The Role of Mast Cells in the Immune Response against Bacterial Infections

vorgelegt von

Dipl. Mol. Med., Carolin Zimmermann, geb. in Stuttgart

von der Fakultät III - Prozesswissenschaften der Technischen Universität Berlin zur Erlangung des akademischen Grades Doktor der Naturwissenschaften -Dr.rer.nat.-

genehmigte Dissertation

Promotionsausschuss: Vorsitzender: Prof. Roland Lauster Gutachter: Prof. Jens Kurreck Gutachter: Prof. Marcus Maurer

Tag der wissenschaftlichen Aussprache: 19.05.2016

Berlin, 2016

Table of contents

Table of contents

I. List of abbreviations ...... VII

II. Summary ...... X

III. Zusammenfassung ...... XI

1. Introduction ...... 1

1.1. Mast cell morphology and distribution pattern ...... 1

1.2. Mast cell origin and differentiation...... 2

1.3. Mast cell heterogeneity ...... 3

1.4. Mast cell-deficient mouse models ...... 4

1.5. Classical mast cell activation ...... 5

1.6. Mast cell activation within the innate immune system ...... 5

1.7. Mast cell functions in response to pathogens ...... 8 1.7.1. Mast cell involvement in innate responses to bacterial infections 9 1.7.2. Role of mast cells in innate immunity against 14 1.7.3. Role of mast cells in skin 15

1.8. Skin wound infection with ...... 18 1.8.1. Skin wound infection 18 1.8.2. Pseudomonas aeruginosa 18

1.9. Aim of the study ...... 19

2. Materials ...... 21

2.1. Cell sources ...... 21

II Table of contents

2.2. Mast cell-deficient mouse strains...... 21

2.3. Genetically modified mice ...... 21

2.4. Cell culture media and supplements ...... 22

2.5. Bacterial culture media and supplements ...... 22

2.6. Buffers, reagents and chemicals ...... 22

2.7. ...... 23

2.8. Cytokines ...... 24

2.9. Primers ...... 24

2.10. Commercial kits ...... 24

2.11. Consumables ...... 25

2.12. Devices and technical support ...... 25

2.13. Analysis software ...... 26

2.14. Manufacturers and distributers ...... 26

3. Methods ...... 29

3.1. Isolation and culture of bone marrow-derived cultured MCs (BMCMCs) ...... 29

3.2. Murine keratinocyte cell culture ...... 29

3.3. Isolation and culture of primary human keratinocytes ...... 30

3.4. Bacterial culture ...... 30

3.5. Mouse model: Skin wound infection ...... 32

3.6. Histology ...... 34

3.7. In vivo live imaging ...... 35

3.8. Skin explant infection ...... 35

3.9. Cell culture infection experiments ...... 35

3.10. linked immunosorbent assay (ELISA) ...... 37

3.11. Quantitative real time polymerase chain reaction (qRT-PCR) ...... 37

III Table of contents

3.12. Flow cytometry ...... 38

3.13. Myeloperoxidase assay ...... 39

3.14. Data presentation and statistical analysis ...... 39

4. Results ...... 41

4.1. Genetically mast cell-deficient KitW/KitW-v mice show impaired wound closure upon skin wound infection with P. aeruginosa ...... 41

4.2. Local mast cell reconstitution of genetically mast cell-deficient KitW/KitW-v mice normalises wound closure upon skin wound infection with P. aeruginosa ...... 43

4.3. Mast cells control bacterial numbers in P. aeruginosa-infected skin wounds ...... 45

4.4. P. aeruginosa reduction requires mast cell-keratinocyte interaction...... 47

4.5. Mast cell-derived IL-6 induces antimicrobial defence in keratinocytes upon P. aeruginosa infection ...... 51

4.6. IL-6 production in mast cells is dependent on stimulation by IL-1 family members ...... 51

4.7. Mast cell-derived IL-6 protects from skin wound infections with P. aeruginosa ...... 55

4.8. Topical treatment with recombinant IL-6 enhances defence against P. aeruginosa skin wound infection ...... 57

4.9. Recombinant IL-6 treatment stimulates the antibacterial response of human keratinocytes ...... 57

5. Discussion ...... 61

5.1. Mast cells are required for closure of infected skin wounds ...... 61

5.2. Mast cells reduce the bacterial load within P. aeruginosa infected skin wounds ...... 64

5.3. Mast cell-mediated bacterial clearance is independent of immune cell recruitment ...... 68

5.4. Mast cells promote the release of antimicrobial peptides by keratinocytes...... 69

5.5. Skin antibacterial capacity requires mast cell-derived IL-6 ...... 71

5.6. Keratinocytes induce IL-6 production and release in mast cells ...... 72

5.7. Mast cell-derived IL-6 is required for normal healing of infected skin wounds in mice .... 74

5.8. Strengths and limitations ...... 75

IV Table of contents

5.9. Conclusion and outlook ...... 75

6. List of figures ...... 76

7. List of tables ...... 77

8. Bibliography ...... 78

V Table of contents

VI List of abbreviations

I. List of abbreviations

Table I List of abbreviations

AMP Antimicrobial peptide Bcl-XL B-cell lymphoma-X large BMCMCs Bone marrow-derived cultured mast cells c-Kit Tyrosine- kinase Kit (CD117) CD Cluster of differentiation cDNA Complementary DNA CFU Colony forming units CLP Cecal ligation puncture

CO2 Carbon dioxide Cpa Carboxypeptidase CRAMP Cathelicidin related antimicrobial peptide Cre Cre recombinase CTMC Connective tissue type mast cells ddH2O Double-distilled water DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid ds Double stranded DT Diphtheria toxin DTR Diphtheria toxin receptor ELISA Enzyme-linked immunosorbent assay FACS Fluorescence-activated cell sorting Fc Fragment crystallisable FCS Fetal calf serum FcεRI High-affinity IgE receptor FITC Fluorescein isothiocyanate G Gauge g Gravitational GAS Group A GM-CSF Granulocyte macrophage colony-stimulating factor h Hour(s) HaCat Human keratinocyte cell line HCl Hydrochloric acid hDTR Human DTR

VII List of abbreviations

IBD Inflammatory bowel disease i.p. Intraperitoneal iDTR Inducible DTR IFN Interferon Ig Immunoglobulin IL Interleukin ITAM Immunoreceptor tyrosine-based activation motifs KC Keratinocyte LB Lysogeny broth LPS Lipopolysaccharide LTB Leukotriene LTB Leukotrien B MAdCAM-1 Mucosal vascular addressin cell adhesion molecule-1 MC Mast cell Mcl-1 Myeloid leukemia cell differentiation protein MCp Mast cell progenitor MCP Mast cell protease MDA-5 Melanoma differentiation-associated gene 5 Min Minutes MMC Mucosal mast cell MIP-1ß Macrophage inflammatory protein-1ß mMCP Mouse mast cell protease MMP Matrix-metalloproteinase MOI Multiplicity of infection MPO Myeloperoxidase mRNA Messenger RNA NaCl Sodium chloride NEAA Non-essential amino acids NET Neutrophil extracellular trap NF-kB Nuclear factor κ light chain enhancer of activated B-cells NLR Nod-like receptor NOD Nucleotide-binding oligomerisation domain n.s. Not significant OD Optical density p-NAG P-Nitrophenyl-N- acetyl-β-D-glucosaminidine P. aeruginosa Pseudomonas aeruginosa P/S Penicillin/Streptomycin PAF Platelet-derived PAM Murine keratinocyte cell line PAMP Pathogen-associated molecular pattern PBS Phosphate-Buffered Saline

VIII List of abbreviations

PCR Polymerase chain reaction PE R-phycoerythrin PKA Protein kinase RNA-activated PRR Pattern recognition receptor RANTES Regulated on activation, normal T cell expressed and secreted RIG-1 Retinoic acid-inducible gene-1 RLR Rig-like receptor RMB Red MC and basophil RNA Ribonucleic acid ROS Reactive oxygen species S. aureus aureus SCF factor SEM Standard error of the mean Sl Steel TER Transepithelial electric resistance TGF Transforming Growth Factor TLR Toll-like receptor TNF Tumour necrosis factor TSB Tryptic soy broth VCAM Vascular cell adhesion molecule W White spotting

IX Summary

II. Summary

Skin wound infections are a significant and increasing health problem, and resistance is increasing. Mast cells have been shown to contribute to host defence responses in bacterial infections. Their role in skin wound infection is presently unknown. We subjected several mast cell-deficient mouse strains to Pseudomonas aeruginosa skin wound infection and found significantly delayed wound closure in infected skin wounds in the absence of mast cells. This delay in wound closure was associated with impaired bacterial clearance in skin wounds. Engraftment of mast cells into the skin of mast cell-deficient mice restored both, bacterial clearance and wound closure, to wild type levels. Bacterial clearance in skin wounds did not correlate with the recruitment of neutrophils or other immune cells but was strongly dependent on the local interaction between mast cells and keratinocytes. Bacterial killing was dependent on keratinocyte activation by Interleukin-6 released from mast cells. Interleukin-6 stimulation of keratinocytes induced the expression and release of several antimicrobial peptides. Induction of Interleukin-6 expression and release in mast cells was, in turn initiated by keratinocyte-derived cytokines of the Interleukin-1 family. Mast cell-deficient mice engrafted with Interleukin- 6-deficient mast cells failed to control wound infection and to restore normal wound healing. Treatment with recombinant Interleukin-6 induced bacterial killing by keratinocytes and resulted in the control of skin wound infection and normal wound healing in vivo. Taken together, these results demonstrate that Pseudomonas aeruginosa skin wound infection is controlled by mast cells by a new antimicrobial defence mechanism that requires the release of Interleukin-6 from mast cells. These findings point to novel strategies for the prevention and treatment of bacterial infections by boosting host innate immune responses.

X Zusammenfassung

III. Zusammenfassung

Hautwundinfektionen sind ein bedeutendes und zunehmendes Gesundheitsproblem vor allem in Zeiten steigender Antibiotikaresistenzen. Mastzellen sind bekannt für ihre Rolle bei Immunreaktionen im Rahmen bakterieller Infektionen. Ihre Funktion in der Haut bei Wundinfektionen ist derzeit nicht bekannt. Unter Verwendung mehrerer Mastzell-defizienter Mausstämme zeigte sich während Hautwundinfektionen mit Pseudomonas aeruginosa ein signifikant verzögerter Wundverschluss in Abwesenheit von Mastzellen. Diese Verzögerung im Wundverschluss korrelierte mit einer eingeschränkten bakteriellen Elimination in den Hautwunden. Der Transfer von Mastzellen in die Haut von Mastzell-defizienten Mäusen normalisierte sowohl die bakterielle Elimination als auch den Wundverschluss. Die bakterielle Reduktion in den Hautwunden korrelierte nicht mit der Rekrutierung von Neutrophilen oder anderen Immunzellen, sondern basierte vor allem auf der lokalen Wechselwirkung zwischen Mastzellen und Keratinozyten. Die Reduktion der Bakterien war abhängig von der Keratinozytenaktivierung durch Interleukin-6, das von Mastzellen freigesetzt wurde. Stimulation von Keratinozyten mit Interleukin-6 induzierte die Expression und Freisetzung von verschiedenen antimikrobiellen Peptiden. Die Expression und Freisetzung von Interleukin-6 von Mastzellen wurde wiederum durch die Simulation durch von Keratinozyten-sezernierten Zytokinen der Interleukin-1 Familie induziert. Mastzell-defiziente Mäuse, die mit Interleukin- 6-defizienten Mastzellen rekonstituiert worden waren, konnten im Gegensatz zu Mastzellen aus Wildtyp-Mäusen weder die bakterielle Last noch eine normale Wundheilung wiederherstellen. Eine Behandlung mit rekombinantem Interleukin-6 induzierte eine Reduktion der bakteriellen Last und resultierte in einer normalen Wundheilung. Zusammengenommen zeigen diese Ergebnisse, dass Mastzellen Hautwundinfektionen mit Pseudomonas aeruginosa durch einen neuen antimikrobiellen Abwehrmechanismus kontrollieren, der die Freisetzung von Interleukin-6 erfordert. Diese Resultate ermöglichen die Entwicklung neuer Strategien für die Prävention und Behandlung von bakteriellen Infektionen durch die Verstärkung der körpereigenen antibakteriellen Immunantwort.

XI Introduction

1.Introduction

Paul Ehrlich detected mast cells (MCs) as granule-“stuffed” cells, which prompted him to call these cells “Mastzellen” (1). More than 60 years after this first description, MCs were identified to be the culprit in anaphylaxis because of their ability to rapidly release histamine in response to allergens. The identification of additional MC features like cytokine production and lipid mediator synthesis lead to the discovery of physiological functions of MCs. Today, MCs are not only known for their detrimental role in allergic diseases, but are appreciated as important immune cells in host defence responses.

1.1. Mast cell morphology and distribution pattern

MCs are granular, mononuclear cells that range from 7 to 20 μm in diameter. The most notable feature of mature MCs is their expression of abundant cytoplasmic secretory granules that stain metachromatically upon staining with Giemsa or toluidine blue (Figure 1.1).

Figure 1.1. Degranulating murine skin mast cell. Formalin-fixed and paraffin-embedded murine back skin with Giemsa staining

This metachromasia is due to the highly ionised sulphated proteoglycans that form a backbone structure for mediators such as histamine and proteases within the granules. MCs are long-lived cells that are widespread throughout the body and enriched in tissues that form the borders facing the external environment (2). These tissues include the mucosa of the airways and the gastrointestinal passage, as well as the connective tissue of the skin. Within the tissue MCs are located primarily perivascularly and in close proximity to neurons, smooth muscle cells, mucus and sweat glands, as well as hair follicles (3-6).

1 Introduction

1.2. Mast cell origin and differentiation

Although MCs had already been identified as long-lived (2) tissue-resident cells that have a wide-spread tissue distribution, their origin and development remained enigmatic until the discovery of their hematopoietic origin. Kitamura et al. showed that MC numbers were restored after bone marrow transplantation into previously irradiated MC-deficient mice (7, 8). The failure to detect mature MCs within the blood circulation lead to the assumption that MCs derive form progenitors, so-called committed MC progenitors (9) (9) cells, with their origin in the bone marrow. In vitro differentiation of bone marrow-derived as well as blood-derived MC precursors into mature MCs when supplemented with the appropriate media containing IL-3 and SCF strengthened this hypothesis. These progenitor cells are indeed generated in the bone marrow but are also found in the blood, mucosal tissues, and spleen or lymph nodes (10). Rodewald and colleagues completed the hypothesis of MCp by transferring these non-granulated, FcεR-lacking progenitor cells into the peritoneum of MC-deficient mice that were hereupon repopulated with MCs to wild type levels. They further defined the phenotype of these low-granulated cells by low expression of the cell surface marker CD90, high expression of c-Kit and MC-specific proteases (11). After the commitment, the MCp circulate and home to the tissues in an immature state. The homing mechanism for immature MCs to their target tissue is site specific. For example, mobilisation of intestinal MCp was shown to be dependent on integrins of the α4 family, in particularly α4β7, as well as the corresponding ligand mucosal vascular addressin cell adhesion molecule-1 (MAdCAM-1) and vascular cell adhesion molecule-1 (VCAM-1), since blocking experiments of either receptors or ligands abolished MCp influx (12). The homing of MCp to the skin has been studied by intravenously injecting c-Kit-labelled bone marrow-derived cultured MCs (BMCMCs). The labelled BMCMCs accumulated after injection of leukotriene B4 (13), prostaglandin E2 (14) and CCL2 (15) in the dorsal skin. BMCMC cultures showed a strong expression of BLT1, the receptor of leukotriene B4, while EP3 receptor was identified as the prostaglandin receptor responsible for the migration of MCs. Moreover, the intradermal application of IgE in mice resulted in increased MC numbers (16). In a follow up publication, IgE binding to MCp was shown to stimulate the proliferation and maturation of MCs in the skin (17). As a complementary mechanism, endothelial cells were shown to up-regulate VCAM-1 upon stimulation with supernatant from IgE activated MCs. This VCAM-1 up-regulation was tracked down to be mediated by tumour necrosis factor (TNF), as neutralising antibodies against TNF inhibited the effect. Therefore, the authors proposed that TNF is necessary for the release and activation of endothelium-derived VCAM-1 that stimulate activation of α4-integrins on the MCp (18). MC differentiation is strongly dependent on the expression and functionality of the receptor for stem cell factor (SCF), the tyrosin kinase receptor c-Kit. Mice with loss of function mutations within c-Kit have been found to be profoundly MC-deficient by histological analyses (7). Further studies confirmed that SCF is not only a potent multifunctional hematopoietic cytokine, important for the self-renewal and survival of hematopoietic stem cells, but it is also required for spermatogenesis, melanogenesis and MC differentiation. Tsai et al. showed that SCF is a strong

2 Introduction inducer of MC proliferation and maturation in vitro and upon injection into mice (19, 20). The importance of c-Kit is further supported by the finding that several mutations of the human c-Kit receptor are linked to the hematopoietic disease of mastocytosis, a MC disorder caused by extensive proliferation of MCs (21). SCF production, as mentioned above, is an important MC enhancing factor, as are other mediators including IL-3, as well as TH2-associated cytokines such as IL-4 and IL-9 or IL-33 (22). The first in vitro MC differentiation protocols included media conditioned with the supernatant from a cloned inducer T-cell population and IL-3 was later identified to be the factor present in the conditioned media required for the differentiation and growth of bone marrow-derived MCs (23). Moreover, IL-9, identified as MC growth enhancing factor in spleen cell-conditioned media, was able to increase the proliferation of immature MCs in synergy with IL-3 and the proliferation of mature MCs alone (24). On the other hand, IL-4 has been shown to accelerate the proliferation rate of both mature MCs and MC progenitors (25). More recently, IL-33 was identified as an inflammatory cytokine of the IL-1 family that attenuates apoptosis of MCs through the up-regulation of the anti-apoptotic molecule B-cell lymphoma-X large (Bcl-XL). Upon joint transfer of WT and IL-33 receptor (T1/ST2) knock-out MCs (Il1rl1-/-) the survival rate was investigated in response to IL-33 injection into the peritoneum of mice. Although, no differences in proliferation were found, higher numbers of WT MCs were recovered after 6 days compared to Il1rl1-/- supporting an IL-33-mediated survival advantage (26).

1.3. Mast cell heterogeneity

Within their target tissue, MCp differentiate into mature, resident MCs under the influence of cytokines provided by stromal cells. Differences in cytokine concentration and composition shape the MC phenotype according to the microenvironment, e.g. connective or mucosal tissue (27). MCs are divided into subpopulations with distinct phenotypes varying in their morphology, granule content, sensitivity to activation and proliferative potential based on their protease-rich granule content. In rodents, two subsets have been described: connective tissue-type MCs (CTMCs) with a size ranging from 10 - 20 µm in diameter and mucosal-type MCs (MMCs) that are smaller in size (5 - 10 µm) (28, 29). CTMCs are primarily present in the skin and the peritoneum and are mainly characterised by the expression of mouse MC protease (mMCP)-4, mMCP-5 and carboxypeptidase-A (CPA), along with high granular content of histamine and heparin. MMCs reside in the mucosal epithelium of the respiratory and gastrointestinal tract and lack tryptases but express predominantly mMCP-1 and mMCP-2 combined with low histamine and heparin expression levels (30, 31). However, at some anatomic sites like the lung and intestinal tract both subtypes of MCs exist. In humans, two analogous subsets of MCs have been identified that differ in the protease content of their granules either expressing the protease tryptase alone (MCT) or tryptase along with chymase (MCTC) (30, 32, 33). The origin of these two MCs subset roots within the plasticity of MCs. Murine MCs cultured only with exogenous IL-3 develop into mucosal-type MCs whereas culture conditions with additional SCF favour a connective tissue-type MC type (34). Affirming this finding, in vitro

3 Introduction differentiated MCs adapted their phenotype according to the location of transplantation into MC- deficient mice either to a connective or mucosal environment (27). The biochemical heterogeneity is also reflected by functional differences in responsiveness to various stimuli. Whereas allergen-induced histamine release from human nasal CTMC was inhibited by cromolyn, the sodium salt cromoglycate, MMCs were not impaired with regard to their reactivity and release of mediators (35). Moreover, CTMCs from the skin respond with 30-fold more sensitivity to the neurotransmitter substance-P than MCs of either subtype derived from lung tissue (36). Although, biochemically and histologically well defined, the physiological functions related to the heterogeneity of MC subtypes are not well understood.

1.4. Mast cell-deficient mouse models

In 1978 Kitamura and colleagues made the observation that the two naturally occurring mutations W/W-v as well as Sl/Sl-d resulted in profound MC deficiency. Both mutations were found to impair c-Kit signalling but due to different underlying mechanisms. The W/W-v mutation (dominant white spotting (W)) affects the signalling of c-Kit in KitW/KitW-v mice and thereby prevents the early development of MCs. A mutation at the steel (Sl) locus alters the c-Kit ligand SCF in KitlSl/KitlSl-d mice and impairs the development of MCs within the target tissue. Based on the extensive work with such mutants, these naturally occurring MC-deficient mice provide excellent models for studying MC functions (37). Nevertheless, MC deficiency is accompanied by other defects that arise from the essential role of c-Kit, not only for MCs, but also in the development of other haematopoietic cell lineages. Impaired c-Kit signalling also leads to abnormalities in erythrocytes, neutrophils, subpopulations of T cells (γδ T cells), germ cells, melanocytes, and intestinal Cajal pacemaker cells. MC independence of distinct defects observed in these MC-deficient mouse models can be excluded upon local or systemic reconstitution of MC-deficient mice with MCs. This adoptive transfer of MCs only restores MC function but does not affect any other malfunctions potentially occurring in KitW/W-v or KitlSl/Sl-d mice (19, 38). More recently, c-Kit-independent mouse models of MC deficiency have been generated. To this end, mainly site-specific recombinase-mediated DNA modification, namely the Cre-loxP system has been used. Cre-lox recombination is a recombination technology used to manipulate the DNA at specific sites. Thereby, DNA modifications such as insertions, deletions, translocations and inversions targeted to a specific cell type or trigger by external stimulation are facilitated (39). To specifically deplete MCs, the Cre gene was inserted under the control of a MC-specific promoter such as Cpa3 or Mcpt5. These mice were crossed with mice that express a P-lox-flanked (floxed) stop cassette of the human diphtheria toxin receptor (hDTR) yielding a MC-specific expression of the simian DTR due to excision of the stop codon. In this Mcpt5-Cre;iDTR model, inducible MC deficiency can be achieved by injection of diphtheria toxin (40). Alternatively, MC deficiency can be introduced by crossing MC-specific Cre mice with mice that express a floxed anti-apoptotic protein such as the induced myeloid leukemia cell differentiation protein (Mcl-1) like in the Cpa3-Cre;Mcl1fl/fl model. Thereby, the complete Mcl-1 is deleted causing constitutive MC-specific cell death (41). In rare cases, as in Cpa3-CreMaster

4 Introduction mice, the MC deficiency is solely caused by MC-specific Cre expression. This phenomenon, called Cre toxicity, is based on the strong expression of Cre in MCs that mediates MC death (42). Although these models do not display any c-Kit-dependent side effects, most of these models also affect basophils, except the Mcpt5-Cre;iDTR model. Others side effects such as splenic neutrophilia and macrocytic anaemia are so far only characterised in the Cpa3-Cre;Mcl1fl/fl mouse strain (43).

1.5. Classical mast cell activation

The distribution pattern of MCs at the body-environment interface allows them to be among the first cells to encounter exogenous antigens, allergens, as well as invading pathogens and toxins (44). Nowadays, MCs are considered to be multifunctional immune cells that contribute to innate and adaptive immunity, but MCs are best known for their role in allergic reactions as well as helminth infections. Common features of these reactions are swelling, inflammation, and smooth muscle contraction. These symptoms are caused by the release of MC-derived mediators such as histamine and leukotrienes that cause vasodilation, increased vascular permeability, and smooth muscle contraction as well as of cytokines and chemokines, which mediate leukocyte infiltration (45). Upon first encounter of the body with an allergen, an antigen that drives an immunoglobulin (Ig)-E response, antigen-presenting cells (APCs) take up the antigen and migrate to the draining lymph nodes where they interact with naive CD4 T cells driving type 2 helper T cells (TH2) differentiation. TH2 cells provide B cells with Interleukin-4 (IL-4) or IL-13 and co-stimulatory CD40-CD40 ligand interaction leading to IgE production. Thereby, B cells undergo Ig class switch of the isotype from IgM to IgE (46). During a step called sensitisation, IgE produced by terminally differentiated B cells called plasma cells, binds to the high affinity receptor for IgE, designated FceRI, that is expressed on MCs. FcεRI is a heterotetrameric Ig receptor formed by the subunits αβγ2. Whereas the α subunit possesses an extracellular part that binds to the fragment crystallisable (Fc) region of IgE, the β and γ subunits bear the intracellular immunoreceptor tyrosine-based activation motifs (ITAMs) (47). Upon re- exposure of the antigen, crosslinking of the surface-bound IgE by multivalent antigens promotes a cascade of intracellular signalling events leading to MC degranulation, lipid mediator and cytokine production and release (48). This allergic reaction, also described as type I hypersensitivity, ranges from hay fever to severe anaphylactic reactions. The IgE-dependent release of mediators by MCs also plays an important role in the response to parasites and nematodes. During gastrointestinal helminth infections, MCs are considered key effector cells mediating pathogen expulsion by increasing the intestinal permeability, fluid secretion, and smooth muscle contraction (49, 50).

1.6. Mast cell activation within the innate immune system

MCs are equipped with various pattern recognition receptors (PRRs) (Table 1.1). These receptors including toll-like receptors (TLRs), nucleotide-binding oligomerisation domain

5 Introduction receptors (27)-like receptors (NLRs), and retinoic acid-inducible gene 1 (RIG-1)-like receptors (RLRs) all recognise molecules unique to microbes that exhibit so called pathogen-associated molecular patterns (PAMPs) (51). Thereby, MCs can respond to bacterial-derived cell wall components like lipopolysaccharide (LPS), peptidoglycans (PGN) (52), bacterial and viral nucleic acids, as well as fungal β-glucan and α-mannan cell wall components. The intracellular signalling cascade triggered by these receptors enables MCs to initiate a specific immune response releasing different combinations of cytokines and chemokines fitted to the invading pathogen by a process that is not well understood (53). The TLR family consists of transmembrane containing leucine-rich repeats that recognise bacterial and viral PAMPs combined with an intracellular TIR (toll-IL-1 receptor) domain. Extracellular PAMPs are recognised on the plasma membrane (TLR1, -2, -4, -6), whereas intracellular PAMPs signal via TLR3, -7, -9 expressed within the lysosomal membrane (54, 55). TLRs function as homodimers, except for TLR2 that is able to form heterodimers with TLR1 and -6. Differences between activation stimuli of TLRs as well as cytokine and chemokine responses have been observed in MCs (56). While activation of TLR4 by LPS causes TNF, IL-6, and IL-1β secretion from murine BMCMCs, binding of peptidoglycans to TLR2 heterodimers causes additional secretion of the Th2 cytokines IL-4, IL-5, and IL-13 (57). TLR4, but not TLR2 expression on MCs was shown to be required for the survival in a MC-dependent cecal ligation and puncture model. Only reconstitution of MC-deficient mice with BMCMCs from TLR4 but not TLR2-deficient mice increased the mortality due to reduced cytokine production and impaired neutrophil and leukocyte recruitment (57). Several viruses like respiratory syncytial virus, influenza virus, or Newcastle disease virus as well as the synthetic mimic of viral double-stranded RNA polyinosinic-polycytidylic acid (polyI:C) reportedly induce the production of type I interferons (IFNs) by MCs. This activation was shown to be TLR3-dependent and was ablated when BMCMCs from TLR-3 knock-out mice were used (58). In response to polyI:C, MCs release, in addition to IFN, macrophage inflammatory protein (MIP)-1β, RANTES (regulated on activation, normal T cell expressed and secreted), and keratinocyte chemoattractant, which induce cytotoxic T cell recruitment (59). Additionally, MCs have been shown to recognise cytoplasmatic viral double-stranded RNA (dsRNA) via TLRs, which evoke antiviral MC cytokine and chemokine responses including TNF and IFNs (58, 60, 61). Moreover, viral single stranded RNA containing guanin-uracil-rich structures as well as DNA with unmethylated cytosine followed by a guanosine (CpG motif) has been identified as natural ligands for murine TLR7 and TLR9, respectively. When stimulated with TLR7 or TLR9 activators, MCs respond with cytokine (TNF and IL-6) and chemokine (MIP-2, MIP-1β, and RANTES) production (54). Whereas TLR7 stimulation of skin MCs leads to early signs of inflammation and promotes the emigration of Langerhans cells (62), the physiological functions of MC TLR9 activation remain to be identified. NLRs are intracellular receptors that mediate responses upon uptake of microbial structural components or intracellular cell stress signals. NLRs often cooperate with TLRs in the perpetuation of inflammatory diseases. The best-characterised members of the NLR family are NOD1 and NOD2. While NOD1 is a sensor for a molecule called meso-diaminopimelic acid

6 Introduction mainly found in gram negative bacteria like Helicobacter pylori (H. pylori) or Pseudomonas aeruginosa (P. aeruginosa), NOD2 responds to muramyl dipeptide derived from the bacterial peptidoglycan layer of e.g. Streptococcus pneumoniae (S. pneumoniae) or Mycobacterium tuberculosis (M. tuberculosis) (63). PGN was shown to activate the human MC line (HMC)-1 via NLR NOD2 and TLR2. MC degranulation upon PGN stimulation compromised the epithelial barrier function of a human colon carcinoma cell line, recorded by transepithelial electric resistance (TER) and permeability suggesting a contribution of MCs to intestinal inflammatory diseases like inflammatory bowel disease (IBD) (64). Upon PGN gavage, intestinal MCs were activated via NOD1 and TLR2 leading to histamine- and serotonin-mediated diarrhoea in mice that was abolished after interference with anti-NOD1 and -TLR2 blocking antibodies (65).

Table 1.1. Important pathogen receptors expressed by mast cells.

Receptor Subtype Ligand TLR TLR1/2, TLR2/6 Bacterial lipoproteins, Peptidoglycans TLR3 DsRNA TLR4 Lipopolysaccharides TLR7, TLR9 Bacterial/viral ssRNA, CpG- DNA NLR PGNs RLR Viral dsRNA CD48 Fimbriated E. coli, Mycobacteria

Beyond canonical PRRs, MCs use other molecules that directly detect pathogens or their products. CD48 was implicated as a receptor for fimbriated (E. coli) and for mycobacteria, as shown by their co-localisation and the use of anti-CD48 antibodies that inhibited the release of TNF and histamine in response to E. coli and mycobacteria, respectively (66, 67). In addition to recognising PAMPs, MCs respond to endogenous danger signals such as ATP, complement split products, various antimicrobial peptides (AMPs), and IL-1 family members released by damaged, infected or stressed cells. Such danger signals or alarmins are characterised by a rapid release following necrosis but not apoptosis leading to the recruitment of innate immune cells, and induction of inflammation (68). MCs respond to damage-associated molecular patterns (DAMPs) like ATP with the secretion of a variety of inflammatory cytokines like IL-6, TNF. Crohn’s disease, an inflammatory bowel disease, is accompanied by increased ATP levels (69). In the according model of TNBS-induced colitis MCs boosted the inflammation upon P2X7 purinoceptors engagement with ATP (70). Treatment of mice with a P2X7 purinoceptor-specific antibody reduced MC activation and ameliorated intestinal inflammation, as did reconstitution of KitW-sh/W-sh mice with P2x7-/- MCs as compared to WT cells. Furthermore,

7 Introduction when activated via the complement component C3, MC-derived TNF was shown to be essential for the recruitment of neutrophils and bacterial clearance in a model of bacterial peritonitis (71). Moreover, AMPs like β- and cathelicidin promoted MC degranulation (72-74). Both have been reported to stimulate IL-1 expression, and the latter additionally induced the production of several inflammatory cytokines including IL-6, GM-CSF, and TNF, as well as the chemokines CCL4 and CXCL8 (72, 75). The most recently described IL-1 family member, IL-33, a potent MC activator, signals through a heterodimeric receptor complex comprised of suppression of tumourigenicity 2 (ST2) and IL-1 receptor accessory protein (IL-1RAcP) (76). IL-33 is predominantly expressed in endothelial or epithelial cells and mediates tissue inflammation in inflammatory human diseases such as psoriasis (77, 78) and atopic dermatitis (79) as well as asthma (80). Human as well as murine MCs have been described as damage- sensors that respond to IL-33 released from necrotic skin cells or to recombinant IL-33 with the secretion of several cytokines including IL-6, IL-1β and TNF (81) (82) (83). Moreover, a recent publication suggested a role for MCs in antigen presentation showing that long-term IL-33 stimulation induces strong expression of MHC class II protein and T cell activation when co- cultured with IL-33-treated BMCMCs (84).

