DOCSLIB.ORG

Cloning of Casbene Synthase Cdna: Evidence for Conserved Structural

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cloning of Casbene Synthase Cdna: Evidence for Conserved Structural Proc. Nati. Acad. Sci. USA Vol. 91, pp. 8497-8501, August 1994 Plant Biology Cloning of casbene synthase cDNA: Evidence for conserved structural features among terpenoid cyclases in plants (phytoalexins/castor bean/Ricinus communis/defense response) CHRISTOPHER J. D. MAU* AND CHARLES A. WESTt Departments of *Biology and tChemistry and Biochemistry, University of California, Los Angeles, CA 90024 Communicated by Paul D. Boyer, April 25, 1994 ABSTRACT A near-fll-length casbene synthase cDNA oligogalacturonide elicitors. This report describes the char- clone, pCS7, was isolated by using a partial cDNA clone, pCS4, acterization ofthis clone§ and the comparison ofthe primary to probe a g10 library constructed from poly(A)+ RNA from structure of CS deduced from it with the deduced primary elicited castor bean dlings. The cDNA insert had a length of structures derived from two other nucleotide sequences 1983 bases with a polyadenylate tail of 19 bases. Translation of reported for higher plant terpenoid cyclization enzymes: the cDNA sequence revealed an open reading frame encoding 5-epi-aristolochene synthase (EAS), which is involved in the a 601-aa protein with a predicted Mr of 68,960. Search of the initial cyclization step for farnesyl diphosphate (FPP) that GenBank data base with the deduced translation product leads to sesquiterpenoid phytoalexins in tobacco (6), and revealed 42% identity and 65% similarity with 5-epi- (-)-4S-limonene synthase (LS), which catalyzes the cycliza- aristolochene synthe from tobacco and 31% identity and 53% tion of geranyl diphosphate (GPP) to essential oil compo- simarity with limonene synthase from spearmint. Each of the nents in spearmint (7). Significant similarities exist among the three proteins catalyzes an intramolecular cyclization of a deduced primary structures ofthe three enzymes. This result prenyl diphosphate substrate to a specific cyclic terpenoid implies that a similar overall conformation, and possibly the hydrocarbon product. The proposed reaction mechanisms for relative positions of similar side chain functional groups, is the three catalytic processes share common chemical features, necessary for catalysis by this group ofenzymes in plants. An even though the products being formed are members of three abstract referring to some ofthis work has been published (8). different es of terpenoid compounds. Analysis of the alignment ofthe three proteins suggests that both primary and AND secondary structural elements are conserved. These smilarties MATERIALS METHODS suggest that the genes that encode terpenoid cyclization en- Isolation of Nucleic Acids. Castor bean seeds were germi- zymes of this type in anglosperms have undergone divergent nated aseptically (9) and treated with elicitor (5). Total RNA evolution from an ancestral progenitor gene. In support ofthis was isolated (10), and contaminating polysaccharides were proposition, the locations offive ofthe six introns in the casbene removed (11). Poly(A)+ RNA was isolated from the total synthase gene align very closely with those ofthe five introns in RNA by two cycles of oligo(dT)-cellulose chromatography the 5-epi-aristolochene synthase gene. (Collaborative Research). The purified sample was precipi- tated with ethanol, and the resulting precipitate was resus- Casbene is a macrocyclic diterpene hydrocarbon that serves pended in RNase-free water for storage at -700C. as a phytoalexin in castor bean (Ricinus communes L.) (1). Library Construction and Screening. Double-stranded Casbene synthase (CS; EC 4.6.1.7) (previously designated cDNA was synthesized with the SuperScript system (Life casbene synthetase) from castor bean seedlings catalyzes the Technologies, Gaithersburg, MD) from 4 jg of poly(A)+ cyclization of geranylgeranyl diphosphate (GGPP) to form RNA obtained from