P., et al., Synergistic effect of human relaxin and progesterone on human myometrial contractions. Int J Gynaecol Obstet, 1982. 20(2): p. 141-4. 47. Levine, L., Habitual Abortion. A Controlled Study of Progestational Therapy. West J Surg Obstet Gynecol, 1964. 72: p. 30-6. 48. Meis, P.J., et al., Prevention of recurrent preterm delivery by 17 alpha- hydroxyprogesterone caproate. N Engl J Med, 2003. 348(24): p. 2379-85. 49. Rouse, D.J., et al., A trial of 17 alpha-hydroxyprogesterone caproate to prevent prematurity in twins. N Engl J Med, 2007. 357(5): p. 454-61. 50. Hartikainen-Sorri, A.L., A. Kauppila, and R. Tuimala, Inefficacy of 17 alpha- hydroxyprogesterone caproate in the prevention of prematurity in twin pregnancy. Obstet Gynecol, 1980. 56(6): p. 692-5. 51. Caritis, S.N., et al., Prevention of preterm birth in triplets using 17 alpha- hydroxyprogesterone caproate: a randomized controlled trial. Obstet Gynecol, 2009. 113(2 Pt 1): p. 285-92. 52. Rebarber, A., et al., Increased recurrence of preterm delivery with early cessation of 17-alpha-hydroxyprogesterone caproate. Am J Obstet Gynecol, 2007. 196(3): p. 224 e1-4. 53. Waters, T.P., et al., Effect of 17alpha-hydroxyprogesterone caproate on glucose intolerance in pregnancy. Obstet Gynecol, 2009. 114(1): p. 45-9. 54. Sideris, I.G. and K.H. Nicolaides, Amniotic fluid pressure during pregnancy. Fetal Diagn Ther, 1990. 5(2): p. 104-8. 55. Fisk, N.M., et al., Normal amniotic pressure throughout gestation. Br J Obstet Gynaecol, 1992. 99(1): p. 18-22. 56. Sladek, S.M., A. Westerhausen-Larson, and J.M. Roberts, Endogenous nitric oxide suppresses rat myometrial connexin 43 gap junction protein expression during pregnancy. Biol Reprod, 1999. 61(1): p. 8-13. 57. Linton, E.A., et al., Corticotrophin releasing hormone: its potential for a role in human myometrium. Exp Physiol, 2001. 86(2): p. 273-81. 58. Ou, C.W., A. Orsino, and S.J. Lye, Expression of connexin-43 and connexin- 26 in the rat myometrium during pregnancy and labor is differentially regulated by mechanical and hormonal signals. Endocrinology, 1997. 138(12): p. 5398-407. 59. Ou, C.W., et al., Increased expression of the rat myometrial oxytocin receptor messenger ribonucleic acid during labor requires both mechanical and hormonal signals. Biol Reprod, 1998. 59(5): p. 1055-61. 60. Wu, W.X., et al., Differential expression of myometrial oxytocin receptor and prostaglandin H synthase 2, but not estrogen receptor alpha and heat shock protein 90 messenger ribonucleic acid in the gravid horn and nongravid horn in sheep during betamethasone-induced labor. Endocrinology, 1999. 140(12): p. 5712-8. 61. Chow, L. and S.J. Lye, Expression of the gap junction protein connexin-43 is increased in the human myometrium toward term and with the onset of labor. Am J Obstet Gynecol, 1994. 170(3): p. 788-95. 62. Ticconi, C. and S.J. Lye, Placenta and fetal membranes in human parturition and preterm delivery--a workshop report. Placenta, 2002. 23 Suppl A: p. S149-52. 63. McLean, M. and R. Smith, Corticotrophin-releasing hormone and human parturition. Reproduction, 2001. 121(4): p. 493-501.
- 177 - References
64. Condon, J.C., et al., Surfactant protein secreted by the maturing mouse fetal lung acts as a hormone that signals the initiation of parturition. Proc Natl Acad Sci U S A, 2004. 101(14): p. 4978-83. 65. Gardner, M.O., et al., The origin and outcome of preterm twin pregnancies. Obstet Gynecol, 1995. 85(4): p. 553-7. 66. Kirkinen, P. and P. Jouppila, Polyhydramnion. A clinical study. Ann Chir Gynaecol, 1978. 67(3): p. 117-22. 67. Hill, L.M., et al., Polyhydramnios: ultrasonically detected prevalence and neonatal outcome. Obstet Gynecol, 1987. 69(1): p. 21-5. 68. Phelan, J.P., et al., Polyhydramnios and perinatal outcome. J Perinatol, 1990. 10(4): p. 347-50. 69. Heinonen, P.K., Unicornuate uterus and rudimentary horn. Fertil Steril, 1997. 68(2): p. 224-30. 70. Ludmir, J., et al., Pregnancy outcome of patients with uncorrected uterine anomalies managed in a high-risk obstetric setting. Obstet Gynecol, 1990. 75(6): p. 906-10. 71. Hall, J.G., Twinning. Lancet, 2003. 362(9385): p. 735-43. 72. Alexander, G.R., et al., What are the fetal growth patterns of singletons, twins, and triplets in the United States? Clin Obstet Gynecol, 1998. 41(1): p. 114-25. 73. McDonald, S., et al., Perinatal outcomes of in vitro fertilization twins: a systematic review and meta-analyses. Am J Obstet Gynecol, 2005. 193(1): p. 141-52. 74. Norman, J.E., et al., Progesterone for the prevention of preterm birth in twin pregnancy (STOPPIT): a randomised, double-blind, placebo-controlled study and meta-analysis. Lancet, 2009. 373(9680): p. 2034-40. 75. TambyRaja, R.L. and S.S. Ratnam, Plasma steroid changes in twin pregnancies. Prog Clin Biol Res, 1981. 69A: p. 189-95. 76. Toyoshima, K., et al., Platelet-activating factor. Role in fetal lung development and relationship to normal and premature labor. Clin Perinatol, 1995. 22(2): p. 263-80. 77. Stock, S. and J. Norman, Preterm and term labour in multiple pregnancies. Semin Fetal Neonatal Med, 2010. 15(6): p. 336-41. 78. Lyall, F., et al., Expression of Gsalpha, connexin-43, connexin-26, and EP1, 3, and 4 receptors in myometrium of prelabor singleton versus multiple gestations and the effects of mechanical stretch and steroids on Gsalpha. J Soc Gynecol Investig, 2002. 9(5): p. 299-307. 79. Newman, R.B., et al., A prospective masked observational study of uterine contraction frequency in twins. Am J Obstet Gynecol, 2006. 195(6): p. 1564- 70. 80. Sfakianaki, A.K., et al., Ultrasonographic evaluation of myometrial thickness in twin pregnancies. Am J Obstet Gynecol, 2008. 198(5): p. 530 e1-10. 81. Degani, S., et al., Myometrial thickness in pregnancy: longitudinal sonographic study. J Ultrasound Med, 1998. 17(10): p. 661-5. 82. Mitchell, J.A., et al., Mechanical stretch and progesterone differentially regulate activator protein-1 transcription factors in primary rat myometrial smooth muscle cells. Am J Physiol Endocrinol Metab, 2004. 287(3): p. E439- 45. 83. Mohan, A.R., et al., The effect of mechanical stretch on cyclooxygenase type 2 expression and activator protein-1 and nuclear factor-kappaB activity in human amnion cells. Endocrinology, 2007. 148(4): p. 1850-7.