1.7. Mast cell functions in response to pathogens

MCs express a diverse set of pathogen-specific surface receptors that enable them to rapidly sense invaders such as bacteria, viruses, fungi, and parasites. Upon appropriate activation, MCs secrete a wide range of mediators that are either stored in pre-formed granules or are newly synthesised (Figure 1.2).

Pre-formed mediators Biogene amines: Histamine, Serotonin, Dopamine Proteoglycans: Serglycine, Heparine, Proteases: Chymase, Tryptase, Carboxypeptidase-A, Cathepsin-G, Granzyme-B, Matrix-metalloprotease-9, Renin Bacterial infection Cytokines/Growth factors: TNF, IL-4 TGF-ß, IL-15, NGF, VEGF, SCF, bFGF-2 GranzymeB, LL37/cathelicidin, Heparanase Viral/Parasitic infection Others:

Toxin/Venom Newly synthesized mediators Cytokines: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, TNF, TGF-ß, IFN-γ Chemokines: CCL1, CCL2, CCL3, CCL4, CCL5, CCL-8, CCL9 Leukotrtiens: LTB4, LTC4, PGD2, PGE Others: PAF, nitric/superoxide radicals, antimicrobial peptides

Figure 1.2. Important mast cell mediators released in response to pathogens.

8 Introduction

MC degranulation is the process of the immediate release of granule-stored, so-called primary mediators. This process includes the fusion of the granule membrane with the plasma membrane to free granule-associated products including histamine, proteoglycans and proteases. Secondary mediators like cytokines, chemokines, and lipid mediators such as leukotriene (LT)-C4, -B4, platelet activating factor (PAF), prostaglandin-D2, and -E2, as well as low levels of , and AMPs are newly synthesised and released in a delayed response. Nevertheless, MCs are also able to pre-store certain cytokines within their granules, a feature first reported for TNF (85). Subsequent studies indicate that various cytokines and growth factors could be stored in MC granules such as IL-4, transforming growth factor (TGF)-β, and IL-15 (86-88).

1.7.1. Mast cell involvement in innate responses to bacterial infections

Since the first report in 1996 that MCs have a protective role in acute murine bacterial peritonitis caused by enterobacteria (89, 90), MCs have been implicated in the innate host defence against an increasing range of clinically relevant bacterial infections, e.g. those caused by E. coli (91), H. pylori (92) Listeria monocytogenes (93), Klebsiella pneumoniae (94), Mycoplasma pulmonis (95), S. aureus (96), Streptococcus pyogenes (97), as well as P. aeruginosa (98). Due to the expression and release of a multitude of mediators MCs are able to elicit and/or shape different immune functions to combat bacterial infections (Figure 1.3).

Immune cell recruitment MC extracellular traps Bacterial infection Phagocytosis Antimicrobial peptides Limit inflammation

Figure 1.3. Important mast cell-mediated innate immune responses against pathogens.

The best-described mechanism how MCs combat against pathogens is the orchestration of an optimal immune response by recruiting other immune cells to the infection site. MCs have been shown to be a critical source of neutrophil chemoattractants such as LTB4, keratinocyte chemoattractant, IL-12 and TNF (53, 99). In particular, MCs are the only cell type that can store and rapidly release pre-synthesised TNF after activation without the need for de novo transcription (85). In a murine model of bacterial sepsis, it was shown that neutrophil influx, bacterial clearance, and survival of the host were dependent on MCs and correlated with local TNF levels. Blocking this effect by anti-TNF antibodies reduced neutrophil influx and bacterial elimination and hence encouraged speculations about a role for MC-derived TNF in the survival of the infected host (90). Moreover, investigation of the anti-Listeria host defence upon intraperitoneal infection showed reduced neutrophil recruitment upon blocking local TNF

9 Introduction production and thereby corroborated this previously described finding (93). However, a subsequent report showed that TNF-deficient MCs also improved the survival of mice in a similar sepsis model suggesting that additional MC-derived factors contribute to host survival during bacterial sepsis (100). Further investigations identified additional substances secreted by MCs such as LTB4, keratinocyte chemoattractant and IL-12 as important mediators in MC-dependent recruitment of neutrophils. MC-derived LTB4 was established to be critical for neutrophil attraction by applying a leukotriene-synthesis inhibitor in MC-deficient mice in a model of E. coli-induced peritonitis resulting in increased bacterial load and reduced neutrophil recruitment (99). Furthermore, it was shown that MCs are a major source of IL-12, a heterodimeric cytokine (p35/p40) that is required for host defence and neutrophil migration, as demonstrated by increased mortality when MC-deficient mice had been repopulated with p40-/- MCs prior to the induction of acute septic peritonitis (101). Additionally, in a sterile inflammation model using the secretagogue compound 48/80, MC-derived keratinocyte chemoattractant release was demonstrated to lead to neutrophil accumulation by influencing the vascular endothelium and thereby promoting neutrophil rolling and diapedesis (102). Moreover, mice deficient for MC protease-6 (Mcp6-/-) were not able to efficiently clear K. pneumoniae from their peritoneal cavities due to impaired neutrophil recruitment (103). Data from the same group suggested that mouse MCP-6 induces the release of neutrophil chemoattractive mediators from bystander cells like endothelial or epithelial cells and thereby indirectly influences the initiation of innate immune responses. When recombinant murine MCP-6 or its human orthologue hTryptase-β1 were injected into the peritoneal cavities or lungs of KitW/KitW-v mice, these mice responded with a pronounced local neutrophilia pointing to an immunoprotective role of MCP-6 (104, 105). MC-derived mediators can not only trigger the recruitment of neutrophils to the site of infection but also enhance their activation and bactericidal properties. In a study of K. pneumonia peritonitis, MC-derived IL-6 was identified as an important mediator that protected mice from a fatal outcome through augmenting neutrophil killing of bacteria. This study showed that MC-deficient mice reconstituted intraperitoneally with Il6-/- MCs exhibited higher bacterial numbers as well as a higher mortality rate following K. pneumoniae infection. As a possible mechanism, recombinant IL-6 was shown to directly activate bone marrow-derived murine neutrophils leading to enhanced phagocytosis and intracellular killing of K. pneumoniae in vitro (94). Supplemental in vitro investigations described that BMCMCs strongly enhance neutrophil generation of reactive oxygen species and phagocytosis that was partially dependent on MC- derived TNF but mainly mediated by GM-CSF release. Moreover, the latter showed potent anti- apoptotic effects on neutrophils by inhibiting spontaneous apoptosis of neutrophils upon incubation with supernatant from activated MCs. Additionally, using MC-deficient KitW-sh/KitW-sh mice repopulated with Tnf-/- or Csf2-/- MCs, it was demonstrated that in a murine model of LPS- induced acute lung inflammation, neutrophil phagocytosis was impaired in the absence of MC- derived TNF and GM-CSF (106). In addition to neutrophils, MCs interact with macrophages in the elicitation of innate host defence responses. In a co-culture system of BMCMCs and macrophages infected with

10 Introduction

Francisella tularensis (F. tularensis), an intracellular gram-negative bacterium, MC-derived IL-4 was identified to inhibit bacterial invasion and intracellular replication as well as the induction of cell death. Recombinant IL-4 reduced the cellular uptake and replication of F. tularensis, and primary MCs derived from Il4-/- mice were unable to mediate an inhibitory effect on F. tularensis replication. A plausible mechanism by which MC-derived IL-4 mediates the inhibition of F. tularensis replication was demonstrated by improved acidification of organelles containing bacteria. Moreover, MC-deficient KitW/KitW-v mice exhibited reduced survival and increased bacterial burden after F. tularensis pulmonary exposure supporting the role for MCs in the immune defence against this pathogen (107, 108). Besides the impact of MCs on the initiation of an immune response, several studies have linked MCs to direct antimicrobial strategies. MCs have been reported to use certain cellular defence mechanisms that are known from other effector cells of the innate immune system such as macrophages or neutrophils: phagocytosis, i.e. the uptake and subsequent endolysosomal destruction, is one such major elimination strategy against bacteria. While MCs do not belong to the family of professional phagocytic cells, several studies have observed phagocytosis of bacteria by MCs. In line with this, a recent report showed that murine MCs play a critical role in the immune defence against Aggregatibacter actinomycetemcomitans by acting as phagocytes. The phagocytic activity of MCs, as determined in vitro, was even higher than that of macrophages (109). These findings were supported by another study showing that fimbriated strains of E. coli were phagocytosed by MCs and subsequently killed within vacuoles through the release of superoxide anions (110). The first demonstration that human MCs can also phagocytose bacteria such as S. aureus or S. faecium was done by scanning and transmission electron : human cord blood-derived MCs (CBHMC) bound to bacteria were shown to build protoplasmic protrusions on their surfaces to entrap, and subsequently degraded bacteria intracellularly (111). Another mechanism of how MCs participate in the innate immune defence is the secretion of broad-spectrum AMPs. These peptides, mainly expressed by epithelial cells and some myeloid cell types, are potent broad-spectrum host defence peptides that are effective in the defence against bacteria as well as fungi (112). These oligopeptides acting against bacteria are generally positively charged and substantially hydrophobic (113). Most AMPs target LPS of the cell membrane that is ubiquitous in gram-negative microorganisms causing disintegration of the lipid bilayer structure (114). Additionally, AMPs have the ability to modulate and enhance immune responses by altering gene expression in other immune cells or lead to immune cell recruitment (115, 116). MCs have been described to express and release AMPs like cathelicidins and β-, thereby supporting the innate immune system in responses against microbial infections. AMPs of the cathelicidin family have been shown to be expressed by MCs of both humans and mice namely LL-37 and cathelin-related AMP (CRAMP), respectively (117). Using a model of intracutaneous infection with group A streptococcus (GAS), the first evidence for the in vivo relevance of MC-derived AMPs was found. MC-deficient mice were more susceptible to GAS skin infection and developed bacteraemia along with increased skin lesions and higher bacterial

11 Introduction load of skin and spleen. Engraftment of WT but not CRAMP-deficient (Cnlp-/-) BMCMCs into the skin protected genetically MC-deficient mice from GAS infection. In this study, MCs were found to use CRAMP to kill GAS intracellularly thereby protecting from GAS infection (118). Subsequent studies have described the functionality of AMP expression and release in human MCs using the human MC line HMC-1. HMCs have been shown to kill S. pneumoniae in vitro independently of cell-bacteria contact but mediated by LL-37 release. Blocking with anti-LL-37 antibodies markedly reduced the killing of S. pneumoniae by HMCs and hence confirmed that HMCs exhibit direct antimicrobial activity against the respiratory pathogen S. pneumonia (119). MCs were further found to express β-defensins, another family of AMPs that form stable beta-sheets stabilised by disulphide bonds. By releasing murine β-defensin-3 (mBD-3), MCs exhibited potent antibacterial activity against C. rodentium in vitro (120). Moreover, in C. rodentium-induced colitis, MC-deficient KitW/KitW-v mice displayed greater morbidity and bacterial dissemination compared to WT littermates (120). However, due to the lack of MC-specific mBD-3-deficient mice, the relevance of mBD-3 for MC-mediated protection from infection remains elusive. Another mechanism exploited by MCs in the defence against bacteria was first discovered in neutrophils: the formation of extracellular traps. Neutrophil extracellular trap (NET) formation is described as the ejection of nuclear or mitochondrial DNA and antimicrobial peptides, histones, and cell-specific proteases that entrap and kill extracellular bacteria (121). The formation of NET-like structures by MCs is called MC extracellular traps (MCETs). Extracellular growth inhibition of S. pyogenes was reported to be not the result of a simple release of AMPs by MCs into the culture supernatant but to require close proximity of the MCs to the bacteria. The reduction of MCETs by treatment with DNase and myeloperoxidase indicated that entrapment of S. pyogenes in MCETs was required. MCET formation by MCs upon contact with S. pyogenes and other bacteria like P. aeruginosa and S. aureus was later corroborated by field emission scanning electron analysis (122). A recent report gave insight into the antimicrobial mechanism of MCs against E. faecalis. Here, BMCMCs were described to act against E. faecalis by a dual strategy of releasing AMPs and casting extracellular traps, in which E. faecalis was captured and subsequently killed (123). In contrast to enhancing inflammation, MCs are also able to limit inflammatory responses, e.g. by degrading released inflammatory mediators like cytokines, as well as endogenous, and exogenous alarmins. Chymase mouse MC protease 4 (MCPT4) was described to degrade TNF and to thereby limit inflammation and promote survival in a model of bacterial sepsis. Upon cecal ligation and puncture the survival rate of Mcpt4-/- mice was greatly decreased compared to WT mice. This was attributed to increased TNF levels upon the induction of sepsis leading to an excessive inflammatory response caused by the lack of TNF degradation by MC proteases (100). Additionally, the IL-1 family member IL-33 was reported to be degraded by MCPT4 as shown in vitro using Mcpt4-/- peritoneal MCs or in vivo upon intraperitoneal injection into Mcpt4-/- mice (124). Other examples for this beneficial anti-inflammatory function of MC proteases are the degradation of endogenous mediators that influence the blood pressure and thereby influence the outcome of septic shock. Endothelin (ET)-1, a vascular endothelial cell-derived peptide and

12 Introduction potent vasoconstrictor as well as neurotensin, responsible for hypotension, can be degraded by MC proteases. ET-1, when injected into the peritoneal cavity of mice or when produced endogenously in the context of septic peritonitis, caused death by severe hypothermia. Murine peritoneal MCs possess type A ET receptors and responded to ET-1 by releasing degrading peptidases (125) and limiting the ET-1-mediated effect. Whereas most of the MC-deficient mice died upon injection of ET within three hours, WT mice seemed to be protected (125). In a model of septic peritonitis caused by a ruptured appendix, MCs neutralised neurotensin through the proteolytic activity of MC-derived neurolysin as well as MC carboxypeptidase A (MC-CPA) thus limiting mortality (126). Moreover, MC β-tryptase was identified as responsible for the degradation of the AMP and alarmin LL-37 that is most abundantly expressed and released by epithelial cells of the lung and skin during infection. Upon contact with MCs, LL-37 was degraded and consequently lacked its antimicrobial and cytokinergic function leading to diminished inflammatory response (74). Furthermore, MCs have been reported to influence the inflammatory response to bacterial toxins acting as exogenous alarmins. Metz et al. showed that MCs limited inflammation upon injection of S. aureus α-toxin into the ears of mice. MC-deficient mice showed excessive inflammation, whereas MC-competent mice only exhibited a minor immune response that was accompanied by MC degranulation (127). MCs do not only exhibit a beneficial role within the innate immune system, but have also been implicated to aggravate inflammatory responses upon bacterial infections, e.g. by mediator release, inhibiting immune cell function or by acting as bacterial reservoirs. Investigations on systemic MC activation during a model of bacterial sepsis, namely cecal ligation and puncture, revealed that MC activation in distant tissues has a negative impact on the survival outcome. In reconstitution experiments of MC-deficient KitW-sh/KitW-sh mice with MCs derived form Il6- / mice, MC-derived IL-6 was identified to increase mortality during CLP-induced septic peritonitis (128). Using a c-Kit-independent MC-deficient mouse model, but in a comparable disease model setting it was confirmed that MCs could worsen sepsis by negatively affecting the phagocytosis of bacteria by macrophages. This knock-in mouse model, called the red MC and basophil (RMB) mouse, contains a gene sequence coding for bright red td-Tomato (tdT) fluorescent protein and the human diphtheria toxin receptor (hDTR). This allows tracking of MCs as well as diphtheria toxin-induced ablation of MCs and basophils. This model revealed that, upon repopulation of MC-deficient mice with MCs deficient in IL-4, phagocytosis and the subsequent elimination of E. coli from the peritoneum was impaired and the mortality associated with severe sepsis was increased (129). Additionally, it has been reported that bacteria can survive within MCs and hence MCs function as a reservoir for later infections. Once inside murine or human MCs upon in vitro infection, S. aureus did not only survive, but also persisted for more than five days within the cytosol. The authors hypothesised that this mechanism evolved to subvert the antimicrobial mechanisms elicited by MCs (96), thereby hindering the clearance of bacterial infection by the innate immune system. Overall, MCs are without any doubt important cells within the innate immune system against bacterial infections. Nevertheless, the underlying mechanisms how MCs contribute to the innate immune responses are only partially analysed.

13 Introduction

1.7.2. Role of mast cells in skin innate immunity against bacteria

The ability of MCs to release a variety of pro-inflammatory and chemoattractive mediators following activation of cell-surface receptors arms MCs to be an effective defence mechanism within the skin. Although the role of MCs as players in the innate immune system was mainly established in models of bacterial peritonitis and lung infection, there is growing evidence that implicates MCs in the combat against bacterial skin infections applying different defence strategies (Figure 1.4).

Bacterial skin infection

Immune cell recruitment Antimicrobial peptides Limit inflammation

Figure 1.4. Important innate immune responses by mast cells against bacteria within the skin.

The first report that skin MCs are able to protect the host against bacterial infections was provided by Siebenhaar et al. who injected P. aeruginosa intradermally into MC-deficient KitW/KitW-v and wild type mice. Skin lesion size as well as bacterial load were significantly higher in the absence of MCs compared to control mice. This finding correlated with the reduced ability of MC-deficient mice to recruit neutrophils (98). In another model, subcutaneous infection of murine footpads with GAS caused necrotising lesions that in MC-deficient KitW/KitW-v were accompanied by destruction of muscle, whereas in WT mice, necrosis but otherwise intact muscle tissue was observed. Surprisingly, the mortality rate between MC- deficient and MC-competent mice was comparable. This lead the authors to conclude that MCs might be more important in superficial skin infections due to their subepidermal localisation (97). Using a different strain of GAS, MC-derived CRAMP expression was identified as preventative in innate immune responses to skin infections. Subcutaneous injection of GAS into the back skin of MC-deficient KitW-sh/KitW-sh mice resulted in increased lesion size and bacterial load compared to WT mice. In contrast to MC-deficient mice repopulated with MCs derived from WT mice, Cramp-/- MCs were unable to restore the impaired resistance of KitW-sh/KitW-sh to GAS infection in the skin. This effect might be due to decreased CRAMP-mediated neutrophil

14 Introduction recruitment compared to KitW-sh/KitW-sh engrafted with WT MCs or due to the ability of MCs to use CRAMP to kill GAS intracellularly (118). Host protection by skin MCs was not only identified to be effective against whole bacteria but also against bacterial toxin-induced inflammation. MCs were described to reduce the inflammatory response upon injection of S. aureus α-toxin into the ears of mice. Here, MC-deficient KitW/KitW-v mice exhibited greater ear swelling responses as compared to WT mice that were correlated with the absence of MC degranulation in response to S. aureus α-toxin (127). Although skin MCs are described as an important part of the innate immune system, the mechanism how MCs mediate the protective antibacterial response is still not fully understood.

1.7.3. Role of mast cells in skin wound healing

Skin wound healing conventionally has been divided into three stages that have been designated as the inflammation, proliferation, and remodelling phase (Figure 1.5) (130). Upon wounding, the blood vessels contract, and a clot is formed to immediately close the wound and protect the host against invading pathogens. Once haemostasis is achieved, blood vessels dilate and become more permeable. This allows immune cells like neutrophils and macrophages and antibodies to reach the wounded area and provides the wound with growth factors necessary for the proliferation phase. During the proliferation phase of wound healing, is formed, which is comprised of collagen and extracellular matrix deposited by fibroblasts. Additionally, a new network of blood vessels develops and keratinocytes (KCs) resurface the wound from the wound margins. In the remodelling phase, collagen is restructured from type III to type I, the collagen production by fibroblasts reduces and the number of blood vessels in the wounded area regresses.

I. Inflammation phase II. Proliferation phase III. Remodelling phase

• Fibroblast proliferation • Myofibroblast • Formation of granulation tissue • ECM deposition • ECM maturation • Host defence • Re-epitheliasation •

Neutrophils Macrophages Fibrin Platelets Fibroblasts Keratinocytes Collagen Blood vessels

Figure 1.5. Phases of skin wound healing.

15 Introduction

Accumulating evidence has linked MCs to all three aspects of the wound-repair process. Skin MCs are known to be activated upon tissue , such as skin wounds (131). Histological studies showed that MCs in close proximity to the site of the skin undergo extensive degranulation (132). Moreover, MC numbers increase during skin wound healing. This accumulation of MCs was shown to be dependent on SCF (133). Immediately after wounding, during the inflammation phase, bleeding is minimised and the entry of pathogens is reduced by coagulation and the constriction of blood vessels within the wound bed. An essential step is the thrombin-mediated conversion of fibrinogen to fibrin. Thrombin was shown to mediate MC activation and adhesion to extracellular matrix components. The protease-activated receptor PAR-1 has been described to induce MC adhesion to fibronectin and the release of inflammatory mediators such as IL-6 and MMP-9 (134). Additionally, MCs were shown to degrade thrombin and thereby limit the process of coagulation (135). Once a clot is created at the wound as an external barrier, it is essential to prevent bacterial infection through the initiation of an inflammatory response. Degranulation of MCs rapidly mediates vascular permeability via histamine and vascular endothelial growth factor (VEGF) thus facilitating the infiltration and accumulation of neutrophils (132, 136). In several reports, a diminished neutrophil recruitment in MC-deficient KitW/KitW-v mice compared to control mice was accompanied by delayed wound closure (132, 137), but the underlying molecular mechanism how neutrophil numbers impact wound healing was not characterised. The proliferation phase of wound healing is characterised by the formation of granulation tissue, which involves fibroblast proliferation, re-epithelialisation, angiogenesis, as well as increased deposition of type-I collagen into the extracellular matrix (ECM). MCs produce cytokines and growth factors upon activation that support the proliferation of skin cells and collagen synthesis in the skin, thus promoting the proliferative phase of wound healing. Histamine, IL-1α, IL-1β, IL-6, and tryptase–heparin complexes have been found to promote the proliferation of epithelial cells in vitro (138, 139), which may contribute to wound re-epithelialisation that begins at the edges of the wound. In a skin wound healing study with MC-deficient KitW/KitW-v mice or treatment with a histamine receptor antagonist, wound closure was markedly delayed compared to control mice. The authors speculated that MC-derived histamine might promote the wound closure process during wound healing (132). Moreover, activated human and murine MCs release basic fibroblast growth factor, which promotes the proliferation of fibroblasts (140, 141). In a model of scald injury, fibroblast proliferation at the wound edge and wound vascularisation were demonstrated to be impaired in MC-deficient KitW/KitW-v mice compared to WT mice, whereas wound closure was unaffected (142). Similar results were obtained using a wound model with subsequent microdeformational wound therapy in which an interface material is placed between the wound and dressing and connected to suction. Here, it was shown that wound tissue granulation, blood vessel sprouting, and collagen maturation were MC-dependent during the proliferating and remodelling stages of wound healing (143). More detailed information about the role of MCs during the proliferative phase was gathered by analyses of several mouse strains deficient for MC-specific proteases, namely Mcpt4-/-, Mcpt5-/-, and Tpsb2-/-. In all MC protease-deficient mice, the proliferation rates within the granulation tissue, i.e. the frequency of

16 Introduction

Ki67-positive cells, were reduced, as was the thickness of the granulation tissue as compared to control mice. Moreover, mMCP-4-/- and mMCP-6-/- mice exhibited impaired blood vessel sprouting. It was thus proposed that MC proteases might promote wound healing by enzymatically remodelling the extracellular matrix (144). The remodelling phase is the process of collagen maturation in combination with the contraction by myofibroblasts leading to wound closure. Collagen cross-linking and collagen IV production replace unstructured depositions produced during the proliferation phase. Pharmacological inhibition of MC degranulation by the MC stabiliser disodium cromoglycate showed that, in the absence of MC degranulation, collagen fibre organization is improved and collagen fibrillar density is increased. This resulted in reduced width without influencing wound re- epithelialisation. The authors speculated that this impact of MCs on granulation tissue remodelling might be due to MC-mediated inflammation (145). Further speculation about the role of MCs in the remodelling of the extracellular matrix is based on the findings that human skin MCs expressed and secreted an active form of matrix metalloproteinase (MMP)-9, an enzyme responsible for the degradation of the ECM upon stimulation with phorbol 12-myristate 13-acetate (PMA) (146) as well as the demonstration that fibronectin is sensitive to degradation by MC-derived tryptase (147). Another association between MCs and tissue degradation and remodelling was made when MC chymase was shown to effectively process and activate MMP-1 and MMP-3 from precursor zymogens to active in vitro (148). Whether these processes are relevant or even present in vivo needs to be investigated. Wound contraction is mediated by fibroblasts after differentiation into myofibroblasts that are characterised by well-developed microfilament bundles similar to smooth muscle cells. Importantly, myofibroblasts have strong adhesions to the extracellular matrix containing α- smooth muscle actin, which allows them to pull wound edges together thereby reducing the wound size. The human MC line HMC-1 was shown to induce the expression of α-smooth muscle actin in dermal fibroblasts in vitro as well as in an organotypic skin model. Additionally, histamine was identified as a potent inducer of α-smooth muscle actin expression by fibroblasts, suggesting that histamine may play a role in regulating myofibroblast differentiation (149). Although there is convincing evidence that MCs are important for wound healing, recent studies have provided contradictory results that suggest that MCs do not play a major role in skin wound healing. In a wound healing study using c-Kit-dependent MC-deficient KitW/KitW-v and WT control mice neither re-epithelisation, collagen content of the wounds, nor angiogenesis were altered between the genotypes upon wounding (137). Additionally, several groups have reported that wound healing was not altered by the absence of MCs as assessed in c-kit-independent MC-deficient mice. Using the Cpa3-Cre;Mcl-1fl/fl mouse model, wound closure and collagen density were shown to be independent of MCs (150). The investigation of wound healing in Cpa3-CreMaster mice showed that neither wound closure, re-epithelisation, neutrophil recruitment, nor the amount of granulation tissue differed between MC-deficient and MC-competent mice (151). Moreover, Mcpt5Cre;iDTR mice revealed that wound re-epithelisation and the recruitment of inflammatory cells and the number of α-smooth muscle-positive myofibroblasts were MC-independent suggesting that none of the wound healing phases was influenced by the

17 Introduction absence of MCs (152). Taken together, there is mounting evidence implicating MCs in wound healing. Nevertheless, the role of MCs in wound healing is still not well defined, mostly due to the use of different skin wound models, in addition to the application of various MC-deficient mouse models.

1.8. Skin wound infection with Pseudomonas aeruginosa

1.8.1. Skin wound infection

Wound infection occurs when pathogens enter the skin at a site where the protective barrier formed by the skin is disrupted, such as in the case of burns or surgical wounds. In humans, wound infections usually only occur when the host immune defence is compromised and unable to raise an adequate immune response against the pathogen, for instance in diabetic patients, elderly people, patients receiving chronic corticosteroid therapy, or patients undergoing chemotherapy. Microorganisms that cause wound infections, mainly bacteria, can cause a delay in wound healing by promoting prolonged inflammation. Resulting non-healing wounds are associated with pain and suffering for the patient. Moreover, infected wounds can serve as a reservoir for bacteria that can spread to the surrounding soft tissue and bone structures. As the most serious complication, wound infections may even cause sepsis through systemic dissemination. The most common bacterial strains responsible for severe skin wound infections include Staphylococci and Pseudomonadaceae (153, 154). Methicillin-resistant strains of S. aureus, so called Methicillin-resistant S. aureus (MRSA) is already considered a serious health problem. Nowadays, multidrug-resistant isolates of P. aeruginosa are an increasing concern in the clinical management of superinfected wounds (155, 156).

1.8.2. Pseudomonas aeruginosa

P. aeruginosa was first isolated in 1882 by Gessard from green-coloured pus of a skin wound bandage (157). Its typical blue-green colour on solid media or wounds is a result of pigment production, like Pyocyanin and Pyoverdin. P. aeruginosa is an aerobic, rod-shaped, gram-negative bacterium that is characterised as oxidase positive and lactose non-fermenter. P. aeruginosa is an opportunistic pathogen that usually does not affect healthy individuals but causes serious infections in patients with defects in host immunity or barrier functions, such as reduced neutrophil numbers or function, acquired syndrome (AIDS), hematologic cancers, burns, surgical or open wounds, mellitus, or cystic . In these patients, P. aeruginosa is responsible for a wide range of infections including post-operative soft tissue infections, chronic wound, and lung infections, urinary tract infections, bone and joint infections, gastrointestinal infections, as well as systemic bacterial sepsis. P. aeruginosa is motile and has the ability to form biofilms that protect it from immune responses by antibodies and phagocytes, as well as from antibiotic treatments, contributing to

18 Introduction antibiotic resistance. Moreover, P. aeruginosa has minimal nutritional requirements and thrives as a ubiquitous organism in moist environments such as soil and water but also wounds. P. aeruginosa is usually an extracellular pathogen that produces a wide variety of secreted and structural virulence factors including exotoxin A, exotoxin U phospholipase, alkaline protease, elastase, pyocyanin, pili, flagella, and lipopolysaccharide (158). These factors enable P. aeruginosa to cause severe tissue damage. Moreover, the type III secretion system (T3SS) allows host cell manipulation by injecting these virulent proteins into the host cells. P. aeruginosa presents a serious therapeutic challenge for treatment due to its increasing antibiotic resistance. P. aeruginosa is not only well protected by its biofilm formation, but it is also naturally resistant to penicillin and other beta-lactam . This naturally occurring low susceptibility has become more critical since new multi-resistant strains of P. aeruginosa have emerged (159).

1.9. Aim of the study

P. aeruginosa, an ubiquitous environmental gram-negative bacterium, is one of the leading causes of severe nosocomial skin wound infections. Due to increasing resistance to common antibiotics, this pathogen poses a major threat, especially to immunocompromised patients (159). Most susceptible are patients with previous epithelial injuries like burns or surgeries. Although there is a number of studies explaining general mechanisms how MCs may mediate immune responses against bacteria, to date the role of MCs against bacterial infections has never been addressed in a physiologically relevant model that mimics the human clinical situation. The intention of this study is to achieve a profound understanding of the role of MCs in the combat against P. aeruginosa in a physiologically and clinically relevant way:

I Do MCs improve the healing of P. aeruginosa-infected skin wounds? II How do MCs mediate protection from P. aeruginosa skin wounds infection? III Can MCs or MC-derived mediators be used as therapeutic targets in P. aeruginosa skin wounds infection?

19

Materials

2.Materials

2.1. Cell sources

Table 2.1. Cell sources

Cell line Origin References PAM 212 Spontaneously transformed murine BALB/c-derived (160) keratinocyte line. HaCat Spontaneously transformed human keratinocyte cell (161) culture line from non-melanomic skin.

2.2. Mast cell-deficient mouse strains

Table 2.2. Mast cell-deficient mouse strains

Strain Mutation References WBB6F1/J- Spontaneous loss of function point mutation of the (7) KitW/KitW-v kinase domain of c-Kit leading to reduced activity. B6.129- Microinjection of Cpa3-Cre transgene into embryonic (41) Cpa3-Cre; stem cells in the B6 background and crossing with Mcl-1fl/fl B6;129-Mcl-1tm3sjkJ.

2.3. Genetically modified mice

Table 2.3. Genetically modified mice

Strain Mutation References B6.129- Insertion of a neomycin selection cassette into exon 2 of (162) Il6tm1Kopf/J the Il6 gene. B6.129- Deletion of exon 3 of the myeloid differentiation (163) Myd88tm1Defr/J primary response gene 88 locus.

