DOCSLIB.ORG

Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. Research Articles: Cellular/Molecular Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation Omotola F. Omotade1,3, Yanfang Rui1,3, Wenliang Lei1,3, Kuai Yu1, H. Criss Hartzell1, Velia M. Fowler4 and James Q. Zheng1,2,3 1Department of Cell Biology, Emory University School of Medicine, Atlanta, GA 30322. 2Department of Neurology 3Center for Neurodegenerative Diseases, Emory University School of Medicine, Atlanta, GA 30322. 4Department of Molecular Medicine, Scripps Research Institute, La Jolla, CA 92037 DOI: 10.1523/JNEUROSCI.3325-17.2018 Received: 22 November 2017 Revised: 25 September 2018 Accepted: 2 October 2018 Published: 9 October 2018 Author contributions: O.F.O. and J.Q.Z. designed research; O.F.O., Y.R., W.L., and K.Y. performed research; O.F.O. and J.Q.Z. analyzed data; O.F.O. and J.Q.Z. wrote the paper; Y.R., H.C.H., V.M.F., and J.Q.Z. edited the paper; V.M.F. contributed unpublished reagents/analytic tools. Conflict of Interest: The authors declare no competing financial interests. This research project was supported in part by research grants from National Institutes of Health to JQZ (GM083889, MH104632, and MH108025), OFO (5F31NS092437-03), VMF (EY017724) and HCH (EY014852, AR067786), as well as by the Emory University Integrated Cellular Imaging Microscopy Core of the Emory Neuroscience NINDS Core Facilities grant (5P30NS055077). We would like to thank Dr. Kenneth Myers for his technical expertise and help throughout the project. We also thank Drs. Sharada Tilve, Daniela Malide, and Herbert Geller at National Heart, Lung, and Blood Institute (NHLBI, NIH, Bethesda, MD 20892, USA) for their help with super resolution STED imaging. Correspondence: James Zheng, Department of Cell Biology, Emory University School of Medicine, 615 Michael Street, Atlanta, GA 30322. Email: [email protected] Cite as: J. Neurosci ; 10.1523/JNEUROSCI.3325-17.2018 Alerts: Sign up at www.jneurosci.org/cgi/alerts to receive customized email alerts when the fully formatted version of this article is published. Accepted manuscripts are peer-reviewed but have not been through the copyediting, formatting, or proofreading process. Copyright © 2018 the authors 1 Tropomodulin Isoform-Specific Regulation of Dendrite 2 Development and Synapse Formation 3 1,3Omotola F. Omotade, 1,3Yanfang Rui, 1,3Wenliang Lei, 1Kuai Yu, 1H. Criss Hartzell, 4Velia M. 4 Fowler, 1,2,3James Q. Zheng 5 6 1Department of Cell Biology, Emory University School of Medicine, Atlanta, GA 30322. 7 2Department of Neurology, 3Center for Neurodegenerative Diseases, Emory University School of 8 Medicine, Atlanta, GA 30322. 9 4Department of Molecular Medicine, Scripps Research Institute, La Jolla, CA 92037 10 Abbreviated title: Tmod regulation of synapse formation 11 Keywords: dendritic arborization, dendritic spine, cytoskeleton, actin, pointed end 12 Pages: 38 13 Figures: 9 14 Extended datasets: 0 15 Words: 6795 Abstract: 232 Introduction: 636 Discussion: 1473 16 17 Correspondence: James Zheng, Department of Cell Biology, Emory University School of Medicine, 18 615 Michael Street, Atlanta, GA 30322. Email: [email protected] 19 Conflict of Interest: The authors declare no competing financial interests. 20 Acknowledgements: 21 This research project was supported in part by research grants from National Institutes of 22 Health to JQZ (GM083889, MH104632, and MH108025), OFO (5F31NS092437-03), VMF 23 (EY017724) and HCH (EY014852, AR067786), as well as by the Emory University Integrated 24 Cellular Imaging Microscopy Core of the Emory Neuroscience NINDS Core Facilities grant 25 (5P30NS055077). We would like to thank Dr. Kenneth Myers for his technical expertise and help 26 throughout the project. We also thank Drs. Sharada Tilve, Daniela Malide, and Herbert Geller at 27 National Heart, Lung, and Blood Institute (NHLBI, NIH, Bethesda, MD 20892, USA) for their help 28 with super resolution STED imaging. 29 Author contributions: 30 OFO performed most of the experiments and quantitative analyses, drafted and revised the 31 manuscript. YR helped with experiments and analyses concerning the spine development, antibody 32 specificity and knockdown efficiency in neurons. WL performed the FRAP experiments. KY and 33 HCH helped with the electrophysiological recordings and provided feedback on the manuscript. 34 JQZ designed and oversaw the project. VMF provided reagents and helped with interpretations and 35 critical reading of the manuscript. 