- 178 - References
84. Korita, D., et al., Cyclic mechanical stretch augments prostacyclin production in cultured human uterine myometrial cells from pregnant women: possible involvement of up-regulation of prostacyclin synthase expression. J Clin Endocrinol Metab, 2002. 87(11): p. 5209-19. 85. Terzidou, V., et al., Mechanical stretch up-regulates the human oxytocin receptor in primary human uterine myocytes. J Clin Endocrinol Metab, 2005. 90(1): p. 237-46. 86. Li, Y., et al., Stretch activates human myometrium via ERK, caldesmon and focal adhesion signaling. PLoS One, 2009. 4(10): p. e7489. 87. Sooranna, S.R., et al., Mechanical stretch activates type 2 cyclooxygenase via activator protein-1 transcription factor in human myometrial cells. Mol Hum Reprod, 2004. 10(2): p. 109-13. 88. Kumar, A., A.J. Knox, and A.M. Boriek, CCAAT/enhancer-binding protein and activator protein-1 transcription factors regulate the expression of interleukin-8 through the mitogen-activated protein kinase pathways in response to mechanical stretch of human airway smooth muscle cells. J Biol Chem, 2003. 278(21): p. 18868-76. 89. Kobayashi, S., et al., Stretch-induced IL-6 secretion from endothelial cells requires NF-kappaB activation. Biochem Biophys Res Commun, 2003. 308(2): p. 306-12. 90. Romero, R., et al., The role of inflammation and infection in preterm birth. Semin Reprod Med, 2007. 25(1): p. 21-39. 91. Romero, R., et al., Inflammation in preterm and term labour and delivery. Semin Fetal Neonatal Med, 2006. 11(5): p. 317-26. 92. Orsi, N.M. and R.M. Tribe, Cytokine networks and the regulation of uterine function in pregnancy and parturition. J Neuroendocrinol, 2008. 20(4): p. 462- 9. 93. Chaouat, G., Regulation of T-cell activities at the feto-placental interface--by placenta? Am J Reprod Immunol, 1999. 42(4): p. 199-204. 94. Challis, J.R., et al., Inflammation and pregnancy. Reprod Sci, 2009. 16(2): p. 206-15. 95. Minkoff, H., Prematurity: infection as an etiologic factor. Obstet Gynecol, 1983. 62(2): p. 137-44. 96. Romero, R., et al., Infection in the pathogenesis of preterm labor. Semin Perinatol, 1988. 12(4): p. 262-79. 97. Romero, R., et al., Infection and labor. V. Prevalence, microbiology, and clinical significance of intraamniotic infection in women with preterm labor and intact membranes. Am J Obstet Gynecol, 1989. 161(3): p. 817-24. 98. Goncalves, L.F., T. Chaiworapongsa, and R. Romero, Intrauterine infection and prematurity. Ment Retard Dev Disabil Res Rev, 2002. 8(1): p. 3-13. 99. Gibbs, R.S., et al., Experimental intrauterine infection with Prevotella bivia in New Zealand White rabbits. Am J Obstet Gynecol, 2004. 190(4): p. 1082-6. 100. Elovitz, M.A. and C. Mrinalini, Animal models of preterm birth. Trends Endocrinol Metab, 2004. 15(10): p. 479-87. 101. Wang, H. and E. Hirsch, Bacterially-induced preterm labor and regulation of prostaglandin-metabolizing enzyme expression in mice: the role of toll-like receptor 4. Biol Reprod, 2003. 69(6): p. 1957-63. 102. Kaul, A.K., et al., Experimental gestational pyelonephritis induces preterm births and low birth weights in C3H/HeJ mice. Infect Immun, 1999. 67(11): p. 5958-66.
- 179 - References
103. Munn, M.B., et al., Pneumonia as a complication of pregnancy. J Matern Fetal Med, 1999. 8(4): p. 151-4. 104. Kalanda, B.F., et al., Adverse birth outcomes in a malarious area. Epidemiol Infect, 2006. 134(3): p. 659-66. 105. Horowitz, S., et al., Infection of the amniotic cavity with Ureaplasma urealyticum in the midtrimester of pregnancy. J Reprod Med, 1995. 40(5): p. 375-9. 106. Wenstrom, K.D., et al., Elevated second-trimester amniotic fluid interleukin-6 levels predict preterm delivery. Am J Obstet Gynecol, 1998. 178(3): p. 546- 50. 107. Yoon, B.H., et al., An elevated amniotic fluid matrix metalloproteinase-8 level at the time of mid-trimester genetic amniocentesis is a risk factor for spontaneous preterm delivery. Am J Obstet Gynecol, 2001. 185(5): p. 1162-7. 108. Fidel, P., et al., The effect of antibiotic therapy on intrauterine infection- induced preterm parturition in rabbits. J Matern Fetal Neonatal Med, 2003. 14(1): p. 57-64. 109. Osman, I., et al., Leukocyte density and pro-inflammatory cytokine expression in human fetal membranes, decidua, cervix and myometrium before and during labour at term. Mol Hum Reprod, 2003. 9(1): p. 41-5. 110. Young, A., et al., Immunolocalization of proinflammatory cytokines in myometrium, cervix, and fetal membranes during human parturition at term. Biol Reprod, 2002. 66(2): p. 445-9. 111. King, A.E., et al., Innate immune defences in the human uterus during pregnancy. Placenta, 2007. 28(11-12): p. 1099-106. 112. Baschat, A.A., et al., Prevalence of viral DNA in amniotic fluid of low-risk pregnancies in the second trimester. J Matern Fetal Neonatal Med, 2003. 13(6): p. 381-4. 113. Romero, R., et al., Human decidua: a source of interleukin-1. Obstet Gynecol, 1989. 73(1): p. 31-4. 114. Romero, R., et al., Interleukin-1 stimulates prostaglandin biosynthesis by human amnion. Prostaglandins, 1989. 37(1): p. 13-22. 115. Romero, R., et al., Infection and labor. III. Interleukin-1: a signal for the onset of parturition. Am J Obstet Gynecol, 1989. 160(5 Pt 1): p. 1117-23. 116. Sadowsky, D.W., et al., Dexamethasone or interleukin-10 blocks interleukin- 1beta-induced uterine contractions in pregnant rhesus monkeys. Am J Obstet Gynecol, 2003. 188(1): p. 252-63. 117. Vadillo-Ortega, F., et al., Identification of matrix metalloproteinase-9 in amniotic fluid and amniochorion in spontaneous labor and after experimental intrauterine infection or interleukin-1 beta infusion in pregnant rhesus monkeys. Am J Obstet Gynecol, 2002. 186(1): p. 128-38. 118. Sadowsky, D.W., et al., Preterm labor is induced by intraamniotic infusions of interleukin-1beta and tumor necrosis factor-alpha but not by interleukin-6 or interleukin-8 in a nonhuman primate model. Am J Obstet Gynecol, 2006. 195(6): p. 1578-89. 119. Romero, R., M. Mazor, and B. Tartakovsky, Systemic administration of interleukin-1 induces preterm parturition in mice. Am J Obstet Gynecol, 1991. 165(4 Pt 1): p. 969-71. 120. Romero, R. and B. Tartakovsky, The natural interleukin-1 receptor antagonist prevents interleukin-1-induced preterm delivery in mice. Am J Obstet Gynecol, 1992. 167(4 Pt 1): p. 1041-5.
- 180 - References
121. Hirsch, E., et al., Bacterially induced preterm labor in the mouse does not require maternal interleukin-1 signaling. Am J Obstet Gynecol, 2002. 186(3): p. 523-30. 122. Hirsch, E., Y. Filipovich, and M. Mahendroo, Signaling via the type I IL-1 and TNF receptors is necessary for bacterially induced preterm labor in a murine model. Am J Obstet Gynecol, 2006. 194(5): p. 1334-40. 123. Casey, M.L., et al., Cachectin/tumor necrosis factor-alpha formation in human decidua. Potential role of cytokines in infection-induced preterm labor. J Clin Invest, 1989. 83(2): p. 430-6. 124. Romero, R., et al., Infection and labor. IV. Cachectin-tumor necrosis factor in the amniotic fluid of women with intraamniotic infection and preterm labor. Am J Obstet Gynecol, 1989. 161(2): p. 336-41. 125. Fidel, P.L., Jr., et al., Systemic and local cytokine profiles in endotoxin- induced preterm parturition in mice. Am J Obstet Gynecol, 1994. 170(5 Pt 1): p. 1467-75. 126. Chwalisz, K., et al., Cervical ripening with the cytokines interleukin 8, interleukin 1 beta and tumour necrosis factor alpha in guinea-pigs. Hum Reprod, 1994. 9(11): p. 2173-81. 127. Gravett, M.G., et al., An experimental model for intraamniotic infection and preterm labor in rhesus monkeys. Am J Obstet Gynecol, 1994. 171(6): p. 1660-7. 128. Barclay, C.G., et al., Interleukin-8 production by the human cervix. Am J Obstet Gynecol, 1993. 169(3): p. 625-32. 129. Kelly, R.W., R. Leask, and A.A. Calder, Choriodecidual production of interleukin-8 and mechanism of parturition. Lancet, 1992. 339(8796): p. 776- 7. 130. Elliott, C.L., et al., Regulation of interleukin 8 production in the term human placenta during labor and by antigestagens. Am J Obstet Gynecol, 1998. 179(1): p. 215-20. 131. Elliott, C.L., et al., Interleukin 8 expression in human myometrium: changes in relation to labor onset and with gestational age. Am J Reprod Immunol, 2000. 43(5): p. 272-7. 132. Standiford, T.J., et al., Interleukin-8 gene expression by a pulmonary epithelial cell line. A model for cytokine networks in the lung. J Clin Invest, 1990. 86(6): p. 1945-53. 133. Loudon, J.A., et al., Mechanical stretch of human uterine smooth muscle cells increases IL-8 mRNA expression and peptide synthesis. Mol Hum Reprod, 2004. 10(12): p. 895-9. 134. Thomson, A.J., et al., Leukocytes infiltrate the myometrium during human parturition: further evidence that labour is an inflammatory process. Hum Reprod, 1999. 14(1): p. 229-36. 135. Romero, R., et al., A comparative study of the diagnostic performance of amniotic fluid glucose, white blood cell count, interleukin-6, and gram stain in the detection of microbial invasion in patients with preterm premature rupture of membranes. Am J Obstet Gynecol, 1993. 169(4): p. 839-51. 136. Romero, R., et al., The diagnostic and prognostic value of amniotic fluid white blood cell count, glucose, interleukin-6, and gram stain in patients with preterm labor and intact membranes. Am J Obstet Gynecol, 1993. 169(4): p. 805-16.