21 Materials

2.4. Cell culture media and supplements

Table 2.4. Cell culture media and supplements

Product Manufacturer Fetal calf serum Biochrom Glutamin Biochrom Iscove's Modified Dulbecco's Media PAA Keratinocyte Gold Medium Lonza Penicillin & Streptomycin Biochrom Sodium pyruvate Sigma-Aldrich α-Monothioglycerol Sigma-Aldrich

2.5. Bacterial culture media and supplements

Table 2.5. Bacterial culture media and supplements

Product Manufacturer Agar agar Merck Cetrimide Sigma-Aldrich Glucose Sigma-Aldrich Lysogeny broth medium Roth Tryptone plus Fluka Analytical Tryptic soy broth Fluka Analytical Yeast Extract Sigma-Aldrich

2.6. Buffers, reagents and chemicals

Table 2.6. Buffers, reagents and chemicals

Product Manufacturer Buffered formaldehyde (4%) Herbeta Chloroform Roth Collagenase Worthington Dimethyl sulfoxide Sigma-Aldrich Dispase Typ II Roche EDTA Merck Eosin-Phloxin Hollborn & Söhne Ethanol (100%, 90%, 70%) Herbeta Ethanol (100% RNA purity) Merck Flagellin (S. typhimurium) InvivoGen

22 Materials

Gentamicin Biochrom Giemsa Merck Hematoxylin Merck Hexadecyltrimethylammonium bromide (HTAB) Sigma-Aldrich Hydrochloric acid Roth Hydrogen peroxide BioRad Ionomycin (S. conglobatus) Sigma-Aldrich Isofluran (Forene) Abbvie Limonene Mounting Media EMS LPS (P. aeruginosa) Sigma-Aldrich N-3-oxo-dodecanoyl-L-Homoserine Lactone CaymanChemical O-dianisidine dihydrochloride Sigma-Aldrich Paraffin Merck Phosphate-Buffered Saline PAA Sodium chloride Sigma-Aldrich SoftaseptN Braun Toluidine Blue Sigma-Aldrich TritonX-100 Sigma-Aldrich Trypsin EDTA Lonza Xylol Roth

2.7. Antibodies

Table 2.7. Antibodies

Product Conjugate Clone Manufacturer Anti-Mouse CD117 PE ACK2 eBioscience Anti-Mouse Fc epsilon Receptor I FITC MAR-1 eBioscience Anti-Mouse IL-6 receptor Fluor 488 Polyclonal Antikörper-online Anti-Mouse T1/ST2 Biotinylated DJ8 Mdbioproducts Anti-Streptavidin PE Polyclonal BD Pharmingen Armenian Hamster IgG Isotype FITC eBio299Arm eBioscience Rabbit IgG Isotype Fluor 488 Polyclonal Antikörper-online Rat IgG1 Isotype Biotinylated Polyclonal Mdbioproducts Rat IgG2b K Isotype PE eB149/10H5 eBioscience

23 Materials

2.8. Cytokines

Table 2.8. Cytokines

Product Manufacturer Recombinant mouse IL-1α Miltenyi Biotec Recombinant mouse IL-1β Miltenyi Biotec Recombinant mouse IL-3 InvivoGen Recombinant mouse IL-6 eBioscience Recombinant mouse IL-33 Enzo Life Science Recombinant mouse IL-36 Sino Biological Recombinant mouse MPO R&DSystems

2.9. Primers

Table 2.9. Primers

Name Direction Length Tm %GC Sequence Actb forward 21 62 48 ccgtgaaaagatgacccagat reverse 20 64 60 ctcagctgtggtggtgaagc CRAMP forward 20 60 45 gccgctgattcttttgacat reverse 20 60 50 aatcttctccccacctttgc Il-6 forward 25 59 40 gctaccaaactggatataatcagga reverse 24 60 50 ccaggtagctatggtactccagaa Defb14 forward 24 59 38 tgaggcttcattatctgctatttg reverse 20 59 45 tttcggagggtttttggtag S100A7 forward 18 60 61 gcctcgcttcatggacac reverse 22 59 50 cggaacagctctgtgatgtagt

2.10. Commercial kits

Table 2.10. Commercial kits

Product Manufacturer High Capacity cDNA Reverse Transcription Kit Invitrogen Light Cycler FastStart DNA Master SYBR Green I Kit Roche LightCylcer RNA Master SYBR GreenI Roche Mouse beta defensin ELISA MyBioSource Mouse CRAMP ELISA MyBioSource Mouse IL-18 ELISA BioCat GmbH Mouse IL-1α ELISA MAX Standard Set Biolegend Mouse IL-1β Ready-Set-Go ELISA eBioscience

24 Materials

Mouse IL-33 Duo Set ELISA R&D Systems Mouse IL-36 ELISA MyBioSource Mouse IL-6 Ready-Set-Go ELISA eBioscience Mouse TNF ELISA Biolegend RNA Stabilisation Reagent (RNAlater) Qiagen Mouse Multi-Analyte ELISArray (Th1/Th2/Th17) Qiagen

2.11. Consumables

Table 2.11. Consumables

Product Model Manufacturer Biopsy punch 6 mm, 12 mm Acuderm Cannula Sterican Braun Cell culture inserts 0.4 µm, 1 µm Falcon Disposable cell spreader L-shape HeathrowScientific ELISA plates Maxisorb, 96-well NUNC Embedding cassettes Bio-Link / Bio-Net RLangenbrick slide SuperFrost Menzel Light Cycler capillaries 20 μl Roche Nylon mesh Sefar Nitex Sefar Non-tissue culture treated plates 96-well, 6-well Falcon 94 mm x 16 mm Greiner Bio-one Pipet tips 10 µl, 200 µl, 1000 µl Sarsted Pipet tips with filter 10 µl, 200 µl, 1000 µl Sarsted Sterile syringe filters 0.2 µm Gilson Scientific Stripettes 5 ml, 10 ml, 25 ml Sarsted Suspension tissue culture plates 96-well, 6-well Falcon Syringes 1 ml, 10 ml BD Tissue homogeniser QIAshredder Qiagen Tissue-treated cell culture flask 75 cm2 Sarstedt

2.12. Devices and technical support

Table 2.12. Devices and technical support

Product Model Manufacturer Centrifuges Fresco21, Megafuge 1.0 Thermo Fisher Tissue embedding machine Citadel 1000 Thermo Fisher

CO2- HeraCell 150 Heraeus 100 ml Merck

25 Materials

Fluorescence microscope Axioplan2 Zeiss Fluorescence temperature cycler LightCycler Roche Freezing container Nalgene Sigma-Aldrich Incubator T6030 Thermo Electron Inverted microscope CKX 41 Olympus Manual Rotary Microtome Shandon Finesse 325 Thermo Fisher Microbiological Safety Cabinet BIOWIZARD Silver Line Kojair Tech Oy -reader DynexMRX 1.33 Dynex Neubauer counting chamber 0,1 mm Marienfeld 10, 100, 200, 1000 μl Eppendorf Pipettor Pipetus Hirschmann Hereaeus T3023 Thermo Fisher Spectrophotometer BioSpectrometer Eppendorf Thermocylcer FlexCycler² Analytik Jena Flow cytometer MACSQuant Analyser Miltenyi Multi-channel 50 μl, 300 μl Eppendorf Vortexer Model 72020 NeoLab

2.13. Analysis software

Table 2.13. Analysis software

Product Model Manufacturer Image processing program ImageJ NIH (Wayne Rasband) Single cell analysis software FlowJo TreeStar Statistics software Prism GraphPad Universal probe library assay design Roche

2.14. Manufacturers and distributers

Table 2.14. Manufacturer and distributer AbbVie AbbVie GmbH & Co KG, Ludwigshafen a. Rhein, Germany Acuderm Acuderm Inc., Fort Lauderdale, Florida, USA Analytik Jena Analytik Jena AG, Jena, Germany BD BD Pharmingen, Heidelberg, Germany Bio-Rad Bio-Rad Inc., Hercules, California, USA Biochrom Biochrom AG, Berlin, Germany Biolegend Biolegend, London, United Kingdom Braun B Braun AG, Melsungen, Germany

26 Materials

Cayman Cayman Chemical Company, Ann Arbor, United States Dynex Dynex Technologies, Chantilly, USA eBioscience e-bioscience, Frankfurt Germany EMS Electron Microscopy sciences, München, Germany Enzo Life Science Enzo Life Science, Lörrach, Germany Eppendorf Eppendorf AG, Hamburg, Germany Fluka Analytical Fluka Analytical, Sigma-Aldrich Chemie GmbH, Steinheim Gilson Gilson Scientific Ltd., Luton, UK GraphPad GraphPad Software Inc., La Jolla, California, USA Greiner Bio-One Greiner Bio-One GmbH, Frickenhausen, Germany Heathrow Scientific Heathrow Scientific, Illinois, USA Heraeus Heraeus Holding GmbH, Hanau, Germany Herbeta Herbeta Arzneimittel, Berlin, Germany Hirschmann Hirschmann Laborgeräte GmbH & Co. KG, Eberstadt, Germany Hollborn & Söhne Dr. K. Hollborn & Söhne GmbH & Co. KG, Leipzig, Germany Invitrogen Invitrogen AG, Carlsbad, California, USA InvivoGen InvivoGen, Toulouse, France Kojair Tech Oy Kojair Tech Oy, Vilppula, Finnland LONZA LONZA, Basel, Switzerland Marienfeld Marienfeld GmbH & Co. KG, Königshofen, Germany Menzel Menzel GmbH, Wiesbaden, Germany Merck Merck KGaA, Darmstadt, Germany Miltenyi Miltenyi Biotec GmbH, Bergisch Gladbach, Germany MyBioSource MyBioSource Inc., San Diego, California, USA NeoLab NeoLab Migge Laborbedarf-Vertriebs GmbH, Heidelberg, Germany NUNC NUNC GmbH & Co. KG, Wiesbaden, Germany Olympus Olympus, Hamburg, Germany PAA PAA GmbH, Pasching, Austria PerkinElmer PerkinElmer, Waltham , Massachusetts, USA Qiagen Qiagen GmbH, Hilden, Germany R&D R&D Systems, Minneapolis, USA RLangenbrick RLangenbrick Labor- und Medizintechnik, Emmendingen, Germany Roche Roche, Mannheim, Germany ROTH Carl ROTH GmbH + CO. KG, Karlsruhe, Germany Sarstedt Sarstedt AG & Co., Nümbrecht-Rommelsdorf, Germany Sefar Sefar Ag, Heiden, Switzerland Sigma-Aldrich Sigma-Aldrich Chemie GmbH, Steinheim, Germany Sino Biological Sino Biological Inc., Beijing, China Thermo Fisher Thermo Fisher Scientific Inc., Walldorf, Germany Worthington Worthington Biochemical Corporation, Lakewood, New Jersey, USA Zeiss Carl Zeiss, Jena, Germany

27

Methods

3.Methods

3.1. Isolation and culture of bone marrow-derived cultured MCs (BMCMCs)

BMCMCs complete medium IMDM (500ml) 10% FCS 1% P/S 13 µl Monothioglycerat 10 ng/ml murine IL-3

Mice older than 8 weeks were sacrificed, and their abdomen and legs were disinfected using SoftaseptN. Using sterile scissors and forceps, femur and tibia were removed without damaging the bone structure. Any tissue from the femur and tibia was removed, bones were stored in IMDM medium on ice until further processed. Using a 20 G needle, the bone marrow was flushed into a 50 ml tube and resuspended in IMDM medium. Bone marrow-derived cells were pelleted by centrifugation (10 min, 300 g, 4°C). Cells were resuspended in complete BMCMCs medium (20 ml medium / 1 mouse), and the suspension was transferred into a tissue-treated cell culture flask (75 cm2). After five days of culture, the medium was changed, cells were adjusted to a cell density of 1 x 106 cells/ml, and the suspension was transferred into a new cell culture flask. This procedure was repeated every 7 days. After four weeks of culture, cell count, viability as well as purity of MCs were determined. 10 μl of cell culture suspension were diluted 1:2 with Toluidine blue solution (0.5 g Toluidine Blue O + 99.5 ml 0.5 N HCl), and cell numbers were determined using a hemocytometer. MC purity was determined by FACS analysis. Cells with a purity of ≥95% expression of FceRI and c-Kit were included in experiments.

3.2. Murine keratinocyte cell culture

Keratinocyte complete medium IMDM 1% P/S 10% FCS 11 µl α-Monothioglycerol 1% L-Glutamine 0.625 mM HEPES

29 Methods

4 x 106 keratinocytes (KCs) were thawed from -140°C stocks and immediately transferred into a 50 ml tube with pre-warmed medium. Cells were washed twice with complete media (8 min, 300 g). Viable and total cell counts were determined, and cells were resuspended in the appropriate volume of complete KC medium to yield a final cell density of 4 x 106 viable cells/ml. The cell suspension was transferred into a cell culture flask (75 cm2). The medium was replaced every second day with fresh, complete KC medium until cells reached a confluence of 80-100% and were ready to subculture. For this, the medium was aspirated, the cell culture flask was rinsed twice with PBS, and 1 mL of 0.05% Trypsin-EDTA was added to the flask. After 3-5 minutes of incubation at 37°C, when the cells had detached, 20 ml of growth medium were added to the flask. The cell suspension was transferred into a 50 ml tube and centrifuged (8 min, 300 g, RT). The supernatant was aspirated, and the cell pellet was resuspended in fresh complete KC medium and 1/10 of the cell suspension was cultured as described above. For freezing of the cells, 2 x 106 viable cells/ml were diluted 1:2 in pre-chilled freezing medium (KC medium + 20% DMSO) and immediately deep frozen (-80°C) using a cell freezing container supplied with 100% isopropyl alcohol to maintain an approximate -1ºC/minute freeze rate and afterwards transferred to -140°C for long term storage.

3.3. Isolation and culture of primary human keratinocytes

Human keratinocyte medium Keratinocyte gold medium (KGM)

Skin specimens (eyelid or breast skin) were freed from any adhering fat tissue using sterile scissors and weighed. The skin sample was cut into pieces of about 1 cm2, and small, comb-like cuts at 1-2 mm intervals were made to allow enzymes to penetrate the tissue. Skin preparations were then transferred into a 50 ml tube and incubated at 4°C overnight in dispase Typ II (2.4 U / ml in PBS) using 20 ml per 5 g skin. The epidermis was removed from the dermis using sterile forceps, and was digested using Trypsin (0.2%, 10 ml) for 10 min at 37°C, 5% CO2. Digestion was stopped by adding 10 ml RPMI supplemented with 10% FCS, and cells were pelleted (8 min, 300 g, RT). KCs were resuspended in KGM at a cell density of 1 x 106 cells/ml.

After 90 min of incubation (37°C, 5% CO2), the medium was removed, cells were washed with PBS, and fresh pre-warmed medium was supplied. Cells were cultured for 1-3 days and subsequently used for experiments.

3.4. Bacterial culture

Cetrimide-TSB Agar 35 g TSB 15 g Agar Agar 3 g Cetrimide

1 l ddH2O

30 Methods

LB Medium 10 g Tryptone Plus 5 g Yeast Extract 5 g NaCl 1 g Glucose

1 l ddH2O

LB Agar 15 g Agar Agar 1 l LB Medium

The strains P. aeruginosa ATCC 27853 and S. aureus Newman strain were used in experiments. Bacterial cultures from frozen stocks were plated on Cetrimide-Tryptic soy broth (TSB) agar for P. aeruginosa or Lysogeny broth agar plates for S. aureus overnight. Inoculation from grown colonies were grown in LB medium at 150 rpm for 1-2 h at 37°C, to mid exponential growth phase (OD600 = 0.5-0.7) the next day. Bacteria were collected by centrifugation (3000 g) and resuspended to the appropriate density of colony forming units (CFUs) per ml in the indicated media. Bacterial numbers were determined by optical density

(OD600) measurement and plating of serial dilutions on Cetrimide-TSB Agar or LB agar plates for P. aeruginosa or S. aureus, respectively.

Determination of bacterial numbers

Bacterial numbers were determined either by optical densitometry at 600 nm (OD600) or by plating serial dilutions onto agar plates. A series of 1:10 dilutions of the bacterial suspension was made with PBS by adding 15 µl bacterial suspension to 135 µl PBS. 15 µl of each dilution were plated on Cetrimide-TSB agar plates for P. aeruginosa or LB agar plates for S. aureus. The inoculated plates were cultured overnight (ca. 16 h) at 37°C. Grown bacterial colonies were counted, and colony forming units were calculated according to the following equation:

CFUs/ml= Plate Count × (1/dilution) × 66.67. For OD600-dependent determination of bacterial concentration a standard curve was established by plate counting (Figure 3.1).

P. aeruginosaStandard Gro (wATCCth Curve P.27853)aerugino sa S. aureusStan (Newmandard Growth C Strain)urve S. au reus

8 5

)

)

8

8

0

0 4

1

1

6 x

x

(

(

l l 3

m

m

/

/

4 a

a

i

i

r r 2

e

e

t

t

c

c

a a 2 1

B

B

0 0 0.0 0.2 0.4 0.6 0.8 0.0 0.5 1.0 1.5 OD 600 nm OD 600 nm 2 2 Y=8,2304y=8,23 +04 X0.1465 + 0.1465 RR2==0.93210.9321 Y=2.8326y=2.8326X + 0+.6 20.62598598 R2=0. 9R711=0.9711

Figure 3.1 Standard growth curves for P. aeruginosa and S. aureus.

31 Methods

Standard growth curves following linear correlation between CFUs and OD600 for P. aeruginosa 2 and S. aureus. Bacteria numbers per ml are plotted against absorbance at OD600. R is the Pearson coefficient of determination.

3.5. Mouse model: Skin wound infection

Mouse housing and husbandry All mice were housed and bred under specific pathogen-free conditions in individually ventilated cages in the animal facility of the Research Institutes for Experimental Medicine, Charité Universitätsmedizin Berlin or Technical Laboratory for Immunology, University of South- Denmark. The mice were housed in a 12-hour light-dark rhythm, with standard cage enrichment and free access to water and pelleted dry food. All mice were provided by breedings of our working group. Experiments have been approved by local ethic committee „Landesamt für Gesundheit und Soziales“ in Berlin, Germany.

Skin wound infection Female WBBF1-KitW/KitW-v mice and Kit+/+ littermates or C57BL/6-Cpa3-Cre;Mcl-1fl/fl mice and C57BL/6-Cpa3-Cre;Mcl-1+/+ littermates, between 8-11 weeks of age, were used for skin wound infection experiments. Wounding procedure is depicted in Fig. 3.2. Mice were anesthetised by isoflurane inhalation using an anaesthesia evaporator. Elizabethan collars (Ø 5.2 cm, Ø 1.5 cm inner circle) were fitted and fixed with double-faced adhesive tape. Back skin was shaved and wiped with disinfectant solution (SoftaseptN). A skin full-thickness skin wound of 6 mm diameter was created using a 6 mm biopsy punch on the lower back. The inoculum of 5 6.5 x 10 Ski P.n aeruginosawound infect iperon wound was delivered by pipetting 10 µl of bacterial suspension to the centre of the open wounds.

1 Isofluran

2 4

Elizabethan collar 3 5

Figure 3.2. Scheme of skin wound infection procedure. 1) Mice were anesthetised and the Elizabethan collar were fitted. 2) Back skin was shaved and 3) disinfected. 4) Next a wound was created using a biopsy punch that was subsequently 5) infected with P. aeruginosa by pipetting the bacterial suspension onto the wound.

32 Methods

Wounds were neither dressed nor sutured. All mice were housed in individual cages with reduced enrichment and wore Elizabethan collars to prevent wound licking and scratching for the first 24 h. For pre-treatment with recombinant IL-6 (recIL-6) mice were wounded as described above and wounds were either topically treated with 10 µl of recIL-6 (200 ng / 10 µl in PBS) or vehicle treated with PBS only. After 1 h, skin wounds were infected with 6.5 x 105 P. aeruginosa.

MC reconstitution of back skin Mouse back skin reconstitution was performed as described previously (164). 106 BMCMCs per cm2 skin were injected into the skin of MC-deficient mice. BMCMCs derived from wild type littermates or Il6-/- mice were cultured for 4 weeks in IMDM as described above. Cells were centrifuged (8 min, 300 g, RT) and adjusted to a concentration of 107 MCs per ml with IMDM without any supplements and placed on ice. An area of 4 cm2 back skin was shaved and disinfected. A 1 ml syringe with a 30 G needle was used for the injection of the cells. Before injecting, the needle was rolled to avoid sedimentation of the cells. Reconstitution was carried out by 8 intradermal injections of cell suspension (50 µl each) equally distributed over the area of 4 cm2. To confirm successful MC reconstitution, formalin-fixed and paraffin-embedded sections of cutaneous lesions were stained with alkaline Giemsa and analysed for MC numbers.

Skin wound sample recovery Mice were sacrificed and a 12 mm circular biopsy of the wound including an uninjured epithelial margin was excised using a biopsy punch. The excised skin specimen was bisected in the mid transversal plane. One of the bisected tissue segments was fixed in 10% buffered formalin and embedded in paraffin. The other half of the bisected tissue segment was used for the determination of the microbial load, for ELISA, or for RNA isolation.

Calculation of wound closure Wound repair was monitored daily by taking images using a Nikon P510 digital camera. The progress of wound closure was measured by planimetric analysis of the wound margins using Image64 free software. Margins were marked for each image individually and the size of the wound area was calculated. The calculation was normalised using a ruler depicted next to each mouse on the image.

Determination of bacterial load in skin wounds The recovered tissue biopsy was weighed, placed in 300 µl of sterile ice cold PBS and homogenised with sterile scissors under sterile conditions. 1:10 dilution series of the tissue homogenate was prepared in PBS by adding 135 µl PBS to 15 µl of homogenate. 15 µl of diluted or pure skin homogenate were plated on P. aeruginosa-selection Cetrimide-TSB agar plates (2.2.1.4). The colony forming units (CFUs) per 0.1 g of tissue were calculated according to the following equation: CFUs / 0.1 g = [CFUs plate count × (1/dilution) × 20 x 0.1] / weight of homogenised tissue

33 Methods

3.6. Histology

Fixation, embedding and processing of samples Complete skin wounds including epithelial margins were isolated, bisected and fixed overnight in 10% buffered formalin in PBS. Embedding was performed using the Citadel 1000 (Thermo Fisher) tissue-embedding machine.

Table 3.1. Embedding procedure

Time (152) Solution 20 Aqua dest. 50/60 Ethanol 70% 50/60 Ethanol 96% 50/60/60 Ethanol 100% 50/60 Xylol 120/∞ Paraffin

Sectioning Sectioning was performed using a Shandon Finesse 325 (Thermo Fisher) manual rotary microtome. 5 µm thick paraffin sections were cut, and two sections each were mounted on one glass slide, smoothened by short immersion in a 37°C water bath, and dried over night at 60°C.

Staining Before staining, 5 µm thick paraffin sections were deparaffinised through xylene and a series of increasing concentrations of ethanol. Sections were subsequently stained with Giemsa's Azure Eosin Methylene Blue solution and mounted with Limonene Mounting Medium.

Table 3.2. Protocol Giemsa staining

Repetitions Time (min) Solution

2x 10 Xylol 2x 5 Ethanol absolute 2x 5 Ethanol 96% 2x 5 Ethanol 70% ∞ Aqua dest. 15 Giemsa's Azure Eosin Methylene Blue 2x 0.5 Acetic Acid 0.1% 3 Ethanol absolute 3 Xylol Mount with Limonene

34 Methods

3.7. In vivo live imaging

Bacterial skin wound infection was carried out as described above. For in vivo imaging, mice were anaesthetised using 10 µg/g body weight Ketamine and 100 µg/g body weight Xylazin. XenoLight RediJect Bacterial Detection Probe or XenoLight RediJect Chemiluminescent Inflammation Probe was diluted directly before use 1:100, and 10 µl were added onto the wound. Substrate imaging took place after 5 minutes by detecting the fluorescent or bioluminescent signal using the IVIS spectrum (Perkin Elmer) live imaging system. Radiant efficacy was calculated and auto- fluorescence was subtracted using Live Imaging Software 4.1 (Perkin Elmer). Experiments were carried out in the animal facility at the University of Southern Denmark, Odense.

3.8. Skin explant infection

The back skin of KitW/KitW-v mice and wild type littermates was shaved and disinfected. Using a 4 mm biopsy punch, skin sample was excised from the back skin of mice. The skin biopsy was kept in PBS containing 1% P/S on ice. Before infection, the skin slice was washed twice with PBS to remove antibiotics. Infection experiment was performed in a 96-well plate using 60 µl of P/S-free medium containing 3 x 105 bacteria (5 x 106 CFU / ml). Skin samples were placed dermis down into 96 wells. Skin biopsies were incubated for 6 h at 37°C and humidified 5%

CO2.

Skin explant cytokine stimulation For skin explant cytokine stimulation, 4 mm skin biopsy was washed twice with PBS and placed into a 96 well containing 50 µl P/S-free complete cell culture medium with 1% FCS and 200 ng recIL-6 or vehicle. After one hour of incubation samples were washed with media and infection was carried out as described above for 6 h at 37°C and humidified 5% CO2 as described above.

Human skin explants: 4 mm biopsies were taken from healthy human skin specimen derived from eyelid or buttock using a biopsy punch. Biopsies were washed once with PBS containing 1% P/S followed by two washing steps with PBS and subsequently placed into a 96-well plate. Cytokine stimulation and bacterial infection was carried out as described above.

3.9. Cell culture infection experiments

Infection medium: IMDM 1% FCS

Pam-212 KCs were plated 50.000 cells per 100 µl in a flat-bottom 96-well plate and cultured overnight. KCs were washed prior to infection twice with PBS. BMCMCs were washed twice

35 Methods with PBS and plated 50.000 in a total volume of 50 µl infection medium in a flat-bottom 96-well plate. Infection was performed by inoculating the co-culture with 50 µl bacterial suspension in infection medium at a cell-bacterium ratio of 1:5 (MOI=5) meaning 5 x 106 CFU per ml. Consistent infection conditions and optimal bacterium-host cell interaction were achieved by a one minute centrifugation step at 300 g. The end of the centrifugation was defined as the starting point of 3 hours infection (37°C, 5% CO2). Determination of CFUs: CFUs were determined by plating a serial dilution of the co-culture supernatant on Cetrimide-TSB agar plates as described (see 3.4). Determination of the bacteriostatic effect: Bacterial growth was measured in the recovered co-culture supernatant hourly by determination of OD600. Control wells contained bacteria grown under identical conditions without cells or infection medium only. OD600 values were translated into bacterial numbers using a standard bacterial growth curve (Fig. 3.1).

Co-culture infection Pam-212 KCs were plated 35.000 cells per 100 µl in a flat-bottom 96-well plate and cultured overnight. KCs were washed twice with PBS before infection. 15.000 MCs were washed twice with PBS and added to the KCs in a total volume of 50 µl infection medium. The cell numbers of KC and MCs in the co-culture experiments were adjusted to 50.000 cells per 100 µl in a 70:30 ration of KCs and MCs when not stated otherwise. Infection of the co-culture system was carried out as described above.

Cytokine stimulation For cytokine stimulation, 50.000 keratinocytes were pre-stimulated for 1 h with recIL-6 in different concentrations (5, 10, 50 ng / ml) or vehicle in a volume of 100 µl of complete medium prior to infection. Infection experiments were carried out according to the protocol described above. Stimulation and infection of human primary KCs or HaCaT cells was carried out accordingly.

Transwell infection experiments For transwell experiments, a 6-well plate cell culture insert transwell system (0.4 µm) was used. Single cultures were seeded at a density of 1.5 x 106 / 1.5 ml. For co-culture experiments, 106 KCs were plated as described above in the lower chamber in 1 ml, and 0.5 x 106 MCs were seeded into the transwell insert in 0.5 ml. Depending on the experimental setup, either one or both chambers were infected with P. aeruginosa at a MOI of 5 as described above.

Supernatant transfer experiments KCs infection with P. aeruginosa was carried out as described above at a MOI of 5. After 3 h of incubation, the supernatant was collected and either used directly or stored at -20°C. For some experiments, the supernatant was sterilised by centrifugation (15 min, 4000 g, 4°C) followed by sterile filtration using a 0.2 µm filter system. Transfer on MCs: MCs were plated at a density of 5 x 105 cells per 100 µl in a suspension V-bottom 96-well plate and were sedimented (5 min, 300 g, RT). Supernatant was aspirated, and MCs were resuspended in supernatant and incubated

36 Methods

for 3 h (37°C, 5% CO2). Subsequently, MC supernatant was obtained by centrifugation (8 min, 300 g, RT) and analysed for cytokine concentrations.

3.10. Enzyme linked immunosorbent assay (ELISA)

Detection of cytokines in murine tissue The suspension of homogenised murine skin tissue (see 3.5) was centrifuged (15 min, 12,000 g, 4°C) and the resulting supernatant immediately frozen at -80°C. For ELISA, 3 µl of supernatant were diluted in 97 µl Assay buffer. Before homogenisation, samples were weighed to allow calculation per g tissue. PBS adequately diluted in ELISA assay buffer was used as blank value. All ELISA steps were carried out according to the manufacturer's protocol (see Table 2.10).

Detection of cytokines in cell culture supernatants Cell culture supernatants from infected or sham infected cell cultures were diluted 1:2 in ELISA assay buffer. Samples were measured in duplicates. Cell culture medium adequately diluted in ELISA assay buffer was used as vehicle control. All ELISA steps were carried out according to the manufacturer's protocol (see Table 2.10).

3.11. Quantitative real time polymerase chain reaction (qRT-PCR)

RNA isolation Total RNA was isolated from 1.5x106 BMCMCs or Pam-212 KCs using QIAzol Lysis Reagent. Cells were pelleted and homogenised using a 30 G needle in 300 µl QIAzol Lysis Reagent. 100 µl chloroform were added, and the samples were vortexed vigorously for 15 seconds. After 2-3 minutes of incubation at RT, samples were centrifuged (15 min, 12,000 g, 4°C). The aqueous phase was transferred into a new tube and RNA was precipitated with 0.5 volume of absolute ethanol. RNA purification was carried out using the RNeasy Kit from Qiagen according to the manufacturer’s instructions. For RNA isolation from mouse skin 0.1 g of skin samples were homogenised using sterile scissors and stored in 500 µl RNAlater at -80°C. At the day of RNA isolation, samples were thawed, pelleted (10 min, 6000 g, 4°C), and resuspended in 700 µl RLT buffer. In addition to the manufacturer's protocol, these samples were homogenised using QIAshredder columns (3 min, 21,000 g). Afterwards, RNA was stored at -80°C until further processing for qRT-PCR analysis.

RNA reverse transcription to cDNA 300-500 ng total RNA were converted by reverse transcription into cDNA, using High Capacity cDNA Reverse Transcription Kit. All steps were carried out in accordance with the manufacturer’s protocol.

37 Methods

Table 3.3. Protocol RT-reaction cDNA synthesis Step 1 Step 2 Step 3

Temperature (°C) 25 37 4 Time (152) 10 120 ∞

Quantitative real time PCR (qRT-PCR) qRT-PCR was performed using the Light Cycler Fast Start DNA Master SYBR Green I Kit and corresponding sets of specific primers in a fluorescence reader temperature cycler. For the evaluation of relative gene expression, levels of target mRNA were normalised against housekeeping mRNA via the 2–ΔΔCt method using ß-actin. cDNA sequences of the genes under investigation are listed in GenBank NCBI. Primers were designed using Universal Probe Library Assay Design Centre software.

Table 3.4. Protocol qPCR-reaction

Analysis Pre-incubation Amplification Melting Curve (SYBR Green I Kit) Step1 Step2 Step3

Temperature (°C) 37 95 65 72 65-95 Time (min) 10 15 sec 30 sec 10 sec continuously Cycles 1 50 1 Ramp Rate (°C/sec) 20 20 0.1

3.12. Flow cytometry

FACS buffer PBS 2% FCS 2 mM EDTA

500.000 cells from a BMCMC culture suspension were transferred into each 1.5 ml Eppendorf tubes and used for analysis. Cells were washed twice with FACS buffer (PBS with 2% FCS and 2% EDTA) followed by centrifugation (8 min, 300 g, 4°C). The cell pellet was resuspended in 40 µl FACS buffer, and 40 µl 2x antibody solution was added. Staining was performed on ice for 20 min. Cells were washed twice with FACS buffer and resuspended in 100 µl of FACS buffer containing DAPI (0.1 mg/ml). Corresponding isotype controls as well as unstained samples were included as negative controls in the experimental setup. FACS was carried out using the MACSQuant Analyser. Collected data were analysed using FlowJo software. Single, viable (i.e. DAPi negative) cells were included in the analysis.