36 2 37 Abstract 38 Neurons of the central nervous system (CNS) elaborate highly branched dendritic arbors that 39 host numerous dendritic spines, which serve as the postsynaptic platform for most excitatory 40 synapses. The actin cytoskeleton plays an important role in dendrite development and spine 41 formation, but the underlying mechanisms remain incompletely understood. Tropomodulins 42 (Tmods) are a family of actin-binding proteins that cap the slow growing (pointed) end of actin 43 filaments, thereby regulating the stability, length, and architecture of complex actin networks in 44 diverse cell types. Three members of the Tmod family, Tmod1, Tmod2, and Tmod3 are expressed in 45 the vertebrate CNS, but their function in neuronal development is largely unknown. In this study, 46 we present evidence that Tmod1 and Tmod2 exhibit distinct roles in regulating spine development 47 and dendritic arborization, respectively. Using rat hippocampal tissues from both sexes, we find that 48 Tmod1 and Tmod2 are expressed with distinct developmental profiles: Tmod2 is expressed early 49 during hippocampal development, whereas Tmod1 expression coincides with synaptogenesis. We 50 then show that knockdown of Tmod2, but not Tmod1, severely impairs dendritic branching. Both 51 Tmod1 and Tmod2 are localized to a distinct sub-spine region where they regulate local F-actin 52 stability. However, knockdown of Tmod1, but not Tmod2, disrupts spine morphogenesis and impairs 53 synapse formation. Collectively, these findings demonstrate that regulation of the actin cytoskeleton 54 by different members of the Tmod family plays an important role in distinct aspects of dendrite and 55 spine development. 3 56 Significance 57 The Tropomodulin family of molecules is best known for controlling the length and stability 58 of actin myofilaments in skeletal muscles. While several Tropomodulin members are expressed in 59 the brain, fundamental knowledge about their role in neuronal function is limited. In this study, we 60 show the unique expression profile and subcellular distribution of Tmod1 and Tmod2 in 61 hippocampal neurons. While both Tmod1 and Tmod2 regulate F-actin stability, we find that they 62 exhibit isoform-specific roles in dendrite development and synapse formation: Tmod2 regulates 63 dendritic arborization whereas Tmod1 is required for spine development and synapse formation. 64 These findings provide novel insight into the actin regulatory mechanisms underlying neuronal 65 development, thereby shedding light on potential pathways disrupted in a number of neurological 66 disorders. 4 67 Introduction 68 Actin is the major cytoskeletal component in dendritic spines (Fifkova and Delay 1982), 69 where it provides structural support and spatially organizes postsynaptic components (Hotulainen 70 and Hoogenraad 2010). During synapse development, highly motile actin-based filopodia are 71 replaced by relatively stable, mushroom-shaped spines that contain the synaptic components 72 required for receiving presynaptic input (Yuste and Bonhoeffer 2004). This morphological transition 73 is characterized by the conversion of longitudinally arranged F-actin filaments to a highly branched 74 F-actin network that predominates in the spine head (Hotulainen and Hoogenraad 2010, Korobova 75 and Svitkina 2010). The actin cytoskeleton also plays a crucial role in dendrite development. For 76 example, the formation of elaborate dendritic arbors is achieved, in part, through the dendritic 77 growth cone, a motile, actin-based structure present at the tips of developing dendrites. Dendritic 78 growth cones are crucial for dendrite extension as well as the formation of collateral dendritic 79 branches. Despite intense studies, the molecules and mechanisms that regulate actin organization and 80 remodeling during dendrite development and spine morphogenesis are not fully understood. 81 Actin filaments are polarized with a fast growing (barbed) end and a slow growing (pointed) 82 end – the former favors assembly, whereas the latter favors disassembly. Tropomodulins (Tmod) 83 belong to a conserved family of actin binding proteins that are best known for capping the pointed 84 end of actin filaments (Yamashiro, Gokhin et al. 2012, Fowler and Dominguez 2017). By blocking 85 monomer exchange at filament ends and inhibiting filament elongation or depolymerization, Tmod 86 regulates the stability, length, and architecture of complex actin networks in diverse cell types 87 (Yamashiro, Gokhin et al. 2012). Of the four Tmod isoforms, Tmod1, Tmod2 and Tmod3 are 88 expressed in the central nervous system (CNS) (Sussman, Sakhi et al. 1994, Watakabe, Kobayashi et 89 al. 1996, Conley, Fritz-Six et al. 2001, Cox, Fowler et al. 2003). Tmod1 is expressed in many types 5 90 of terminally differentiated cells (including neurons), Tmod2 is expressed solely in neurons, and 91 Tmod3 is ubiquitously expressed (Yamashiro, Gokhin et al. 2012). 92 Altered expression of Tmod1