- 181 - References
137. Romero, R., et al., Amniotic fluid interleukin-6 determinations are of diagnostic and prognostic value in preterm labor. Am J Reprod Immunol, 1993. 30(2-3): p. 167-83. 138. Hanna, N., et al., Gestational age-dependent expression of IL-10 and its receptor in human placental tissues and isolated cytotrophoblasts. J Immunol, 2000. 164(11): p. 5721-8. 139. Hanna, N., et al., Evidence for interleukin-10-mediated inhibition of cyclo- oxygenase-2 expression and prostaglandin production in preterm human placenta. Am J Reprod Immunol, 2006. 55(1): p. 19-27. 140. Terrone, D.A., et al., Interleukin-10 administration and bacterial endotoxin- induced preterm birth in a rat model. Obstet Gynecol, 2001. 98(3): p. 476-80. 141. Keelan, J.A., et al., Cytokines, prostaglandins and parturition--a review. Placenta, 2003. 24 Suppl A: p. S33-46. 142. Slater, D.M., S. Zervou, and S. Thornton, Prostaglandins and prostanoid receptors in human pregnancy and parturition. J Soc Gynecol Investig, 2002. 9(3): p. 118-24. 143. Mitchell, M.D., et al., Prostaglandins and parturition. Reprod Fertil Dev, 1995. 7(3): p. 623-32. 144. Romero, R., et al., Increase in prostaglandin bioavailability precedes the onset of human parturition. Prostaglandins Leukot Essent Fatty Acids, 1996. 54(3): p. 187-91. 145. Zakar, T. and F. Hertelendy, Regulation of prostaglandin synthesis in the human uterus. J Matern Fetal Med, 2001. 10(4): p. 223-35. 146. Hertelendy, F., R. Woods, and B.M. Jaffe, Prostaglandin E levels in peripheral blood during labor. Prostaglandins, 1973. 3(2): p. 223-7. 147. Satoh, K., et al., Prostaglandin F2 alpha metabolite levels in plasma, amniotic fluid, and urine during pregnancy and labor. Am J Obstet Gynecol, 1979. 133(8): p. 886-90. 148. Embrey, M., PGE compounds for induction of labour and abortion. Ann N Y Acad Sci, 1971. 180: p. 518-23. 149. Thiery, M., J.J. Amy, and J.M. Decoster, Vaginal prostaglandin E2 for interruption of pregnancy and management of intrauterine death. Z Geburtshilfe Perinatol, 1979. 183(3): p. 218-22. 150. Robins, J. and L.I. Mann, Midtrimester pregnancy termination by intramuscular injection of a 15-methyl analogue of prostaglandin F2 alpha. Am J Obstet Gynecol, 1975. 123(6): p. 625-31. 151. Jain, J.K. and D.R. Mishell, Jr., A comparison of intravaginal misoprostol with prostaglandin E2 for termination of second-trimester pregnancy. N Engl J Med, 1994. 331(5): p. 290-3. 152. Lewis, R.B. and J.D. Schulman, Influence of acetylsalicylic acid, an inhibitor of prostaglandin synthesis, on the duration of human gestation and labour. Lancet, 1973. 2(7839): p. 1159-61. 153. Zuckerman, H., U. Reiss, and I. Rubinstein, Inhibition of human premature labor by indomethacin. Obstet Gynecol, 1974. 44(6): p. 787-92. 154. Mitchell, B.F. and D.M. Olson, Prostaglandin endoperoxide H synthase inhibitors and other tocolytics in preterm labour. Prostaglandins Leukot Essent Fatty Acids, 2004. 70(2): p. 167-87. 155. King, J., et al., Cyclo-oxygenase (COX) inhibitors for treating preterm labour. Cochrane Database Syst Rev, 2005(2): p. CD001992.
- 182 - References
156. Carrasco, M.P., et al., Fluprostenol activates phospholipase C and Ca2+ mobilization in human myometrial cells. J Clin Endocrinol Metab, 1996. 81(6): p. 2104-10. 157. Molnar, M. and F. Hertelendy, Regulation of intracellular free calcium in human myometrial cells by prostaglandin F2 alpha: comparison with oxytocin. J Clin Endocrinol Metab, 1990. 71(5): p. 1243-50. 158. Molnar, M., J. Rigo, Jr., and F. Hertelendy, Signal transduction in human myometrial cells. Acta Physiol Hung, 1996. 84(2): p. 89-97. 159. Funk, C.D., Prostaglandins and leukotrienes: advances in eicosanoid biology. Science, 2001. 294(5548): p. 1871-5. 160. Rice, G.E., et al., Contribution of type II phospholipase A2 to in vitro phospholipase A2 enzymatic activity in human term placenta. J Endocrinol, 1998. 157(1): p. 25-31. 161. Skannal, D.G., et al., Changes in activity of cytosolic phospholipase A2 in human amnion at parturition. Am J Obstet Gynecol, 1997. 177(1): p. 179-84. 162. Munns, M.J., et al., Secretory type II PLA2 immunoreactivity and PLA2 enzymatic activity in human gestational tissues before, during and after spontaneous-onset labour at term. Placenta, 1999. 20(1): p. 21-6. 163. Bennett, P., et al., The expression of phospholipase A2 and lipocortins (annexins) I, II and V in human fetal membranes and placenta in association with labour. Prostaglandins, 1994. 48(2): p. 81-90. 164. Brown, A.G., R.S. Leite, and J.F. Strauss, 3rd, Mechanisms underlying "functional" progesterone withdrawal at parturition. Ann N Y Acad Sci, 2004. 1034: p. 36-49. 165. Goppelt-Struebe, M., Regulation of prostaglandin endoperoxide synthase (cyclooxygenase) isozyme expression. Prostaglandins Leukot Essent Fatty Acids, 1995. 52(4): p. 213-22. 166. Herschman, H.R., Regulation of prostaglandin synthase-1 and prostaglandin synthase-2. Cancer Metastasis Rev, 1994. 13(3-4): p. 241-56. 167. Hirst, J.J., et al., Prostaglandin endoperoxide-H synthase-1 and -2 messenger ribonucleic acid levels in human amnion with spontaneous labor onset. J Clin Endocrinol Metab, 1995. 80(2): p. 517-23. 168. Hirst, J.J., et al., Prostaglandin H synthase-2 expression increases in human gestational tissues with spontaneous labour onset. Reprod Fertil Dev, 1995. 7(3): p. 633-7. 169. Slater, D.M., et al., Expression of cyclooxygenase types 1 and 2 in human fetal membranes at term. Am J Obstet Gynecol, 1995. 172(1 Pt 1): p. 77-82. 170. Slater, D., V. Allport, and P. Bennett, Changes in the expression of the type-2 but not the type-1 cyclo-oxygenase enzyme in chorion-decidua with the onset of labour. Br J Obstet Gynaecol, 1998. 105(7): p. 745-8. 171. Bennett, P.R., et al., Changes in amniotic arachidonic acid metabolism associated with increased cyclo-oxygenase gene expression. Br J Obstet Gynaecol, 1993. 100(11): p. 1037-42. 172. Zakar, T., et al., Regulation of prostaglandin endoperoxide H2 synthase in term human gestational tissues. Acta Physiol Hung, 1996. 84(2): p. 109-18. 173. Mitchell, M.D., et al., Mechanism of interleukin-1 beta stimulation of human amnion prostaglandin biosynthesis: mediation via a novel inducible cyclooxygenase. Placenta, 1993. 14(6): p. 615-25.
- 183 - References
174. Ishihara, O., et al., Interleukin-1 beta stimulates decidual stromal cell cyclo- oxygenase enzyme and prostaglandin production. Prostaglandins, 1992. 44(1): p. 43-52. 175. Erkinheimo, T.L., et al., Expression of cyclooxygenase-2 and prostanoid receptors by human myometrium. J Clin Endocrinol Metab, 2000. 85(9): p. 3468-75. 176. Allport, V.C., et al., Human labour is associated with nuclear factor-kappaB activity which mediates cyclo-oxygenase-2 expression and is involved with the 'functional progesterone withdrawal'. Mol Hum Reprod, 2001. 7(6): p. 581-6. 177. Johnson, R.F., et al., The in vivo control of prostaglandin H synthase-2 messenger ribonucleic acid expression in the human amnion at parturition. J Clin Endocrinol Metab, 2002. 87(6): p. 2816-23. 178. Dixon, D.A., et al., Post-transcriptional control of cyclooxygenase-2 gene expression. The role of the 3'-untranslated region. J Biol Chem, 2000. 275(16): p. 11750-7. 179. Tamura, M., et al., Interleukin-1beta elevates cyclooxygenase-2 protein level and enzyme activity via increasing its mRNA stability in human endometrial stromal cells: an effect mediated by extracellularly regulated kinases 1 and 2. J Clin Endocrinol Metab, 2002. 87(7): p. 3263-73. 180. Appleby, S.B., et al., Structure of the human cyclo-oxygenase-2 gene. Biochem J, 1994. 302 ( Pt 3): p. 723-7. 181. Kang, Y.J., et al., Cyclooxygenase-2 gene transcription in a macrophage model of inflammation. J Immunol, 2006. 177(11): p. 8111-22. 182. Gorgoni, B., et al., The transcription factor C/EBPbeta is essential for inducible expression of the cox-2 gene in macrophages but not in fibroblasts. J Biol Chem, 2001. 276(44): p. 40769-77. 183. Newton, R., et al., Evidence for involvement of NF-kappaB in the transcriptional control of COX-2 gene expression by IL-1beta. Biochem Biophys Res Commun, 1997. 237(1): p. 28-32. 184. Subbaramaiah, K., et al., Peroxisome proliferator-activated receptor gamma ligands suppress the transcriptional activation of cyclooxygenase-2. Evidence for involvement of activator protein-1 and CREB-binding protein/p300. J Biol Chem, 2001. 276(15): p. 12440-8. 185. Zhu, X.O., et al., Paradoxical stimulation of cyclooxygenase-2 expression by glucocorticoids via a cyclic AMP response element in human amnion fibroblasts. Mol Endocrinol, 2009. 23(11): p. 1839-49. 186. Okazaki, T., et al., Initiation of human parturition. XII. Biosynthesis and metabolism of prostaglandins in human fetal membranes and uterine decidua. Am J Obstet Gynecol, 1981. 139(4): p. 373-81. 187. Hertelendy, F. and T. Zakar, Prostaglandins and the myometrium and cervix. Prostaglandins Leukot Essent Fatty Acids, 2004. 70(2): p. 207-22. 188. Pomini, F., A. Caruso, and J.R. Challis, Interleukin-10 modifies the effects of interleukin-1beta and tumor necrosis factor-alpha on the activity and expression of prostaglandin H synthase-2 and the NAD+-dependent 15- hydroxyprostaglandin dehydrogenase in cultured term human villous trophoblast and chorion trophoblast cells. J Clin Endocrinol Metab, 1999. 84(12): p. 4645-51. 189. Challis, J.R., F.A. Patel, and F. Pomini, Prostaglandin dehydrogenase and the initiation of labor. J Perinat Med, 1999. 27(1): p. 26-34.