38 Methods

Table 3.5. Antibody solutions

Antibody Isotype control antibody Dilution

Anti-Mouse CD117, PE Rat IgG2b K Isotype Control, PE 1:1000 Anti-Mouse FcεRI, FITC Armenian Hamster IgG Isotype, FITC 1:1000 Anti-Mouse IL-6 receptor, AlexaFluor 488 Rabbit IgG Isotype Control, FITC 1:50 Anti-Mouse T1/ST2, Biotinylated Rat IgG1 Isotype Control, Biotinylated 1:800 PE, Streptavidin - 1:500

3.13. Myeloperoxidase assay

The myeloperoxidase assay was carried out as described previously (132). Excised skin samples were weighed, and homogenised in 300 µl potassium phosphate buffer (50 mM) containing 0.5% hexadecyltrimethylammonium bromide (HTAB) using scissors. Subsequently, samples were sonicated 3 min using ice bath sonication. Two cycles of shock freezing and thawing of samples with liquid nitrogen were carried out followed by another sonication for 3 minutes in an ice bath. Skin supernatants were collected by centrifugation (20 min, 4,000 g, 4°C). Samples were analysed in triplicates using 5 µl lysate in 96-well NUNC plates. 145 µl 50 mM Potassium- phosphate-buffer containing 0.167 mg/ml O-dianisidine dihydrochloride and 0.0005% hydrogen peroxide; pH 6 were added. Changes in optical density were measure at OD460 nm after 30 min reaction time. As a positive control, a standard curve using recombinant mouse MPO was established to determine Myeloperoxidase activity in Units per tissue weight.

3.14. Data presentation and statistical analysis

Numeric data are presented as mean ± standard error of the mean (SEM). Statistical tests were carried out using Graph Pad Prism (5.0 for Mac OS X). All data sets with n ≥ 5 were analysed for Gaussian distribution using Kolmogorov Smirnov normality test. To compare two groups with n < 5, or non parametric data sets the rank-sum-based Mann-Whitney test for independent samples was applied. For the comparison of two groups derived from normally distributed data set two-sided unpaired Student’s t test for independent samples was used. For the comparison of multiple groups, the rank-sum-based Kruskal-Wallis test was used for nonparametric data sets followed by Dunn’s post hoc test. For normally distributed data sets, the one-way ANOVA, that compares the means of three or more standard distributions, was used followed by Tukey’s post hoc test. Repeatedly measured data sets were analysed using two-way repeated measure ANOVA. Differences were considered statistically significant at *p<0.05, ** p<0.01 and *** p<0.001. Differences with p>0.05 were considered not statistically significant (n.s).

39

Results

4.Results

4.1. Genetically mast cell-deficient KitW/KitW-v mice show impaired wound closure upon skin wound infection with P. aeruginosa

The role of MCs in skin wound infection with the gram-negative bacterium P. aeruginosa, was assessed by comparing wound closure kinetics of genetically MC-deficient WBBF1-KitW/KitW-v (KitW/KitW-v) mice with wild type (WT) control Kit+/+ mice. For this purpose, mice were subjected to wounding by punch biopsy at the lower back, and the wound was infected with P. aeruginosa or sham-infected as control. To compare KitW/KitW-v mice and WT mice, the wound size was analysed daily for nine days. As early as day one after skin wound infection, MC-deficient KitW/KitW-v mice exhibited increased wound size compared to infected WT mice, indicative of impaired wound closure (Figure 3.1 a, b). This difference in wound size between KitW/KitW-v and WT mice was most pronounced between day two and day four after wound infection with an average of 111 ± 9 % of the initial wound size in MC-deficient mice as compared with 61 ± 5 % in WT mice. The difference in wound size was maintained over the entire measurement period until day nine. On day nine, infected KitW/KitW-v mice still exhibited more than twice the wound size compared to WT mice. In contrast, wound closure of sham-infected KitW/KitW-v mice was comparable to that of WT mice. Moreover, wound closure in WT mice was not affected by P. aeruginosa infection compared with sham-infected WT mice (Figure 3.1 a, b). To assess whether the influence of P. aeruginosa infection on wound closure was indirect, through weakening of the mice by bacterial dissemination and subsequent sepsis, body temperature and body weight were monitored. However, during the infection period, neither body temperature nor body weight was substantially altered (Figure 3.1 d, e). We conclude that wound inoculation with P. aeruginosa significantly impairs wound closure in MC-deficient KitW/KitW-v mice compared with WT mice or sham-treated mice, which is associated with symptomatic of bacterial sepsis.

41 Results

a KiKit+/+ Kitt+/+/++ KiKittW/KittWW-v-v KiKittW/KittWW-v-v b c vehicle infected vehicle infected

KitW/KitW-v infected

)

0

+/+ W W-v

sham infected e Kit Kit /Kit

y

n

a

)

+/+ i

infected l

d Kit e 200 ***

e 40

n sham infected

i

s l ns ***

a

e

3

b

s

**

y a 150 30

a

%

b

(

d

** 9

%

( **

* y 100

e 20

a

5

z

d

i

y ns

s

a

e

d

z

d 50 i

s n 10

u

d

o

n

9

u

W

y

0 o 0 a 0 1 2 3 4 5 d d

W m d e a e t h t c s c fe Day(s) post wound infection fe n in i

d Kit+/+ e f g *** W W-v infected sham infected ) W W-v sham infected d Kit /Kit infected ) Kit /Kit 60 ns 40 e e *** +/+ 110 +/+

t sham infected infected n sham infected C Kit Kit infected

i

a

l

°

e

(

e

r

t

s

e

n

a

r u 38

s

l

b

u

l

40 t 100

e

a

%

r

c

(

e

t

t

s 36

p

h

1

a

g

m

i

y

M

e

a

e

20 t 90

d

w

y

34

d

y

o

d

o

B

0 32 B 80 - d d 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 e e

9 t t

c c

y fe fe a in in Day(s) post wound infection Day(s) post wound infection

d m a sh

Figure 4.1. Mast cell-deficient mice show impaired wound closure upon skin wound infection. To create skin wounds 6mm punch biopsies were applied to Kit+/+ and MC-deficient KitW/KitW-v mice, and wounds were subsequently infected with 6.5 x 105 CFU P. aeruginosa or sham-infected with PBS. MC-deficient mice show delayed wound closure in compared to WT mice. (a) Representative images of skin wounds from Kit+/+ and MC-deficient KitW/KitW-v mice upon skin wound infection or sham infection. (b) Wound closure kinetics of Kit+/+ and KitW/KitW-v mice upon skin wound infection or sham infection. (c) Wound size at day nine after skin wound infection or sham infection of Kit+/+ and KitW/KitW-v mice. (d, e) Skin wound infection did not induce systemic changes. Recording of (d) rectal body temperature and (e) body weight during skin wound infection or sham infection of Kit+/+ and KitW/KitW-v mice. Data are expressed as means ± SEM and are pooled from three independent experiments with a total n = 5-10 mice. Statistical analysis was performed Statistical analysis was performed Statistical analysis was performed by two-way repeated measure ANOVA for wound closure kinetics (b) and one-way ANOVA followed by Tukey’s post hoc test (c, e) for multiple group comparisons. *p<0.05, ** p<0.01 and *** p<0.001, n.s.=not significant.

42 Results

4.2. Local mast cell reconstitution of genetically mast cell-deficient KitW/KitW-v mice normalises wound closure upon skin wound infection with P. aeruginosa

We aimed to further investigate, whether the impairment in wound closure of P. aeruginosa-infected skin wounds observed in MC-deficient KitW/KitW-v mice was indeed due to the lack of MCs and not due to other abnormalities present in this genotype. To this end, we included KitW/KitW-v mice after local reconstitution with bone marrow-derived MCs (KitW/KitW-v + BMCMCs) (164) in the experimental setup of skin wound infection with P. aeruginosa. Reconstitution was carried out by intradermally injecting MCs into the back skin of mice, where four weeks later skin wound infection took place. Histological analysis of the back skin of WT and KitW/KitW-v + MCs mice confirmed that reconstitution with MCs normalised MC numbers in the skin to 72 % of WT levels. In contrast, KitW/KitW-v mice had less than 2.5 % of WT MC present in the skin (Fig. 4.2 d). As this local adoptive transfer of MCs restored MC numbers, but not other possible abnormalities of the genotype, we concluded that any changes in the wound closure phenotype could be attributed to the role of MCs in skin wound infections. In line with this conclusion, KitW/KitW-v that locally received MCs did not exhibit impaired wound closure upon skin wound infection with P. aeruginosa. Wound closure kinetics of KitW/KitW-v + BMCMCs closely resembled those of WT mice (Fig. 4.2 a, b). Moreover, at day nine after wound infection there was no significant difference in wound size between WT and KitW/KitW-v + BMCMCs mice. Direct comparison of KitW/KitW-v and MC-repopulated KitW/KitW-v + BMCMCs mice revealed a mean difference of 53 ± 12 % in wound size during the first five days post skin wound infection. Even at day nine after wound infection, KitW/KitW-v mice exhibited increased wound areas as compared with both, Kit+/+ and KitW/KitW-v + BMCMCs mice (Fig. 4.2 c). The observation that selective reconstitution with MCs prevented the phenotype of reduced wound closure upon skin wound infection with P. aeruginosa of MC- deficient KitW/KitW-v mice, pointed towards a MC-specific mechanism. To further corroborate that MC deficiency but not MC-independent defects of the KitW/KitW-v mouse model were responsible for the delayed wound closure, c-Kit-independent MC-deficient Cpa3-Cre; Mcl-1fl/fl (Mcl-1fl/fl) and the corresponding WT Cpa3-Cre; Mcl-1+/+ (Mcl-1+/+) mice were included in the analysis. Wound size was measured after P. aeruginosa skin wound infection or sham infection. Mcl-1fl/fl and WT mice showed no considerable differences in wound closure kinetics in an uninfected state upon sham infection. In contrast, upon skin wound infection with P. aeruginosa, MC-deficient Mcl-1fl/fl mice exhibited larger wounds compared with WT mice starting at day one after wound infection. The biggest difference in wound size (40 ± 13 %) between the genotypes was observed at day three post wound infection (Fig. 4.2 e). Histological analysis of the back skin revealed that Mcl-1fl/fl mice possess significantly lower MC numbers, less than 4% of MCs in the skin of Mcl-1+/+ WT mice, confirming their MC-deficiency (Fig. 4.2 f). In summary, both MC-deficient mouse models, the KitW/KitW-v model and the c-Kit independent Mcl-1fl/fl model, displayed delayed wound closure kinetics upon skin wound infection with P. aeruginosa as compared with the corresponding MC-competent control mice or sham-infected

43 Results

MC-deficient mice. Additionally, restoring the MC population in MC-deficient KitW/KitW-v mice by local MC reconstitution normalised wound closure times after P. aeruginosa skin wound infection. Together, these findings point towards an important role for local MCs in the physiological healing of P. aeruginosa-infected skin wounds.

Figure 4.2. Impaired wound closure upon skin wound infection with P. aeruginosa is mast cell dependent. Delayed wound closure in MC-deficient mice compared to WT mice that was normalised upon adoptive transfer of MCs (a) Representative images of infected skin wounds of Kit+/+, KitW/KitW-v and KitW/KitW-v mice reconstituted with BMCMCs (KitW/KitW-v + BMCMCs). (b) Wound closure kinetic of Kit+/+, KitW/KitW-v and KitW/KitW-v + BMCMCs mice. (c) Wound size at day nine after skin wound infection of Kit+/+, KitW/KitW-v and KitW/KitW-v + BMCMCs mice. (d) Histological analysis of MC numbers per microscopic field (200x) of paraffin-embedded, Giemsa-stained skin derived from of Kit+/+, KitW/KitW-v and KitW/KitW-v + BMCMCs mice. (e) Wound closure kinetics of infected or sham-infected skin wounds from MC-deficient Cpa3-Cre; Mcl-1fl/fl (Mcl-1fl/fl) or Cpa3-Cre;Mcl-1+/+ (Mcl-1+/+) mice. (f) Histological analysis of MC numbers per microscopic field (200x) of paraffin-embedded, Giemsa-stained skin derived from of Mcl-1fl/fl and Mcl-1+/+ mice. Data are expressed as means ± SEM and are pooled from three independent experiments with a total n = 5-10 mice. Statistical analysis was performed by two-way repeated measure ANOVA for wound closure analysis, (a+e), one-way ANOVA followed by Tukey’s post hoc test (b), one-way ANOVA with Dunn’s post hoc test for nonparametric data sets (d) and Student’s t-test for single comparisons (f). *p<0.05, ** p<0.01 and *** p<0.001, n.s.=not significant.

44 Results

4.3. Mast cells control bacterial numbers in P. aeruginosa-infected skin wounds

To further investigate the role of MCs in the impaired wound closure observed in MC-deficient mice during skin wound infections, skin wounds were analysed for P. aeruginosa numbers. Using in vivo live imaging of fluorescently labelled bacteria, the bacterial load within skin wounds was monitored over five days following wound infection. A comparison of MC-deficient KitW/KitW-v and Kit+/+ mice revealed that MC-deficient KitW/KitW-v mice had a 14-fold higher bacterial load within skin wounds on day one after skin wound infection (Fig. 4.3 a, b). Although bacterial numbers were also decreasing in KitW/KitW-v mice over time, the bacterial load on day five was still 20 times higher than observed in WT mice. Moreover, WT mice had already eliminated all bacteria to a non-detectable level at day seven whereas KitW/KitW-v mice showed still a considerable bacterial burden within the wounds (data not shown). To ascertain that the increased bacterial load consisted of viable not dead bacteria, additional determination of the bacterial load was conducted by plate count at day one after skin wound infection. Lysates of infected skin wounds of KitW/Kit--v mice contained seven times more P. aeruginosa compared with WT mice. Reconstitution of KitW/KitW-v with MCs reduced the bacterial load to merely two-fold WT levels (Fig. 4.3 c). Furthermore, MC-deficient Mcl-1fl/fl mice exhibited a five-fold increase of P. aeruginosa in the skin wounds compared with Mcl-1+/+ mice, confirming this finding (Fig. 4.3 d). To rule out that non-P. aeruginosa-infected control mice were colonised by environmental bacteria upon wounding, we quantified the bacterial load of sham-infected mice. Indeed, skin lysates derived from sham-infected mice did not exhibit bacterial growth in either WT or in KitW/KitW-v mice. However, when mice were housed without an Elizabethan collar, MC-deficient mice were more susceptible to bacterial colonisation of the skin wound compared with WT mice. Whereas lysates of skin derived from WT mice did not contain bacteria, wounds derived from KitW/KitW-v mice exhibited a 15-fold higher bacterial load consisting of several bacterial strains (Figure 4.3 e). In an intradermal infection model with P. aeruginosa MC-deficient KitW/KitW-v mice have been described to exhibit an impaired bacterial clearance due to reduced neutrophil recruitment (98). To address whether reduced neutrophil recruitment in KitW/KitW-v was the underlying cause of the impaired bacterial clearance, we conducted ex vivo skin infection experiments. For this purpose four millimetre skin biopsies derived from KitW/KitW-v and WT mice were infected ex vivo with P. aeruginosa. This experimental set up allows for the study of the process occurring within the skin after infection, but without immune cell recruitment to the site of infection. Six hours after infection, the bacterial load of the supernatant of the skin explant was analysed for bacterial numbers. Skin explants derived from MC-deficient KitW/KitW-v showed a 12 times higher number of P. aeruginosa in the supernatant compared with equally treated WT skin explants (Fig. 4.3 f). This result was also reproducible for the gram-positive bacterium S. aureus (Fig. 4.3 g). Supportive evidence for our hypothesis that differences in the immune cell recruitment between the genotypes were not responsible for this MC-mediated antibacterial effect came from determination of neutrophils numbers per FACS analysis as well as myeloperoxidase (109) measurement as marker for neutrophil activity. FACS analysis for neutrophils numbers revealed

45 Results no differences in neutrophil numbers within skin wounds derived from MC-deficient KitW/KitW-v mice compared with WT neither at 12h nor a 24h post wound infection (Fig. 4.3 h). For MPO measurement two different approaches were applied: (i) in vivo live imaging approach or (ii) conventional MPO assay. Both methods revealed no differences in MPO activity between MC-deficient KitW/KitW-v mice and WT mice (Fig. 4.3 i-k) indicating that granulocyte recruitment or activation is not impaired in the absence of MCs. In summary we were able to show that bacterial clearance in this model of P. aeruginosa skin wound infection is dependent on MCs, as MC-deficient mice exhibit increased bacterial numbers compared to control mice. Moreover, local repopulation of MC-deficient mice with MCs normalised bacterial numbers to WT levels. Even though MCs have been reported to play a role

in neutrophils recruitment, we found no evidence that this MC-dependent antibacterial effect is

mediated by immune cell recruitment or dependent on immune cell activity.

+/+ W W-v +/+ W W-v +/+ W W-v

Kit KitKi/Kit t/Kit Kit Kit /Kit

a b

high 10

10

)

1

**

U

y

F

a

e

d

c

R

**

(

n

e 9

*

a

c 10

3

s

s

y

e

o

a

r

n

d

i

o

u

g

l

u

F 8

r

5

10

e

y

a

a

d low .

P 10n.7d. 1 3 5 Day(s) post wound infection

c d e f g

)

5 n.s. l ** 6 10 6 ** 3 * l 7 10 **

) ) 10 10

e

)

10 l

) ** * l

U

U w

e

U

/

F

F

F

w

U

/

C 4 5 C 5

C

(

F 10 ( 2 10

10 U

(

10 6

C

a

F

a

d ( 10

s

s

C

a

a

o

(

o

o 3 4

l 4 s

n

n

i

s 10 i 10 10

l

1 o

g

u g 10

a

n

i

i

u

e

u r 5

r

r

r

g

e 10

e

e u

t 2 3 u 3

r

c

a

a 10 10 a 10

0 e

a

.

. 10 .

a

B

P

P

S

0 . 101 102 P 104 102 + v + fl v v v / - -v / l/ /+ - /+ - /+ - + W s + f + W + W + W it t W 1 1 t t t t t t K i it C l- l- i i i i i i /K K M c c K W K K /K K /K W W / C t W W it t M M i it it i M K K K K K B

+

+/+ Kit

+/+ Kit+/+ h i j Kit k

W W-v W W-v ) Kit Kit Kit /Kit

2 n

h

i 40 10 0.8

6

k

s

l

l

s

)

e

9 n.s.

n.s. n.s.

g

) n.s. n.s.

c

0

1

s

h

l

. + 30

l

0.6

1

4

0

0

x

e

2

/

(

8

c

.

U

e (

4

n

i

c 1

y F 20

k 10 0.4

t

W W-v n

+

i

s Kit /Kit

a

v

b

i

i

t

1

d

%

c

(

1

a

a

10 h 0.2

D

R

6

O

C

P

0

M 0 h 10 0.0

4 v 12h 24h 12h 24h /+ - 2 + W it it K K W / it low high K Radiance

Figure 4.3. Mast cells control bacterial numbers in P. aeruginosa-infected skin wounds.

46 Results

Figure 4.3. Mast cells control bacterial numbers in P. aeruginosa-infected skin wounds. MC-deficient mice exhibit increased bacterial load compared to WT mice upon skin wound infection. (a, b) Bacterial load during skin wound infection of KitW/KitW-v and Kit+/+ mice measured by in vivo live imaging using fluorescent bacteria-binding substrate. (a) Representative images of WT and KitW/KitW-v mice after skin wound infection at the indicated time points and (b) analysis of relative fluorescent units (RFU). (c-d) Colony forming units (CFUs) of serially diluted skin homogenates normalised to 0.1 g skin derived from (c) KitW/KitW-v, WT and KitW/KitW-v + BMCMCs mice after skin wound infection (d) Mcl-1fl/fl and Mcl-1+/+ mice after skin wound infection (e) KitW/KitW-v and WT mice without skin wound infection. (f, g) Impaired bacterial clearance was not dependent on immune cell recruitment. CFUs of serially diluted supernatant of ex vivo cultured four millimetre skin biopsies from KitW/KitW-v compared to Kit+/+ mice 6 h after infection with (f) P. aeruginosa or (g) S. aureus. (h, i) Myeloperoxidase activity of skin homogenates measured by quantification of the emission emanating from a chemiluminescent MPO substrate applied onto the wounds of mice. (h) Determination of neutrophil numbers in infected skin wounds of KitW/KitW-v and WT mice by FACS analysis. (i) Representative images of WT and KitW/KitW-v mice after skin wound infection at the indicated time points and (j) analysis of emission. (k) MPO activity of skin biopsies measured ex vivo by oxidation of o-dianisidine dihydrochloride normalised to 0.1 g skin from KitW/KitW-v compared to Kit+/+ mice. Data are expressed as means ± SEM and are pooled from three independent experiments with a total of n = 5-10 mice. Statistical analysis was performed using Mann-Whitney test (a-d, f, j) for nonparametric data sets and Student’s t-test (e, g-h, k) for normally distributed data tested by Kolmogorov-Smirnov normality test. *p<0.05, ** p<0.01, n.s.=not significant.

4.4. P. aeruginosa reduction requires mast cell-keratinocyte interaction

As our results pointed to a localised MC-mediated antibacterial effect, we investigated the direct antibacterial effect of MCs in vitro. However, MCs infected with P. aeruginosa were not able to reduce bacterial numbers (Fig. 4.4 a). Therefore, we hypothesised that MCs stimulate other epidermal cells to elicit the antimicrobial activity. Keratinocytes (KCs) constitute the outer most layer of the skin and are the most abundant cell type of the epidermis. KCs exhibit various strategies to support and protect the body against invading pathogens, including the production of pro-inflammatory cytokines and antimicrobial peptides (AMPs) (165). We established a co-culture system of MCs and KCs (MC-KC) to investigate the collaborative antibacterial activity of these cell types. Upon infection with P. aeruginosa, an increase of 56 ± 10 % in the antibacterial effect within the co-culture of MCs and KCs was observed compared with single cultures. This antibacterial capacity was not detected in single cell cultures of either MCs or KCs alone, indicating that neither MCs nor KCs alone are able to reduce the bacterial load within the cell culture system (Fig. 4.4 a). When assessing the growth kinetic of P. aeruginosa growth in the presence of MCs, KCs, or both, we found that bacterial growth was significantly reduced when the infection took place in the presence of both MCs and KCs, but not in either single culture (Fig. 4.4 b), an observation that is in agreement with our previous finding (Fig. 4.4 b).

47 Results

We next sought to unveil the mechanisms behind the antibacterial effects of MC-KC interactions. We titrated different cell counts of MCs and KCs within the co-culture infection experiment and analysed bacterial reduction in the supernatant. We found that the antibacterial capacity of the co-culture increased with raising numbers of KCs. A KC to MC ration of 30:70 only slightly increased the antibacterial capacity, a 50:50 ratio of both cell types increased the bacterial reduction by 48 ± 8 %, and raising the KC-MC ratio to 70:30 increased bacterial reduction by 74 ± 6 % as compared to KC single culture (Fig. 4.4 c). We next determined whether the collaborative antibacterial activity of MCs and KCs required direct cell contact or was mediated by a soluble factor. We used transwell inserts to separate MCs and KCs and found that the transwell inserts did not hinder the bacterial reduction. We concluded that direct cell-cell contact between the two cell types was not essential for the observed antibacterial effect (Fig. 4.4 d). This implicated that the crosstalk between MCs and KCs was mediated by a soluble mediator. Next, we wanted to know which of the two cell types, MCs or KCs, need to be in direct contact with P. aeruginosa to achieve their joint antibacterial effect. Therefore, either MCs or KCs alone were infected with P. aeruginosa within the co-culture using insets with 0.4 µm pore size. While the infection of only MCs within the co-culture merely reduced the bacterial load by 27 ± 5 % the infection of only KCs triggered a fulminant bacterial reduction of 67 % ± 5 (Fig. 4.4 e). These results show that KCs activation by P. aeruginosa is a requirement for the antibacterial properties of the MC-KC co-culture. Furthermore, KCs need to be in direct contact with P. aeruginosa for MCs to be able to induce KCs to acquire antibacterial effects. Upon skin infection or inflammation, AMP expression in KCs is up-regulated providing a soluble antimicrobial barrier (166). Therefore, a likely strategy of KCs to reduce bacterial numbers is the secretion of AMPs. Most AMPs are highly dependent on their positive surface charge to bind to negatively charged LPS, a component of the bacterial cell wall. This in turn leads to destabilisation of the bacterial cell wall and thus elimination of the bacteria (114). In fact, the activity of antimicrobial peptides is affected by the presence of cations that bind the negatively charged LPS of gram-negative bacteria (167, 168). In our co-culture experiments we found that increasing the calcium concentration indeed inhibited the antibacterial effects of P. aeruginosa-infected MC-KC co-cultures. Depriving the co-culture system of calcium ions again, using the calcium chelator EDTA, restored the antibacterial capacity of the co-culture system (Fig. 4.4 f). The chelator EDTA alone however did not significantly influence the bacterial reduction within the co-culture. These findings support the notion that AMPs are involved in the antibacterial effects of interacting MCs and KCs. We hypothesised that if AMPs were induced by P. aeruginosa infection within the co-culture, transfer of the supernatant would be able to reduce the number of P. aeruginosa. Therefore, we performed supernatant transfer experiments. Cell culture supernatant of previously infected or sham-infected co-cultures was sterilised and transferred onto P. aeruginosa. As expected, the supernatant of formerly infected MC-KC co-cultures reduced P. aeruginosa numbers by up to 60 ± 3 % as compared with only 15 ± 8 % reduction by supernatants of sham-infected MC-KC co-cultures (Fig. 4.4 f). We analysed the mRNA expression of three AMPs, which have been previously shown to be

48 Results effective against P. aeruginosa, namely mBD-14 (169, 170), CRAMP (166) and Psoriasin (171). Upon infection of the co-culture, KCs increased the expression of the mBD-14 gene (Defb14) four-fold as well as CRAMP (Camp) two-fold. The expression level of Psoriasin (S100A7) however remained unchanged (Fig. 4.4 g). There was no significant increase in AMP expression induced by MC-KC co-culture without infection (data not shown). As expected no induction of AMP expression in MCs was detected (data not shown).

a b c

)

0

)

)

0

6

%

%

(

(

D

100 0.05 vehicle 100

n n *** ** O MCs

o

o

i

i n.s. D

t KCs ***

t

** (

c 80 80 0.04 MCs + KCs c n.s.

h

u

u

t

d d n.s.

w

e

e

o

r 60 0.03 r 60

r **

a

a g *

s

s

a

o 40 o 40 s 0.02

n

n

i

i

o

g

g

n

i

u

u

g

r 20 0.01 r 20

u

e

e

r

a

a

e

.

.

0 a 0

0.00

P

P s s s . 1 2 3 4 5 6 7 8 s s ) ) ) C C C C C 0 0 0 P :3 :5 :7 M K K M K 0 0 0 + Time (h) (7 (5 (3 s C s s s M C C C K K K + + + s s s C C C M M M d e f g

)

)

)

)

%

%

% % **

(

(

(

(

100

100 100 100

n

n

n n ***

o

o

o

o

n.s. i

i

i i n.s.

t

t

t t * 80 *

c

80 c 80

c c 80

u

u

u u **

d

d

d

d

e

e

e

e

r 60

r

r 60 r 60 60

a

a

a

a

s

s

s

s

o

o

o 40 o 40 40 40

n

n

n

n

i

i

i

i

g

g

g

g

u

u

u

u

r

r

r 20 r 20 20 20

e

e

e

e

a

a

a

a

.

.

. 0 . 0 0 0

P

P

P l P ly y re l n d l d s s l 2 l 2 A e e u e o e n e C C C C T r r lt w t o t K K a a D tu tu u s s c c + l l d c n fe s fe C C E u le u e - a C n C n s + -c c -c ct o tr M i K i C i o c A co h c fe M T ve in D E MCs + KCs transwell sterile supernatant

h i j

)

)

d +/+ W W-v

l

d 8 600 l 1.5 Kit Kit Kit o 3

f * o

f - * *

-

)

n

)

l

n

l

(

(

m

m

n 6 / * ** **

/

n

o

g

i

g

o

400 2 i 1.0

p

s

n

s

(

(

s

s

e

4

e

P r 4 n.s.

r * 1

p

-

M

p

x

x

D

A e 200

0.5 1 e

B

R

A 2

C A

m

N

N

R

n.d. R

m

0 0 m 0 0.0 Defb14 Camp S100A7 le d le d c te c te 4 7 p i c i c 1 A m h e h e fb 0 a coculture e f e f e 0 + + + v in v in 1 C vehicle D S coculture infected + + + co-culture co-culture

Figure 4.4. P. aeruginosa reduction requires mast cell-keratinocyte interaction.

49 Results

Figure 4.4. P. aeruginosa reduction requires mast cell-keratinocyte interaction. P. aeruginosa numbers are reduced in a co-culture system of MCs and KCs compared with single cultures. (a) P. aeruginosa reduction in MCs or KCs culture alone or MC-KC co-culture were analysed by plate count. (b) P. aeruginosa growth in MCs or KCs cultures or MC-KC co-culture were measured by OD600. (c) P. aeruginosa reduction in MC-KC co-cultures with different cell ratios. (d-e) P. aeruginosa reduction in MC-KC co-cultures (d) separated by transwell insert or (e) separated by transwell insert where either KCs or MCs only were infected. (f) P. aeruginosa reduction in MC-KC co-cultures stimulated with Calcium (Ca2+), EDTA or both. (g) P. aeruginosa reduction after incubation with supernatant derived from MC-KC co-cultures with prior infection or sham infection. (h) mRNA of AMPs expression in KCs during MC-KC co-culture with prior infection or sham infection. (i) AMP protein levels in MC-KC co-cultures with prior infection or sham infection measured by ELISA. (j) AMP expression in skin samples derived from KitW/KitW-v and Kit+/+ mice 24 h post skin wound infection with P. aeruginosa. Data are expressed as means ± SEM and pooled from at least two independent experiments with a total of n=4-10 mice. Statistical analysis was performed by one-way ANOVA followed by Tukey’s post hoc test (a, c, f). Single comparisons were analysed using Mann-Whitney test (b, d, e, g-i) for nonparametric and Student’s t-test (j) for parametric data sets. *p<0.05, ** p<0.01 and *** p<0.001, n.s.=not significant.

To confirm that these AMPs are in fact also secreted, we measured protein levels of mBD-14 and CRAMP. Analysis of the supernatant of previously infected MC-KCs co-cultures by ELISA allowed for the detection of both mBD-14 and CRAMP protein. While mBD-14 showed a moderate increase in protein levels of 385 ± 118 pg/ml, a significant CRAMP release of 2140 ± 348 pg/ml was observed (Fig. 4.4 h). Taken together, the increased expression and release of AMPs by KCs in response to P. aeruginosa infection offers a plausible explanation for the antibacterial effect of the MC-KC co-culture. To test this hypothesis in vivo, we turned to our skin wound infection mouse model and analysed AMP expression after skin wound infection. Upon P. aeruginosa skin wound infection, MC-deficient KitW/KitW-v mice showed markedly lower levels of mBD-14, CRAMP and Psoriasin in comparison with WT animals (Fig. 4.4 j) at day one after skin wound infection. AMP mRNA levels in sham-infected skin were similar in both genotypes (data not shown). Taken together our findings show an antibacterial capacity of the MC-KC co-culture systems that is likely to be dependent on the expression and secretion of AMPs by KCs. Additionally, we identified the direct contact of KCs with P. aeruginosa to be a prerequisite of this anti-bacterial property. We propose that following KC activation by P. aeruginosa, a MC-KC crosstalk takes place, which provides KCs with an additional soluble signal that stimulates the antibacterial response.