elicitor-treated seedlings. The cDNA the macrocyclic hydrocarbon in a single enzymatic step. The was then fractionated on Sephacryl S-500 HR columns (Phar- inducible enzyme activity is found in proplastids of germi- macia LKB) to enrich for larger cDNA inserts. Eighty-five nating seedlings infected by the fungus Rhizopus stolonifer nanograms of size-fractionated cDNA was ligated to EcoRI/ (2). The plant cells recognize oligogalacturonide fragments Not I adapters and then ligated to EcoRI-digested AgtlO released from pectic components of the plant cell wall by a vector DNA and packaged in vitro with Packagene extracts secreted fungal endopolygalacturonase as a signal to activate (Promega). Phage virions were plated on Escherichia coli CS induction (3). CS activity reaches detectable levels after MB406 (Promega), and duplicate nitrocellulose filter replicas 5 hr of incubation with pectic fragments, with a peak occur- were screened with the pCS4 insert (5) and 5' sequences from ring after 10-12 hr (4). The active enzyme consists ofa single the CS gene (unpublished data) that were labeled by random polypeptide and has an apparent Mr of 59,000 as determined priming (12). The probes were chosen to identify a clone that by SDS/PAGE. Polyclonal antibodies to the purified enzyme should be full-length. Hybridization was for 18 hr at 420C in have been used to isolate a partial cDNA clone from a Agtll 50% formamide/5x standard saline citrate (SSC)/0.1% library (5). RNA gel blots probed with this clone show that SDS/50 mM sodium phosphate, pH 7, containing (100 hep- casbene synthase mRNA is undetectable in unelicited seed- arin ug/ml) and yeast tRNA (20 ug/ml). Filters were washed lings but accumulates to a maximum at 6 hr following for 1 hr at 420C with three changes of preequilibrated 0.1 x elicitation. Nuclear run-on experiments indicate that control SSC/0.1% SDS. Plaques hybridizing to both probes were is exerted at the level of transcription. A full-length CS cDNA clone was isolated as part of an Abbreviations: CS, casbene synthase; EAS, 5-epi-aristolochene effort to characterize the gene structure in order to identify synthase; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphos- cis-acting elements involved in the induction of this gene by phate; GPP, geranyl diphosphate; LS, limonene synthase. tTo whom reprint requests should be addressed at: Department of Chemistry and Biochemistry, University of California at Los An- The publication costs of this article were defrayed in part by page charge geles, 405 Hilgard Avenue, Los Angeles, CA 90024-1569. payment. This article must therefore be hereby marked "advertisement" §The nucleotide sequence reported in this paper has been submitted in accordance with 18 U.S.C. §1734 solely to indicate this fact. to the GenBank data library (accession no. L32134). 8497 Downloaded by guest on September 28, 2021 8498 Plant Biology: Mau and West Proc. Nati. Acad. Sci. USA 91 (1994) r-. pCS7 identified by autoradiography at -700C and purified by three ACTCAGCAGCCGCCTCTCCTACCCCAATTAGCACAGAAGATTTGGTGGTTCCTCTCCTTG rounds of hybridization as described above. Sequencing of cDNA Inserts. cDNA inserts from purified TGAAACACGGCATTGCCATCAGCTGCTA2AATCCAACCCTGAAAAGCTTAACTTATTT 120 phage clones were ligated into pBluescript II SK(-) (Strat- 1 1 A L P S A A N Q S N P E K L N L F agene) or pGEM-7f+ (Promega) by use of appropriate re- CACAGATTGTCAAGCTTACCCACCACTAGCTTGGAATATGGCAATAATCGCTTCCCTTTC 180 F P F striction endonucleases (Stratagene, Promega, or United 19 H R L S S L P T T S L E Y G N N R States Biochemical) according to common procedures (13, TTTTCCTCATCTGCCAAGTCACACTTTAAAAAACCAACTCAAGCATGTTTATCCTCAACA 240 K P T A C L S S T 14). Dideoxynucleotide sequencing of the cDNA clone was 39 F S S S A K S H F K 0 performed with Sequenase II (United States Biochemical) ACCCACCAAGAAGTTCGTCCATTAGCATACTTTCCTCCTACTGTCTGGGGCAATCGCTTT 300 T E V R P L A Y F P P T V W G N R F using synthetic oligonucleotide primers made on a Pharmacia 59 H Q Gene Assembler. Sequence