- 184 - References
190. Patel, F.A., J.W. Funder, and J.R. Challis, Mechanism of cortisol/progesterone antagonism in the regulation of 15-hydroxyprostaglandin dehydrogenase activity and messenger ribonucleic acid levels in human chorion and placental trophoblast cells at term. J Clin Endocrinol Metab, 2003. 88(6): p. 2922-33. 191. Negishi, M., Y. Sugimoto, and A. Ichikawa, Prostanoid receptors and their biological actions. Prog Lipid Res, 1993. 32(4): p. 417-34. 192. Breyer, R.M., et al., Prostanoid receptors: subtypes and signaling. Annu Rev Pharmacol Toxicol, 2001. 41: p. 661-90. 193. Kotani, M., et al., Molecular cloning and expression of multiple isoforms of human prostaglandin E receptor EP3 subtype generated by alternative messenger RNA splicing: multiple second messenger systems and tissue- specific distributions. Mol Pharmacol, 1995. 48(5): p. 869-79. 194. Arias, F., Pharmacology of oxytocin and prostaglandins. Clin Obstet Gynecol, 2000. 43(3): p. 455-68. 195. Blanks, A.M., A. Shmygol, and S. Thornton, Regulation of oxytocin receptors and oxytocin receptor signaling. Semin Reprod Med, 2007. 25(1): p. 52-9. 196. Fuchs, A.R., et al., Correlation between oxytocin receptor concentration and responsiveness to oxytocin in pregnant rat myometrium: effects of ovarian steroids. Endocrinology, 1983. 113(2): p. 742-9. 197. Mitchell, B.F. and B. Schmid, Oxytocin and its receptor in the process of parturition. J Soc Gynecol Investig, 2001. 8(3): p. 122-33. 198. Soloff, M.S., M. Alexandrova, and M.J. Fernstrom, Oxytocin receptors: triggers for parturition and lactation? Science, 1979. 204(4399): p. 1313-5. 199. Alexandrova, M. and M.S. Soloff, Oxytocin receptors and parturition in the guinea pig. Biol Reprod, 1980. 22(5): p. 1106-11. 200. Fuchs, A.R., et al., Oxytocin receptors in the human uterus during pregnancy and parturition. Am J Obstet Gynecol, 1984. 150(6): p. 734-41. 201. Fuchs, A.R., et al., Oxytocin and bovine parturition: a steep rise in endometrial oxytocin receptors precedes onset of labor. Biol Reprod, 1992. 47(6): p. 937-44. 202. Hinko, A. and M.S. Soloff, Characterization of oxytocin receptors in rabbit amnion involved in the production of prostaglandin E2. Endocrinology, 1992. 130(6): p. 3547-53. 203. Lundin-Schiller, S., et al., Characterization of porcine endometrial, myometrial, and mammary oxytocin binding sites during gestation and labor. Biol Reprod, 1996. 55(3): p. 575-81. 204. Riemer, R.K., et al., Rabbit uterine oxytocin receptors and in vitro contractile response: abrupt changes at term and the role of eicosanoids. Endocrinology, 1986. 119(2): p. 699-709. 205. Fuchs, A.R., et al., Oxytocin receptors and human parturition: a dual role for oxytocin in the initiation of labor. Science, 1982. 215(4538): p. 1396-8. 206. Kimura, T., et al., Expression of oxytocin receptor in human pregnant myometrium. Endocrinology, 1996. 137(2): p. 780-5. 207. Alexandrova, M. and M.S. Soloff, Oxytocin receptors and parturition. I. Control of oxytocin receptor concentration in the rat myometrium at term. Endocrinology, 1980. 106(3): p. 730-5. 208. Romero, R., et al., Infection and prematurity and the role of preventive strategies. Semin Neonatol, 2002. 7(4): p. 259-74.
- 185 - References
209. Romero, R., et al., Interleukin 6 determination in the detection of microbial invasion of the amniotic cavity. Ciba Found Symp, 1992. 167: p. 205-20; discussion 220-3. 210. Terzidou, V., et al., Regulation of the human oxytocin receptor by nuclear factor-kappaB and CCAAT/enhancer-binding protein-beta. J Clin Endocrinol Metab, 2006. 91(6): p. 2317-26. 211. Weiss, G., Endocrinology of parturition. J Clin Endocrinol Metab, 2000. 85(12): p. 4421-5. 212. Graham, J.D. and C.L. Clarke, Physiological action of progesterone in target tissues. Endocr Rev, 1997. 18(4): p. 502-19. 213. Graham, J.D. and C.L. Clarke, Expression and transcriptional activity of progesterone receptor A and progesterone receptor B in mammalian cells. Breast Cancer Res, 2002. 4(5): p. 187-90. 214. Li, X., D.M. Lonard, and B.W. O'Malley, A contemporary understanding of progesterone receptor function. Mech Ageing Dev, 2004. 125(10-11): p. 669- 78. 215. Mote, P.A., J.D. Graham, and C.L. Clarke, Progesterone receptor isoforms in normal and malignant breast. Ernst Schering Found Symp Proc, 2007(1): p. 77-107. 216. Csapo, A., Progesterone block. Am J Anat, 1956. 98(2): p. 273-91. 217. Anderson, A.B., A.P. Flint, and A.C. Turnbull, Mechanism of action of glucocorticoids in induction of ovine parturition: effect on placental steroid metabolism. J Endocrinol, 1975. 66(1): p. 61-70. 218. Keelan, J.A., M. Coleman, and M.D. Mitchell, The molecular mechanisms of term and preterm labor: recent progress and clinical implications. Clin Obstet Gynecol, 1997. 40(3): p. 460-78. 219. Liggins, G.C., et al., The mechanism of initiation of parturition in the ewe. Recent Prog Horm Res, 1973. 29: p. 111-59. 220. Mesiano, S., Roles of estrogen and progesterone in human parturition. Front Horm Res, 2001. 27: p. 86-104. 221. Young, I.R., The comparative physiology of parturition in mammals. Front Horm Res, 2001. 27: p. 10-30. 222. Sugimoto, Y., et al., Failure of parturition in mice lacking the prostaglandin F receptor. Science, 1997. 277(5326): p. 681-3. 223. Pandey, A.V., S.H. Mellon, and W.L. Miller, Protein phosphatase 2A and phosphoprotein SET regulate androgen production by P450c17. J Biol Chem, 2003. 278(5): p. 2837-44. 224. Csapo, A., The luteo-placental shift, the guardian of pre-natal life. Postgrad Med J, 1969. 45(519): p. 57-64. 225. Peyron, R., et al., Early termination of pregnancy with mifepristone (RU 486) and the orally active prostaglandin misoprostol. N Engl J Med, 1993. 328(21): p. 1509-13. 226. Mesiano, S. and T.N. Welsh, Steroid hormone control of myometrial contractility and parturition. Semin Cell Dev Biol, 2007. 18(3): p. 321-31. 227. Westphal, U., S.D. Stroupe, and S.L. Cheng, Progesterone binding to serum proteins. Ann N Y Acad Sci, 1977. 286: p. 10-28. 228. Schwarz, B.E., et al., Initiation of human parturition. V. Progesterone binding substance in fetal membranes. Obstet Gynecol, 1976. 48(6): p. 685-9.