50 Results

4.5. Mast cell-derived IL-6 induces antimicrobial defence in keratinocytes upon P. aeruginosa infection

The antibacterial effect of KCs upon infection with P. aeruginosa did only become apparent when they were co-cultured with MCs. This effect was, however shown not to require direct cell-cell contact between these two cell types. We therefore aimed to address the question how MCs induce KCs to carry out their antibacterial effects. For this purpose, we screened P. aeruginosa-infected MC-KC co-cultures for supernatant cytokine levels by a multiplex ELISA assay. We observed a four-fold increase in IL-6 protein level in MC-KC co-cultures as compared with either infected single cultures. Protein levels of other inflammatory cytokines derived from infected co-cultures were comparable to those in single cultures of MCs and KCs (Fig. 4.5 a). The observed increase in IL-6 release from the co-culture upon infection was confirmed with conventional ELISA. Following infection with P. aeruginosa MC-KC co-cultures secreted 24 ng of IL-6 when infected as compared with only three ng after sham infection. KCs alone did not secrete considerable amounts of IL-6, neither after infection nor after sham infection. There was however a trend towards increased IL-6 secretion (5 ng) in MC single cultures upon infection with P. aeruginosa (Fig. 4.5 b). To identify the source of IL-6 secretion, we performed expression analysis of IL-6 mRNA transcripts from MCs and KCs derived from infected co-cultures. IL-6 mRNA levels were 36-fold higher in MCs as compared with KCs (Fig. 4.5 c). Taken together, these experiments demonstrate that IL-6 production and release is only increased when MC-KC co-cultures are infected, not in MCs or KCs cultures alone. Furthermore, we found supportive evidence that the IL-6 found in the co-culture supernatant is produced and released by MCs and not KCs. To prove this further, we cultured MCs derived from bone marrow of IL-6-deficient mice and measured. IL-6 release in Il6-/- MC-KC co-cultures upon infection with P. aeruginosa. Co-cultures of Il6-/- MCs and KCs did not show significantly increased IL-6 release as compared to WT control co-cultures (Fig. 4.5 d). To investige the importance of MC-derived IL-6 for the collaborative antimicrobial effect of MC-KC co-cultures, co-cultures of ll6-/- MCs and KCs were subjected to P. aeruginosa reduction assays. Strikingly, co-cultures of Il6-/- MCs with KCs resulted in no considerable reduction of P. aeruginosa numbers as compared with WT co-cultures (Fig. 4.5 e). Next, we analysed the AMP mRNA expression levels of KCs in MC-KC co-cultures containing Il6-/- MCs and found no up-regulation of AMP expression in KCs upon infection with P. aeruginosa compared with co-cultures containing WT MCs (Fig. 4.5 f). Taken together, our findings show that infection of MC-KC co-cultures with P. aeruginosa induced MC IL-6 expression that is crucial for AMP mRNA induction in KCs as well as bacterial clearance.

4.6. IL-6 production in mast cells is dependent on stimulation by IL-1 family members

Upon infection with P. aeruginosa, MCs in MC-KC co-cultures secrete high amounts of IL-6.

51 Results

a b c MCs KCs MCs + KCs *** 3 * 0.03 40 n 10 *** o

i

*** s 2

s 10

*** e

)

r l 30 1

p

0.02 m 10

x

/

e

g

D

n 0

A

O ( 20 n.s. 10

N

6

- n.s.

R -1 0.01 L 10

I

m

10

6 -2

- 10

L

I 0.00 0 10-3 s s s s s s s 2 4 5 6 0 2 7 3 g a b C C C C C C C s L L L L 1 1 1 2 F F F C I I I I L L L L K M K K M K M K I I I I IN N G + + T T s s C C M M co-culture sham infected infected

d e f

)

)

d

n.s. l

50 %

( 8 ** o

100 f *

- n *** ***

n

o

i 40 (

)

t

l 80

c n 6

u

m

o

/

i

d

g 30 s

e

s

n

r 60

(

e *

a r 4

6

s

p - 20

o

x

L 40

I *

n

e

i

g 10 A 2

u

r 20 N

e

R

a

m

0 . - / 0 0 s - P Defb14 Camp S100A7 C 6 s s s M Il C C C K K K coculture s C + - + WT MCs + + + s -/ M C l6 coculture M I -/- + + + s Il6 MCs C co-culture M

Figure 4.5. Mast cell-derived IL-6 induces antimicrobial defence in KCs upon P. aeruginosa infection. Increased IL-6 levels were detected in a co-culture system of MCs and KCs upon P. aeruginosa infection. (a) Protein levels of several cytokines measured in supernatants of single or co-cultures from MCs and KCs upon P. aeruginosa infection detected by Multiplex-ELISA. (b) IL-6 protein levels from supernatants of KCs or MCs alone or MC-KC co-cultures with prior P. aeruginosa or sham infection. (c) Higher IL-6 mRNA expression was detected in MCs compared to KCs after P. aeruginosa infection. (d) IL-6 protein levels from supernatants of MC-KC co-cultures with WT MCs (KCs + MCs) or Il-6-deficient MCs (KCs + Il6-/- MCs). (e) P. aeruginosa reduction was reduced in Il-6-/- MC-KCs compared to P. aeruginosa. (f) Reduced mRNA levels of AMPs expressed in KCs during co-culture with Il6-/- compared to MCs from WT mice after P. aeruginosa infection. Statistical analysis was performed by one-way ANOVA with Turkey’s post hoc test for multiple comparison (b, e) and Mann-Whitney test (c, d, f) for single comparisons. *p<0.05, ** p<0.01 and *** p<0.001, n.s.=not significant.

52 Results

P. aeruginosa-derived components like LPS and members of the IL-1 cytokine family released by KCs, have been described to induce IL-6 production in MCs (172) (173). To gain an understanding whether these signalling pathways are relevant in our setting, we utilised MCs derived from Myd88-/- mice. MYD88 is an adapter protein in innate immunity signal transduction, which integrates signals from IL-1 receptor family receptors and Toll-lie receptors (TLRs) and induces the production of inflammatory cytokines including IL-6 stimulating (174). Since we found that direct cell-cell contact between MC and KC was not required for bacterial killing, we hypothesized that IL-6 secretion would also not be affected by absence or presence of cell-cell contact. To this end, we transferred supernatant from previously infected KCs or control media onto MCs. When MCs were stimulated with supernatant derived from infected KCs, an increase in IL-6 production (17 ng) was detectable in WT MCs, but not in Myd88-/- MCs (2 ng; Fig. 4.6 a), suggesting that KCs induce IL-6 production and secretion in MCs by a soluble mediator that requires MYD88 for signalling. In line with this finding the antibacterial effect of the co-culture was abolished upon application of Myd88-/- MCs (Fig. 4.6 b). To further investigate whether LPS or cytokines of the IL-1 family are responsible for the IL-6 induction in MCs we applied the TLR4 inhibitor Cli-095. Inhibition of the intracellular signalling cascade by Cli-095 did not significantly reduce the IL-6 production in MCs (Fig. 4.6 c). This finding implicates that LPS-mediated TLR4 signalling is not required for the induction of an IL-6 response by MCs. We, therefore, analysed the secretion profile of pro-inflammatory IL-1 family memebers in KCs. Upon infection with P. aeruginosa, KCs secreted IL-1α, IL-1β, IL-33 and IL-36 (Fig. 4.6 d-g), with IL-33 showing the most pronounced up-regulation. Next, we investigated if the stimulation of MCs with these IL-1 family members would lead to IL-6 secretion from MCs. Indeed, all IL-1 family members released by infected KCs induced IL-6 production in MCs (Fig. 4.6 h). Amongst these cytokines, IL-33 induced the strongest increase in IL-6 levels, leading to a release of up to 177 ng IL-6 MCs. Since IL-33 is known to be a major MyD88-dependent inducer of IL-6 in MCs (81, 175), we analysed if MC-derived IL-6 production was mediated by IL-33. For this purpose we co-cultured MCs deficient for the IL-33 receptor T1/ST2 (Il1rl1-/-) with KCs. Surprisingly, we found that following infection with P. aeruginosa WT MCs showed a similar increases in the release of IL-6 (16 ng) as Il1rl1-/- MCs (15 ng; Fig. 4.6 i). Moreover, this finding was reflected by unaffected bacterial reduction in the co-culture of Il1rl1-/- MCs and KCs (Fig. 4.6 j). This suggests that IL-33 from KCs and ST2 on MCs are not critically involved in the up-regulation of MC-derived IL-6 release in P. aeruginosa-infected MC-KC co-cultures. We next sought to identify the mechanisms underlying the P. aeruginosa-induced production and release of cytokines of the IL-1 family by KCs and analysed the stimulation of KCs by viable versus dead P. aeruginosa. Only living bacteria were able to induce IL-6 release from MCs downstream of KC activation (Fig. 4.6 k). This finding prompted us to as whether actively secreted mediators in the supernatant of viable P. aeruginosa can stimulate KCs to induce MC IL-6 production and release. We found that stimulation of KCs with P. aeruginosa-derived broth lead to an up to six-fold increase in IL-6 release from MCs in a concentration-dependent manner (Fig. 4.6 l). Taken together, we were able to show that a soluble mediator provided by infected

53 Results

KCs stimulates MCs to produce and secrete IL-6 in MC-KC co-cultures. Potential mediators were found to be dependent on MYD88-dependent signalling. Moreover, several members of the IL-1 family were secreted by infected KCs and induced IL-6 production in MCs. However, IL-33 and its receptor ST2 appeared to be dispensable for the induction of IL-6 production and release in MCs by KCs. We propose KCs activation by actively secreted mediator from P. aeruginosa inducing the release of cytokines form the IL-1 family as a possible mechanism for MC-derived IL-6 in MC-KC co-cultures upon infection.

a b c d e ) 140 40 % * ( *

25 100 25 ns *** n *

)

)

l

o

l

i

t 105 30

m

80 m 20 c 20

)

/

)

/

l

l

u

g

g

d

m

m

p

p

/

/

(

(

e

g

g 15 r 60 15 70 20

b

n

a

n

a

(

(

1

1

s

-

-

6

6

o

L

L

- - 10 40 10

I

I

n

L

L i 35 10

I

I

u

g

5 r 20 5

e

a 0 0

. s d s d 0 0 0 C te C e - P t s -/ s s le 5 K c K c C C C c 9 fe fe 8 i li n n M 8 K K h C i i D + - + e s s y s -/ v C C M C 8 K K s M 8 C D M y M s KC supernatant C KC supernatant M

f g h i j

)

%

600 20 150 ( ** ** 25 n.s. 100 n.s. 100 n

o

i

t

)

)

)

l l 80 20 c

l 50 ) 450 15 l

u

m m

m

/ / 10

m

d

/

/

g

g

e

g

g

15 r 60

p p

n 8

( n

(

(

(

a

300 10

3 6 s

6

6

o

3 3 - 6 - 10 40

- -

n

L

L

i

I

L L

I

I I 150 5 4 g

u

5 r 20

2 e

a

0 0 0 0 . 0 - P s d s d a b 3 6 s -/ s s C te C te 1 1 -3 3 C C C K c K c - - - l1 K K e e L L IL L M r f f I I I l1 + - + n n I -/ i i s s s s C l1 C C C M r K M l1 K I s C KC supernatant M k l 30 30 *

) * l *

)

l

m

/ 20

m 20

/

g

g

n

n

(

(

6

6

-

-

L

I L 10 10 I

0 0 e d e d 1 0 0 v a l e I 1 0 li ic t I 1 e h c O I d e e M O v f M O in M KC supernatant KC supernatant

Figure 4.6. IL-6 production in MCs is dependent on MYD88 signalling.

54 Results

(a) Reduced IL-6 protein levels measured in cell culture supernatants from MyD88-/- MCs stimulated with supernatant derived from P. aeruginosa-infected KCs with in comparison with WT MCs. (b) Reduced P. aeruginosa reduction in MyD88-/- MC-KCs co-cultures infected with P. aeruginosa in comparison with WT MC-KC co-cultures. (c) Comparable IL-6 protein levels measured in cell culture supernatants from MCs stimulated with supernatant derived from P. aeruginosa-infected KCs with Cli-095 inhibitor and vehicle treatment. (d-g) Protein levels measured in cell culture supernatants from KCs with prior P. aeruginosa or sham infection detected by ELISA (d) IL-1α, (e) IL-1β, (f) IL-33, and (g) IL-36. (h) IL-6 protein levels measured in cell culture supernatants from MCs stimulated with the indicated recombinant cytokine (10ng/ml) for three hours. (i) Comparable IL-6 protein levels measured in the cell culture supernatants from Il1rl1-/- MCs and WT MCs stimulated with supernatant derived from P. aeruginosa-infected KCs. (j) Comparable P. aeruginosa reduction of MC-KCs co-cultures infected with P. aeruginosa in comparison with Il1rl1-/- MC-KC co-culture. (k-l) IL-6 protein levels measured in cell culture supernatants from MCs stimulated with supernatant derived from KCs (k) infected with viable or dead P. aeruginosa or (l) P. aeruginosa- derived broth in different concentrations in MOI. Data are expressed as means ± SEM and pooled from at least three independent experiments. Statistical analysis was performed by one-way ANOVA with Turkey’s test for multiple comparisons (l) and Mann-Whitney test for nonparametric (b-i, k) and for Student’s t-test for parametric single comparisons (a, j ). *p<0.05, ** p<0.01 and *** p<0.001, n.s.=not significant.

4.7. Mast cell-derived IL-6 protects from skin wound infections with P. aeruginosa

As we had demonstrated that the antimicrobial capacity of KCs was strongly dependent on MC- derived IL-6 stimulation in vitro, we hypothesised that the antimicrobial effects of MCs observed in skin wound infections are also be mediated by IL-6. Therefore, we analysed skin wounds in MC-deficient KitW/KitW-v and WT mice for their content of IL-6 upon P. aeruginosa infection. We found that MC-deficient KitW/KitW-v mice exhibit three times lower IL-6 levels compared with WT mice. Adoptive transfer of WT MCs restored IL-6 levels in P. aeruginosa-infected skin wounds of KitW/KitW-v mice (104 ± 24 ng) to WT levels (118 ± 11 ng). Reconstitution of the skin with Il6-/- MCs resulted in four-fold lower levels of IL-6 within the P. aeruginosa-infected skin wounds of KitW/KitW-v mice (Fig. 4.7 b) compared with WT mice. This observation led us to conclude that MC-derived IL-6 is a crucial contributor to cutaneous IL-6 levels during skin wound infections with P. aeruginosa. Next, we investigated the role of MC-derived IL-6 in skin wound closure upon P. aeruginosa infection. To this end, we performed reconstitution of MC-deficient KitW/KitW-v mice with Il6-deficient and Il6-competent MCs and subjected the mice to bacterial skin wound infection. Adoptive transfer of WT MCs resulted in wound closure times similar to those observed in WT mice. In contrast, MC-deficient KitW/KitW-v mice repopulated with Il6-/- MCs exhibited larger wounds compared with WT mice, as early as day one and throughout the observation period (28 ± 6 %). Reconstitution with Il6-/- MCs did not lead to an improvement in wound healing

55 Results compared with non-reconstituted MC-deficient mice at any time point during wound healing (Fig. 4.7 a). We then analysed the bacterial load in P. aeruginosa-infected wounds of MC- deficient mice as well as MC-deficient mice that had received IL-6-deficient or WT MCs. Compared with MC-deficient KitW/KitW-v mice, WT MC-reconstituted KitW/KitW-v mice, exhibited reduced bacterial numbers that was only 2.2-fold relative to WT mice (Fig. 4.7 c). In contrast, adoptive transfer of MCs lacking IL-6 resulted in a 14-fold higher bacterial burden within the skin wounds on day one compared with WT mice (Fig. 4.7 c). This increased bacterial load of KitW/KitW-v + Il6-/- BMCMCs was comparable to that in MC-deficient KitW/KitW-v mice. Taken together, these findings demonstrate that MC-derived IL-6 production contributes to increased IL-6 levels upon skin wound infection with P. aeruginosa, and that reduced IL-6 levels correlate with impaired wound closure as well as increased bacterial load.

W W-v -/- ** a b Kit /Kit +Il6 BMCMCs c n.s. ** KitW/KitW-v +WT BMCMCs n.s. W W-v n.s.

) Kit /Kit +/+ 6 e 10 250 ** 200 Kit )

n

i

U

l ) ** * ** ** *

e

F n ***

i

s

k 200 C 5

a

(

s 150 10

b

*** a

g

s

1

%

. 150

o

(

0 ** 4

n

/

100 i 10

e

g

g

z

i

n *

100 u

s

(

r

*

e

d 6 3

-

50 a n 10

L

.

50 u

I

o

P

0 W 0 102 + /- + v / -v - 0 1 2 3 4 5 / - /- + T + W T - it W l6 it t 6 K it W I i W Il K Day(s) post wound infection K /K W / W it it K K KitW/W-v + BMCMCs KitW/W-v + BMCMCs

Figure 4.7. Mast cell-derived IL-6 is crucial for optimal antimicrobial skin defence during P. aeruginosa infection. (a) Delayed wound closure of infected skin wounds of KitW/KitW-v mice could no be restored to WT levels by local transfer of Il-6-deficient mice (KitW/KitW-v + Il6-/- BMCMCs) compared with BMCMCs from WT (KitW/KitW-v + BMCMCs). (b) IL-6 protein levels in skin lysates derived from skin wounds of KitW/KitW-v mice, Kit+/+ mice, KitW/KitW-v + BMCMCs and KitW/KitW-v + Il6-/- BMCMCs after P. aeruginosa infection. (c) CFUs from skin wounds of KitW/KitW-v mice were not restored to WT levels by local transfer of IL-6 deficient mice (KitW/KitW-v + Il6-/- BMCMCs) compared with WT BMCMCs (KitW/KitW-v + BMCMCs). Data are expressed as means ± SEM and pooled from at least three independent experiments. Statistical analysis was performed one-way ANOVA with Turkey’s post hoc test for multiple comparison (a, c) and two-way repeated measure Anova for wound closure analysis (b). *p<0.05, ** p<0.01 and *** p<0.001, n.s.=not significant.

56 Results

4.8. Topical treatment with recombinant IL-6 enhances defence against P. aeruginosa skin wound infection

We next tested whether the topical application of recombinant IL-6 (recIL-6) can substitute for MC-deficiency in the promotion of antibacterial responses to wound infection with P. aeruginosa. Pre-treatment of KCs with recIL-6 induced a significant bacterial reduction in vitro compared with vehicle treatment in a concentration-dependent manner (Fig. 4.8 a). While the bacterial reduction exerted by KCs alone was negligible when 5 ng recIL-6 were applied (22 ± 11 %), pre-treatment of KCs with 10 ng recIL-6 reduced bacterial numbers markedly (76 ± 4 %). Using 50 ng / ml recIL-6 for KCs pre-treatment lead to an almost complete clearance of P. aeruginosa (87 ± 6 %). KCs showed a strong induction of AMPs upon recIL-6 stimulation compared with vehicle-treated KCs (Fig. 4.8 b). Upon recIL-6 pre-treatment, mRNA levels of Defb14 as well as CRAMP mRNA were induced by 15-fold and 27-fold, respectively. In contrast, S100A7 expression remained unchanged by recIL-6 treatment. To translate these findings to our in vivo skin wound infection model, we pre-treated skin wounds of MC-deficient and WT mice with 200 ng recIL-6 or vehicle one hour before infection with P. aeruginosa. Pre-treatment with IL-6 improved wound closure of infected skin wounds in MC-deficient KitW/KitW-v mice and normalised wound healing to WT levels over the whole measurement period compared to vehicle-treated KitW/KitW-v mice (4.4 ± 22 %) (Fig. 4.8 c). Vehicle pre-treatment of MC-deficient mice did not improve wound closure of infected skin wounds compared to WT mice and was significantly slower (26 ± 25 %). IL-6 pre-treatment of WT mice did not alter the closure of infected skin wounds. Pre-treatment of MC-deficient mice with recIL-6 also significantly reduced the bacterial load of skin wounds as compared with vehicle-treated littermates (Fig. 4.8 d). RecIL-6 pre-treatment normalised the bacterial load of skin wounds in KitW/KitW-v mice to 1.4 fold those of WT mice. Interestingly, recIL-6 treatment also reduced the bacterial load of skin wounds of MC-competent WT mice four-fold compared with vehicle-treated WT mice. Together, these findings show that recIL-6 can induce antibacterial effects of KCs as measured by P. aeruginosa reduction and AMP induction. Moreover, recIL-6 pre-treatment of skin wounds normalised the wound closure kinetics of MC-deficient KitW/KitW-v mice and increased the P. aeruginosa clearance within the skin wounds of KitW/KitW-v as well as WT mice upon skin wound infection.

4.9. Recombinant IL-6 treatment stimulates the antibacterial response of human keratinocytes

Since pre-treatment with recIL-6 significantly improved wound healing of MC-deficient mice as well as bacterial reduction within skin wounds of both MC-deficient and competent mice, we wanted to translate these findings into the human system. Therefore, we conducted in vitro infection experiments using human KCs with recIL-6 or vehicle pre-treatment for 1 h. Using the

57 Results

a b

)

)

% **

d

(

l

100 25

* o

n

f

-

o

i

n

t

80 ( c 20

u

n

d

o

i

e

s

r 60 15

s

a

e

r

s

p o 40 10

x

n

i

e

g

A

u

r 20 5

N

e

R

a

. 0 m 0 P s C 5 10 50 Defb14 Cramp S100A7 K rec IL-6 (ng/ml) recIL-6 - + - + - +

c KitW/KitW-v recIL-6 d KitW/KitW-v vehicle Kit+/+ recIL-6 ) Kit+/+ vehicle 6 e 150 10 n.s.

)

n

i

l U ** *

e

F s 5

C a ***

( 10

b

100 a

s

%

(

o

** 4

n 10

e * i

z

g

i

u

s

50 r

d e 3

n 10

a

.

u

P

o

W 0 102 0 1 2 3 4 5 le -6 le -6 ic L ic L h I h I e c e c v re v re Day(s) post wound infection + /+ -v -v / + + t W W it i it it K K K K W / W / it it K K

Figure 4.8. IL-6 treatment enhances skin antimicrobial capacity for optimal antimicrobial skin defence during P. aeruginosa infection. (a) P. aeruginosa reduction was induced by one hour pre-treatment of KCs with indicated concentrations of rec-IL6 compared with vehicle treatment. (b) Increased mRNA levels of AMPs expressed in KCs after three hours stimulation with 10 ng/ml rec- IL6 compared with vehicle treatment. (c) Wound closure kinetics of infected skin wounds derived from KitW/KitW-v mice and Kit+/+ mice with recIL-6 or vehicle pre-treatment. (d) Reduced CFUs of lysates from skin wounds derived from KitW/KitW-v mice and Kit+/+ mice treated with recIL-6 pre-treatment compared with vehicle treatment. Data are expressed as means ± SEM and pooled from at least three independent experiments. Statistical analysis was performed by one-way ANOVA with Dunns for nonparametric multiple comparison (a), two-way repeated measure ANOVA for wound closure analysis (c) and Mann-Whitney test for nonparametric single comparison (d). *p<0.05, ** p<0.01 and *** p<0.001, n.s.=not significant.

58 Results human KC cell line HaCaT we observed a 13-fold increase in bacterial reduction bacterial of P. aeruginosa after recIL-6 pre-treatment with compared to vehicle-treated controls (Fig. 9 a). Furthermore, human primary KCs in response to recIL-6 pre-treatment showed markedly increased bacterial reduction (Fig. 9 b). Next, we investigated whether IL-6 pre-treatment also improves host-defence responses in human skin ex vivo. For this purpose we pre-treated four millimetre human skin biopsies with recIL-6 or vehicle for 1 h prior to P. aeruginosa infection. We observed significantly increased bacterial reduction in recIL-6-treated human skin biopsies as compared with vehicle-treated controls (Fig. 9 a). Taken together, this data demonstrates that recIL-6 pre-treatment can induce antibacterial effects of human KCs as well as human skin.

a b c

)

) ) * *

%

% % 100 ( 100

(

( 100

n

n

n

o

o

o

i

i

i

t

t t 80 80 80

c

c

c

u

u

u

d

d

d

e

e e 60 60 60

r

r

r

a

a

a

s

s s 40 40 40

n

n

n

i

i

i

g

g

g

u

u

u

r

r 20 20 r 20

e

e

e

a

a

a

.

.

.

P

P 0 P 0 0 t T 6 s 6 n 6 a L C IL a IL C I K - l c a c- c p e e u e x r H r h r e t y C n n T r i la a a K k p C u s x a im h u e H r h p ry in a k m s ri u p h

Figure 4.9 Recombinant IL-6 treatment enhances human skin antimicrobial capacity during P. aeruginosa infection. (a) Increased P. aeruginosa reduction after one hour pre-treatment and three hours infection of (a) human KC cell line HaCaT and (b) human primary KCs with 10ng/ml recIL-6 compared to vehicle treatment. (c) Increased P. aeruginosa reduction after one h pre-treatment and 6h infection of ex vivo cultured four mm human skin slices with recIL-6 compared to vehicle treatment. Data are expressed as means ± SEM and pooled from at least two independent experiments. Statistical analysis was performed by Mann-Whitney test for nonparametric data set (a) and paired Student’s t-test (b). *p<0.05.

59

Discussion

5.Discussion

The results of these studies show, for the first time, that MCs are required for normal healing of infected skin wounds in a mouse model that closely mimics the clinical situation of skin wound infection. We established a murine skin wound infection model in which P. aeruginosa was delivered topically onto skin wounds resembling smear infection, rather than intradermally injected. We analysed the impact of MCs on wound closure as well as bacterial load of P. aeruginosa-infected skin wounds. Using MC-deficient mice we observed significantly delayed wound closure upon skin wound infection compared to WT mice. The impaired wound closure was only seen in infected but not in sham-infected mice. Infected MC-deficient mice had increased bacterial numbers within the skin wound as compared to WT mice. Interestingly, we found that MCs were not themselves bactericidal but instead boosted the antimicrobial activity of KCs by secreting IL-6. This antibacterial function correlated with the expression and release of AMPs by KCs. Investigating an innovative treatment approach, we could show that topical application of recombinant IL-6 (recIL-6) improved both healing of infected skin wounds in MC-deficient mice as well as normalised the bacterial load to WT levels. We hence propose that MC-derived IL-6 is crucial for normal healing of infected skin wounds in mice. In the following section, the findings of this thesis will be discussed in detail.

5.1. Mast cells are required for closure of infected skin wounds

MCs have been described to protect from bacterial infections in various settings (176), however their role in skin wound infections has remained unclear. To address the role MCs in the outcome of P. aeruginosa skin wound infection, mice were wounded using a biopsy punch and wounds were infected by topical P. aeruginosa application. In this clinically relevant model, which closely mimics the superinfection with P. aeruginosa of skin wounds in humans, we compared wound closure in the absence and presence of skin MCs. We could show that MCs were required for normal healing of infected skin wounds but were dispensable for closure of sham-infected skin wounds in our mouse model. Upon wound infection with P. aeruginosa, MC- deficient KitW/KitW-v mice showed markedly delayed wound closure compared to WT mice that was normalised upon adoptive transfer of MCs into KitW/KitW-v mice and confirmed in the c-Kit-independent Cpa-Cre;Mcl-1fl/fl mouse model. Whereas the role of MCs in skin wound infection has so far not been characterised, the role of

61 Discussion

MCs in skin wound healing has been investigated in multiple independent studies. Our finding that MCs are not involved in the closure of non-infected wounds is in accordance with several previous studies (150-152). In a model of splinted excisional wounds, MC-deficient Cpa-Cre;Mcl-1fl/fl mice did not show substantial alterations in wound healing (150). Along the same lines, full-thickness excisional wounds in MC-deficient CreMaster mice also did not exhibit major defects in wound closure (151, 152). On the other hand, MCs have been reported to be involved in several stages of wound healing (132, 142-144). Weller et al. found delayed wound closure in MC-deficient KitW/KitW-v mice (132). Another study supporting a role for MCs in wound healing described MC-dependent changes in the proliferation phase in detail and found reduced formation of granulation tissue and angiogenesis (142). Using microdeformational wound therapy (MWT) were a wound cover consisting of a highly porous interface is connected to suction creating negative pressure reduced granulation tissue formation, skin cell proliferation, vascularisation, and collagen maturation was described in KitW/KitW-v mice as compared to controls (143). In the same wound therapy model, mMCP-4-/-, mMCP-5-/-, and mMCP-6-/- mice were shown to have disrupted granulation tissue as well as reduced fibrous proliferation (144). In a model of scald injury, the process of wound closure and re-epithelialisation was not markedly different between KitW/KitW-v mice compared to controls. However, the degree of proliferation within the wounded area and blood vessel sprouting at the wound edges were markedly impaired in KitW/KitW-v mice compared to WT mice (142). Taken together, while the abovementioned studies found MCs to promote the healing of non-infected wounds, other reports including the data from our study do not confirm these observations. Three major reasons for the observed differences can be conceived and are discussed below. First, the different outcomes of studies on the role of MCs in wound healing may be due to the use of different models of MC-deficiency in these studies. Using similar wounding approaches, i.e. full-thickness excisional punch biopsy wounds on the back of mice, MC functions in wound healing detected in c-Kit-dependent mouse models of MC-deficiency (132) could not be confirmed in non c-Kit-dependent mouse models (150-152). Importantly, c-Kit-dependent MC-deficient KitW/KitW-v mice display phenotypic alterations that affect other cells than MCs including hematopoietic cells such as erythrocytes and neutrophils, subpopulations of γδ T cells, namely dendritic epidermal T cells (DETCs) (177), innate lymphoid cells, germ cells, melanocytes and intestinal Cajal pacemaker cells. Therefore, impaired functionality of cells other than MCs could have influenced the outcome of wound healing in these mice. In support of this, skin γδ T cells as well as innate lymphoid cells (ILC) have been shown to promote wound closure as shown in a recent report, where re-epithelialisation and wound closure were delayed in ILC-depleted mice (178). Although the depletion with an anti-CD90 antibody used in this study may also target other cell populations (179), the authors speculate that the reduced wound closure might be dependent on decreased M2 macrophage function due to the lack of ILC-derived IL-13. M2 macrophages have been found to promote angiogenesis in wounds and might thereby promote ILC-mediated wound closure (180). Another cell type that expresses c-Kit are DETCs, an intraepithelial γδ T cell population that has been described to be important for wound closure. DETCs were shown to participate in tissue repair as demonstrated in a model

62 Discussion full-thickness wounding. In a first report DETCs were reported to accumulate around the wound area, and wound healing was significantly delayed in γδ T cell-deficient mice (TCRd-/-). The authors speculated that DETCs influence wound closure through local production of fibroblast growth factors like FGF-7 and FGF-10 leading to KC proliferation (181). Later on, a functional role for DETC–derived IL-17A in inducing epidermal AMP responses and hence promoting wound repair was identified. Adoptive transfer of Il17-/- DETCs demonstrated that IL-17A produced by DETCs is required for normal wound healing in mice. The improved wound healing was accompanied by increased expression of β defensin-3, S100A8, and RegIIIγ in KCs and hence proposed as a likely underlying mechanism of the wound healing-promoting characteristics of DETC-derived IL-17A (182). In conclusion, wound healing studies relying solely on c-Kit-dependent MC deficiency might have revealed false-positive results due to confounding effects of other c-Kit-dependent cell types such as ILCs or γδ T cells. Second, the use of different wounding protocols in the different studies might offer a possible explanation for the contradictory results concerning the role of MCs for the healing of skin wounds. Whereas wounding by use of a punch biopsy resulted in markedly reduced wound closure in KitW/KitW-v mice compared to controls (132), other studies using additional microdeformational wound therapy (MWT) upon wounding showed only minor MC-dependent changes in the proliferation phase without discernable effects on wound closure time in KitW/KitW-v mice. In the MWT model MCs promoted granulation tissue formation, cell proliferation and vascularisation (143, 144). MWT is described to accelerate healing of skin wounds by improving the granulation tissue formation, inducing angiogenesis and cell proliferation (183). The improvement of wound healing due to MWT might mask the influence of MCs on wound healing and hence account as a possible explanation for the divergent role of MCs described in wound healing. The use of another wounding protocol, the application of a heated lead block to the skin (scald wounds), did not reveal changes in wound closure or re-epithelialisation in KitW/KitW-v mice, but uncovered minor changes in fibrotic proliferation and angiogenesis in MC-deficient mice as compared to WT mice (142). The authors describe that wounds were swollen immediately after scald injury followed by the formation of a layer of necrotic skin that later, forming a crust, covered the wound. Necrotic tissue within scald wounds is known to serve as an inflammatory focus that constantly activates the complement cascade, leading to increased levels of pro-inflammatory and chemotactic cytokines that attract neutrophils as well as macrophages (184) and thereby delay wound closure (185). Moreover, scald wounds are described to be impaired in wound closure due to dysfunctional KCs and fibroblasts leading to decreased re-epithelialisation, granulation tissue formation, and collagen deposition (9). These phenomena of scald wounds distinguishes scald wound from mechanical wounds. Therefore, it is reasonable to conclude that MCs are involved in wound healing of subtypes of wounds but not scald wounds. In conclusion, differences in wounding protocols are likely to have contributed to the controversial data concerning the role of MCs for the healing of non-infected wounds. Third, bacterial contamination of skin wounds is known as a major cause of delayed wound healing (186-188) and hence needs to be taken into account as an interference factor in wound