comparisons were done using GCTTCCTTGACCTTCAATCCATCIGAATTTGAATCGTATGATGAACGGGTAATTGTGCTG 360 A SL T F N P S E F E S Y D E R V I V L MACVECTOR version 3.5 (International Biotechnologies) and 79 the programs from the University of Wisconsin Genetics AAGAAAAAAGTTAAGGACATATTAATTTCATCTACAAGTGATTCAGTGGAGACCGTTATT 420 99 K K K V K D I L I S S T S D S V E T V I Computer Group, version 7 (15). TTAATCGACTTATTATGTCGGCTTGGCGTATCATATCACTTTGAAAATGATATTGAAGAG 480 119 L I D L L C R L G V S Y H F E N D I E E RESULTS AND DISCUSSION CTACTAAGTAAAATCTTCAACTCCCAGCCTGACCTTGTCGATGAAAAAGAATGTGATCTC 540 139 L L S K I F N S Q P D L V D E K E C D L pCS4, the initial cDNA clone identified by polyclonal anti- bodies from an expression library, contained only 230 of the TACACTGCGGCAATTGTATTCCGAGTTTTCAGACAGCATGGTTTTAAAATGTCTTCGG^T 600 159 Y T A A I V F R V F R 0 H G F K M S S D 1650 bases predicted for a full-length message (5). Three types of evidence indicated that pCS4 contained CS coding GTGTTTAGCAAATTCAAGGACAGTGATGGTAAGTTCAAGGAATCCCTACGGGGTGATGCT 660 179 V F S K F K D S D G K F K E S L R G D A sequences-the observed binding of CS polyclonal antibod- ies to the fusion protein expressed from pCS4 sequences AAGGGTATGCTCAGCCTTTTTGAAGCTTCCCATCTAAGTGTGCATGGAGAAGACATTCTT 720 199 K G M L S LF E A S H L S V H G E D I L ligated in a Agtll library, and the results of both hybrid- arrested and hybrid-selected in vitro translation of RNA that GAAGAAGCCTTTGCTTTCACCAAGGATTACTTACAGTCCTCTGCAGTTGAGTTATTCCCT 780 219 E E A F A F T K D Y L Q S S A V E L F P annealed to this clone after extraction from elicited seedlings (5). Attempts to isolate any longer clones from the original AATCTCAAAAGGCATATAACGAACGCCCTAGAGCAGCCTTTCCACAGTGGCGTGCCGAGG 840 239 N L K R H I T N A L E Q P F H S G V P R Agtll library were never successful, probably because the 230-bp clone was propagated preferentially during library CTAGAGGCCAGGAAATTCATCGATCTATACGAAGCTGATATTGAATGCCGGAATGAAACT 900 259 L E A R K F I D L Y E A D I E C R N E T amphlfcation. We suspect that the truncated pCS4 clone arose after incomplete EcoRI methylase protection of syn- CTGCTCGAGTTTGCAAAGTTGGATTATAATAGAGTTCAGTTATTGCACCAACAAGAGCTG 960 L L E F A K L D Y N R V Q L L H 0 Q E L thesized double-stranded cDNA was followed by subsequent 279 cloning steps into EcoRI-digested Agtll vector.
Load more

Recommended publications
  • Structure-Based Virtual Screening of Hypothetical Inhibitors of the Enzyme Longiborneol Synthase—A Potential Target to Reduce Fusarium Head Blight Disease
    J Mol Model (2016) 22: 163 DOI 10.1007/s00894-016-3021-1 ORIGINAL PAPER Structure-based virtual screening of hypothetical inhibitors of the enzyme longiborneol synthase—a potential target to reduce Fusarium head blight disease E. Bresso1 & V. L ero ux 2 & M. Urban3 & K. E. Hammond-Kosack3 & B. Maigret2 & N. F. Martins1 Received: 17 December 2015 /Accepted: 27 May 2016 /Published online: 21 June 2016 # Springer-Verlag Berlin Heidelberg 2016 Abstract Fusarium head blight (FHB) is one of the most compounds from a library of 15,000 drug-like compounds. destructive diseases of wheat and other cereals worldwide. These putative inhibitors of longiborneol synthase provide a During infection, the Fusarium fungi produce mycotoxins that sound starting point for further studies involving molecular represent a high risk to human and animal health. Developing modeling coupled to biochemical experiments. This process small-molecule inhibitors to specifically reduce mycotoxin could eventually lead to the development of novel approaches levels would be highly beneficial since current treatments to reduce mycotoxin contamination in harvested grain. unspecifically target the Fusarium pathogen. Culmorin pos- sesses a well-known important synergistically virulence role Keywords Fusarium mycotoxins . Culmorin . Inhibitors . among mycotoxins, and longiborneol synthase appears to be a Homology modeling . Molecular dynamics . Ensemble key enzyme for its synthesis, thus making longiborneol syn- docking thase a particularly interesting target. This study aims to dis- cover potent and less toxic agrochemicals against FHB. These compounds would hamper culmorin synthesis by inhibiting Introduction longiborneol synthase. In order to select starting molecules for further investigation, we have conducted a structure- Fusarium head blight (FHB), caused by Fusarium based virtual screening investigation.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 9,115,366 B2 Tissier Et Al