- 186 - References
229. Milewich, L., et al., Initiation of human parturition. VIII. Metabolism of progesterone by fetal membranes of early and late human gestation. Obstet Gynecol, 1977. 50(1): p. 45-8. 230. Mitchell, B.F. and S. Wong, Changes in 17 beta,20 alpha-hydroxysteroid dehydrogenase activity supporting an increase in the estrogen/progesterone ratio of human fetal membranes at parturition. Am J Obstet Gynecol, 1993. 168(5): p. 1377-85. 231. Karalis, K., G. Goodwin, and J.A. Majzoub, Cortisol blockade of progesterone: a possible molecular mechanism involved in the initiation of human labor. Nat Med, 1996. 2(5): p. 556-60. 232. Mesiano, S., Myometrial progesterone responsiveness. Semin Reprod Med, 2007. 25(1): p. 5-13. 233. Gellersen, B., M.S. Fernandes, and J.J. Brosens, Non-genomic progesterone actions in female reproduction. Hum Reprod Update, 2009. 15(1): p. 119-38. 234. Giangrande, P.H. and D.P. McDonnell, The A and B isoforms of the human progesterone receptor: two functionally different transcription factors encoded by a single gene. Recent Prog Horm Res, 1999. 54: p. 291-313; discussion 313-4. 235. Kastner, P., et al., Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. Embo J, 1990. 9(5): p. 1603-14. 236. Sartorius, C.A., et al., A third transactivation function (AF3) of human progesterone receptors located in the unique N-terminal segment of the B- isoform. Mol Endocrinol, 1994. 8(10): p. 1347-60. 237. Giangrande, P.H., et al., The opposing transcriptional activities of the two isoforms of the human progesterone receptor are due to differential cofactor binding. Mol Cell Biol, 2000. 20(9): p. 3102-15. 238. Tung, L., et al., Antagonist-occupied human progesterone B-receptors activate transcription without binding to progesterone response elements and are dominantly inhibited by A-receptors. Mol Endocrinol, 1993. 7(10): p. 1256-65. 239. Vegeto, E., et al., Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function. Mol Endocrinol, 1993. 7(10): p. 1244-55. 240. Hirata, S., et al., The novel isoform of the progesterone receptor cDNA in the human testis and detection of its mRNA in the human uterine endometrium. Oncology, 2000. 59 Suppl 1: p. 39-44. 241. Hirata, S., et al., The novel exon, exon T, of the human progesterone receptor gene and the genomic organization of the gene. J Steroid Biochem Mol Biol, 2002. 80(3): p. 365-7. 242. Hisatomi, H., et al., Novel alternatively spliced variant with a deletion of 52 BP in exon 6 of the progesterone receptor gene is observed frequently in breast cancer tissues. Int J Cancer, 2003. 105(2): p. 182-5. 243. Saner, K.J., et al., Cloning and expression of a novel, truncated, progesterone receptor. Mol Cell Endocrinol, 2003. 200(1-2): p. 155-63. 244. Wei, L.L., et al., 5'-Heterogeneity in human progesterone receptor transcripts predicts a new amino-terminal truncated "C"-receptor and unique A-receptor messages. Mol Endocrinol, 1990. 4(12): p. 1833-40. 245. Yamanaka, T., et al., Progesterone receptor mRNA variant containing novel exon insertions between exon 4 and exon 5 in human uterine endometrium. Endocr J, 2002. 49(4): p. 473-82.
- 187 - References
246. Haluska, G.J., et al., Progesterone receptor localization and isoforms in myometrium, decidua, and fetal membranes from rhesus macaques: evidence for functional progesterone withdrawal at parturition. J Soc Gynecol Investig, 2002. 9(3): p. 125-36. 247. Madsen, G., et al., Prostaglandins differentially modulate progesterone receptor-A and -B expression in human myometrial cells: evidence for prostaglandin-induced functional progesterone withdrawal. J Clin Endocrinol Metab, 2004. 89(2): p. 1010-3. 248. Mesiano, S., Myometrial progesterone responsiveness and the control of human parturition. J Soc Gynecol Investig, 2004. 11(4): p. 193-202. 249. Mesiano, S., et al., Progesterone withdrawal and estrogen activation in human parturition are coordinated by progesterone receptor A expression in the myometrium. J Clin Endocrinol Metab, 2002. 87(6): p. 2924-30. 250. Ni, X., et al., Progesterone receptors A and B differentially modulate corticotropin-releasing hormone gene expression through a cAMP regulatory element. Cell Mol Life Sci, 2004. 61(9): p. 1114-22. 251. Oh, S.Y., et al., Progesterone receptor isoform (A/B) ratio of human fetal membranes increases during term parturition. Am J Obstet Gynecol, 2005. 193(3 Pt 2): p. 1156-60. 252. Leite, R.S., A.G. Brown, and J.F. Strauss, 3rd, Tumor necrosis factor-alpha suppresses the expression of steroid receptor coactivator-1 and -2: a possible mechanism contributing to changes in steroid hormone responsiveness. FASEB J, 2004. 18(12): p. 1418-20. 253. Abdel-Hafiz, H., et al., The inhibitory function in human progesterone receptor N termini binds SUMO-1 protein to regulate autoinhibition and transrepression. J Biol Chem, 2002. 277(37): p. 33950-6. 254. Lange, C.A., T. Shen, and K.B. Horwitz, Phosphorylation of human progesterone receptors at serine-294 by mitogen-activated protein kinase signals their degradation by the 26S proteasome. Proc Natl Acad Sci U S A, 2000. 97(3): p. 1032-7. 255. Weigel, N.L., Steroid hormone receptors and their regulation by phosphorylation. Biochem J, 1996. 319 ( Pt 3): p. 657-67. 256. Jones, M.C., et al., Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A, 2006. 103(44): p. 16272-7. 257. Heine, G.F. and J.D. Parvin, BRCA1 control of steroid receptor ubiquitination. Sci STKE, 2007. 2007(391): p. pe34. 258. Faus, H. and B. Haendler, Post-translational modifications of steroid receptors. Biomed Pharmacother, 2006. 60(9): p. 520-8. 259. Moore, N.L., R. Narayanan, and N.L. Weigel, Cyclin dependent kinase 2 and the regulation of human progesterone receptor activity. Steroids, 2007. 72(2): p. 202-9. 260. Narayanan, R., D.P. Edwards, and N.L. Weigel, Human progesterone receptor displays cell cycle-dependent changes in transcriptional activity. Mol Cell Biol, 2005. 25(8): p. 2885-98. 261. Pierson-Mullany, L.K. and C.A. Lange, Phosphorylation of progesterone receptor serine 400 mediates ligand-independent transcriptional activity in response to activation of cyclin-dependent protein kinase 2. Mol Cell Biol, 2004. 24(24): p. 10542-57.
- 188 - References
262. Shen, T., K.B. Horwitz, and C.A. Lange, Transcriptional hyperactivity of human progesterone receptors is coupled to their ligand-dependent down- regulation by mitogen-activated protein kinase-dependent phosphorylation of serine 294. Mol Cell Biol, 2001. 21(18): p. 6122-31. 263. Takimoto, G.S., et al., Role of phosphorylation on DNA binding and transcriptional functions of human progesterone receptors. J Biol Chem, 1996. 271(23): p. 13308-16. 264. Boonyaratanakornkit, V., et al., The role of extranuclear signaling actions of progesterone receptor in mediating progesterone regulation of gene expression and the cell cycle. Mol Endocrinol, 2007. 21(2): p. 359-75. 265. Daniel, A.R., E.J. Faivre, and C.A. Lange, Phosphorylation-dependent antagonism of sumoylation derepresses progesterone receptor action in breast cancer cells. Mol Endocrinol, 2007. 21(12): p. 2890-906. 266. Faivre, E.J., et al., Progesterone receptor rapid signaling mediates serine 345 phosphorylation and tethering to specificity protein 1 transcription factors. Mol Endocrinol, 2008. 22(4): p. 823-37. 267. Narayanan, R., et al., Cyclin-dependent kinase activity is required for progesterone receptor function: novel role for cyclin A/Cdk2 as a progesterone receptor coactivator. Mol Cell Biol, 2005. 25(1): p. 264-77. 268. Qiu, M., et al., Mitogen-activated protein kinase regulates nuclear association of human progesterone receptors. Mol Endocrinol, 2003. 17(4): p. 628-42. 269. Lange, C.A., Integration of progesterone receptor action with rapid signaling events in breast cancer models. J Steroid Biochem Mol Biol, 2008. 108(3-5): p. 203-12. 270. Dressing, G.E., et al., Progesterone receptors act as sensors for mitogenic protein kinases in breast cancer models. Endocr Relat Cancer, 2009. 16(2): p. 351-61. 271. Dittmar, K.D., et al., Reconstitution of the steroid receptor.hsp90 heterocomplex assembly system of rabbit reticulocyte lysate. J Biol Chem, 1996. 271(22): p. 12833-9. 272. Elbi, C., et al., Molecular chaperones function as steroid receptor nuclear mobility factors. Proc Natl Acad Sci U S A, 2004. 101(9): p. 2876-81. 273. Kosano, H., et al., The assembly of progesterone receptor-hsp90 complexes using purified proteins. J Biol Chem, 1998. 273(49): p. 32973-9. 274. Tranguch, S., et al., Cochaperone immunophilin FKBP52 is critical to uterine receptivity for embryo implantation. Proc Natl Acad Sci U S A, 2005. 102(40): p. 14326-31. 275. Tranguch, S., et al., FKBP52 deficiency-conferred uterine progesterone resistance is genetic background and pregnancy stage specific. J Clin Invest, 2007. 117(7): p. 1824-34. 276. Reynolds, P.D., et al., Glucocorticoid resistance in the squirrel monkey is associated with overexpression of the immunophilin FKBP51. J Clin Endocrinol Metab, 1999. 84(2): p. 663-9. 277. Scammell, J.G., et al., Overexpression of the FK506-binding immunophilin FKBP51 is the common cause of glucocorticoid resistance in three New World primates. Gen Comp Endocrinol, 2001. 124(2): p. 152-65. 278. Hubler, T.R., et al., The FK506-binding immunophilin FKBP51 is transcriptionally regulated by progestin and attenuates progestin responsiveness. Endocrinology, 2003. 144(6): p. 2380-7.