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Impairments in Contractility and Cytoskeletal Organisation Cause Nuclear Defects in Nemaline Myopathy
    bioRxiv preprint doi: https://doi.org/10.1101/518522; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Impairments in contractility and cytoskeletal organisation cause nuclear defects in nemaline myopathy Jacob A Ross1, Yotam Levy1, Michela Ripolone2, Justin S Kolb3, Mark Turmaine4, Mark Holt5, Maurizio Moggio2, Chiara Fiorillo6, Johan Lindqvist3, Nicolas Figeac5, Peter S Zammit5, Heinz Jungbluth5,7,8, John Vissing9, Nanna Witting9, Henk Granzier3, Edmar Zanoteli10, Edna C Hardeman11, Carina Wallgren- Pettersson12, Julien Ochala1,5. 1. Centre for Human & Applied Physiological Sciences, School of Basic & Medical Biosciences, Faculty of Life Sciences & Medicine, Guy’s Campus, King’s College London, SE1 1UL, UK 2. Neuromuscular and Rare Diseases Unit, Department of Neuroscience, Fondazione IRCCS Ca' Granda, Ospedale Maggiore Policlinico, Milan 20122, Italy 3. Department of Cellular and Molecular Medicine, University of Arizona, Tucson, Arizona, 85721, USA 4. Division of Biosciences, University College London, Gower Street, London WC1E 6BT, UK 5. Randall Centre for Cell and Molecular Biophysics, School of Basic & Medical Biosciences, Faculty of Life Sciences & Medicine, Guy’s Campus, King’s College London, SE1 1UL, UK 6. Molecular Medicine, IRCCS Fondazione Stella Maris, Pisa and Department of Neuroscience, Rehabilitation, Ophthalmology, Genetics, Maternal and Child Health, University of Genova, Genoa, Italy 7. Department of Paediatric Neurology, Neuromuscular Service, Evelina's Children Hospital, Guy's and St Thomas' Hospital National Health Service Foundation Trust, London, SE1 9RT, UK 8. Department of Basic and Clinical Neuroscience, Institute of Psychiatry, Psychology & Neuroscience, King's College, London, SE1 1UL, UK 9.
    [Show full text]
  • Assembly and Maintenance of Sarcomere Thin Filaments and Associated Diseases
    International Journal of Molecular Sciences Review Assembly and Maintenance of Sarcomere Thin Filaments and Associated Diseases Kendal Prill and John F. Dawson * Centre for Cardiovascular Investigations, Department of Molecular and Cellular Biology, University of Guelph, Guelph, ON N1G 2W1, Canada; [email protected] * Correspondence: [email protected] Received: 17 December 2019; Accepted: 12 January 2020; Published: 15 January 2020 Abstract: Sarcomere assembly and maintenance are essential physiological processes required for cardiac and skeletal muscle function and organism mobility. Over decades of research, components of the sarcomere and factors involved in the formation and maintenance of this contractile unit have been identified. Although we have a general understanding of sarcomere assembly and maintenance, much less is known about the development of the thin filaments and associated factors within the sarcomere. In the last decade, advancements in medical intervention and genome sequencing have uncovered patients with novel mutations in sarcomere thin filaments. Pairing this sequencing with reverse genetics and the ability to generate patient avatars in model organisms has begun to deepen our understanding of sarcomere thin filament development. In this review, we provide a summary of recent findings regarding sarcomere assembly, maintenance, and disease with respect to thin filaments, building on the previous knowledge in the field. We highlight debated and unknown areas within these processes to clearly define open research questions. Keywords: sarcomere assembly; sarcomere maintenance; sarcomere thin filaments; thin filament assembly; thin filament maintenance; thin filament turnover; actin turnover; chaperone; sarcomere; myopathy 1. Introduction Striated muscle requires the coordination of hundreds of proteins not only for cellular function but also for assembly of the contractile sarcomere units within the myofibril.