    USOO9115366B2 (12) United States Patent (10) Patent No.: US 9,115,366 B2 Tissier et al. (45) Date of Patent: *Aug. 25, 2015 (54) SYSTEM FOR PRODUCING TERPENOIDS IN WO WO99,38957 * 8, 1999 .......... C12N 15/82 PLANTS WO WO99,38957 A1 8/1999 WO WOOOf 17327 A3 3.2000 Fre WO WO 01/20008 A2 3, 2001 (75) Inventors: Alain Tissier, Pertuis (FR); Christophe WO WO 2004/111183 A2 12/2004 Sallaud, Montpellier (FR); Denis WO WO 2006/04.0479 4/2006 Rontein,ontein, GreouxG les Bains (FR(FR) OTHER PUBLICATIONS (73) Assignee: PHILIP MORRIS PRODUCTS S.A., Aharoni, Aetal. The Plant Cell (Dec. 2003), vol. 15: pp. 2866-2884.* Neuchatel (CH) Besumbes, O. et al. Biotechnology and Bioengineering; Oct. 20. 2004; vol. 88, No. 2: pp. 168-175.* (*) Notice: Subject to any disclaimer, the term of this Wang, E. et al. Nature Biotechnology, Apr. 2001; vol. 19, pp. 371 patent is extended or adjusted under 35 37.4% U.S.C. 154(b) by 900 days. Wang, E. et al. Journal of Experimental Botany, Sep. 2002, vol. 53, No. 376; pp. 1891-1897.* This patent is Subject to a terminal dis Walker K. et al. Phytochemistry (2001) vol. 58; pp. 1-7.* claimer. Gutiérrez-Alcalá et al., A versatile promoter for the expression of proteins in glandular and non-glandular trichomes from a variety of plants, 56 J of Exp Botany No. 419, 2487-2494 (2005).* (21) Appl. No.: 11/814,943 Besumbes et al. (Metabolic Engineering of Isoprenoid Biosynthesis in Arabidopsis for the Production of Taxadiene, the First Committed (22) PCT Filed: Jan.
    [Show full text]
  • Searching for Novel Targets to Control Wheat Head Blight Disease—I-Protein Identification, 3D Modeling and Virtual Screening
    Advances in Microbiology, 2016, 6, 811-830 http://www.scirp.org/journal/aim ISSN Online: 2165-3410 ISSN Print: 2165-3402 Searching for Novel Targets to Control Wheat Head Blight Disease—I-Protein Identification, 3D Modeling and Virtual Screening Natália F. Martins1, Emmanuel Bresso1, Roberto C. Togawa1, Martin Urban2, John Antoniw2, Bernard Maigret3, Kim Hammond-Kosack2 1EMBRAPA Recursos Genéticos e Biotecnologia Parque Estação Biológica, Brasília, Brazil 2Department of Plant Biology and Crop Science, Rothamsted Research, Harpenden, UK 3CNRS, LORIA, UMR 7503, Lorraine University, Nancy, France How to cite this paper: Martins, N.F., Abstract Bresso, E., Togawa, R.C., Urban, M., Anto- niw, J., Maigret, B. and Hammond-Kosack, Fusarium head blight (FHB) is a destructive disease of wheat and other cereals. FHB K. (2016) Searching for Novel Targets to occurs in Europe, North America and around the world causing significant losses in Control Wheat Head Blight Disease— production and endangers human and animal health. In this article, we provide the I-Protein Identification, 3D Modeling and strategic steps for the specific target selection for the phytopathogen system wheat- Virtual Screening. Advances in Microbiol- ogy, 6, 811-830. Fusarium graminearum. The economic impact of FHB leads to the need for innova- http://dx.doi.org/10.4236/aim.2016.611079 tion. Currently used fungicides have been shown to be effective over the years, but recently cereal infecting Fusaria have developed resistance. Our work presents a new Received: June 21, 2016 perspective on target selection to allow the development of new fungicides. We de- Accepted: September 11, 2016 veloped an innovative approach combining both genomic analysis and molecular Published: September 14, 2016 modeling to increase the discovery for new chemical compounds with both safety Copyright © 2016 by authors and and low environmental impact.