63 Discussion healing. In none of the wound healing studies detecting a beneficial role for MCs in wound healing, bacterial wound infection by air- or body liquid-borne bacteria was analysed or prevented. To set up the wound healing protocol in the present study, we analysed the amount of bacteria that colonise wounds after wound induction. As expected, we found that the wounds were not sterile but colonised with bacteria. Interestingly, MC-deficient mice had significantly more bacteria within skin wounds compared to WT. These bacteria were either of airborne origin or derived from the of the mice transferred via licking of the wounds. To exclude that susceptibility to unintended bacterial colonisation impaired the outcome of our wound closure analyses, we kept mice individually in single cages and protected the wounds from bacterial contamination from saliva with Elizabethan collars that prohibited licking of the wound. Since in previous studies, e.g. by Weller and co-workers Elizabethan collars were not used, the wounds in these studies might have been infected unintentionally with environmental bacteria (132). The positive effects of MCs on wound healing observed in these studies would thus be in line with the positive influence of MCs on the healing of P. aeruginosa-infected skin wounds that we describe here. It is important to note that skin wound closure in mice is substantially different to human skin wound closure. Mice, in contrast to humans, have loose skin and skeletal muscle layers, the panniculus carnosus. This additional muscle in mice is responsible for wound contraction upon excisional wounding, whereas in humans the contribution of contraction is negligible (189). Other mouse models of wound healing in which wound contraction was prevented by implanting splints show prolonged time to complete wound closure, as well as increased granulation tissue formation compared to unsplinted control mice. Although this model reflects the wound healing situation in humans even more closely, we chose a conventional wound healing approach for our studies due to the tendency of P. aeruginosa to adhere to a variety of surfaces including medical devices, like catheters and form biofilms. Importantly, bacteria that grow in biofilms display significant phenotypic differences that range from changes in motility to the production of extracellular polysaccharides and increased antibiotic resistance. Thus, the use of splint implants would have introduced an unpredictable variable that might have influenced the outcome of our wound closure study (190, 191). Taken together, we established a mouse model of skin wound infection that closely resembles superinfected skin wounds in humans. Using this model we characterised the healing kinetics of MC-deficient mice as compared to WT mice. MC-deficient KitW/KitW-v as well as Cpa-Cre; Mcl-1fl/fl mice revealed a significant delay in wound closure upon skin wound infection compared to controls indicating that MCs contribute to the normal closure of infected skin wounds in mice. 5.2. Mast cells reduce the bacterial load within P. aeruginosa infected skin wounds

Upon P. aeruginosa infection of skin wounds, MC-deficient KitW/KitW-v as well as Cpa-Cre;Mcl-1fl/fl mice exhibited a delay in wound closure. The impaired wound closure process was accompanied by an increased bacterial load within the skin wounds. This increase in bacterial load was confirmed to be MC-dependent using local MC reconstitution as well as the

64 Discussion application of a non-c-Kit-dependent MC-deficient mouse model. The role of MCs in combatting the bacterial load of infected skin wounds is in accordance with studies of subcutaneous bacterial skin infection with either P. aeruginosa (98) or group A streptococcus (GAS) (97, 118). KitW/KitW-v mice exhibited a two-fold larger as well as a prolonged progression of the P. aeruginosa infection, which correlated with higher bacterial load within the infected skin lesion. Using GAS skin infections as a model, KitW-sh/KitW-sh mice were reported to have 30 % larger skin lesions and 80 % more lesional bacteria compared with WT mice (118). Moreover, injection of GAS into the footpads of KitW/KitW-v mice caused necrotic destruction of muscle layers, which was absent in WT mice. This tissue destruction correlated with higher bacterial clusters of streptococci at the damaged muscle layers (97). All these studies point towards a beneficial role for MCs in bacterial clearance, which is one possible explanation for the delay in wound closure seen in the absence of MCs. P. aeruginosa is highly associated with delayed wound healing in immunocompromised mice as well as in humans (186-188). In a mouse model of streptozotocin-induced diabetes, P. aeruginosa application onto skin wounds delayed wound healing, which was associated with reduced bacterial clearance and strong biofilm formation compared with controls (192). Moreover, using genetically diabetic mice, biofilm application of P. aeruginosa onto skin wounds also resulted in significantly delayed wound closure by an average of two weeks. The reduced wound closure was associated with higher bacterial load as well as limited angiogenesis and reduced inflammatory cell recruitment (193). Furthermore, in a study of human venous leg ulcers, complete healing within 180 days was observed only in 10.5% of P. aeruginosa-infected wounds compared to 35% of non-infected wounds (186). However, the mechanisms that underlie delayed healing in wounds with bacterial colonisation are poorly understood. P. aeruginosa has been proposed to deteriorate wound healing by the expression of virulence factors and the prolongation of the inflammation phase of wound healing. All clinical isolates of P. aeruginosa secrete virulence determinants and are also able to translocate these exotoxins into eukaryotic cells using a special apparatus associated with the cell wall called type III secretion system (T3SS) (194). P. aeruginosa exotoxins have been described to be detrimental for the outcome of wound healing (195). While the exotoxin ExoU disrupts membrane function and induces necrotic cell death, ExoS and ExoT have been described to inhibit actin polymerisation, thereby preventing phagocytosis and cell migration and promoting apoptosis (196). In addition, ExoA, the most virulent factor of P. aeruginosa inhibits protein synthesis (197) and was shown to be toxic for human peripheral blood macrophages (198) as well as for mice upon intraperitoneal injection (199). P. aeruginosa-derived exotoxins have been reported to exhibit toxic effects that might offer an explanation for the impaired wound healing of P. aeruginosa-infected skin wounds. Moreover, P. aeruginosa-derived virulence determinant haemolytic phospholipase C (PlcH) and quorum sensing (QS) molecules have been described to influence angiogenesis, as well as KC and endothelial cell proliferation, activation, and migration thereby causing delayed wound closure. The PlcH of P. aeruginosa was shown to be lethal for human umbilical vascular endothelial cells (HUVEC) in a dose-dependent manner and inhibited angiogenesis in vivo in

65 Discussion zebrafish (200). Experiments using biofilm-conditioned media from P. aeruginosa exhibited an inhibitory effect on proliferation of human epidermal KCs (201). Since epithelisation by KCs is a major step in wound healing, these findings provide a plausible explanation of how P. aeruginosa could inhibit wound closure. P. aeruginosa is equipped with QS molecules, which represent a cell-to-cell communication mechanism that determines bacterial growth and biofilm formation according to bacterial density and the environmental conditions such as the nutrient sources available (202). QS have also been implicated to influence host immune responses (203). P. aeruginosa produces two main QS molecules namely N-butanoyl-L-homoserine lactone (C4-HSL) and N-3-oxododecanoyl-L-homoserine lactone (3-oxo-C12-HSL). 3-oxo-C12-HSL was shown to induce cell death in murine fibroblasts and human vascular endothelial cells (HUVEC) (204). Both cell types underwent apoptosis upon incubation with 3-oxo-C12-HSL as measured by annexin-V-positivity. Thus, direct cytotoxicity of P. aeruginosa QS molecules might impair angiogenesis and the formation of granulation tissue in vivo leading to disturbed wound closure. Moreover, the QS molecule 3-oxo-C12-HSL was shown to inhibit fibroblast and KC migration as well as KC proliferation (205). Application of supernatant derived from P. aeruginosa onto human fibroblasts (HFF-1) or the human transformed KC cell line CCD 1102 KERTr lead to reduced migratory capacity in both cell types and to deteriorated proliferation selectively in KCs. This effect was absent when P. aeruginosa deficient for 3-oxo-C12-HSL was applied. Thus, besides directly killing endothelial and stromal cells, P. aeruginosa QS molecules can inhibit proliferation and migration of host cells. This multi-inhibitory function of QS molecules on different host cell types might lead to impairment of the key processes in wound healing, such as re-epithelisation and formation of granulation tissue, which are primarily dependent on fibroblasts and KCs. On the other hand, increased inflammation due to incomplete bacterial clearance within skin wounds can cause delayed wound closure resulting in chronic wounds. Within chronic non-healing wounds, increased leukocyte activity in response to bacteria has been found to render the microenvironment highly proteolytic resulting in the cleavage of matrix components and growth factors. In chronic wounds invading neutrophils and macrophages are described as the major source of MMPs. Due to ongoing stimulation with pro-inflammatory cytokines or bacterial components MMPs are highly up-regulated whereas the activity of the MMP-inhibitor TIMP-1 is inhibited. In patients with chronic leg increased levels of MMP-1, -2, and -9 were found in patients with poorly healing wounds, while well healing wounds showed decreased MMP levels accompanied with an increase in TIMP-1 (206). This reduced healing capacity due to unbalanced proteolytic activity in chronic wounds was shown to be due to degradation of ECM components such as0 fibronectin and vitronectin (207) that hinders the deposition of new ECM required for wound healing. On the other hand, several growth factors including VEGF are affected by the proteolytic wound bed. VEGF was reported to be rapidly degraded in chronic wounds leading to reduced angiogenesis (208, 209). This negative impact of increased proteolysis in chronic wounds is in accordance with the effect of topical treatment with protease inhibitors onto chronic diabetic foot lesions that resulted in reduced wound size (210). Moreover, the incomplete switch of M1 macrophage populations to an anti-inflammatory,

66 Discussion pro-healing M2 phenotype was associated with non-healing wounds such as chronic venous leg ulcers in humans and mice. Macrophages can polarise, depending on their surrounding environment, into either pro-inflammatory classically activated M1 macrophages upon stimulation with microbial agents e.g. LPS and/or IFNγ or into an alternatively activated phenotype characterised as anti-inflammatory M2 macrophages. This division is based on their expression of cytokines: M1 macrophages express low levels of IL-10 and high levels of IL-6, IL-12, as well as TNF, whereas M2 macrophages mainly express high levels of IL-10 and only small amounts of IL-12 (211). In chronic ulcers the accumulation of macrophages with an M1 profile was characterised by increased TNF production (212). Moreover, impaired wound healing shown by reduced granulation tissue formation, angiogenesis and collagen deposition was attended with numbers of M1 macrophages expressing IL-1β, inducible nitric oxide synthase (16) and MMP9 until late in the wound healing of diabetic mice. The authors speculated that the imbalance of M1/M2 macrophages accompanied by low levels of anti-inflammatory IL-10 in diabetic db/db mice were the underlying cause of the disturbed wound healing (213). Additionally, oxidative stress through the excessive release of ROS by immune cells like neutrophils and macrophages can cause structural damage to proteins of the ECM and alterations in signalling and transcriptional pathways of pro-inflammatory cytokines and chemokines (209). In a mouse model of chronic ulcers induced by intraperitoneal injection of iron-dextran, enhanced macrophage-dependent ROS release was described to reduce wound closure due to senescence in wound fibroblasts hence impairing their capacity for tissue repair (212). Taken together, prolonged and intensified inflammation leading to destruction or degradation of ECM, as well as inhibition of growth factors upon bacterial infection are plausible explanations for reduced wound healing of infected skin wounds. P. aeruginosa has developed several mechanisms of circumventing the antibacterial activity of the immune system to facilitate bacterial survival inside the host thereby sustaining inflammation within the wound. In addition to the previously described functions, haemolytic phospholipase C (PlcH) was shown to impair the respiratory burst in neutrophils, a prominent killing mechanism aimed at the rapid production and release of ROS within vacuoles (214). P. aeruginosa addition to human neutrophils lead to the inhibition of the respiratory burst that was not seen in P. aeruginosa mutants lacking PlcH. PlcH-mediated inhibition of the intracellular elimination of P. aeruginosa might offer a possible mechanism that favours chronic persistence of P. aeruginosa infection within skin wounds. On the other hand, 3-oxo-C12-HSL was reported to induce apoptosis in macrophages and neutrophils (215) as well as to down regulate the production of pro-inflammatory cytokines in macrophages (216). In vitro stimulation with 3-oxo-C12-HSL demonstrated accelerated apoptosis in bone marrow-derived macrophages, as well as cell line macrophages and neutrophils, but not in epithelial cells (215). Since macrophages and neutrophils as professional phagocytes are mainly responsible for bacterial clearance, it is legitimate to speculate that 3-oxo-C12-HSL might impair the bacterial clearance in vivo leading to an increased bacterial load and inflammation within infected skin wounds. Moreover, investigations of the effect of 3-oxo-C12-HSL on LPS-induced expression of TNF

67 Discussion and IL-10 in murine macrophages revealed increased IL-10 production and decreased TNF secretion upon stimulation with 3-oxo-C12-HSL (216). Tilting macrophages towards an anti-inflammatory phenotype might silence the immune response against P. aeruginosa in vivo allowing for bacterial survival and replication. Taken together, dysregulation of the immune response against P. aeruginosa leading to hindered bacterial clearance may greatly favour bacterial survival and persistence and support ongoing inflammation within infected skin wounds. To directly prove that the increased bacterial load is the underlying cause of the disturbed wound healing in infected MC-deficient mice, experiments using antibiotic treatment would be advisable. This might explain the delayed wound closure in our model of P. aeruginosa skin wound infection.

5.3. Mast cell-mediated bacterial clearance is independent of immune cell recruitment

MCs are known to be important immune cells in the combat against bacterial infections (53). Although several studies have been conducted in models of bacterial skin infection, the underlying mechanism of how MCs contribute to bacterial defence are insufficiently is understood, although several studies have pointed towards a role for MCs in recruiting neutrophils to the site of infection. To address a possible role for neutrophil recruitment, we analysed MPO levels as a marker for neutrophil activity as well as neutrophil numbers in our model of P. aeruginosa skin wound infection. In the absence of MCs, no differences in MPO activity or neutrophil numbers were detected during bacterial skin wound infection compared to WT mice. To exclude the involvement of immune cell recruitment in bacterial reduction during skin wound infection, we applied skin explants, where immune cell recruitment is very restricted, to P. aeruginosa infection. Ex vivo infection of skin explants derived from MC-deficient mice showed decreased bacterial killing as compared WT skin explants. These findings implicate that neither neutrophil activity nor immune cell recruitment were required for MC-dependent bacterial clearance in infected skin wounds. In contrast, using a model of subcutaneous infection with P. aeruginosa (98) or GAS (97, 118), impaired bacterial clearance in MC-deficient mice was shown to be associated with reduced neutrophil accumulation at sites of bacterial infection. Whereas earlier studies reported that the prolonged resolution of the bacterial infection was associated with diminished neutrophil recruitment in MC-deficient mice (97, 98), Di Nardo et al. proposed that cathelicidin release from MCs was responsible for the recruitment of neutrophils, thereby offering a potential molecular mechanism (118). The differences in the mechanism of MC-dependent bacterial clearance between those studies and the present thesis might be due to the route of bacterial application. In support of this MC numbers within the skin are highest in the superficial dermal layers and lowest in the subcutis. Subcutaneous injection of bacteria might provoke a different MC-dependent immune response than topical bacterial skin wound infection (217). Moreover, upon injection of bacteria, a direct activation of MCs by bacteria inducing degranulation was described (97, 98). In the case of the bacterial skin wound infection herein, direct MC activation

68 Discussion by bacterial products is rather unlikely due to the spatial separation of MCs and bacteria. In support of this hypothesis, Siebenhaar et al. have observed that MC degranulation upon stimulation with P. aeruginosa was higher in vivo than upon in vitro infection of only MC cultures (98) suggesting that additional skin-derived soluble alarmins like Endothelin-1 or IL-1 family members that are induced by P. aeruginosa could have been responsible for MC activation. This hypothesis is further supported by the finding that MC degranulation also takes place after skin wounding without infection in a distance-dependent manner (132). Thus, it is plausible to speculate that MC activation in the case of skin wound infection is mediated by host- derived danger signals, released in response to tissue damage or infection, rather than direct bacterial contact. In accordance with this, MCs have been described as sensors of tissue damage releasing pro-inflammatory cytokines like IL-6 or TNF upon exposure to the supernatant of necrotic cells (81). The responsible mediator leading to the initiation of a pro-inflammatory response in MCs was identified to be the IL-1 family member IL-33. Taken together, although MCs were reported to be involved in the initiation of neutrophil recruitment upon infection, in our model of skin wound infection, we could not detect any MC-dependent differences in neutrophil numbers or activity.

5.4. Mast cells promote the release of antimicrobial peptides by keratinocytes

As we excluded immune cell recruitment as a possible mechanism of MC-mediated bacterial reduction within bacterial skin wound infection with P. aeruginosa, we next investigated the interaction between MCs and KCs. KCs are the predominant cell type in the epidermis, the outermost layer of the skin, forming a first line of defence against invading pathogens by providing a physical as well as an immunological barrier. KCs can not only produce pro-inflammatory chemokines like CXCL10 and CCL2, which attract leukocytes (218), but also secrete AMPs providing a soluble barrier that acts as a protective shield against infections (219). In response to infection or injury, expression of AMPs like cathelicidin (220, 221), psoriasin (171, 222) and ß-defensins (223) in human skin are up regulated due to increased synthesis by KCs. As KCs are a major part of the innate immune defence of the epidermal skin compartment, we hypothesised that MC-KC interactions render the skin more resistant against superficial bacterial skin wound infection. To this end, we established an in vitro system of MC-KC co-culture infected with P. aeruginosa. We observed that a concerted action of MC and KCs is necessary to conduct the antibacterial function against P. aeruginosa in vitro. Neither MCs nor KCs alone were able to reduce the number of P. aeruginosa. However, co-cultures of MCs and KCs were able to significantly reduce the bacterial load, which was accompanied by the expression of AMPs including CAMP and mBD-14. Other studies have described AMPs as effective molecules against P. aeruginosa. For example, P. aeruginosa biofilm growth was found to be inhibited and destroyed upon treatment with the human analogue of CAMP, LL-37 (224, 225). The microbicidal activity of murine CAMP was assessed by incubating P. aeruginosa with recombinant CAMP resulting in a strong and concentration-dependent reduction in P. aeruginosa within one hour (226). Also, hBD-3 and the murine homologue mBD-14 was reported to be effective in killing P. aeruginosa

69 Discussion in vitro (170, 223). In conclusion, we speculate that the antimicrobial effect of MCs on P. aeruginosa is mediated by the induction of AMP expression and release from KCs. Next, we showed that the antibacterial effect of the MC-KC co-cultures was abolished by increased Ca2+ concentrations indicating an involvement of AMPs in the MC/KC-mediated killing of P. aeruginosa. Increasing concentrations of divalent cations was described to interfere with the membrane permeabilisation of AMPs by competitively displacing the divalent cations that are necessary to partially neutralise the LPS negative charge (112, 227, 228). Therefore, it is plausible to assume that KC-derived AMPs are responsible for the reduction in P. aeruginosa numbers. Future experiments using neutralising antibodies or pharmacological inhibitors to specifically inhibit AMPs shell confirm the crucial role of AMPs in the KC-mediated killing of P aeruginosa. To address the role of AMPs in vivo, we analysed the expression of AMPs upon skin wound infection in MC-deficient KitW/KitW-v and WT mice. We observed that, upon infection with P. aeruginosa, MC-deficient KitW/KitW-v mice exhibited lower mRNA levels of mBD-14, CRAMP, as well as psoriasin within the skin wounds. The decreased expression of AMPs in MC-deficient mice is in line with a potential involvement of AMPs in the reduction of P. aeruginosa. This is in accordance with other studies that observed a correlation between AMPs and the susceptibility to bacterial infections in humans and mice. Human cathelicidin LL-37 was found to be highly expressed in KCs in acute surgical wounds but not in chronic ulcers (229). The fact that all chronic ulcers analysed in this study were colonised with a diverse microbial flora implicates that LL-37 might prevent bacterial colonisation. Moreover, the genetic deletion of mouse cathelicidin CRAMP resulted in increased susceptibility to GAS infection (230). Subcutaneous injection of GAS into CRAMP-deficient mice resulted in larger lesion size that was accompanied by increased bacterial load. In contrast, injecting GAS mutants resistant to CRAMP into WT mice produced more severe infections than WT GAS. Taken together, these findings implicate CRAMP in the skin defence against P. aeruginosa in mice. Moreover, also infections models that are based on the infection of other organs than skin describe the role of the murine AMP CRAMP in the combat against P. aeruginosa infections. First, in a mouse model of P. aeruginosa-induced keratitis, CRAMP-deficient mice show increased susceptibility. While in 80% of WT mice the cornea healed upon infection within 21 days, the cornea of CRAMP- deficient Cnlp-/- mice did not recover or even perforated. Worse histopathological scores of the cornea in Cnlp-/- mice correlated with an increased bacterial load implicating a role for CAMP in bacterial clearance (231). Second, in a murine model of P. aeruginosa pulmonary infection, application of exogenous recombinant LL-37 was shown to enhance clearance of P. aeruginosa (232). Both studies observed AMP-dependent neutrophil infiltration and hence reasoned that AMP-induced bacterial killing by neutrophils was the underlying mechanism. Nevertheless, neither the exclusive role of neutrophils nor a combined mechanism or a direct antibacterial function of AMPs was confirmed. In summary, KC antibacterial capacity was observed in MC-KC co-cultures, which was accompanied by AMP expression implying a possible involvement of AMPs in the combat against P. aeruginosa. In accordance with this finding, the expression of AMPs by KCs in vivo was MC-dependent. As MC-deficient mice exhibit higher

70 Discussion levels of P. aeruginosa within skin wounds it is likely that MC-mediated AMP expression in KCs confers antibacterial capacity upon P. aeruginosa-induced skin wound infection. In line with this, inhibition of AMPs by elevated Ca2+ concentrations abolished the MC/KC-mediated killing of P. aeruginosa.

5.5. Skin antibacterial capacity requires mast cell-derived IL-6

Having shown that MCs cannot themselves phagocytose or kill P. aeruginosa, but induce bactericidal AMP expression in KCs, we asked which signal is provided by MCs to induce AMP expression in KCs. Analysis of the supernatant of MC-KC co-cultures revealed that a high amount of IL-6 was released upon P. aeruginosa infection. The IL-6 production was attributed to MCs by mRNA analysis. Since IL-6 has formerly been reported to induce AMP expression, e.g. in colonic enterocytes (233), we hypothesised that MC-derived IL-6 is crucial for AMP induction in KCs. Indeed, we could show that MC-derived IL-6 induces AMP production and enhances the antibacterial capacity of KCs in vitro as well as in vivo. Although the specific role of MC-derived IL-6 in the induction of AMPs by KCs has not been described previously, several studies have identified a general role for IL-6 in the stimulation of skin-derived or KC-derived AMPs. Comparing human skin wounds and ex vivo wounded human skin samples, AMPs including hBD-2, hBD-3, and psoriasin were found to be increased compared to non-wounded skin. This upregulation was accompanied by elevated transcript levels of cytokines like IL-6, IL-8, IL-20, and IL-24 (234). Investigation of the effect of IL-6 on cultured KCs revealed that IL-6 increased the mRNA levels of LL-37 but not hBD-1 or hBD-2. Applying cultured composite KC grafts consisting of human cadaver epidermis placed on acellular dermis confirmed this finding, namely that recIL-6 stimulation of these composite skin grafts enhanced their antibacterial properties, i.e. the killing of different bacteria such as P. aeruginosa, S. aureus, or E. coli (235). Although IL-6 only increased LL-37 expression 1.5-fold, the bacterial load was markedly reduced upon stimulation indicating that either LL-37 is highly effective against these bacterial strains or that the induction of other AMPs is involved. Further evidence for a role of IL-6 in antibacterial skin defence comes from Tocilizumab-treated patients (236). Tocilizumab is a humanised neutralising anti-IL-6 receptor antibody applied in the treatment of patients with rheumatic arthritis. In the safety analysis of a randomized, double-blinded, placebo-controlled study of Tocilizumab, the most frequent treatment-related side effects were bacterial and fungal infections. Skin and subcutaneous infections were reported with a frequency of 4.1 % in Tocilizumab-treated patients as compared to 0.7 % in controls. This adverse event during the therapeutical inhibition of IL-6 signalling supports the critical antimicrobial function of IL-6. Taken together, these findings implicate a crucial role for IL-6 in the antibacterial AMP response of KCs in both murine and human skin. Furthermore, we show here for the first time that MCs are a non-redundant source of this AMP-inducing IL-6 and thus are critical for the defence against P. aeruginosa infection.

71 Discussion

5.6. Keratinocytes induce IL-6 production and release in mast cells

Having demonstrated that MCs are not directly activated by P. aeruginosa but are rather activated to produce IL-6 in MC-KC co-cultures with P. aeruginosa, we wondered which KC-derived signal induces IL-6 expression in MCs. Transwell experiments revealed that MCs do not require direct contact with KCs or P. aeruginosa, but that supernatant derived from infected KCs is sufficient to induce IL-6 production. To identify possible signalling pathways involved in this MC activation, we applied MyD88-deficient MCs to the co-culture system. Toll-like receptors as well as IL-1 family cytokines signal through the MyD88-dependent pathway that culminates in the activation of nuclear factor-κB and the expression of inflammatory cytokines like IL-6. Upon infection, no induction of IL-6 was observed in Myd88-deficient MCs indicating a crucial role for the MyD88 adapter protein in KC-mediated signalling in MCs. To exclude LPS-mediated TLR4 signalling a TLR4 inhibitor was applied that did not result in reduced IL-6 release form MCs within the co-culture system. But since almost all TLRs, except TLR3 are signalling via MyD88 (174). P. aeruginosa was described to signal via a combination of TLR2, TLR4 and TLR5 (237). Therefore, inhibition experiments or experiments using other TLR knock-out mice need to be carried out to exclude a TLR-involvement in the IL-6 induction in MCs. It has been previously found that IL-1 family members like IL-1 and IL-33 are potent inducers of IL-6 in MCs (81, 173). In this thesis it could be shown that several members of the IL-1 family were released by KCs upon infection with P. aeruginosa namely IL-1α, IL-1β, IL-33, and IL-36. Although IL-33 is described in the literature as a key danger signal released from necrotic KCs that can stimulate MC-derived IL-6 production (81), other danger signals such as IL-1α, IL-1β are highly expressed in KCs and released upon physical stimuli like UV irradiation (238) or viral (239) and bacterial infection (240). Nevertheless, no investigations on the response of KCs to P. aeruginosa are reported in the literature. Despite this, analysis of the cytokine response of whole skin upon infection with P. aeruginosa or P. aeruginosa-derived virulence factors revealed findings that complement our results. For example, the QS molecule 3O-C12-HSL was shown to be a potent inducer of skin-derived pro-inflammatory cytokines in vivo (241). Upon injection of 3O-C12-HSL into the skin of mice, the mRNA levels of IL-1α, IL-1β as well as IL-6 were increased. Moreover, in a human ex vivo skin infection model with P. aeruginosa, IFN, TNF as well as IL-1 and IL-6 were up regulated in response to infection (242). In conclusion, activation of MCs by KCs requires the signal transducer MyD88 suggesting the involvement of IL-1 family cytokines. In the literature IL-33 is described as major IL-6 inducer in MCs (74). When MCs were incubated with supernatant derived from necrotic KCs by repeated freeze-thawing, a strong increase in IL-6 expression was observed that was completely abrogated using MCs deficient for the corresponding receptor T1/ST2 (81). Surprisingly, when we subjected IL-33 receptor deficient MCs to the co-culture infection the IL-6 production was not affected. A reason for the observed difference could be the release of danger signals like IL-1α, IL-1β by KCs in our co-culture infection experiments. Moreover, it is likely that the secreted IL-1 family members may act in a redundant manner inducing an IL-6 response in MCs during

72 Discussion

P. aeruginosa KCs infection in vitro. Taken together, we showed that P. aeruginosa-infected KCs induce IL-6 production in MCs most likely mediated by the release of IL-1 family cytokines from KCs. We can, at this point, only speculate which of the IL-1 family members induced in KCs upon P. aeruginosa infection, i.e. IL-1α, IL-1β, IL-33, or IL-36, is responsible for MC activation in vivo. Future experiments involving antibody-mediated neutralisation of cytokines are needed to answer this question. Another important question is how KCs are activated in the MC-KC co-culture as well as in single KC cultures by P. aeruginosa. In a report the P. aeruginosa-derived ceramide metabolite sphingosine-1-phosphate was shown to stimulate the production of inflammatory mediators like TNF and IL-8. Unfortunately, the study did not include further cytokines but still offers a possible signalling mechanism (243). Since literature on KC activation by P. aeruginosa is scarse, we can only speculate on the activation of KCs leading to cytokine secretion of IL-1 family based on other cell and bacterial strains. A plausible mechanism would be inflammasome activation leading to maturation and secretion of the pro-inflammatory cytokines IL-1β and IL-18 by P. aeruginosa virulence factors. P. aeruginosa-derived Pilin was described to activate inflammasome-dependent IL-1β in bone marrow-derived macrophages that was abrogated when Pilin-mutant P. aeruginosa was applied (244). Moreover, alveolar macrophages were observed to release IL-1β and IL-18 after NLRC4 inflammasome activation by P. aeruginosa-derived flagellin (245). On the other hand, LPS-mediated TLR4 activation might lead to IL-1α as well as IL-33 expression. Peritoneal macrophages were found to respond to TLR4 stimulation via LPS with increased IL-33 mRNA production (246). Moreover, KCs have also been described to react to LPS, via TLR4 signalling inducing pro-inflammatory cytokine release like IL-1 and TNF. Unfortunately, other cytokines have not been included in these measurements. The stimulatory effect of LPS was abolished when TLR4-deficient or KC deficient for the downstream signalling molecule MyD88 were used (247). These studies suggest that the TLR-MyD88-dependent pathway in KCs is likely to be addressed by bacterial infection. Additionally, IL-33 has been shown to be constitutively expressed in the nuclei of KCs (248). Therefore, cell damage induced by P. aeruginosa-derived extoxins might lead to IL-33 liberation and enable IL-33 to act as alarmin. Since induction of IL-1β, as well as IL-1α, IL-33, and IL-36 depends on different receptors and signalling pathways, it is likely that several P. aeruginosa-derived factors are involved. To ultimately unveil the activation of KCs by P. aeruginosa further investigations need to be carried out. Primarily, the required cytokine derived from KCs for the IL-6 induction in MCs needs to be deciphered. Therefore, an inhibition experiment using specific antibodies against IL-1β, as well as IL-1α, IL-33, and IL-36 will be carried out. Furthermore, studies revealing the P. aeruginosa-derived mediator that induces the cytokine response in KCs will be done. Since we know that P. aeruginosa needs to be viable and that P. aeruginosa-derived supernatant was sufficient to initiate KC-induced IL-6 response in MCs, we hypothesise that the inducer of KC cytokine response is a P. aeruginosa-secreted molecule. Since ExoS, as one of the possible mediators, was described to be able to signal via TLR2 and TLR4 (249), different P. aeruginosa exotoxin-mutant strains will be included in the analysis. To determine if the cytokine release from KCs is dependent on secreted substances form P. aeruginosa by T3SS

73 Discussion experiments with the PAKΔC mutants lacking the T3SS machineries will be conducted. Upon confirmation that T3SS is involved, further single-mutants or multiple-mutants (250) of the secreted effectors ExoT, ExoY, and ExoS or ExoU will be used to detect the responsible mediators. Another approach includes inhibition experiments using antibodies against possible involved receptors on KCs like TLR2, TLR4 or inflammasome receptors including NLRC4. Overall, we propose a mechanism by which P. aeruginosa activates KCs by a yet unknown mechanism to release IL-1 family cytokines. These cytokines activate MCs in a MyD88-dependent mechanism to express and release IL-6. IL-6, in turn, induces AMP expression in the KCs, which mediates killing of P. aeruginosa.

