Supplementary Table 1

Total Page:16

File Type:pdf, Size:1020Kb

Load more

There are 657 predicted targets for hsa-miR-138-5p in miRDB.
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)

    Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)

    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
  • Table 2. Significant

    Table 2. Significant

    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
  • Download (PDF)

    Download (PDF)

    Tomono et al.: Glycan evolution based on phylogenetic profiling 1 Supplementary Table S1. List of 173 enzymes that are composed of glycosyltransferases and functionally-linked glycan synthetic enzymes UniProt ID Protein Name Categories of Glycan Localization CAZy Class 1 Q8N5D6 Globoside -1,3-N -acetylgalactosaminyltransferase 1 Glycosphingolipid Golgi apparatus GT6 P16442 Histo-blood group ABO system transferase Glycosphingolipid Golgi apparatus GT6 P19526 Galactoside 2--L-fucosyltransferase 1 Glycosphingolipid Golgi apparatus GT11 Q10981 Galactoside 2--L-fucosyltransferase 2 Glycosphingolipid Golgi apparatus GT11 Q00973 -1,4 N -acetylgalactosaminyltransferase 1 Glycosphingolipid Golgi apparatus GT12 Q8NHY0 -1,4 N -acetylgalactosaminyltransferase 2 O -Glycan, N -Glycan, Glycosphingolipid Golgi apparatus GT12 Q09327 -1,4-mannosyl-glycoprotein 4--N -acetylglucosaminyltransferase N -Glycan Golgi apparatus GT17 Q09328 -1,6-mannosylglycoprotein 6--N -acetylglucosaminyltransferase A N -Glycan Golgi apparatus GT18 Q3V5L5 -1,6-mannosylglycoprotein 6--N -acetylglucosaminyltransferase B O -Glycan, N -Glycan Golgi apparatus GT18 Q92186 -2,8-sialyltransferase 8B (SIAT8-B) (ST8SiaII) (STX) N -Glycan Golgi apparatus GT29 O15466 -2,8-sialyltransferase 8E (SIAT8-E) (ST8SiaV) Glycosphingolipid Golgi apparatus GT29 P61647 -2,8-sialyltransferase 8F (SIAT8-F) (ST8SiaVI) O -Glycan Golgi apparatus GT29 Q9NSC7 -N -acetylgalactosaminide -2,6-sialyltransferase 1 (ST6GalNAcI) (SIAT7-A) O -Glycan Golgi apparatus GT29 Q9UJ37 -N -acetylgalactosaminide -2,6-sialyltransferase
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation

    Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation

    This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. Research Articles: Cellular/Molecular Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation Omotola F. Omotade1,3, Yanfang Rui1,3, Wenliang Lei1,3, Kuai Yu1, H. Criss Hartzell1, Velia M. Fowler4 and James Q. Zheng1,2,3 1Department of Cell Biology, Emory University School of Medicine, Atlanta, GA 30322. 2Department of Neurology 3Center for Neurodegenerative Diseases, Emory University School of Medicine, Atlanta, GA 30322. 4Department of Molecular Medicine, Scripps Research Institute, La Jolla, CA 92037 DOI: 10.1523/JNEUROSCI.3325-17.2018 Received: 22 November 2017 Revised: 25 September 2018 Accepted: 2 October 2018 Published: 9 October 2018 Author contributions: O.F.O. and J.Q.Z. designed research; O.F.O., Y.R., W.L., and K.Y. performed research; O.F.O. and J.Q.Z. analyzed data; O.F.O. and J.Q.Z. wrote the paper; Y.R., H.C.H., V.M.F., and J.Q.Z. edited the paper; V.M.F. contributed unpublished reagents/analytic tools. Conflict of Interest: The authors declare no competing financial interests. This research project was supported in part by research grants from National Institutes of Health to JQZ (GM083889, MH104632, and MH108025), OFO (5F31NS092437-03), VMF (EY017724) and HCH (EY014852, AR067786), as well as by the Emory University Integrated Cellular Imaging Microscopy Core of the Emory Neuroscience NINDS Core Facilities grant (5P30NS055077). We would like to thank Dr. Kenneth Myers for his technical expertise and help throughout the project. We also thank Drs.
  • Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
  • Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats

    Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats

    ORGINAL ARTICLE Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats Seyed Jalal Taherabadi 1, Masoud Rahmati 1*, Rahim Mirnasuri 1, Abdolreza Kazemi 2 Abstract 1. Department of Sport Sciences, Lorestan Objective: It is well documented that exercise training (ET) University, Khoram Abad, Iran. imposes beneficial effects on diabetes mellitus and its complication 2. Department of Sport Sciences, Vali-E-Asr University of Rafsanjan, Kerman, Iran. such as diabetic peripheral neuropathy (DPN). Regarding the importance of tropomodulin-2 (TMOD2) in nervous system plasticity, this protein may be recognized as a candidate mechanism for ET-induced neuroplasticity. The aim of this study was to *Correspondence: investigate the effects of ET on cerebellar gene expression of Masoud Rahmati, PhD, Department of TMOD2 in rats with DPN. Sport Sciences, Lorestan University, Materials and Methods: Animals were randomly divided into Khoram Abad, Iran. three groups: healthy control (C), diabetic control (DC) and diabetic Tel: (98) 912 452 5538 trained (DT). Diabetes was induced by a single intraperitoneal Email: [email protected] injection of streptozotocin. Behavioral nociception assessment was carried out by Von Frey Filaments and tail-flick tests. TMOD2 gene expression was assessed by real time-PCR . Received: 17 February 2019 Results: The mRNA levels of TMOD2 increased to 0.50-fold ( P- value: 0.005) in comparison of the sedentary controls after 6 weeks Accepted: 21 June 2019 of DPN. Also, TMOD2 gene expression in DT group was decreased Published in August 2019 to -0.68-fold changes in comparison of the C group ( P-value: 0.001).
  • Aberrant Sialylation in Cancer: Biomarker and Potential Target for Therapeutic Intervention?

    Aberrant Sialylation in Cancer: Biomarker and Potential Target for Therapeutic Intervention?

    cancers Review Aberrant Sialylation in Cancer: Biomarker and Potential Target for Therapeutic Intervention? Silvia Pietrobono * and Barbara Stecca * Tumor Cell Biology Unit, Core Research Laboratory, Institute for Cancer Research and Prevention (ISPRO), Viale Pieraccini 6, 50139 Florence, Italy * Correspondence: [email protected] (S.P.); [email protected] (B.S.); Tel.: +39-055-7944568 (S.P.); +39-055-7944567 (B.S.) Simple Summary: Sialylation is a post-translational modification that consists in the addition of sialic acid to growing glycan chains on glycoproteins and glycolipids. Aberrant sialylation is an established hallmark of several types of cancer, including breast, ovarian, pancreatic, prostate, colorectal and lung cancers, melanoma and hepatocellular carcinoma. Hypersialylation can be the effect of increased activity of sialyltransferases and results in an excess of negatively charged sialic acid on the surface of cancer cells. Sialic acid accumulation contributes to tumor progression by several paths, including stimulation of tumor invasion and migration, and enhancing immune evasion and tumor cell survival. In this review we explore the mechanisms by which sialyltransferases promote cancer progression. In addition, we provide insights into the possible use of sialyltransferases as biomarkers for cancer and summarize findings on the development of sialyltransferase inhibitors as potential anti-cancer treatments. Abstract: Sialylation is an integral part of cellular function, governing many biological processes Citation: Pietrobono, S.; Stecca, B. including cellular recognition, adhesion, molecular trafficking, signal transduction and endocytosis. Aberrant Sialylation in Cancer: Sialylation is controlled by the levels and the activities of sialyltransferases on glycoproteins and Biomarker and Potential Target for lipids. Altered gene expression of these enzymes in cancer yields to cancer-specific alterations of Therapeutic Intervention? Cancers glycoprotein sialylation.
  • Two Arabidopsis Proteins Synthesize Acetylated Xylan Invitro