    [Show full text]
  • PURIFICATION of the NATIVE ENZYME and CLONING .AND CHARACTERIZATION of a Cdna for (+ )-6-CADINENE SYNTHASE from BACTERIA-INOCULATED COTTON FOLIAR TISSUE
    PURIFICATION OF THE NATIVE ENZYME AND CLONING .AND CHARACTERIZATION OF A cDNA FOR (+ )-6-CADINENE SYNTHASE FROM BACTERIA-INOCULATED COTTON FOLIAR TISSUE By EDWARD M. DAVIS Bachelor of Science Oklahoma State University Stillwater, Oklahoma 1987 Submitted to the Faculty of the Graduate College of the Oklahoma State University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY May, 1998 PURIFICATION OF THENATIVE ENZYME AND . CLONING AND CHARACTERIZATIQNOFA cDNA FOR (+ )-B-CADINENE SYNTHASE FROM BACTERIA-INOCULATED COTTON FOLIAR TISSUE Thesis Approved: ~··. L) .. ·g pJ ~fthe Graduate College . · · ii ACKNOWLEDGMENTS I would like to express my appreciation to the faculty, staff and graduate students of the Department of Biochemistry and Molecular Biology who have given both time and energy to assist in my scientific training and development. I would like to thank Margaret and Marlee for giving me the opportunity to participate on a project that includes protein and molecular biological methods. I wish to acknowledge the members of my committee for their time, guidance, and support. I would like to acknowledge Phillips 66 Corporation for their generous donation of equipment, the McAlester Scottish Rite Foundation and the OSU Foundation for financial support, and the EPSCOR program,. the NSF, and the USDA for providing the grants which made this work possible. A special thanks to Drs. Blair, Leach, Melcher, Sensharma and Mitchell for helping to maintain a nearly steady salary when the grant money was not available and to Drs. Cushman and Melcher and Janet Rogers fortechnical support. I would like to thank Drs. Gordon Davis and Steve Hartson for their encouragement and scientific advice, Dr.
    [Show full text]
  • Supporting Information High-Throughput Virtual Screening
    Supporting Information High-Throughput Virtual Screening of Proteins using GRID Molecular Interaction Fields Simone Sciabola, Robert V. Stanton, James E. Mills, Maria M. Flocco, Massimo Baroni, Gabriele Cruciani, Francesca Perruccio and Jonathan S. Mason Contents Table S1 S2-S21 Figure S1 S22 * To whom correspondence should be addressed: Simone Sciabola, Pfizer Research Technology Center, Cambridge, 02139 MA, USA Phone: +1-617-551-3327; Fax: +1-617-551-3117; E-mail: [email protected] S1 Table S1. Description of the 990 proteins used as decoy for the Protein Virtual Screening analysis. PDB ID Protein family Molecule Res. (Å) 1n24 ISOMERASE (+)-BORNYL DIPHOSPHATE SYNTHASE 2.3 1g4h HYDROLASE 1,3,4,6-TETRACHLORO-1,4-CYCLOHEXADIENE HYDROLASE 1.8 1cel HYDROLASE(O-GLYCOSYL) 1,4-BETA-D-GLUCAN CELLOBIOHYDROLASE I 1.8 1vyf TRANSPORT PROTEIN 14 KDA FATTY ACID BINDING PROTEIN 1.85 1o9f PROTEIN-BINDING 14-3-3-LIKE PROTEIN C 2.7 1t1s OXIDOREDUCTASE 1-DEOXY-D-XYLULOSE 5-PHOSPHATE REDUCTOISOMERASE 2.4 1t1r OXIDOREDUCTASE 1-DEOXY-D-XYLULOSE 5-PHOSPHATE REDUCTOISOMERASE 2.3 1q0q OXIDOREDUCTASE 1-DEOXY-D-XYLULOSE 5-PHOSPHATE REDUCTOISOMERASE 1.9 1jcy LYASE 2-DEHYDRO-3-DEOXYPHOSPHOOCTONATE ALDOLASE 1.9 1fww LYASE 2-DEHYDRO-3-DEOXYPHOSPHOOCTONATE ALDOLASE 1.85 1uk7 HYDROLASE 2-HYDROXY-6-OXO-7-METHYLOCTA-2,4-DIENOATE 1.7 1v11 OXIDOREDUCTASE 2-OXOISOVALERATE DEHYDROGENASE ALPHA SUBUNIT 1.95 1x7w OXIDOREDUCTASE 2-OXOISOVALERATE DEHYDROGENASE ALPHA SUBUNIT 1.73 1d0l TRANSFERASE 35KD SOLUBLE LYTIC TRANSGLYCOSYLASE 1.97 2bt4 LYASE 3-DEHYDROQUINATE DEHYDRATASE