- 189 - References
279. Lei, K., et al., Uterine stretch and progesterone action. J Clin Endocrinol Metab, 2011. 96(6): p. E1013-24. 280. Smith, D.F. and D.O. Toft, Minireview: the intersection of steroid receptors with molecular chaperones: observations and questions. Mol Endocrinol, 2008. 22(10): p. 2229-40. 281. Rogatsky, I., et al., Alternate surfaces of transcriptional coregulator GRIP1 function in different glucocorticoid receptor activation and repression contexts. Proc Natl Acad Sci U S A, 2002. 99(26): p. 16701-6. 282. Reily, M.M., et al., The GRIP1:IRF3 interaction as a target for glucocorticoid receptor-mediated immunosuppression. Embo J, 2006. 25(1): p. 108-17. 283. Rogatsky, I., K.A. Zarember, and K.R. Yamamoto, Factor recruitment and TIF2/GRIP1 corepressor activity at a collagenase-3 response element that mediates regulation by phorbol esters and hormones. Embo J, 2001. 20(21): p. 6071-83. 284. Cox, S.M., M.L. Casey, and P.C. MacDonald, Accumulation of interleukin- 1beta and interleukin-6 in amniotic fluid: a sequela of labour at term and preterm. Hum Reprod Update, 1997. 3(5): p. 517-27. 285. Olson, D.M., The role of prostaglandins in the initiation of parturition. Best Pract Res Clin Obstet Gynaecol, 2003. 17(5): p. 717-30. 286. Chase, A.J., et al., Role of nuclear factor-kappa B activation in metalloproteinase-1, -3, and -9 secretion by human macrophages in vitro and rabbit foam cells produced in vivo. Arterioscler Thromb Vasc Biol, 2002. 22(5): p. 765-71. 287. Belt, A.R., et al., The nuclear transcription factor NF-kappaB mediates interleukin-1beta-induced expression of cyclooxygenase-2 in human myometrial cells. Am J Obstet Gynecol, 1999. 181(2): p. 359-66. 288. Kalkhoven, E., et al., Negative interaction between the RelA(p65) subunit of NF-kappaB and the progesterone receptor. J Biol Chem, 1996. 271(11): p. 6217-24. 289. Condon, J.C., et al., Up-regulation of the progesterone receptor (PR)-C isoform in laboring myometrium by activation of nuclear factor-kappaB may contribute to the onset of labor through inhibition of PR function. Mol Endocrinol, 2006. 20(4): p. 764-75. 290. Hardy, D.B., et al., Progesterone receptor plays a major antiinflammatory role in human myometrial cells by antagonism of nuclear factor-kappaB activation of cyclooxygenase 2 expression. Mol Endocrinol, 2006. 20(11): p. 2724-33. 291. Bamberger, A.M., et al., Modulation of AP-1 activity by the human progesterone receptor in endometrial adenocarcinoma cells. Proc Natl Acad Sci U S A, 1996. 93(12): p. 6169-74. 292. Christian, M., et al., Functional association of PR and CCAAT/enhancer- binding protein beta isoforms: promoter-dependent cooperation between PR-B and liver-enriched inhibitory protein, or liver-enriched activatory protein and PR-A in human endometrial stromal cells. Mol Endocrinol, 2002. 16(1): p. 141-54. 293. Richer, J.K., et al., Differential gene regulation by the two progesterone receptor isoforms in human breast cancer cells. J Biol Chem, 2002. 277(7): p. 5209-18. 294. Zhu, Y., J. Bond, and P. Thomas, Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a
- 190 - References
fish membrane progestin receptor. Proc Natl Acad Sci U S A, 2003. 100(5): p. 2237-42. 295. Fernandes, M.S., et al., Regulated expression of putative membrane progestin receptor homologues in human endometrium and gestational tissues. J Endocrinol, 2005. 187(1): p. 89-101. 296. Chapman, N.R., et al., Examining the spatio-temporal expression of mRNA encoding the membrane-bound progesterone receptor-alpha isoform in human cervix and myometrium during pregnancy and labour. Mol Hum Reprod, 2006. 12(1): p. 19-24. 297. Karteris, E., et al., Progesterone signaling in human myometrium through two novel membrane G protein-coupled receptors: potential role in functional progesterone withdrawal at term. Mol Endocrinol, 2006. 20(7): p. 1519-34. 298. Krietsch, T., et al., Human homologs of the putative G protein-coupled membrane progestin receptors (mPRalpha, beta, and gamma) localize to the endoplasmic reticulum and are not activated by progesterone. Mol Endocrinol, 2006. 20(12): p. 3146-64. 299. Peluso, J.J., Multiplicity of progesterone's actions and receptors in the mammalian ovary. Biol Reprod, 2006. 75(1): p. 2-8. 300. Boonyaratanakornkit, V., et al., Progesterone receptor contains a proline-rich motif that directly interacts with SH3 domains and activates c-Src family tyrosine kinases. Mol Cell, 2001. 8(2): p. 269-80. 301. Ojasoo, T., et al., Binding of steroids to the progestin and glucocorticoid receptors analyzed by correspondence analysis. J Med Chem, 1988. 31(6): p. 1160-9. 302. De Bosscher, K., W. Vanden Berghe, and G. Haegeman, Cross-talk between nuclear receptors and nuclear factor kappaB. Oncogene, 2006. 25(51): p. 6868-86. 303. Adcock, I.M., R. Newton, and P.J. Barnes, NF-kappa B involvement in IL-1 beta-induction of GM-CSF and COX-2: inhibition by glucocorticoids does not require I-kappa B. Biochem Soc Trans, 1997. 25(2): p. 154S. 304. Widen, C., J.A. Gustafsson, and A.C. Wikstrom, Cytosolic glucocorticoid receptor interaction with nuclear factor-kappa B proteins in rat liver cells. Biochem J, 2003. 373(Pt 1): p. 211-20. 305. Nissen, R.M. and K.R. Yamamoto, The glucocorticoid receptor inhibits NFkappaB by interfering with serine-2 phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev, 2000. 14(18): p. 2314- 29. 306. Luecke, H.F. and K.R. Yamamoto, The glucocorticoid receptor blocks P- TEFb recruitment by NFkappaB to effect promoter-specific transcriptional repression. Genes Dev, 2005. 19(9): p. 1116-27. 307. Sheppard, K.A., et al., Nuclear integration of glucocorticoid receptor and nuclear factor-kappaB signaling by CREB-binding protein and steroid receptor coactivator-1. J Biol Chem, 1998. 273(45): p. 29291-4. 308. Cho, I.J. and S.G. Kim, A novel mitogen-activated protein kinase phosphatase-1 and glucocorticoid receptor (GR) interacting protein-1- dependent combinatorial mechanism of gene transrepression by GR. Mol Endocrinol, 2009. 23(1): p. 86-99. 309. Ito, K., P.J. Barnes, and I.M. Adcock, Glucocorticoid receptor recruitment of histone deacetylase 2 inhibits interleukin-1beta-induced histone H4 acetylation on lysines 8 and 12. Mol Cell Biol, 2000. 20(18): p. 6891-903.
