
Proc. Nati. Acad. Sci. USA Vol. 91, pp. 8497-8501, August 1994 Plant Biology Cloning of casbene synthase cDNA: Evidence for conserved structural features among terpenoid cyclases in plants (phytoalexins/castor bean/Ricinus communis/defense response) CHRISTOPHER J. D. MAU* AND CHARLES A. WESTt Departments of *Biology and tChemistry and Biochemistry, University of California, Los Angeles, CA 90024 Communicated by Paul D. Boyer, April 25, 1994 ABSTRACT A near-fll-length casbene synthase cDNA oligogalacturonide elicitors. This report describes the char- clone, pCS7, was isolated by using a partial cDNA clone, pCS4, acterization ofthis clone§ and the comparison ofthe primary to probe a g10 library constructed from poly(A)+ RNA from structure of CS deduced from it with the deduced primary elicited castor bean dlings. The cDNA insert had a length of structures derived from two other nucleotide sequences 1983 bases with a polyadenylate tail of 19 bases. Translation of reported for higher plant terpenoid cyclization enzymes: the cDNA sequence revealed an open reading frame encoding 5-epi-aristolochene synthase (EAS), which is involved in the a 601-aa protein with a predicted Mr of 68,960. Search of the initial cyclization step for farnesyl diphosphate (FPP) that GenBank data base with the deduced translation product leads to sesquiterpenoid phytoalexins in tobacco (6), and revealed 42% identity and 65% similarity with 5-epi- (-)-4S-limonene synthase (LS), which catalyzes the cycliza- aristolochene synthe from tobacco and 31% identity and 53% tion of geranyl diphosphate (GPP) to essential oil compo- simarity with limonene synthase from spearmint. Each of the nents in spearmint (7). Significant similarities exist among the three proteins catalyzes an intramolecular cyclization of a deduced primary structures ofthe three enzymes. This result prenyl diphosphate substrate to a specific cyclic terpenoid implies that a similar overall conformation, and possibly the hydrocarbon product. The proposed reaction mechanisms for relative positions of similar side chain functional groups, is the three catalytic processes share common chemical features, necessary for catalysis by this group ofenzymes in plants. An even though the products being formed are members of three abstract referring to some ofthis work has been published (8). different es of terpenoid compounds. Analysis of the alignment ofthe three proteins suggests that both primary and AND secondary structural elements are conserved. These smilarties MATERIALS METHODS suggest that the genes that encode terpenoid cyclization en- Isolation of Nucleic Acids. Castor bean seeds were germi- zymes of this type in anglosperms have undergone divergent nated aseptically (9) and treated with elicitor (5). Total RNA evolution from an ancestral progenitor gene. In support ofthis was isolated (10), and contaminating polysaccharides were proposition, the locations offive ofthe six introns in the casbene removed (11). Poly(A)+ RNA was isolated from the total synthase gene align very closely with those ofthe five introns in RNA by two cycles of oligo(dT)-cellulose chromatography the 5-epi-aristolochene synthase gene. (Collaborative Research). The purified sample was precipi- tated with ethanol, and the resulting precipitate was resus- Casbene is a macrocyclic diterpene hydrocarbon that serves pended in RNase-free water for storage at -700C. as a phytoalexin in castor bean (Ricinus communes L.) (1). Library Construction and Screening. Double-stranded Casbene synthase (CS; EC 4.6.1.7) (previously designated cDNA was synthesized with the SuperScript system (Life casbene synthetase) from castor bean seedlings catalyzes the Technologies, Gaithersburg, MD) from 4 jg of poly(A)+ cyclization of geranylgeranyl diphosphate (GGPP) to form RNA obtained from elicitor-treated seedlings. The cDNA the macrocyclic hydrocarbon in a single enzymatic step. The was then fractionated on Sephacryl S-500 HR columns (Phar- inducible enzyme activity is found in proplastids of germi- macia LKB) to enrich for larger cDNA inserts. Eighty-five nating seedlings infected by the fungus Rhizopus stolonifer nanograms of size-fractionated cDNA was ligated to EcoRI/ (2). The plant cells recognize oligogalacturonide fragments Not I adapters and then ligated to EcoRI-digested AgtlO released from pectic components of the plant cell wall by a vector DNA and packaged in vitro with Packagene extracts secreted fungal endopolygalacturonase as a signal to activate (Promega). Phage virions were plated on Escherichia coli CS induction (3). CS activity reaches detectable levels after MB406 (Promega), and duplicate nitrocellulose filter replicas 5 hr of incubation with pectic fragments, with a peak occur- were screened with the pCS4 insert (5) and 5' sequences