    [Show full text]
  • Medically Useful Plant Terpenoids: Biosynthesis, Occurrence, and Mechanism of Action
    molecules Review Medically Useful Plant Terpenoids: Biosynthesis, Occurrence, and Mechanism of Action Matthew E. Bergman 1 , Benjamin Davis 1 and Michael A. Phillips 1,2,* 1 Department of Cellular and Systems Biology, University of Toronto, Toronto, ON M5S 3G5, Canada; [email protected] (M.E.B.); [email protected] (B.D.) 2 Department of Biology, University of Toronto–Mississauga, Mississauga, ON L5L 1C6, Canada * Correspondence: [email protected]; Tel.: +1-905-569-4848 Academic Editors: Ewa Swiezewska, Liliana Surmacz and Bernhard Loll Received: 3 October 2019; Accepted: 30 October 2019; Published: 1 November 2019 Abstract: Specialized plant terpenoids have found fortuitous uses in medicine due to their evolutionary and biochemical selection for biological activity in animals. However, these highly functionalized natural products are produced through complex biosynthetic pathways for which we have a complete understanding in only a few cases. Here we review some of the most effective and promising plant terpenoids that are currently used in medicine and medical research and provide updates on their biosynthesis, natural occurrence, and mechanism of action in the body. This includes pharmacologically useful plastidic terpenoids such as p-menthane monoterpenoids, cannabinoids, paclitaxel (taxol®), and ingenol mebutate which are derived from the 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway, as well as cytosolic terpenoids such as thapsigargin and artemisinin produced through the mevalonate (MVA) pathway. We further provide a review of the MEP and MVA precursor pathways which supply the carbon skeletons for the downstream transformations yielding these medically significant natural products. Keywords: isoprenoids; plant natural products; terpenoid biosynthesis; medicinal plants; terpene synthases; cytochrome P450s 1.
    [Show full text]
  • Subject Index Proc
    13088 Subject Index Proc. Natl. Acad. Sci. USA 91 (1994) Apoptosis in substantia nigra following developmental striatal excitotoxic Brine shrimp injury, 8117 See Artemia Visualizing hippocampal synaptic function by optical detection of Ca2l Broccol entry through the N-methyl-D-aspartate channel, 8170 See Brassica Amygdala modulation of hippocampal-dependent and caudate Bromophenacyl bromide nucleus-dependent memory processes, 8477 Bromophenacyl bromide binding to the actin-bundling protein I-plastin Distribution of corticotropin-releasing factor receptor mRNA expression inhibits inositol trisphosphate-independent increase in Ca2l in human in the rat brain and pituitary, 8777 neutrophils, 3534 Brownian dynamics Preproenkephalin promoter yields region-specific and long-term Adhesion of hard spheres under the influence of double-layer, van der expression in adult brain after direct in vivo gene transfer via a Waals, and gravitational potentials at a solid/liquid interface, 3004 defective herpes simplex viral vector, 8979 Browsers Intravenous administration of a transferrin receptor antibody-nerve Thorn-like prickles and heterophylly in Cyanea: Adaptations to extinct growth factor conjugate prevents the degeneration of cholinergic avian browsers on Hawaii?, 2810 striatal neurons in a model of Huntington disease, 9077 Bruton agammaglobulinemia Axotomy induces the expression of vasopressin receptors in cranial and Genomic organization and structure of Bruton agammaglobulinemia spinal motor nuclei in the adult rat, 9636 tyrosine kinase: Localization