- 191 - References
310. Kassel, O., et al., Glucocorticoids inhibit MAP kinase via increased expression and decreased degradation of MKP-1. Embo J, 2001. 20(24): p. 7108-16. 311. Clark, A.R., MAP kinase phosphatase 1: a novel mediator of biological effects of glucocorticoids? J Endocrinol, 2003. 178(1): p. 5-12. 312. Lasa, M., et al., Dexamethasone causes sustained expression of mitogen- activated protein kinase (MAPK) phosphatase 1 and phosphatase-mediated inhibition of MAPK p38. Mol Cell Biol, 2002. 22(22): p. 7802-11. 313. Doucas, V., et al., Cytoplasmic catalytic subunit of protein kinase A mediates cross-repression by NF-kappa B and the glucocorticoid receptor. Proc Natl Acad Sci U S A, 2000. 97(22): p. 11893-8. 314. Hirota, Y., J. Cha, and S.K. Dey, Revisiting reproduction: Prematurity and the puzzle of progesterone resistance. Nat Med, 2010. 16(5): p. 529-31. 315. Chwalisz, K. and R.E. Garfield, Antiprogestins in the induction of labor. Ann N Y Acad Sci, 1994. 734: p. 387-413. 316. Frydman, R., et al., Mifepristone for induction of labour. Lancet, 1991. 337(8739): p. 488-9. 317. Csapo, A.I., M.O. Pulkkinen, and H.L. Kaihola, The effect of luteectomy- induced progesterone-withdrawal on the oxytocin and prostaglandin response of the first trimester pregnant human uterus. Prostaglandins, 1973. 4(3): p. 421-9. 318. Norman, J.E., K.J. Thong, and D.T. Baird, Uterine contractility and induction of abortion in early pregnancy by misoprostol and mifepristone. Lancet, 1991. 338(8777): p. 1233-6. 319. Pieber, D., et al., Interactions between progesterone receptor isoforms in myometrial cells in human labour. Mol Hum Reprod, 2001. 7(9): p. 875-9. 320. Winkler, M., et al., Estrogen receptor alpha and progesterone receptor A and B concentration and localization in the lower uterine segment in term parturition. J Soc Gynecol Investig, 2002. 9(4): p. 226-32. 321. Perusquia, M., Nongenomic action of steroids in myometrial contractility. Endocrine, 2001. 15(1): p. 63-72. 322. Perusquia, M., J. Espinoza, and E. Navarrete, Nongenomic uterine relaxing effect of RU 486 (mifepristone) prior to its antiprogesterone activity in the human pregnancy. Steroids, 2009. 74(10-11): p. 825-31. 323. Parry, L.J. and R.A. Bathgate, The role of oxytocin and regulation of uterine oxytocin receptors in pregnant marsupials. Exp Physiol, 2000. 85 Spec No: p. 91S-99S. 324. Manabe, Y., A. Manabe, and T. Aso, Plasma concentrations of oestrone, oestradiol, oestriol and progesterone during mechanical stretch-induced abortion at mid-trimester. J Endocrinol, 1981. 91(3): p. 385-9. 325. Manabe, Y., A. Manabe, and A. Takahashi, Effect of indomethacin on stretch- induced uterine activity in the post-partum. Prostaglandins, 1983. 25(5): p. 653-9. 326. Sooranna, S.R., et al., Stretch and interleukin 1 beta: pro-labour factors with similar mitogen-activated protein kinase effects but differential patterns of transcription factor activation and gene expression. J Cell Physiol, 2007. 212(1): p. 195-206. 327. Sooranna, S.R., et al., The MAPK dependent expression of prostaglandin H synthase-2 and interleukin 8 mRNA by myometrial cells: the differential effect of stretch and interleukin-1{beta}. J Clin Endocrinol Metab, 2005.
- 192 - References
328. Manabe, Y., A. Manabe, and A. Takahashi, F prostaglandin levels in amniotic fluid during balloon-induced cervical softening and labor at term. Prostaglandins, 1982. 23(2): p. 247-56. 329. Csapo, A.I., The effects of ovariectomy and stretch on the regulatory profile and activity of the uterus. Prostaglandins, 1977. 13(5): p. 965-73. 330. Li, Y., et al., Focal adhesion signaling is required for myometrial ERK activation and contractile phenotype switch before labor. J Cell Biochem, 2007. 100(1): p. 129-40. 331. Malhotra, R., et al., G alpha(q)-mediated activation of GRK2 by mechanical stretch in cardiac myocytes: the role of protein kinase C. J Biol Chem, 2010. 285(18): p. 13748-60. 332. Nam, J.H., et al., Mechanosensitive activation of K+ channel via phospholipase C-induced depletion of phosphatidylinositol 4,5-bisphosphate in B lymphocytes. J Physiol, 2007. 582(Pt 3): p. 977-90. 333. Meyer, M.E., et al., Agonistic and antagonistic activities of RU486 on the functions of the human progesterone receptor. Embo J, 1990. 9(12): p. 3923- 32. 334. Chivers, J.E., et al., Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E release. Eur J Biochem, 2004. 271(20): p. 4042-52. 335. Loudon, J.A., et al., Progesterone represses interleukin-8 and cyclo- oxygenase-2 in human lower segment fibroblast cells and amnion epithelial cells. Biol Reprod, 2003. 69(1): p. 331-7. 336. Streicher, J.M., et al., MAPK-activated protein kinase-2 in cardiac hypertrophy and cyclooxygenase-2 regulation in heart. Circ Res, 2010. 106(8): p. 1434-43. 337. Faour, W.H., et al., Prostaglandin E(2) regulates the level and stability of cyclooxygenase-2 mRNA through activation of p38 mitogen-activated protein kinase in interleukin-1 beta-treated human synovial fibroblasts. J Biol Chem, 2001. 276(34): p. 31720-31. 338. Sfakianaki, A.K. and E.R. Norwitz, Mechanisms of progesterone action in inhibiting prematurity. J Matern Fetal Neonatal Med, 2006. 19(12): p. 763-72. 339. Russo, A.A., et al., Crystal structure of the p27Kip1 cyclin-dependent-kinase inhibitor bound to the cyclin A-Cdk2 complex. Nature, 1996. 382(6589): p. 325-31. 340. Hale, T.K., et al., Phosphorylation of the linker histone H1 by CDK regulates its binding to HP1alpha. Mol Cell, 2006. 22(5): p. 693-9. 341. Contreras, A., et al., The dynamic mobility of histone H1 is regulated by cyclin/CDK phosphorylation. Mol Cell Biol, 2003. 23(23): p. 8626-36. 342. Bhattacharjee, R.N., et al., Histone H1 phosphorylation by Cdk2 selectively modulates mouse mammary tumor virus transcription through chromatin remodeling. Mol Cell Biol, 2001. 21(16): p. 5417-25. 343. da Fonseca, E.B., et al., Prophylactic administration of progesterone by vaginal suppository to reduce the incidence of spontaneous preterm birth in women at increased risk: a randomized placebo-controlled double-blind study. Am J Obstet Gynecol, 2003. 188(2): p. 419-24. 344. Fonseca, E.B., et al., Progesterone and the risk of preterm birth among women with a short cervix. N Engl J Med, 2007. 357(5): p. 462-9.
- 193 - References
345. Kloosterboer, H.J., G.H. Deckers, and W.G. Schoonen, Pharmacology of two new very selective antiprogestagens: Org 31710 and Org 31806. Hum Reprod, 1994. 9 Suppl 1: p. 47-52. 346. Sugino, N., C.M. Telleria, and G. Gibori, Progesterone inhibits 20alpha- hydroxysteroid dehydrogenase expression in the rat corpus luteum through the glucocorticoid receptor. Endocrinology, 1997. 138(10): p. 4497-500. 347. Jones, L.A., et al., Toll-like receptor-4-mediated macrophage activation is differentially regulated by progesterone via the glucocorticoid and progesterone receptors. Immunology, 2008. 125(1): p. 59-69. 348. Bhattacharyya, S., et al., Macrophage glucocorticoid receptors regulate Toll- like receptor 4-mediated inflammatory responses by selective inhibition of p38 MAP kinase. Blood, 2007. 109(10): p. 4313-9. 349. Wu, W., et al., Glucocorticoid receptor-induced MAPK phosphatase-1 (MPK- 1) expression inhibits paclitaxel-associated MAPK activation and contributes to breast cancer cell survival. J Biol Chem, 2005. 280(6): p. 4117-24. 350. Furumai, R., et al., Histone deacetylase inhibitors block nuclear factor- kappaB-dependent transcription by interfering with RNA polymerase II recruitment. Cancer Sci, 2011. 102(5): p. 1081-7. 351. Condon, J.C., et al., A decline in the levels of progesterone receptor coactivators in the pregnant uterus at term may antagonize progesterone receptor function and contribute to the initiation of parturition. Proc Natl Acad Sci U S A, 2003. 100(16): p. 9518-23. 352. Mangelsdorf, D.J., et al., The nuclear receptor superfamily: the second decade. Cell, 1995. 83(6): p. 835-9. 353. Tsai, M.J. and B.W. O'Malley, Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem, 1994. 63: p. 451-86. 354. Edwards, D.P., S.A. Leonhardt, and E. Gass-Handel, Novel mechanisms of progesterone antagonists and progesterone receptor. J Soc Gynecol Investig, 2000. 7(1 Suppl): p. S22-4. 355. Gottlicher, M., S. Heck, and P. Herrlich, Transcriptional cross-talk, the second mode of steroid hormone receptor action. J Mol Med, 1998. 76(7): p. 480-9. 356. McKenna, N.J., R.B. Lanz, and B.W. O'Malley, Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev, 1999. 20(3): p. 321-44. 357. Lonard, D.M. and B.W. O'Malley, Expanding functional diversity of the coactivators. Trends Biochem Sci, 2005. 30(3): p. 126-32. 358. Rosenfeld, M.G. and C.K. Glass, Coregulator codes of transcriptional regulation by nuclear receptors. J Biol Chem, 2001. 276(40): p. 36865-8. 359. McKenna, N.J. and B.W. O'Malley, Combinatorial control of gene expression by nuclear receptors and coregulators. Cell, 2002. 108(4): p. 465-74. 360. Glass, C.K. and M.G. Rosenfeld, The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev, 2000. 14(2): p. 121-41. 361. von der Ahe, D., et al., Glucocorticoid and progesterone receptors bind to the same sites in two hormonally regulated promoters. Nature, 1985. 313(6004): p. 706-9. 362. Dilworth, F.J. and P. Chambon, Nuclear receptors coordinate the activities of chromatin remodeling complexes and coactivators to facilitate initiation of transcription. Oncogene, 2001. 20(24): p. 3047-54.