5.7. Mast cell-derived IL-6 is required for normal healing of infected skin wounds in mice

We could show that skin wound healing of infected skin wounds requires MC-derived IL-6 and can be enhanced by topical IL-6 treatment. In accordance with our finding that IL-6 is required for normal healing of infected wounds, IL-6 has already been reported to be essential for wound healing. Upon wounding of Il6-/- mice, a significant delay in wound healing was observed as compared to WT mice. The authors report that the disturbed wound healing was accompanied by reduced leukocyte infiltration, granulation tissue formation, as well as neovascularisation (251). Although these findings deliver reasonable explanations for impaired wound healing, the fact that bacterial colonisation might have influenced the outcome of the study was not investigated. Even though the origin of IL-6 in our mouse model of skin wound infection was shown to be MCs, the results of recIL-6 treatment might be explained by several mechanisms. On the one hand our data support the role of IL-6 in the induction of AMPs within the skin leading to reduced bacterial load and hence allowing wound closure. On the other hand, IL-6 was reported to increase KC proliferation. Although the application of IL-6 to human KCs in vitro was 10-fold less potent than , it is possible that IL-6 is beneficial for epithelisation in vivo and hence a considerable mechanism speeding up wound closure in vivo (252). Moreover, upon stimulation of AMP expression in KCs these peptides might also act indirectly on wound healing. Several studies implicated AMPs in wound healing for example the human β-defensins hBD-2, -3, and -4 were reported to stimulate KC migration and proliferation (253). Another study reports that cathelicidin was expressed in epithelium as well as wound infiltrate upon skin wounding in mice but was involved in epithelisation. In wounded organ-cultured human skin re-epithelialisation was inhibited upon anti-cathelicidin antibody treatment (229). Furthermore, the murine homologue CRAMP was reported to promote neovascularisation in a mouse wound model (254). CRAMP-deficient mice exhibited decreased revascularisation upon wounding compared to WT mice. In conclusion, these studies demonstrate a possible role for AMPs influencing wound healing despite eliciting an antimicrobial function. Nevertheless, recIL-6 treatment did not accelerate wound healing of non-infected skin wounds supporting our finding that reduced AMP production associates with increased bacterial load in vitro as well as in vivo. Taken together, our data implicate a role for MC-derived IL-6 in wound healing of

74 Discussion infected skin wounds. Moreover, we could show that recIL-6 stimulated antibacterial capacity in murine as well as human skin. Since recIL-6 improves wound healing of infected skin wounds in MC-deficient mice, we translated this finding into the human system. Upon pre-treatment of human skin explants with recIL-6 followed by P. aeruginosa infection we observed a significant reduction in bacterial load within the explant culture upon recIL-6 treatment. This further supports our hypothesis that MC-derived IL-6 stimulates the antibacterial capacity of the skin upon infection with P. aeruginosa.

5.8. Strengths and limitations

In this study we analysed the role of MCs in skin wound infection with P. aeruginosa. We established a mouse model of skin wound infection that resembles clinical relevant smear infection. P. aeruginosa is of high relevance due to emerging antibiotic resistant strains that worsen the patient outcome upon infection. To analyse the function of MCs in detail two different MC-deficient mouse models, as well as reconstitution experiments have been applied: a c-Kit-dependent KitW/W-v mouse model as well as the c-Kit independent Cpa-Cre;Mcl-1fl/fl mouse model. We could identify MCs as a critical source of IL-6 upon infection with P. aeruginosa in vitro as well as in vivo. MC-derived IL-6 was further shown to induce AMPs in KCs as well as in skin sample. MC-dependent reduction of P. aeruginosa is highly likely due to increased AMP expression but due to the lack of inhibitors or blocking antibodies a concluding in vivo experiment remains to be done. MC activation that lead to IL-6 release was shown to be MyD88-dependent and thereby possibly due to stimulation by IL-1 family members released by infected KCs. Several members of the IL-1 family namely IL-1α, IL-1β, IL-33 as well as IL-18 were able to induce IL-6 release from MCs. How P. aeruginosa acts on KCs and activates the release of IL-1 family members will be part of future investigations. Finally, we could translate our finding that IL-6 involved in bacterial clearance into the human system and confirmed a beneficial role for IL-6 in wound infections.

5.9. Conclusion and outlook

In this report we identified MC-derived IL-6 as a crucial driver for antibacterial skin innate immune responses in superinfected wounds. We uncovered a so far unknown mechanism how the skin controls bacterial numbers within infected skin wounds. MC-derived IL-6 is required for normal healing of infected skin wounds in mice. Not only was wound closure accelerated by IL- 6 treatment but also the bacterial load within skin wounds was reduced. We found that the bacterial load correlated with the IL-6-induced AMP response of KCs upon infection with P. aeruginosa. Moreover, the beneficial role of IL-6 was confirmed in human explant infections. Taken together, our findings may allow for the development of novel and effective approaches for the prevention and/or treatment of bacterial skin and other infections, which are urgently needed in times of increasing antibiotic resistance.

75 List of tables

6.List of figures

Figure 1.1. Degranulating murine skin mast cell. Formalin-fixed and paraffin-embedded S.1 murine back skin with Giemsa staining. Figure 1.2. Important mast cell mediators released in response to pathogens. S.8 Figure 1.3. Important mast cell-mediated innate immune responses against pathogens. S.9 Figure 1.4. Important innate immune responses by mast cells against bacteria within the S.14 skin. Figure 1.5. Phases of skin wound healing. S.15 Figure 3.1 Standard growth curves for P. aeruginosa and S. aureus. S.31 Figure 3.2. Schema of skin wound infection procedure. S.32 Figure 4.1. Mast cell-deficient mice show impaired wound closure upon skin wound S.42 infection. Figure 4.2. Impaired wound closure upon skin wound infection with P. aeruginosa is S.44 mast cell-dependent. Figure 4.3. Mast cells control bacterial numbers in P. aeruginosa-infected skin wounds. S.46 Figure 4.4. P. aeruginosa reduction requires mast cell-keratinocyte interaction. S.49 Figure 4.5. Mast cell-derived IL-6 induces antimicrobial defence in KCs upon P. aeruginosa S.52 infection. Figure 4.6. IL-6 production in mast cells is dependent on stimulation by IL-1 family S.54 members Figure 4.7. Mast cell-derived IL-6 is crucial for optimal antimicrobial skin defence during S.56 P. aeruginosa infection. Figure 4.8. IL-6 treatment enhances skin antimicrobial capacity for optimal antimicrobial S.58 skin defence during P. aeruginosa infection. Figure 4.9. Recombinant IL-6 treatment enhances human skin antimicrobial capacity during S.59 P. aeruginosa infection.

76 List of tables

7.List of tables

Table I List of abbreviations S.IX Table 1.1. Important pathogen receptors expressed by MCs S.7 Table 2.1. Cell sources S.21 Table 2.2. Mast cell-deficient mouse strains S.21 Table 2.3. Genetically modified mice S.21 Table 2.4. Cell culture media and supplements S.22 Table 2.5. Bacterial culture media and supplements S.22 Table 2.6. Buffers, reagents and chemicals S.22 Table 2.7. Antibodies S.23 Table 2.8. Cytokines S.24 Table 2.9. Primers S.24 Table 2.10. Commercial kits S.24 Table 2.11. Consumables S.25 Table 2.12. Devices and technical support S.25 Table 2.13. Analysis software S.26 Table 2.14. Manufacturers and distributers S.26 Table 3.1. Embedding procedure S.34 Table 3.2. Protocol Giemsa staining S.34 Table 3.3. Protocol RT-reaction S.38 Table 3.4. Protocol qPCR-reaction S.38 Table 3.5. Antibody solutions S.39

77

8.Bibliography

1. Ehrlich P. Beiträge zur Theorie und Praxis der histologischen Färbung [Inaugural Dissertation]: Leipzig; 1878.

2. Fukuzumi T, Waki N, Kanakura Y, Nagoshi J, Hirota S, Yoshikawa K, et al. Differences in irradiation susceptibility and turnover between mucosal and connective tissue-type mast cells of mice. Experimental hematology. 1990;18(7):843-7.

3. Metcalfe DD, Baram D, Mekori YA. Mast cells. Physiological reviews. 1997;77(4):1033- 79.

4. Metcalfe DD, Boyce JA. Mast cell biology in evolution. The Journal of and clinical immunology. 2006;117(6):1227-9.

5. Galli SJ, Kalesnikoff J, Grimbaldeston MA, Piliponsky AM, Williams CM, Tsai M. Mast cells as "tunable" effector and immunoregulatory cells: recent advances. Annual review of immunology. 2005;23:749-86.

6. Jamur MC, Grodzki AC, Berenstein EH, Hamawy MM, Siraganian RP, Oliver C. Identification and characterization of undifferentiated mast cells in mouse bone marrow. Blood. 2005;105(11):4282-9.

7. Kitamura Y, Go S, Hatanaka K. Decrease of mast cells in W/Wv mice and their increase by bone marrow transplantation. Blood. 1978;52(2):447-52.

8. Kitamura Y, Shimada M, Hatanaka K, Miyano Y. Development of mast cells from grafted bone marrow cells in irradiated mice. Nature. 1977;268(5619):442-3.

9. Khammo N, McPhie P, Settle JA, Ingham E, Kearney JN. Effect of burn patient serum on fibroblast and keratinocyte cell morphology. Burns : journal of the International Society for Burn Injuries. 1997;23(3):212-7.

78

10. Crapper RM, Schrader JW. Frequency of mast cell precursors in normal tissues determined by an in vitro assay: antigen induces parallel increases in the frequency of P cell precursors and mast cells. Journal of immunology. 1983;131(2):923-8.

11. Rodewald HR, Dessing M, Dvorak AM, Galli SJ. Identification of a committed precursor for the mast cell lineage. Science. 1996;271(5250):818-22.

12. Abonia JP, Austen KF, Rollins BJ, Joshi SK, Flavell RA, Kuziel WA, et al. Constitutive homing of mast cell progenitors to the intestine depends on autologous expression of the chemokine receptor CXCR2. Blood. 2005;105(11):4308-13.

13. Weller CL, Collington SJ, Brown JK, Miller HR, Al-Kashi A, Clark P, et al. Leukotriene B4, an activation product of mast cells, is a chemoattractant for their progenitors. The Journal of experimental medicine. 2005;201(12):1961-71.

14. Weller CL, Collington SJ, Hartnell A, Conroy DM, Kaise T, Barker JE, et al. Chemotactic action of prostaglandin E2 on mouse mast cells acting via the PGE2 receptor 3. Proceedings of the National Academy of Sciences of the United States of America. 2007;104(28):11712-7.

15. Collington SJ, Hallgren J, Pease JE, Jones TG, Rollins BJ, Westwick J, et al. The role of the CCL2/CCR2 axis in mouse mast cell migration in vitro and in vivo. Journal of immunology. 2010;184(11):6114-23.

16. Kitaura J, Kinoshita T, Matsumoto M, Chung S, Kawakami Y, Leitges M, et al. IgE- and IgE+Ag-mediated mast cell migration in an autocrine/paracrine fashion. Blood. 2005;105(8):3222-9.

17. Kawakami T, Kitaura J. Mast cell survival and activation by IgE in the absence of antigen: a consideration of the biologic mechanisms and relevance. Journal of immunology. 2005;175(7):4167-73.

18. Collmann E, Bohnacker T, Marone R, Dawson J, Rehberg M, Stringer R, et al. Transient targeting of phosphoinositide 3-kinase acts as a roadblock in mast cells' route to allergy. The Journal of allergy and clinical immunology. 2013;132(4):959-68.

19. Tsai M, Shih LS, Newlands GF, Takeishi T, Langley KE, Zsebo KM, et al. The rat c-kit ligand, stem cell factor, induces the development of connective tissue-type and mucosal mast cells in vivo. Analysis by anatomical distribution, histochemistry, and protease phenotype. The Journal of experimental medicine. 1991;174(1):125-31.

20. Tsai M, Takeishi T, Thompson H, Langley KE, Zsebo KM, Metcalfe DD, et al. Induction of mast cell proliferation, maturation, and heparin synthesis by the rat c-kit ligand, stem cell factor. Proceedings of the National Academy of Sciences of the United States of America. 1991;88(14):6382-6.

79

21. Metcalfe DD. Mast cells and mastocytosis. Blood. 2008;112(4):946-56.

22. Hultner L, Druez C, Moeller J, Uyttenhove C, Schmitt E, Rude E, et al. Mast cell growth- enhancing activity (MEA) is structurally related and functionally identical to the novel mouse T cell growth factor P40/TCGFIII (interleukin 9). European journal of immunology. 1990;20(6):1413-6.

23. Nabel G, Galli SJ, Dvorak AM, Dvorak HF, Cantor H. Inducer T lymphocytes synthesize a factor that stimulates proliferation of cloned mast cells. Nature. 1981;291(5813):332-4.

24. Renauld JC. Interleukin-9: structural characteristics and biologic properties. Cancer treatment and research. 1995;80:287-303.

25. Hamaguchi Y, Kanakura Y, Fujita J, Takeda S, Nakano T, Tarui S, et al. Interleukin 4 as an essential factor for in vitro clonal growth of murine connective tissue-type mast cells. The Journal of experimental medicine. 1987;165(1):268-73.

26. Wang JX, Kaieda S, Ameri S, Fishgal N, Dwyer D, Dellinger A, et al. IL-33/ST2 axis promotes mast cell survival via BCLXL. Proceedings of the National Academy of Sciences of the United States of America. 2014;111(28):10281-6.

27. Nakano T, Sonoda T, Hayashi C, Yamatodani A, Kanayama Y, Yamamura T, et al. Fate of bone marrow-derived cultured mast cells after intracutaneous, intraperitoneal, and intravenous transfer into genetically mast cell-deficient W/Wv mice. Evidence that cultured mast cells can give rise to both connective tissue type and mucosal mast cells. The Journal of experimental medicine. 1985;162(3):1025-43.

28. Heavey DJ, Ernst PB, Stevens RL, Befus AD, Bienenstock J, Austen KF. Generation of leukotriene C4, leukotriene B4, and prostaglandin D2 by immunologically activated rat intestinal mucosa mast cells. Journal of immunology. 1988;140(6):1953-7.

29. Kitamura Y. Heterogeneity of mast cells and phenotypic change between subpopulations. Annual review of immunology. 1989;7:59-76.

30. Pejler G, Ronnberg E, Waern I, Wernersson S. Mast cell proteases: multifaceted regulators of inflammatory disease. Blood. 2010;115(24):4981-90.

31. Welle M. Development, significance, and heterogeneity of mast cells with particular regard to the mast cell-specific proteases chymase and tryptase. Journal of leukocyte biology. 1997;61(3):233-45.

32. Irani AA, Schechter NM, Craig SS, DeBlois G, Schwartz LB. Two types of human mast cells that have distinct neutral protease compositions. Proceedings of the National Academy of Sciences of the United States of America. 1986;83(12):4464-8.

80

33. Schwartz LB. Analysis of MC(T) and MC(TC) mast cells in tissue. Methods in molecular biology. 2006;315:53-62.

34. Metcalfe DD, Mekori JA, Rottem M. Mast cell ontogeny and apoptosis. Experimental dermatology. 1995;4(4 Pt 2):227-30.

35. Okuda M, Ohnishi M, Ohtsuka H. The effects of cromolyn sodium on the nasal mast cells. Annals of allergy. 1985;55(5):721-3.

36. Louis RE, Radermecker MF. Substance P-induced histamine release from human basophils, skin and lung fragments: effect of nedocromil sodium and theophylline. International archives of allergy and applied immunology. 1990;92(4):329-33.

37. Galli SJ, Kitamura Y. Genetically mast-cell-deficient W/Wv and Sl/Sld mice. Their value for the analysis of the roles of mast cells in biologic responses in vivo. The American journal of pathology. 1987;127(1):191-8.

38. Galli SJ. Mast cell deficient mice and rats with mutations of the c-kit protooncogene. Japanese journal of cancer research : Gann. 1993;84(6):inside front cover.

39. Gu H, Marth JD, Orban PC, Mossmann H, Rajewsky K. Deletion of a DNA polymerase beta gene segment in T cells using cell type-specific gene targeting. Science. 1994;265(5168):103-6.

40. Scholten J, Hartmann K, Gerbaulet A, Krieg T, Muller W, Testa G, et al. Mast cell-specific Cre/loxP-mediated recombination in vivo. Transgenic research. 2008;17(2):307-15.

41. Lilla JN, Chen CC, Mukai K, BenBarak MJ, Franco CB, Kalesnikoff J, et al. Reduced mast cell and basophil numbers and function in Cpa3-Cre; Mcl-1fl/fl mice. Blood. 2011;118(26):6930-8.

42. Sawaguchi M, Tanaka S, Nakatani Y, Harada Y, Mukai K, Matsunaga Y, et al. Role of mast cells and basophils in IgE responses and in allergic airway hyperresponsiveness. Journal of immunology. 2012;188(4):1809-18.

43. Voehringer D. Protective and pathological roles of mast cells and basophils. Nature reviews Immunology. 2013;13(5):362-75.

44. Galli SJ, Tsai M. Mast cells in allergy and infection: versatile effector and regulatory cells in innate and adaptive immunity. European journal of immunology. 2010;40(7):1843-51.

45. Amin K. The role of mast cells in allergic inflammation. Respiratory medicine. 2012;106(1):9-14.

81

46. Janeway CA Jr TP, Walport M, et al. Immunobiology: The Immune System in Health and Disease. 5th edition. Garland Science. 2001;5th edition.

47. Turner H, Kinet JP. Signalling through the high-affinity IgE receptor Fc epsilonRI. Nature. 1999;402(6760 Suppl):B24-30.

48. da Silva EZ, Jamur MC, Oliver C. Mast cell function: a new vision of an old cell. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society. 2014;62(10):698-738.

49. Hepworth MR, Maurer M, Hartmann S. Regulation of type 2 immunity to helminths by mast cells. Gut microbes. 2012;3(5):476-81.

50. Pennock JL, Grencis RK. The mast cell and gut nematodes: damage and defence. Chemical immunology and allergy. 2006;90:128-40.

51. Marshall JS. Mast-cell responses to pathogens. Nature reviews Immunology. 2004;4(10):787-99.

52. Ikeda T, Funaba M. Altered function of murine mast cells in response to lipopolysaccharide and peptidoglycan. Immunology letters. 2003;88(1):21-6.

53. Abraham SN, St John AL. Mast cell-orchestrated immunity to pathogens. Nature reviews Immunology. 2010;10(6):440-52.

54. Matsushima H, Yamada N, Matsue H, Shimada S. TLR3-, TLR7-, and TLR9-mediated production of proinflammatory cytokines and chemokines from murine connective tissue type skin-derived mast cells but not from bone marrow-derived mast cells. Journal of immunology. 2004;173(1):531-41.

55. Lee CC, Avalos AM, Ploegh HL. Accessory molecules for Toll-like receptors and their function. Nature reviews Immunology. 2012;12(3):168-79.

56. Sandig H, Bulfone-Paus S. TLR signaling in mast cells: common and unique features. Frontiers in immunology. 2012;3:185.

57. Supajatura V, Ushio H, Nakao A, Akira S, Okumura K, Ra C, et al. Differential responses of mast cell Toll-like receptors 2 and 4 in allergy and innate immunity. The Journal of clinical investigation. 2002;109(10):1351-9.

58. Kulka M, Alexopoulou L, Flavell RA, Metcalfe DD. Activation of mast cells by double- stranded RNA: evidence for activation through Toll-like receptor 3. The Journal of allergy and clinical immunology. 2004;114(1):174-82.

82

59. Orinska Z, Bulanova E, Budagian V, Metz M, Maurer M, Bulfone-Paus S. TLR3-induced activation of mast cells modulates CD8+ T-cell recruitment. Blood. 2005;106(3):978-87.

60. Fukuda M, Ushio H, Kawasaki J, Niyonsaba F, Takeuchi M, Baba T, et al. Expression and functional characterization of retinoic acid-inducible gene-I-like receptors of mast cells in response to viral infection. Journal of innate immunity. 2013;5(2):163-73.

61. Graham AC, Hilmer KM, Zickovich JM, Obar JJ. Inflammatory response of mast cells during influenza A virus infection is mediated by active infection and RIG-I signaling. Journal of immunology. 2013;190(9):4676-84.

62. Heib V, Becker M, Warger T, Rechtsteiner G, Tertilt C, Klein M, et al. Mast cells are crucial for early inflammation, migration of Langerhans cells, and CTL responses following topical application of TLR7 ligand in mice. Blood. 2007;110(3):946-53.

63. Franchi L, Warner N, Viani K, Nunez G. Function of Nod-like receptors in microbial recognition and host defense. Immunological reviews. 2009;227(1):106-28.

64. Wu L, Feng BS, He SH, Zheng PY, Croitoru K, Yang PC. Bacterial peptidoglycan breaks down intestinal tolerance via mast cell activation: the role of TLR2 and NOD2. Immunology and cell biology. 2007;85(7):538-45.

65. Feng BS, He SH, Zheng PY, Wu L, Yang PC. Mast cells play a crucial role in Staphylococcus aureus peptidoglycan-induced diarrhea. The American journal of pathology. 2007;171(2):537-47.

66. Malaviya R, Gao Z, Thankavel K, van der Merwe PA, Abraham SN. The mast cell tumor necrosis factor alpha response to FimH-expressing Escherichia coli is mediated by the glycosylphosphatidylinositol-anchored molecule CD48. Proceedings of the National Academy of Sciences of the United States of America. 1999;96(14):8110-5.

67. Munoz S, Hernandez-Pando R, Abraham SN, Enciso JA. Mast cell activation by Mycobacterium tuberculosis: mediator release and role of CD48. Journal of immunology. 2003;170(11):5590-6.

68. Bianchi ME. DAMPs, PAMPs and alarmins: all we need to know about danger. Journal of leukocyte biology. 2007;81(1):1-5.

69. Wan P, Liu X, Xiong Y, Ren Y, Chen J, Lu N, et al. Extracellular ATP mediates inflammatory responses in colitis via P2 x 7 receptor signaling. Scientific reports. 2016;6:19108.

83

70. Kurashima Y, Amiya T, Nochi T, Fujisawa K, Haraguchi T, Iba H, et al. Extracellular ATP mediates mast cell-dependent intestinal inflammation through P2X7 purinoceptors. Nature communications. 2012;3:1034.

71. Prodeus AP, Zhou X, Maurer M, Galli SJ, Carroll MC. Impaired mast cell-dependent natural immunity in complement C3-deficient mice. Nature. 1997;390(6656):172-5.

72. Babolewska E, Brzezinska-Blaszczyk E. Human-derived cathelicidin LL-37 directly activates mast cells to proinflammatory mediator synthesis and migratory response. Cellular immunology. 2015;293(2):67-73.

73. Yoshioka M, Fukuishi N, Kubo Y, Yamanobe H, Ohsaki K, Kawasoe Y, et al. Human cathelicidin CAP18/LL-37 changes mast cell function toward innate immunity. Biological & pharmaceutical bulletin. 2008;31(2):212-6.

74. Schiemann F, Brandt E, Gross R, Lindner B, Mittelstadt J, Sommerhoff CP, et al. The cathelicidin LL-37 activates human mast cells and is degraded by mast cell tryptase: counter-regulation by CXCL4. Journal of immunology. 2009;183(4):2223-31.

75. Niyonsaba F, Ushio H, Hara M, Yokoi H, Tominaga M, Takamori K, et al. Antimicrobial peptides human beta-defensins and cathelicidin LL-37 induce the secretion of a pruritogenic cytokine IL-31 by human mast cells. Journal of immunology. 2010;184(7):3526-34.

76. Chackerian AA, Oldham ER, Murphy EE, Schmitz J, Pflanz S, Kastelein RA. IL-1 receptor accessory protein and ST2 comprise the IL-33 receptor complex. Journal of immunology. 2007;179(4):2551-5.

77. Balato A, Di Caprio R, Canta L, Mattii M, Lembo S, Raimondo A, et al. IL-33 is regulated by TNF-alpha in normal and psoriatic skin. Archives of dermatological research. 2014;306(3):299-304.

78. Balato A, Lembo S, Mattii M, Schiattarella M, Marino R, De Paulis A, et al. IL-33 is secreted by psoriatic keratinocytes and induces pro-inflammatory cytokines via keratinocyte and mast cell activation. Experimental dermatology. 2012;21(11):892-4.

79. Savinko T, Matikainen S, Saarialho-Kere U, Lehto M, Wang G, Lehtimaki S, et al. IL-33 and ST2 in atopic dermatitis: expression profiles and modulation by triggering factors. The Journal of investigative dermatology. 2012;132(5):1392-400.

80. Borish L, Steinke JW. Interleukin-33 in asthma: how big of a role does it play? Current allergy and asthma reports. 2011;11(1):7-11.

84

81. Enoksson M, Lyberg K, Moller-Westerberg C, Fallon PG, Nilsson G, Lunderius- Andersson C. Mast cells as sensors of cell injury through IL-33 recognition. Journal of immunology. 2011;186(4):2523-8.

82. Moulin D, Donze O, Talabot-Ayer D, Mezin F, Palmer G, Gabay C. Interleukin (IL)-33 induces the release of pro-inflammatory mediators by mast cells. Cytokine. 2007;40(3):216-25.

83. Iikura M, Suto H, Kajiwara N, Oboki K, Ohno T, Okayama Y, et al. IL-33 can promote survival, adhesion and cytokine production in human mast cells. Laboratory investigation; a journal of technical methods and pathology. 2007;87(10):971-8.

84. Ito T, Egusa C, Maeda T, Numata T, Nakano N, Nishiyama C, et al. IL-33 promotes MHC class II expression in murine mast cells. Immunity, inflammation and disease. 2015;3(3):196-208.

85. Gordon JR, Galli SJ. Mast cells as a source of both preformed and immunologically inducible TNF-alpha/cachectin. Nature. 1990;346(6281):274-6.

86. Grutzkau A, Kruger-Krasagakes S, Kogel H, Moller A, Lippert U, Henz BM. Detection of intracellular interleukin-8 in human mast cells: flow cytometry as a guide for immunoelectron microscopy. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society. 1997;45(7):935-45.

87. Sayed BA, Christy A, Quirion MR, Brown MA. The master switch: the role of mast cells in autoimmunity and tolerance. Annual review of immunology. 2008;26:705-39.

88. Lundequist A, Pejler G. Biological implications of preformed mast cell mediators. Cellular and molecular life sciences : CMLS. 2011;68(6):965-75.

89. Echtenacher B, Mannel DN, Hultner L. Critical protective role of mast cells in a model of acute septic peritonitis. Nature. 1996;381(6577):75-7.

90. Malaviya R, Ikeda T, Ross E, Abraham SN. Mast cell modulation of neutrophil influx and bacterial clearance at sites of infection through TNF-alpha. Nature. 1996;381(6577):77-80.

91. Ratliff TL. Contribution of mast cells to bacterial clearance and their proliferation during experimental cystitis induced by type 1 fimbriated E. coli. The Journal of urology. 2005;173(2):662.

92. Velin D, Bachmann D, Bouzourene H, Michetti P. Mast cells are critical mediators of vaccine-induced Helicobacter clearance in the mouse model. Gastroenterology. 2005;129(1):142-55.

85

93. Gekara NO, Weiss S. Mast cells initiate early anti-Listeria host defences. Cellular microbiology. 2008;10(1):225-36.

94. Sutherland RE, Olsen JS, McKinstry A, Villalta SA, Wolters PJ. Mast cell IL-6 improves survival from Klebsiella pneumonia and sepsis by enhancing neutrophil killing. Journal of immunology. 2008;181(8):5598-605.

95. Xu X, Zhang D, Lyubynska N, Wolters PJ, Killeen NP, Baluk P, et al. Mast cells protect mice from Mycoplasma pneumonia. American journal of respiratory and critical care medicine. 2006;173(2):219-25.

96. Abel J, Goldmann O, Ziegler C, Holtje C, Smeltzer MS, Cheung AL, et al. Staphylococcus aureus evades the extracellular antimicrobial activity of mast cells by promoting its own uptake. Journal of innate immunity. 2011;3(5):495-507.

97. Matsui H, Sekiya Y, Takahashi T, Nakamura M, Imanishi K, Yoshida H, et al. Dermal mast cells reduce progressive tissue necrosis caused by subcutaneous infection with Streptococcus pyogenes in mice. Journal of medical microbiology. 2011;60(Pt 1):128-34.

98. Siebenhaar F, Syska W, Weller K, Magerl M, Zuberbier T, Metz M, et al. Control of Pseudomonas aeruginosa skin infections in mice is mast cell-dependent. The American journal of pathology. 2007;170(6):1910-6.

99. Malaviya R, Abraham SN. Role of mast cell leukotrienes in neutrophil recruitment and bacterial clearance in infectious peritonitis. Journal of leukocyte biology. 2000;67(6):841- 6.

100. Piliponsky AM, Chen CC, Grimbaldeston MA, Burns-Guydish SM, Hardy J, Kalesnikoff J, et al. Mast cell-derived TNF can exacerbate mortality during severe bacterial infections in C57BL/6-KitW-sh/W-sh mice. The American journal of pathology. 2010;176(2):926- 38.

101. Nakano N, Nishiyama C, Kanada S, Niwa Y, Shimokawa N, Ushio H, et al. Involvement of mast cells in IL-12/23 p40 production is essential for survival from polymicrobial infections. Blood. 2007;109(11):4846-55.

102. Schramm R, Schaefer T, Menger MD, Thorlacius H. Acute mast cell-dependent neutrophil recruitment in the skin is mediated by KC and LFA-1: inhibitory mechanisms of dexamethasone. Journal of leukocyte biology. 2002;72(6):1122-32.

103. Thakurdas SM, Melicoff E, Sansores-Garcia L, Moreira DC, Petrova Y, Stevens RL, et al. The mast cell-restricted tryptase mMCP-6 has a critical immunoprotective role in bacterial infections. The Journal of biological chemistry. 2007;282(29):20809-15.

86

104. Huang C, De Sanctis GT, O'Brien PJ, Mizgerd JP, Friend DS, Drazen JM, et al. Evaluation of the substrate specificity of human mast cell tryptase beta I and demonstration of its importance in bacterial infections of the lung. The Journal of biological chemistry. 2001;276(28):26276-84.

105. Huang C, Sali A, Stevens RL. Regulation and function of mast cell proteases in inflammation. Journal of clinical immunology. 1998;18(3):169-83.

106. Doener F, Michel A, Reuter S, Friedrich P, Bohm L, Relle M, et al. Mast cell-derived mediators promote murine neutrophil effector functions. International immunology. 2013;25(10):553-61.

107. Ketavarapu JM, Rodriguez AR, Yu JJ, Cong Y, Murthy AK, Forsthuber TG, et al. Mast cells inhibit intramacrophage Francisella tularensis replication via contact and secreted products including IL-4. Proceedings of the National Academy of Sciences of the United States of America. 2008;105(27):9313-8.

108. Rodriguez AR, Yu JJ, Murthy AK, Guentzel MN, Klose KE, Forsthuber TG, et al. Mast cell/IL-4 control of Francisella tularensis replication and host cell death is associated with increased ATP production and phagosomal acidification. Mucosal immunology. 2011;4(2):217-26.

109. Lima HG, Pinke KH, Gardizani TP, Souza-Junior DA, Carlos D, Avila-Campos MJ, et al. Mast cells act as phagocytes against the periodontopathogen Aggregatibacter actinomycetemcomitans. Journal of periodontology. 2013;84(2):265-72.

110. Malaviya R, Ross EA, MacGregor JI, Ikeda T, Little JR, Jakschik BA, et al. Mast cell phagocytosis of FimH-expressing enterobacteria. Journal of immunology. 1994;152(4):1907-14.

111. Arock M, Ross E, Lai-Kuen R, Averlant G, Gao Z, Abraham SN. Phagocytic and tumor necrosis factor alpha response of human mast cells following exposure to gram-negative and gram-positive bacteria. Infection and immunity. 1998;66(12):6030-4.