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 6,610,527 B1 Croteau Et Al
    USOO6610527B1 (12) United States Patent (10) Patent No.: US 6,610,527 B1 Croteau et al. (45) Date of Patent: Aug. 26, 2003 (54) COMPOSITIONS AND METHODS FOR Facchini et al., “Gene family for an Elicitor-Induced Ses TAXOL BIOSYNTHESIS quiterpene Cyclase in Tobacco,” Proc. Natl. Acad. Sci. USA 89:11088–11092 (1992). (75) Inventors: Rodney B. Croteau, Pullman, WA FloSS et al., in Taxol: Science and Applications, Suffness (US); Mark R. Wildung, Colfax, WA (ed.), pp. 191-208, CRC Press, Boca Raton, FL (1995). (US) Hezari et al., “Purification and Characterization of Taxa-4(5), 11(12)-diene Synthase from Pacific Yew (Taxus (73) Assignee: Washington State University Research brevifolia) that Catalyzes the First Committed Step of Taxol Foundation, Pullman, WA (US) Bosynthesis,” Arch. Biochem. BiophyS. 322:437-444 (1995). * Y NotOtice: Subjubject to anyy disclaimer,disclai theh term off thisthi Hezari et al., “Taxol Biosynthesis: An Update,” Planta Med. patent is extended or adjusted under 35 63:291-295 (1997). U.S.C. 154(b) by 162 days. Hezari et al., “Taxol Production and Taxadiene Synthase Activity in Taxus canadensis Cell Suspension Cultures,” (21) Appl. No.: 09/593,253 Arch. Biochem. Biophy. 337:185-190 (1997). Koepp et al., “Cyclization of Geranylgeranyl Diphosphate to (22) Filed: Jun. 13, 2000 Taxa-4(5), 11(12)-diene Is the Committed Step of Taxol Related U.S. Application Data Biosynthesis in Pacific Yew,” J. Biol. Chem. 270:8686-8690 (1995). (60) Continuation of application No. 09/315.861, filed on May LaFever et al., “Diterpenoid Resin Acid Biosynthesis in 20, 1999, now Pat.
    [Show full text]
  • X-Ray Fluorescence Analysis Method Röntgenfluoreszenz-Analyseverfahren Procédé D’Analyse Par Rayons X Fluorescents
    (19) & (11) EP 2 084 519 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G01N 23/223 (2006.01) G01T 1/36 (2006.01) 01.08.2012 Bulletin 2012/31 C12Q 1/00 (2006.01) (21) Application number: 07874491.9 (86) International application number: PCT/US2007/021888 (22) Date of filing: 10.10.2007 (87) International publication number: WO 2008/127291 (23.10.2008 Gazette 2008/43) (54) X-RAY FLUORESCENCE ANALYSIS METHOD RÖNTGENFLUORESZENZ-ANALYSEVERFAHREN PROCÉDÉ D’ANALYSE PAR RAYONS X FLUORESCENTS (84) Designated Contracting States: • BURRELL, Anthony, K. AT BE BG CH CY CZ DE DK EE ES FI FR GB GR Los Alamos, NM 87544 (US) HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR (74) Representative: Albrecht, Thomas Kraus & Weisert (30) Priority: 10.10.2006 US 850594 P Patent- und Rechtsanwälte Thomas-Wimmer-Ring 15 (43) Date of publication of application: 80539 München (DE) 05.08.2009 Bulletin 2009/32 (56) References cited: (60) Divisional application: JP-A- 2001 289 802 US-A1- 2003 027 129 12164870.3 US-A1- 2003 027 129 US-A1- 2004 004 183 US-A1- 2004 017 884 US-A1- 2004 017 884 (73) Proprietors: US-A1- 2004 093 526 US-A1- 2004 235 059 • Los Alamos National Security, LLC US-A1- 2004 235 059 US-A1- 2005 011 818 Los Alamos, NM 87545 (US) US-A1- 2005 011 818 US-B1- 6 329 209 • Caldera Pharmaceuticals, INC. US-B2- 6 719 147 Los Alamos, NM 87544 (US) • GOLDIN E M ET AL: "Quantitation of antibody (72) Inventors: binding to cell surface antigens by X-ray • BIRNBAUM, Eva, R.