    [Show full text]
  • A Cell Line P53 Mutation Type UM
    A Cell line p53 mutation Type UM-SCC 1 wt UM-SCC5 Exon 5, 157 GTC --> TTC Missense mutation by transversion (Valine --> Phenylalanine UM-SCC6 wt UM-SCC9 wt UM-SCC11A wt UM-SCC11B Exon 7, 242 TGC --> TCC Missense mutation by transversion (Cysteine --> Serine) UM-SCC22A Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC22B Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC38 Exon 5, 132 AAG --> AAT Missense mutation by transversion (Lysine --> Asparagine) UM-SCC46 Exon 8, 278 CCT --> CGT Missense mutation by transversion (Proline --> Alanine) B 1 Supplementary Methods Cell Lines and Cell Culture A panel of ten established HNSCC cell lines from the University of Michigan series (UM-SCC) was obtained from Dr. T. E. Carey at the University of Michigan, Ann Arbor, MI. The UM-SCC cell lines were derived from eight patients with SCC of the upper aerodigestive tract (supplemental Table 1). Patient age at tumor diagnosis ranged from 37 to 72 years. The cell lines selected were obtained from patients with stage I-IV tumors, distributed among oral, pharyngeal and laryngeal sites. All the patients had aggressive disease, with early recurrence and death within two years of therapy. Cell lines established from single isolates of a patient specimen are designated by a numeric designation, and where isolates from two time points or anatomical sites were obtained, the designation includes an alphabetical suffix (i.e., "A" or "B"). The cell lines were maintained in Eagle's minimal essential media supplemented with 10% fetal bovine serum and penicillin/streptomycin.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • Mechanism of Action Through an IFN Type I-Independent Responses To
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 is online at: average * The Journal of Immunology , 12 of which you can access for free at: 2012; 188:3088-3098; Prepublished online 20 from submission to initial decision 4 weeks from acceptance to publication February 2012; doi: 10.4049/jimmunol.1101764 http://www.jimmunol.org/content/188/7/3088 MF59 and Pam3CSK4 Boost Adaptive Responses to Influenza Subunit Vaccine through an IFN Type I-Independent Mechanism of Action Elena Caproni, Elaine Tritto, Mario Cortese, Alessandro Muzzi, Flaviana Mosca, Elisabetta Monaci, Barbara Baudner, Anja Seubert and Ennio De Gregorio J Immunol cites 33 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/02/21/jimmunol.110176 4.DC1 This article http://www.jimmunol.org/content/188/7/3088.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats
    ORGINAL ARTICLE Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats Seyed Jalal Taherabadi 1, Masoud Rahmati 1*, Rahim Mirnasuri 1, Abdolreza Kazemi 2 Abstract 1. Department of Sport Sciences, Lorestan Objective: It is well documented that exercise training (ET) University, Khoram Abad, Iran. imposes beneficial effects on diabetes mellitus and its complication 2. Department of Sport Sciences, Vali-E-Asr University of Rafsanjan, Kerman, Iran. such as diabetic peripheral neuropathy (DPN). Regarding the importance of tropomodulin-2 (TMOD2) in nervous system plasticity, this protein may be recognized as a candidate mechanism for ET-induced neuroplasticity. The aim of this study was to *Correspondence: investigate the effects of ET on cerebellar gene expression of Masoud Rahmati, PhD, Department of TMOD2 in rats with DPN. Sport Sciences, Lorestan University, Materials and Methods: Animals were randomly divided into Khoram Abad, Iran. three groups: healthy control (C), diabetic control (DC) and diabetic Tel: (98) 912 452 5538 trained (DT). Diabetes was induced by a single intraperitoneal Email: [email protected] injection of streptozotocin. Behavioral nociception assessment was carried out by Von Frey Filaments and tail-flick tests. TMOD2 gene expression was assessed by real time-PCR . Received: 17 February 2019 Results: The mRNA levels of TMOD2 increased to 0.50-fold ( P- value: 0.005) in comparison of the sedentary controls after 6 weeks Accepted: 21 June 2019 of DPN. Also, TMOD2 gene expression in DT group was decreased Published in August 2019 to -0.68-fold changes in comparison of the C group ( P-value: 0.001).
    [Show full text]
  • Serum Albumin OS=Homo Sapiens
    Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]