112. Hancock RE, Lehrer R. Cationic peptides: a new source of antibiotics. Trends in biotechnology. 1998;16(2):82-8.

113. Shai Y. Mode of action of membrane active antimicrobial peptides. Biopolymers. 2002;66(4):236-48.

114. Nguyen LT, Haney EF, Vogel HJ. The expanding scope of antimicrobial peptide structures and their modes of action. Trends in biotechnology. 2011;29(9):464-72.

87

115. Yang D, Chertov O, Bykovskaia SN, Chen Q, Buffo MJ, Shogan J, et al. Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science. 1999;286(5439):525-8.

116. Lehrer RI, Lichtenstein AK, Ganz T. Defensins: antimicrobial and cytotoxic peptides of mammalian cells. Annual review of immunology. 1993;11:105-28.

117. Di Nardo A, Vitiello A, Gallo RL. Cutting edge: mast cell antimicrobial activity is mediated by expression of cathelicidin antimicrobial peptide. Journal of immunology. 2003;170(5):2274-8.

118. Di Nardo A, Yamasaki K, Dorschner RA, Lai Y, Gallo RL. Mast cell cathelicidin antimicrobial peptide prevents invasive group A Streptococcus infection of the skin. Journal of immunology. 2008;180(11):7565-73.

119. Cruse G, Fernandes VE, de Salort J, Pankhania D, Marinas MS, Brewin H, et al. Human lung mast cells mediate pneumococcal cell death in response to activation by pneumolysin. Journal of immunology. 2010;184(12):7108-15.

120. Wei OL, Hilliard A, Kalman D, Sherman M. Mast cells limit systemic bacterial dissemination but not colitis in response to Citrobacter rodentium. Infection and immunity. 2005;73(4):1978-85.

121. Brinkmann V, Reichard U, Goosmann C, Fauler B, Uhlemann Y, Weiss DS, et al. Neutrophil extracellular traps kill bacteria. Science. 2004;303(5663):1532-5.

122. von Kockritz-Blickwede M, Goldmann O, Thulin P, Heinemann K, Norrby-Teglund A, Rohde M, et al. Phagocytosis-independent antimicrobial activity of mast cells by means of extracellular trap formation. Blood. 2008;111(6):3070-80.

123. Scheb-Wetzel M, Rohde M, Bravo A, Goldmann O. New insights into the antimicrobial effect of mast cells against Enterococcus faecalis. Infection and immunity. 2014;82(11):4496-507.

124. Roy A, Ganesh G, Sippola H, Bolin S, Sawesi O, Dagalv A, et al. Mast cell chymase degrades the alarmins heat shock protein 70, biglycan, HMGB1, and interleukin-33 (IL-33) and limits danger-induced inflammation. The Journal of biological chemistry. 2014;289(1):237-50.

125. Maurer M, Wedemeyer J, Metz M, Piliponsky AM, Weller K, Chatterjea D, et al. Mast cells promote homeostasis by limiting endothelin-1-induced toxicity. Nature. 2004;432(7016):512-6.

88

126. Piliponsky AM, Chen CC, Nishimura T, Metz M, Rios EJ, Dobner PR, et al. Neurotensin increases mortality and mast cells reduce neurotensin levels in a mouse model of sepsis. Nature medicine. 2008;14(4):392-8.

127. Metz M, Magerl M, Kuhl NF, Valeva A, Bhakdi S, Maurer M. Mast cells determine the magnitude of bacterial toxin-induced skin inflammation. Experimental dermatology. 2009;18(2):160-6.

128. Seeley EJ, Sutherland RE, Kim SS, Wolters PJ. Systemic mast cell degranulation increases mortality during polymicrobial septic peritonitis in mice. Journal of leukocyte biology. 2011;90(3):591-7.

129. Dahdah A, Gautier G, Attout T, Fiore F, Lebourdais E, Msallam R, et al. Mast cells aggravate sepsis by inhibiting peritoneal macrophage phagocytosis. The Journal of clinical investigation. 2014;124(10):4577-89.

130. Schilling JA. Wound healing. The Surgical clinics of North America. 1976;56(4):859-74.

131. el Sayed SO, Dyson M. Responses of dermal mast cells to injury. Journal of anatomy. 1993;182 ( Pt 3):369-76.

132. Weller K, Foitzik K, Paus R, Syska W, Maurer M. Mast cells are required for normal healing of skin wounds in mice. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2006;20(13):2366-8.

133. Zoog SJ, Itano A, Trueblood E, Pacheco E, Zhou L, Zhang X, et al. Antagonists of CD117 (cKit) signaling inhibit mast cell accumulation in healing skin wounds. Cytometry Part A : the journal of the International Society for Analytical Cytology. 2009;75(3):189-98.

134. Vliagoftis H. Thrombin induces mast cell adhesion to fibronectin: evidence for involvement of protease-activated receptor-1. Journal of immunology. 2002;169(8):4551- 8.

135. Pejler G, Karlstrom A. Thrombin is inactivated by mast cell secretory granule chymase. The Journal of biological chemistry. 1993;268(16):11817-22.

136. Dvorak AM. Mast cell-derived mediators of enhanced microvascular permeability, vascular permeability factor/vascular endothelial growth factor, histamine, and serotonin, cause leakage of macromolecules through a new endothelial cell permeability organelle, the vesiculo-vacuolar organelle. Chemical immunology and allergy. 2005;85:185-204.

89

137. Egozi EI, Ferreira AM, Burns AL, Gamelli RL, Dipietro LA. Mast cells modulate the inflammatory but not the proliferative response in healing wounds. Wound repair and regeneration : official publication of the Wound Healing Society [and] the European Tissue Repair Society. 2003;11(1):46-54.

138. Katayama I, Yokozeki H, Nishioka K. Mast-cell-derived mediators induce epidermal cell proliferation: clue for lichenified skin lesion formation in atopic dermatitis. International archives of allergy and immunology. 1992;98(4):410-4.

139. Cairns JA, Walls AF. Mast cell tryptase is a mitogen for epithelial cells. Stimulation of IL- 8 production and intercellular adhesion molecule-1 expression. Journal of immunology. 1996;156(1):275-83.

140. Qu Z, Huang X, Ahmadi P, Stenberg P, Liebler JM, Le AC, et al. Synthesis of basic fibroblast growth factor by murine mast cells. Regulation by transforming growth factor beta, tumor necrosis factor alpha, and stem cell factor. International archives of allergy and immunology. 1998;115(1):47-54.

141. Reed JA, Albino AP, McNutt NS. Human cutaneous mast cells express basic fibroblast growth factor. Laboratory investigation; a journal of technical methods and pathology. 1995;72(2):215-22.

142. Shiota N, Nishikori Y, Kakizoe E, Shimoura K, Niibayashi T, Shimbori C, et al. Pathophysiological role of skin mast cells in wound healing after scald injury: study with mast cell-deficient W/W(V) mice. International archives of allergy and immunology. 2010;151(1):80-8.

143. Younan GJ, Heit YI, Dastouri P, Kekhia H, Xing W, Gurish MF, et al. Mast cells are required in the proliferation and remodeling phases of microdeformational wound therapy. and reconstructive surgery. 2011;128(6):649e-58e.

144. Succar J, Douaiher J, Lancerotto L, Li Q, Yamaguchi R, Younan G, et al. The role of mouse mast cell proteases in the proliferative phase of wound healing in microdeformational wound therapy. Plastic and reconstructive surgery. 2014;134(3):459- 67.

145. Chen L, Schrementi ME, Ranzer MJ, Wilgus TA, DiPietro LA. Blockade of mast cell activation reduces cutaneous scar formation. PloS one. 2014;9(1):e85226.

146. Kanbe N, Tanaka A, Kanbe M, Itakura A, Kurosawa M, Matsuda H. Human mast cells produce matrix metalloproteinase 9. European journal of immunology. 1999;29(8):2645-9.

147. Lohi J, Harvima I, Keski-Oja J. Pericellular substrates of human mast cell tryptase: 72,000 dalton gelatinase and fibronectin. Journal of cellular biochemistry. 1992;50(4):337-49.

90

148. Lees M, Taylor DJ, Woolley DE. Mast cell proteinases activate precursor forms of collagenase and stromelysin, but not of gelatinases A and B. European journal of biochemistry / FEBS. 1994;223(1):171-7.

149. Gailit J, Marchese MJ, Kew RR, Gruber BL. The differentiation and function of myofibroblasts is regulated by mast cell mediators. The Journal of investigative dermatology. 2001;117(5):1113-9.

150. Nauta AC, Grova M, Montoro DT, Zimmermann A, Tsai M, Gurtner GC, et al. Evidence that mast cells are not required for healing of splinted cutaneous excisional wounds in mice. PloS one. 2013;8(3):e59167.

151. Antsiferova M, Martin C, Huber M, Feyerabend TB, Forster A, Hartmann K, et al. Mast cells are dispensable for normal and activin-promoted wound healing and skin carcinogenesis. Journal of immunology. 2013;191(12):6147-55.

152. Willenborg S, Eckes B, Brinckmann J, Krieg T, Waisman A, Hartmann K, et al. Genetic ablation of mast cells redefines the role of mast cells in skin wound healing and bleomycin-induced fibrosis. The Journal of investigative dermatology. 2014;134(7):2005- 15.

153. Bessa LJ, Fazii P, Di Giulio M, Cellini L. Bacterial isolates from infected wounds and their antibiotic susceptibility pattern: some remarks about wound infection. International wound journal. 2015;12(1):47-52.

154. Giacometti A, Cirioni O, Schimizzi AM, Del Prete MS, Barchiesi F, D'Errico MM, et al. Epidemiology and microbiology of surgical wound infections. Journal of clinical microbiology. 2000;38(2):918-22.

155. Hirsch EB, Tam VH. Impact of multidrug-resistant Pseudomonas aeruginosa infection on patient outcomes. Expert review of pharmacoeconomics & outcomes research. 2010;10(4):441-51.

156. System N. National Nosocomial Infections Surveillance (NNIS) System Report, Data Summary from January 1990-May 1999, issued June 1999. A report from the NNIS System. American journal of infection control. 1999;27(6):520-32.

157. Gessard C On the blue and green coloration that appears on bandages. Rev Infect Dis. 1984.

158. Finck-Barbancon V, Goranson J, Zhu L, Sawa T, Wiener-Kronish JP, Fleiszig SM, et al. ExoU expression by Pseudomonas aeruginosa correlates with acute cytotoxicity and epithelial injury. Molecular microbiology. 1997;25(3):547-57.

91

159. Lister PD, Wolter DJ, Hanson ND. Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clinical microbiology reviews. 2009;22(4):582-610.

160. Yuspa SH, Hawley-Nelson P, Koehler B, Stanley JR. A survey of transformation markers in differentiating epidermal cell lines in culture. Cancer research. 1980;40(12):4694-703.

161. Boukamp P, Petrussevska RT, Breitkreutz D, Hornung J, Markham A, Fusenig NE. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. The Journal of cell biology. 1988;106(3):761-71.

162. Kopf M, Baumann H, Freer G, Freudenberg M, Lamers M, Kishimoto T, et al. Impaired immune and acute-phase responses in interleukin-6-deficient mice. Nature. 1994;368(6469):339-42.

163. Adachi O, Kawai T, Takeda K, Matsumoto M, Tsutsui H, Sakagami M, et al. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function. Immunity. 1998;9(1):143-50.

164. Grimbaldeston MA, Chen CC, Piliponsky AM, Tsai M, Tam SY, Galli SJ. Mast cell- deficient W-sash c-kit mutant Kit W-sh/W-sh mice as a model for investigating mast cell biology in vivo. The American journal of pathology. 2005;167(3):835-48.

165. Yang D, Chertov O, Oppenheim JJ. The role of mammalian antimicrobial peptides and proteins in awakening of innate host defenses and adaptive immunity. Cellular and molecular life sciences : CMLS. 2001;58(7):978-89.

166. Bals R. Epithelial antimicrobial peptides in host defense against infection. Respiratory research. 2000;1(3):141-50.

167. Lehrer RI, Ganz T, Szklarek D, Selsted ME. Modulation of the in vitro candidacidal activity of human neutrophil defensins by target cell metabolism and divalent cations. The Journal of clinical investigation. 1988;81(6):1829-35.

168. Cole AM, Darouiche RO, Legarda D, Connell N, Diamond G. Characterization of a fish antimicrobial peptide: gene expression, subcellular localization, and spectrum of activity. Antimicrobial agents and chemotherapy. 2000;44(8):2039-45.

169. Dhople V, Krukemeyer A, Ramamoorthy A. The human beta-defensin-3, an antibacterial peptide with multiple biological functions. Biochimica et biophysica acta. 2006;1758(9):1499-512.

92

170. Hinrichsen K, Podschun R, Schubert S, Schroder JM, Harder J, Proksch E. Mouse beta- defensin-14, an antimicrobial ortholog of human beta-defensin-3. Antimicrobial agents and chemotherapy. 2008;52(5):1876-9.

171. Glaser R, Harder J, Lange H, Bartels J, Christophers E, Schroder JM. Antimicrobial psoriasin (S100A7) protects human skin from Escherichia coli infection. Nature immunology. 2005;6(1):57-64.

172. Boudreau RT, Garduno R, Lin TJ. Protein phosphatase 2A and protein kinase Calpha are physically associated and are involved in Pseudomonas aeruginosa-induced interleukin 6 production by mast cells. The Journal of biological chemistry. 2002;277(7):5322-9.

173. Kandere-Grzybowska K, Letourneau R, Kempuraj D, Donelan J, Poplawski S, Boucher W, et al. IL-1 induces vesicular secretion of IL-6 without degranulation from human mast cells. Journal of immunology. 2003;171(9):4830-6.

174. Deguine J, Barton GM. MyD88: a central player in innate immune signaling. F1000prime reports. 2014;6:97.

175. Tung HY, Plunkett B, Huang SK, Zhou Y. Murine mast cells secrete and respond to interleukin-33. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research. 2014;34(3):141-7.

176. Metz M, Maurer M. Mast cells--key effector cells in immune responses. Trends in immunology. 2007;28(5):234-41.

177. Kadow S, Jux B, Zahner SP, Wingerath B, Chmill S, Clausen BE, et al. Aryl hydrocarbon receptor is critical for homeostasis of invariant gammadelta T cells in the murine epidermis. Journal of immunology. 2011;187(6):3104-10.

178. Rak GD, Osborne LC, Siracusa MC, Kim BS, Wang K, Bayat A, et al. IL-33-Dependent Group 2 Innate Lymphoid Cells Promote Cutaneous Wound Healing. The Journal of investigative dermatology. 2016;136(2):487-96.

179. Haeryfar SM, Hoskin DW. Thy-1: more than a mouse pan-T cell marker. Journal of immunology. 2004;173(6):3581-8.

180. Brancato SK, Albina JE. Wound macrophages as key regulators of repair: origin, phenotype, and function. The American journal of pathology. 2011;178(1):19-25.

181. Jameson J, Ugarte K, Chen N, Yachi P, Fuchs E, Boismenu R, et al. A role for skin gammadelta T cells in wound repair. Science. 2002;296(5568):747-9.

93

182. MacLeod AS, Hemmers S, Garijo O, Chabod M, Mowen K, Witherden DA, et al. Dendritic epidermal T cells regulate skin antimicrobial barrier function. The Journal of clinical investigation. 2013;123(10):4364-74.

183. Lancerotto L, Bayer LR, Orgill DP. Mechanisms of action of microdeformational wound therapy. Seminars in cell & developmental biology. 2012;23(9):987-92.

184. van de Goot F, Krijnen PA, Begieneman MP, Ulrich MM, Middelkoop E, Niessen HW. Acute inflammation is persistent locally in burn wounds: a pivotal role for complement and C-reactive protein. Journal of burn care & research : official publication of the American Burn Association. 2009;30(2):274-80.

185. Wu JC, Rose LF, Christy RJ, Leung KP, Chan RK. Full-Thickness Thermal Injury Delays Wound Closure in a Murine Model. Advances in wound care. 2015;4(2):83-91.

186. Madsen SM, Westh H, Danielsen L, Rosdahl VT. Bacterial colonization and healing of venous leg ulcers. APMIS : acta pathologica, microbiologica, et immunologica Scandinavica. 1996;104(12):895-9.

187. Menke NB, Ward KR, Witten TM, Bonchev DG, Diegelmann RF. Impaired wound healing. Clinics in dermatology. 2007;25(1):19-25.

188. Edwards R, Harding KG. Bacteria and wound healing. Current opinion in infectious diseases. 2004;17(2):91-6.

189. Galiano RD, Michaels Jt, Dobryansky M, Levine JP, Gurtner GC. Quantitative and reproducible murine model of excisional wound healing. Wound repair and regeneration : official publication of the Wound Healing Society [and] the European Tissue Repair Society. 2004;12(4):485-92.

190. Stewart PS, Costerton JW. Antibiotic resistance of bacteria in biofilms. Lancet. 2001;358(9276):135-8.

191. Sauer K, Camper AK, Ehrlich GD, Costerton JW, Davies DG. Pseudomonas aeruginosa displays multiple phenotypes during development as a biofilm. Journal of bacteriology. 2002;184(4):1140-54.

192. Watters C, DeLeon K, Trivedi U, Griswold JA, Lyte M, Hampel KJ, et al. Pseudomonas aeruginosa biofilms perturb wound resolution and antibiotic tolerance in diabetic mice. Medical microbiology and immunology. 2013;202(2):131-41.

94

193. Zhao G, Usui ML, Underwood RA, Singh PK, James GA, Stewart PS, et al. Time course study of delayed wound healing in a biofilm-challenged diabetic mouse model. Wound repair and regeneration : official publication of the Wound Healing Society [and] the European Tissue Repair Society. 2012;20(3):342-52.

194. Galan JE, Collmer A. Type III secretion machines: bacterial devices for protein delivery into host cells. Science. 1999;284(5418):1322-8.

195. Danielsen L, Balslev E, Doring G, Hoiby N, Madsen SM, Agren M, et al. Ulcer bed infection. Report of a case of enlarging venous leg ulcer colonized by Pseudomonas aeruginosa. APMIS : acta pathologica, microbiologica, et immunologica Scandinavica. 1998;106(7):721-6.

196. Barbieri JT, Sun J. Pseudomonas aeruginosa ExoS and ExoT. Reviews of physiology, biochemistry and pharmacology. 2004;152:79-92.

197. Pavlovskis OR, Iglewski BH, Pollack M. Mechanism of action of Pseudomonas aeruginosa exotoxin A in experimental mouse infections: adenosine diphosphate ribosylation of elongation factor 2. Infection and immunity. 1978;19(1):29-33.

198. Pollack M, Anderson SE, Jr. Toxicity of Pseudomonas aeruginosa exotoxin A for human macrophages. Infection and immunity. 1978;19(3):1092-6.

199. El-Zaim HS, Chopra AK, Peterson JW, Vasil ML, Heggers JP. Protection against exotoxin A (ETA) and Pseudomonas aeruginosa infection in mice with ETA-specific antipeptide antibodies. Infection and immunity. 1998;66(11):5551-4.

200. Vasil ML, Stonehouse MJ, Vasil AI, Wadsworth SJ, Goldfine H, Bolcome RE, 3rd, et al. A complex extracellular sphingomyelinase of Pseudomonas aeruginosa inhibits angiogenesis by selective cytotoxicity to endothelial cells. PLoS pathogens. 2009;5(5):e1000420.

201. Jeffery Marano R, Jane Wallace H, Wijeratne D, William Fear M, San Wong H, O'Handley R. Secreted biofilm factors adversely affect cellular wound healing responses in vitro. Scientific reports. 2015;5:13296.

202. de Kievit TR. Quorum sensing in Pseudomonas aeruginosa biofilms. Environmental microbiology. 2009;11(2):279-88.

203. Telford G, Wheeler D, Williams P, Tomkins PT, Appleby P, Sewell H, et al. The Pseudomonas aeruginosa quorum-sensing signal molecule N-(3-oxododecanoyl)-L- homoserine lactone has immunomodulatory activity. Infection and immunity. 1998;66(1):36-42.

95

204. Shiner EK, Terentyev D, Bryan A, Sennoune S, Martinez-Zaguilan R, Li G, et al. Pseudomonas aeruginosa autoinducer modulates host cell responses through calcium signalling. Cellular microbiology. 2006;8(10):1601-10.

205. Jacobsen JN, Andersen AS, Krogfelt KA. Impact of Pseudomonas aeruginosa quorum sensing on cellular wound healing responses in vitro. Scandinavian journal of infectious diseases. 2012;44(8):615-9.

206. Muller M, Trocme C, Lardy B, Morel F, Halimi S, Benhamou PY. Matrix metalloproteinases and diabetic foot ulcers: the ratio of MMP-1 to TIMP-1 is a predictor of wound healing. Diabetic medicine : a journal of the British Diabetic Association. 2008;25(4):419-26.

207. Grinnell F, Zhu M. Fibronectin degradation in chronic wounds depends on the relative levels of elastase, alpha1-proteinase inhibitor, and alpha2-macroglobulin. The Journal of investigative dermatology. 1996;106(2):335-41.

208. Lauer G, Sollberg S, Cole M, Flamme I, Sturzebecher J, Mann K, et al. Expression and proteolysis of vascular endothelial growth factor is increased in chronic wounds. The Journal of investigative dermatology. 2000;115(1):12-8.

209. Grice EA, Segre JA. Interaction of the microbiome with the innate immune response in chronic wounds. Advances in experimental medicine and biology. 2012;946:55-68.

210. Lobmann R, Zemlin C, Motzkau M, Reschke K, Lehnert H. Expression of matrix metalloproteinases and growth factors in diabetic foot wounds treated with a protease absorbent dressing. Journal of diabetes and its complications. 2006;20(5):329-35.

211. Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M. The chemokine system in diverse forms of macrophage activation and polarization. Trends in immunology. 2004;25(12):677-86.

212. Sindrilaru A, Peters T, Wieschalka S, Baican C, Baican A, Peter H, et al. An unrestrained proinflammatory M1 macrophage population induced by iron impairs wound healing in humans and mice. The Journal of clinical investigation. 2011;121(3):985-97.

213. Mirza R, Koh TJ. Dysregulation of monocyte/macrophage phenotype in wounds of diabetic mice. Cytokine. 2011;56(2):256-64.

214. Terada LS, Johansen KA, Nowbar S, Vasil AI, Vasil ML. Pseudomonas aeruginosa hemolytic phospholipase C suppresses neutrophil respiratory burst activity. Infection and immunity. 1999;67(5):2371-6.

96

215. Tateda K, Ishii Y, Horikawa M, Matsumoto T, Miyairi S, Pechere JC, et al. The Pseudomonas aeruginosa autoinducer N-3-oxododecanoyl homoserine lactone accelerates apoptosis in macrophages and neutrophils. Infection and immunity. 2003;71(10):5785-93.

216. Glucksam-Galnoy Y, Sananes R, Silberstein N, Krief P, Kravchenko VV, Meijler MM, et al. The bacterial quorum-sensing signal molecule N-3-oxo-dodecanoyl-L-homoserine lactone reciprocally modulates pro- and anti-inflammatory cytokines in activated macrophages. Journal of immunology. 2013;191(1):337-44.

217. Cowen T, Trigg P, Eady RA. Distribution of mast cells in human dermis: development of a mapping technique. The British journal of dermatology. 1979;100(6):635-40.

218. Albanesi C, Scarponi C, Giustizieri ML, Girolomoni G. Keratinocytes in inflammatory skin diseases. Current drug targets Inflammation and allergy. 2005;4(3):329-34.

219. Braff MH, Bardan A, Nizet V, Gallo RL. Cutaneous defense mechanisms by antimicrobial peptides. The Journal of investigative dermatology. 2005;125(1):9-13.

220. Frohm M, Agerberth B, Ahangari G, Stahle-Backdahl M, Liden S, Wigzell H, et al. The expression of the gene coding for the antibacterial peptide LL-37 is induced in human keratinocytes during inflammatory disorders. The Journal of biological chemistry. 1997;272(24):15258-63.

221. Dorschner RA, Pestonjamasp VK, Tamakuwala S, Ohtake T, Rudisill J, Nizet V, et al. Cutaneous injury induces the release of cathelicidin anti-microbial peptides active against group A Streptococcus. The Journal of investigative dermatology. 2001;117(1):91-7.

222. Meyer-Hoffert U, Zimmermann A, Czapp M, Bartels J, Koblyakova Y, Glaser R, et al. Flagellin delivery by Pseudomonas aeruginosa rhamnolipids induces the antimicrobial protein psoriasin in human skin. PloS one. 2011;6(1):e16433.

223. Harder J, Bartels J, Christophers E, Schroder JM. Isolation and characterization of human beta -defensin-3, a novel human inducible peptide antibiotic. The Journal of biological chemistry. 2001;276(8):5707-13.

224. Dosler S, Karaaslan E. Inhibition and destruction of Pseudomonas aeruginosa biofilms by antibiotics and antimicrobial peptides. Peptides. 2014;62:32-7.

225. Overhage J, Campisano A, Bains M, Torfs EC, Rehm BH, Hancock RE. Human host defense peptide LL-37 prevents bacterial biofilm formation. Infection and immunity. 2008;76(9):4176-82.

97

226. Gallo RL, Kim KJ, Bernfield M, Kozak CA, Zanetti M, Merluzzi L, et al. Identification of CRAMP, a cathelin-related antimicrobial peptide expressed in the embryonic and adult mouse. The Journal of biological chemistry. 1997;272(20):13088-93.

227. Jeong K-WS, So-Young; Kim, Jin-Kyoung; Kim, Yang-Mee. Antibacterial Activity and Synergism of the Hybrid Antimicrobial Peptide, CAMA-syn. Bulletin of the Korean Chemical Society. 2009;30(8):1839-44.

228. Piers KL, Brown MH, Hancock RE. Improvement of outer membrane-permeabilizing and lipopolysaccharide-binding activities of an antimicrobial cationic peptide by C-terminal modification. Antimicrobial agents and chemotherapy. 1994;38(10):2311-6.

229. Heilborn JD, Nilsson MF, Kratz G, Weber G, Sorensen O, Borregaard N, et al. The cathelicidin anti-microbial peptide LL-37 is involved in re-epithelialization of human skin wounds and is lacking in chronic ulcer epithelium. The Journal of investigative dermatology. 2003;120(3):379-89.

230. Nizet V, Ohtake T, Lauth X, Trowbridge J, Rudisill J, Dorschner RA, et al. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature. 2001;414(6862):454-7.

231. Huang LC, Reins RY, Gallo RL, McDermott AM. Cathelicidin-deficient (Cnlp -/- ) mice show increased susceptibility to Pseudomonas aeruginosa keratitis. Investigative ophthalmology & visual science. 2007;48(10):4498-508.

232. Beaumont PE, McHugh B, Gwyer Findlay E, Mackellar A, Mackenzie KJ, Gallo RL, et al. Cathelicidin host defence peptide augments clearance of pulmonary Pseudomonas aeruginosa infection by its influence on neutrophil function in vivo. PloS one. 2014;9(6):e99029.

233. Grivennikov S, Karin E, Terzic J, Mucida D, Yu GY, Vallabhapurapu S, et al. IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis- associated cancer. Cancer cell. 2009;15(2):103-13.

234. Buchau AS. EGFR (trans)activation mediates IL-8 and distinct human antimicrobial peptide and protein production following skin injury. The Journal of investigative dermatology. 2010;130(4):929-32.

235. Erdag G, Morgan JR. Interleukin-1alpha and interleukin-6 enhance the antibacterial properties of cultured composite keratinocyte grafts. Annals of surgery. 2002;235(1):113- 24.

98

236. Jones G, Ding C. Tocilizumab: a review of its safety and efficacy in rheumatoid arthritis. Clinical medicine insights Arthritis and musculoskeletal disorders. 2010;3:81-9.

237. Raoust E, Balloy V, Garcia-Verdugo I, Touqui L, Ramphal R, Chignard M. Pseudomonas aeruginosa LPS or flagellin are sufficient to activate TLR-dependent signaling in murine alveolar macrophages and airway epithelial cells. PloS one. 2009;4(10):e7259.

238. Feldmeyer L, Keller M, Niklaus G, Hohl D, Werner S, Beer HD. The inflammasome mediates UVB-induced activation and secretion of interleukin-1beta by keratinocytes. Current biology : CB. 2007;17(13):1140-5.

239. Milora KA, Miller SL, Sanmiguel JC, Jensen LE. Interleukin-1alpha released from HSV-1- infected keratinocytes acts as a functional alarmin in the skin. Nature communications. 2014;5:5230.

240. Olaru F, Jensen LE. Staphylococcus aureus stimulates neutrophil targeting chemokine expression in keratinocytes through an autocrine IL-1alpha signaling loop. The Journal of investigative dermatology. 2010;130(7):1866-76.

241. Smith RS, Harris SG, Phipps R, Iglewski B. The Pseudomonas aeruginosa quorum-sensing molecule N-(3-oxododecanoyl)homoserine lactone contributes to virulence and induces inflammation in vivo. Journal of bacteriology. 2002;184(4):1132-9.

242. Steinstraesser L, Sorkin M, Niederbichler AD, Becerikli M, Stupka J, Daigeler A, et al. A novel human skin chamber model to study wound infection ex vivo. Archives of dermatological research. 2010;302(5):357-65.

243. Oizumi A, Nakayama H, Okino N, Iwahara C, Kina K, Matsumoto R, et al. Pseudomonas- derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate. PloS one. 2014;9(2):e89402.

244. Arlehamn CS, Evans TJ. Pseudomonas aeruginosa pilin activates the inflammasome. Cellular microbiology. 2011;13(3):388-401.

245. Cohen TS, Prince AS. Activation of inflammasome signaling mediates pathology of acute P. aeruginosa pneumonia. The Journal of clinical investigation. 2013;123(4):1630-7.

246. Polumuri SK, Jayakar GG, Shirey KA, Roberts ZJ, Perkins DJ, Pitha PM, et al. Transcriptional regulation of murine IL-33 by TLR and non-TLR agonists. Journal of immunology. 2012;189(1):50-60.

247. Sumikawa Y, Asada H, Hoshino K, Azukizawa H, Katayama I, Akira S, et al. Induction of beta-defensin 3 in keratinocytes stimulated by bacterial lipopeptides through toll-like receptor 2. Microbes and infection / Institut Pasteur. 2006;8(6):1513-21.

99

248. Pichery M, Mirey E, Mercier P, Lefrancais E, Dujardin A, Ortega N, et al. Endogenous IL- 33 is highly expressed in mouse epithelial barrier tissues, lymphoid organs, brain, embryos, and inflamed tissues: in situ analysis using a novel Il-33-LacZ gene trap reporter strain. Journal of immunology. 2012;188(7):3488-95.

249. Epelman S, Stack D, Bell C, Wong E, Neely GG, Krutzik S, et al. Different domains of Pseudomonas aeruginosa exoenzyme S activate distinct TLRs. Journal of immunology. 2004;173(3):2031-40.

250. Lee VT, Smith RS, Tummler B, Lory S. Activities of Pseudomonas aeruginosa effectors secreted by the Type III secretion system in vitro and during infection. Infection and immunity. 2005;73(3):1695-705.

251. Lin ZQ, Kondo T, Ishida Y, Takayasu T, Mukaida N. Essential involvement of IL-6 in the skin wound-healing process as evidenced by delayed wound healing in IL-6-deficient mice. Journal of leukocyte biology. 2003;73(6):713-21.

252. Hernandez-Quintero M, Kuri-Harcuch W, Gonzalez Robles A, Castro-Munozledo F. Interleukin-6 promotes human epidermal keratinocyte proliferation and keratin cytoskeleton reorganization in culture. Cell and tissue research. 2006;325(1):77-90.

253. Niyonsaba F, Ushio H, Nakano N, Ng W, Sayama K, Hashimoto K, et al. Antimicrobial peptides human beta-defensins stimulate epidermal keratinocyte migration, proliferation and production of proinflammatory cytokines and chemokines. The Journal of investigative dermatology. 2007;127(3):594-604.

254. Koczulla R, von Degenfeld G, Kupatt C, Krotz F, Zahler S, Gloe T, et al. An angiogenic role for the human peptide antibiotic LL-37/hCAP-18. The Journal of clinical investigation. 2003;111(11):1665-72.

100

101