    [Show full text]
  • 12) United States Patent (10
    US007635572B2 (12) UnitedO States Patent (10) Patent No.: US 7,635,572 B2 Zhou et al. (45) Date of Patent: Dec. 22, 2009 (54) METHODS FOR CONDUCTING ASSAYS FOR 5,506,121 A 4/1996 Skerra et al. ENZYME ACTIVITY ON PROTEIN 5,510,270 A 4/1996 Fodor et al. MICROARRAYS 5,512,492 A 4/1996 Herron et al. 5,516,635 A 5/1996 Ekins et al. (75) Inventors: Fang X. Zhou, New Haven, CT (US); 5,532,128 A 7/1996 Eggers Barry Schweitzer, Cheshire, CT (US) 5,538,897 A 7/1996 Yates, III et al. s s 5,541,070 A 7/1996 Kauvar (73) Assignee: Life Technologies Corporation, .. S.E. al Carlsbad, CA (US) 5,585,069 A 12/1996 Zanzucchi et al. 5,585,639 A 12/1996 Dorsel et al. (*) Notice: Subject to any disclaimer, the term of this 5,593,838 A 1/1997 Zanzucchi et al. patent is extended or adjusted under 35 5,605,662 A 2f1997 Heller et al. U.S.C. 154(b) by 0 days. 5,620,850 A 4/1997 Bamdad et al. 5,624,711 A 4/1997 Sundberg et al. (21) Appl. No.: 10/865,431 5,627,369 A 5/1997 Vestal et al. 5,629,213 A 5/1997 Kornguth et al. (22) Filed: Jun. 9, 2004 (Continued) (65) Prior Publication Data FOREIGN PATENT DOCUMENTS US 2005/O118665 A1 Jun. 2, 2005 EP 596421 10, 1993 EP 0619321 12/1994 (51) Int. Cl. EP O664452 7, 1995 CI2O 1/50 (2006.01) EP O818467 1, 1998 (52) U.S.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials OH 8 H H8 H C N OH 3 7 3 2 4 H1 1 5 O H4 O 6 H6’ H3 OH H6 H1’ H2 H5 3.9 3.8 3.7 3.6 3.5 3.4 3.3 3.2 ppm 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 2.4 2.2 ppm Figure S1. 1D 1H spectrum of 1-dglcnac and signal assignments ppm 2.0 H8 2.5 OH 8 H H C N OH 3 7 3 2 4 3.0 1 5 H1 O H5 O 6 H4 H3 OH 3.5 H6 H2 H6’ H1’ 4.0 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 2.4 2.2 2.0 ppm Figure S2. 1H-1H TOCSY 2D NMR spectra for 1-dglcnac and signal assignments ppm 3.0 H1 3.2 H5 H4 3.4 H3 3.6 H6 H6’ H2 3.8 H1’ 4.0 4.1 4.0 3.9 3.8 3.7 3.6 3.5 3.4 3.3 3.2 3.1 3.0 ppm Figure S3. 1H-1H COSY 2D NMR spectra for 1-dglcnac and signal assignment ppm -0.02 -0.01 0.00 0.01 0.02 H1’ H6’ H2 H6 H3 H4 H5 H1 3.9 3.8 3.7 3.6 3.5 3.4 3.3 3.2 3.1 ppm Figure S4. 1H-1H JRES 2D NMR spectra for 1-dglcnac and signal assignments ppm 20 C8(22.9) 40 OH 8 H H C N OH C2(53.2) 3 7 3 2 4 60 1 5 C6(63.2) C6(63.2) O 6 C1(69.2) C1(69.2) O C4(72.6) C3(77.0) OH 80 C5(82.7) 100 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 2.4 2.2 2.0 ppm Figure S5.
    [Show full text]
  • Diene Synthase for the Production of Novel Products
    Engineering Selina-4(15),7(11)-diene synthase for the Production of Novel Products Emily Turri Submitted in accordance with the requirements for the degree of Doctor of Philosophy The University of Leeds Astbury Centre for Structural Molecular Biology September 2020 The candidate confirms that the work submitted is her own and that appropriate credit has been given where reference has been made to the work of others. This copy has been supplied on the understanding that it is copyright material and that no quotation from the thesis may be published without proper acknowledgement. The right of Emily Turri to be identified as Author of this work has been asserted by her in accordance with the Copyright, Designs and Patents Act 1988. © 2020 The University of Leeds and Emily Turri 2 Acknowledgements Throughout my PhD I have been extremely lucky to receive support and encouragement from family, friends, colleagues and the university. Without these people and their support, this thesis would not be possible. First, I would like to thank my supervisors Alan Berry and Adam Nelson for their encouragement, guidance and patience over these four years. I would also like to thank Glyn Hemsworth and Nasir Khan for their continued advice and support. I am very grateful to Glyn Hemsworth, Sheena Radford, David Brockwell and John Blacker for letting me use their equipment while offering me direction to give me the best results. In addition, I would like to thank James Ault, Rachel George, Mary Bayana, Mark Howard and Ricardo Labes for their technical assistance and biochemical analysis. My PhD experience would have been nothing without the present and past members of the Hemrry’s and Radford’s with specific thanks to Jess, Alex, Jess and Dan.
    [Show full text]