- 194 - References
363. Torchia, J., C. Glass, and M.G. Rosenfeld, Co-activators and co-repressors in the integration of transcriptional responses. Curr Opin Cell Biol, 1998. 10(3): p. 373-83. 364. Chalepakis, G., et al., Differential gene activation by glucocorticoids and progestins through the hormone regulatory element of mouse mammary tumor virus. Cell, 1988. 53(3): p. 371-82. 365. Vicent, G.P., et al., Minireview: role of kinases and chromatin remodeling in progesterone signaling to chromatin. Mol Endocrinol, 2010. 24(11): p. 2088- 98. 366. Li, X., et al., Progesterone and glucocorticoid receptors recruit distinct coactivator complexes and promote distinct patterns of local chromatin modification. Mol Cell Biol, 2003. 23(11): p. 3763-73. 367. Lu, N.Z., et al., International Union of Pharmacology. LXV. The pharmacology and classification of the nuclear receptor superfamily: glucocorticoid, mineralocorticoid, progesterone, and androgen receptors. Pharmacol Rev, 2006. 58(4): p. 782-97. 368. Mitchell, C., et al., PTGS2 (prostaglandin endoperoxide synthase-2) expression in term human amnion in vivo involves rapid mRNA turnover, polymerase-II 5'-pausing, and glucocorticoid transrepression. Endocrinology, 2011. 152(5): p. 2113-22. 369. Zakar, T. and S. Mesiano, How does progesterone relax the uterus in pregnancy? N Engl J Med, 2011. 364(10): p. 972-3. 370. Thomas, C.P., K.Z. Liu, and H.S. Vats, Medroxyprogesterone acetate binds the glucocorticoid receptor to stimulate alpha-ENaC and sgk1 expression in renal collecting duct epithelia. Am J Physiol Renal Physiol, 2006. 290(2): p. F306-12. 371. Hong, J.S., et al., Maternal plasma osteoprotegerin concentration in normal pregnancy. Am J Obstet Gynecol, 2005. 193(3 Pt 2): p. 1011-5. 372. Hofbauer, L.C., et al., Interleukin-1beta and tumor necrosis factor-alpha, but not interleukin-6, stimulate osteoprotegerin ligand gene expression in human osteoblastic cells. Bone, 1999. 25(3): p. 255-9. 373. Hofbauer, L.C., et al., Stimulation of osteoprotegerin ligand and inhibition of osteoprotegerin production by glucocorticoids in human osteoblastic lineage cells: potential paracrine mechanisms of glucocorticoid-induced osteoporosis. Endocrinology, 1999. 140(10): p. 4382-9. 374. Hofbauer, L.C., et al., Estrogen stimulates gene expression and protein production of osteoprotegerin in human osteoblastic cells. Endocrinology, 1999. 140(9): p. 4367-70. 375. Saika, M., et al., 17beta-estradiol stimulates expression of osteoprotegerin by a mouse stromal cell line, ST-2, via estrogen receptor-alpha. Endocrinology, 2001. 142(6): p. 2205-12. 376. Saarikoski, S.T., S.P. Rivera, and O. Hankinson, Mitogen-inducible gene 6 (MIG-6), adipophilin and tuftelin are inducible by hypoxia. FEBS Lett, 2002. 530(1-3): p. 186-90. 377. Wick, M., et al., Identification of a novel mitogen-inducible gene (mig-6): regulation during G1 progression and differentiation. Exp Cell Res, 1995. 219(2): p. 527-35. 378. Ferby, I., et al., Mig6 is a negative regulator of EGF receptor-mediated skin morphogenesis and tumor formation. Nat Med, 2006. 12(5): p. 568-73.
- 195 - References
379. Zhang, Y.W., et al., Evidence that MIG-6 is a tumor-suppressor gene. Oncogene, 2007. 26(2): p. 269-76. 380. Amatschek, S., et al., Tissue-wide expression profiling using cDNA subtraction and microarrays to identify tumor-specific genes. Cancer Res, 2004. 64(3): p. 844-56. 381. Anastasi, S., et al., Loss of RALT/MIG-6 expression in ERBB2-amplified breast carcinomas enhances ErbB-2 oncogenic potency and favors resistance to Herceptin. Oncogene, 2005. 24(28): p. 4540-8. 382. Han, S.J., et al., Dynamic cell type specificity of SRC-1 coactivator in modulating uterine progesterone receptor function in mice. Mol Cell Biol, 2005. 25(18): p. 8150-65. 383. Burney, R.O., et al., Gene expression analysis of endometrium reveals progesterone resistance and candidate susceptibility genes in women with endometriosis. Endocrinology, 2007. 148(8): p. 3814-26. 384. Jeong, J.W., et al., Mig-6 modulates uterine steroid hormone responsiveness and exhibits altered expression in endometrial disease. Proc Natl Acad Sci U S A, 2009. 106(21): p. 8677-82. 385. Neufeld, E.B., et al., Cellular localization and trafficking of the human ABCA1 transporter. J Biol Chem, 2001. 276(29): p. 27584-90. 386. Langmann, T., et al., Real-time reverse transcription-PCR expression profiling of the complete human ATP-binding cassette transporter superfamily in various tissues. Clin Chem, 2003. 49(2): p. 230-8. 387. Nikitina, L., et al., Expression and localization pattern of ABCA1 in diverse human placental primary cells and tissues. Placenta, 2011. 32(6): p. 420-30. 388. Nishiuchi, Y., et al., Transcriptional factor prolactin regulatory element- binding protein-mediated gene transcription of ABCA1 via 3',5'-cyclic adenosine-5'-monophosphate. Atherosclerosis, 2010. 212(2): p. 418-25. 389. Fu, X., T. Backstrom, and U. Ulmsten, Progesterone increases cAMP release and accumulation in isolated term human myometrium. Gynecol Obstet Invest, 1998. 45(4): p. 242-6. 390. Simard, J., et al., Molecular biology and genetics of the 3 beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase gene family. J Endocrinol, 1996. 150 Suppl: p. S189-207. 391. Rheaume, E., et al., Structure and expression of a new complementary DNA encoding the almost exclusive 3 beta-hydroxysteroid dehydrogenase/delta 5- delta 4-isomerase in human adrenals and gonads. Mol Endocrinol, 1991. 5(8): p. 1147-57. 392. Peng, L. and A.H. Payne, AP-2 gamma and the homeodomain protein distal- less 3 are required for placental-specific expression of the murine 3 beta- hydroxysteroid dehydrogenase VI gene, Hsd3b6. J Biol Chem, 2002. 277(10): p. 7945-54. 393. Peng, L., et al., Transcription enhancer factor-5 and a GATA-like protein determine placental-specific expression of the Type I human 3beta- hydroxysteroid dehydrogenase gene, HSD3B1. Mol Endocrinol, 2004. 18(8): p. 2049-60. 394. Molet, S., et al., IL-17 is increased in asthmatic airways and induces human bronchial fibroblasts to produce cytokines. J Allergy Clin Immunol, 2001. 108(3): p. 430-8.
- 196 - References
395. Ferretti, S., et al., IL-17, produced by lymphocytes and neutrophils, is necessary for lipopolysaccharide-induced airway neutrophilia: IL-15 as a possible trigger. J Immunol, 2003. 170(4): p. 2106-12. 396. Cho, M.L., et al., STAT3 and NF-kappaB signal pathway is required for IL- 23-mediated IL-17 production in spontaneous arthritis animal model IL-1 receptor antagonist-deficient mice. J Immunol, 2006. 176(9): p. 5652-61. 397. Aggarwal, S. and A.L. Gurney, IL-17: prototype member of an emerging cytokine family. J Leukoc Biol, 2002. 71(1): p. 1-8. 398. Witowski, J., K. Ksiazek, and A. Jorres, Interleukin-17: a mediator of inflammatory responses. Cell Mol Life Sci, 2004. 61(5): p. 567-79. 399. Linden, A., H. Hoshino, and M. Laan, Airway neutrophils and interleukin-17. Eur Respir J, 2000. 15(5): p. 973-7. 400. Pongcharoen, S., et al., Interleukin-17 expression in the human placenta. Placenta, 2007. 28(1): p. 59-63. 401. Hee, L., et al., Low serum interleukin-17 is associated with preterm delivery. Acta Obstet Gynecol Scand, 2011. 90(1): p. 92-6. 402. Ghatge, R.P., et al., The progestational and androgenic properties of medroxyprogesterone acetate: gene regulatory overlap with dihydrotestosterone in breast cancer cells. Breast Cancer Res, 2005. 7(6): p. R1036-50.
- 197 -