    Two Arabidopsis Proteins Synthesize Acetylated Xylan Invitro

    The Plant Journal (2014) 80, 197–206 doi: 10.1111/tpj.12643 FEATURED ARTICLE Two Arabidopsis proteins synthesize acetylated xylan in vitro Breeanna R. Urbanowicz, Maria J. Pena*,~ Heather A. Moniz, Kelley W. Moremen and William S. York* Complex Carbohydrate Research Center, University of Georgia, 315 Riverbend Road, Athens, GA 30602, USA Received 4 June 2014; revised 18 July 2014; accepted 1 August 2014; published online 21 August 2014. *For correspondence (e-mails [email protected]; [email protected]). SUMMARY Xylan is the third most abundant glycopolymer on earth after cellulose and chitin. As a major component of wood, grain and forage, this natural biopolymer has far-reaching impacts on human life. This highly acetylated cell wall polysaccharide is a vital component of the plant cell wall, which functions as a molecular scaffold, pro- viding plants with mechanical strength and flexibility. Mutations that impair synthesis of the xylan backbone give rise to plants that fail to grow normally because of collapsed xylem cells in the vascular system. Phenotypic analysis of these mutants has implicated many proteins in xylan biosynthesis; however, the enzymes directly responsible for elongation and acetylation of the xylan backbone have not been unambiguously identified. Here we provide direct biochemical evidence that two Arabidopsis thaliana proteins, IRREGULAR XYLEM 10–L (IRX10-L) and ESKIMO1/TRICOME BIREFRINGENCE 29 (ESK1/TBL29), catalyze these respective processes in vi- tro. By identifying the elusive xylan synthase and establishing ESK1/TBL29 as the archetypal plant polysaccha- ride O-acetyltransferase, we have resolved two long-standing questions in plant cell wall biochemistry.
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic

    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic

    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
  • Figure S1. Reverse Transcription‑Quantitative PCR Analysis of ETV5 Mrna Expression Levels in Parental and ETV5 Stable Transfectants

    Figure S1. Reverse transcription‑quantitative PCR analysis of ETV5 mRNA expression levels in parental and ETV5 stable transfectants. (A) Hec1a and Hec1a‑ETV5 EC cell lines; (B) Ishikawa and Ishikawa‑ETV5 EC cell lines. **P<0.005, unpaired Student's t‑test. EC, endometrial cancer; ETV5, ETS variant transcription factor 5. Figure S2. Survival analysis of sample clusters 1‑4. Kaplan Meier graphs for (A) recurrence‑free and (B) overall survival. Survival curves were constructed using the Kaplan‑Meier method, and differences between sample cluster curves were analyzed by log‑rank test. Figure S3. ROC analysis of hub genes. For each gene, ROC curve (left) and mRNA expression levels (right) in control (n=35) and tumor (n=545) samples from The Cancer Genome Atlas Uterine Corpus Endometrioid Cancer cohort are shown. mRNA levels are expressed as Log2(x+1), where ‘x’ is the RSEM normalized expression value. ROC, receiver operating characteristic. Table SI. Clinicopathological characteristics of the GSE17025 dataset. Characteristic n % Atrophic endometrium 12 (postmenopausal) (Control group) Tumor stage I 91 100 Histology Endometrioid adenocarcinoma 79 86.81 Papillary serous 12 13.19 Histological grade Grade 1 30 32.97 Grade 2 36 39.56 Grade 3 25 27.47 Myometrial invasiona Superficial (<50%) 67 74.44 Deep (>50%) 23 25.56 aMyometrial invasion information was available for 90 of 91 tumor samples. Table SII. Clinicopathological characteristics of The Cancer Genome Atlas Uterine Corpus Endometrioid Cancer dataset. Characteristic n % Solid tissue normal 16 Tumor samples Stagea I 226 68.278 II 19 5.740 III 70 21.148 IV 16 4.834 Histology Endometrioid 271 81.381 Mixed 10 3.003 Serous 52 15.616 Histological grade Grade 1 78 23.423 Grade 2 91 27.327 Grade 3 164 49.249 Molecular subtypeb POLE 17 7.328 MSI 65 28.017 CN Low 90 38.793 CN High 60 25.862 CN, copy number; MSI, microsatellite instability; POLE, DNA polymerase ε.