from ring after 10-12 hr (4). The active enzyme consists ofa single the CS gene (unpublished data) that were labeled by random polypeptide and has an apparent Mr of 59,000 as determined priming (12). The probes were chosen to identify a clone that by SDS/PAGE. Polyclonal antibodies to the purified enzyme should be full-length. Hybridization was for 18 hr at 420C in have been used to isolate a partial cDNA clone from a Agtll 50% formamide/5x standard saline citrate (SSC)/0.1% library (5). RNA gel blots probed with this clone show that SDS/50 mM sodium phosphate, pH 7, containing (100 hep- casbene synthase mRNA is undetectable in unelicited seed- arin ug/ml) and yeast tRNA (20 ug/ml). Filters were washed lings but accumulates to a maximum at 6 hr following for 1 hr at 420C with three changes of preequilibrated 0.1 x elicitation. Nuclear run-on experiments indicate that control SSC/0.1% SDS. Plaques hybridizing to both probes were is exerted at the level of transcription. A full-length CS cDNA clone was isolated as part of an Abbreviations: CS, casbene synthase; EAS, 5-epi-aristolochene effort to characterize the gene structure in order to identify synthase; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphos- cis-acting elements involved in the induction of this gene by phate; GPP, geranyl diphosphate; LS, limonene synthase. tTo whom reprint requests should be addressed at: Department of Chemistry and Biochemistry, University of California at Los An- The publication costs of this article were defrayed in part by page charge geles, 405 Hilgard Avenue, Los Angeles, CA 90024-1569. payment. This article must therefore be hereby marked "advertisement" §The nucleotide sequence reported in this paper has been submitted in accordance with 18 U.S.C. §1734 solely to indicate this fact. to the GenBank data library (accession no. L32134). 8497 Downloaded by guest on September 28, 2021 8498 Plant Biology: Mau and West Proc. Nati. Acad. Sci. USA 91 (1994) r-. pCS7 identified by autoradiography at -700C and purified by three ACTCAGCAGCCGCCTCTCCTACCCCAATTAGCACAGAAGATTTGGTGGTTCCTCTCCTTG rounds of hybridization as described above. Sequencing of cDNA Inserts. cDNA inserts from purified TGAAACACGGCATTGCCATCAGCTGCTA2AATCCAACCCTGAAAAGCTTAACTTATTT 120 phage clones were ligated into pBluescript II SK(-) (Strat- 1 1 A L P S A A N Q S N P E K L N L F agene) or pGEM-7f+ (Promega) by use of appropriate re- CACAGATTGTCAAGCTTACCCACCACTAGCTTGGAATATGGCAATAATCGCTTCCCTTTC 180 F P F striction endonucleases (Stratagene, Promega, or United 19 H R L S S L P T T S L E Y G N N R States Biochemical) according to common procedures (13, TTTTCCTCATCTGCCAAGTCACACTTTAAAAAACCAACTCAAGCATGTTTATCCTCAACA 240 K P T A C L S S T 14). Dideoxynucleotide sequencing of the cDNA clone was 39 F S S S A K S H F K 0 performed with Sequenase II (United States Biochemical) ACCCACCAAGAAGTTCGTCCATTAGCATACTTTCCTCCTACTGTCTGGGGCAATCGCTTT 300 T E V R P L A Y F P P T V W G N R F using synthetic oligonucleotide primers made on a Pharmacia 59 H Q Gene Assembler. Sequence comparisons were done using GCTTCCTTGACCTTCAATCCATCIGAATTTGAATCGTATGATGAACGGGTAATTGTGCTG 360 A SL T F N P S E F E S Y D E R V I V L MACVECTOR version 3.5 (International Biotechnologies) and 79 the programs from the University of Wisconsin Genetics AAGAAAAAAGTTAAGGACATATTAATTTCATCTACAAGTGATTCAGTGGAGACCGTTATT 420 99 K K K V K D I L I S S T S D S V E T V I Computer Group, version 7 (15). TTAATCGACTTATTATGTCGGCTTGGCGTATCATATCACTTTGAAAATGATATTGAAGAG 480 119 L I D L L C R L G V S Y H F E N D I E E RESULTS AND DISCUSSION CTACTAAGTAAAATCTTCAACTCCCAGCCTGACCTTGTCGATGAAAAAGAATGTGATCTC 540 139 L L S K I F N S Q P D L V D E K E C D L pCS4, the initial cDNA clone identified by polyclonal anti- bodies from an expression library, contained only 230 of the TACACTGCGGCAATTGTATTCCGAGTTTTCAGACAGCATGGTTTTAAAATGTCTTCGG^T 600 159 Y T A A I V F R V F R 0 H G F K M S S D 1650 bases predicted for a full-length message (5). Three types of evidence indicated that pCS4 contained CS coding GTGTTTAGCAAATTCAAGGACAGTGATGGTAAGTTCAAGGAATCCCTACGGGGTGATGCT 660 179 V F S K F K D S D G K F K E S L R G D A sequences-the observed binding of CS polyclonal antibod- ies to the fusion protein expressed from pCS4 sequences AAGGGTATGCTCAGCCTTTTTGAAGCTTCCCATCTAAGTGTGCATGGAGAAGACATTCTT 720 199 K G M L S LF E A S H L S V H G E D I L ligated in a Agtll library, and the results of both hybrid- arrested and hybrid-selected in vitro translation of RNA that GAAGAAGCCTTTGCTTTCACCAAGGATTACTTACAGTCCTCTGCAGTTGAGTTATTCCCT 780 219 E E A F A F T K D Y L Q S S A V E L F P annealed to this clone after extraction from elicited seedlings (5). Attempts to isolate any longer clones from the original AATCTCAAAAGGCATATAACGAACGCCCTAGAGCAGCCTTTCCACAGTGGCGTGCCGAGG 840 239 N L K R H I T N A L E Q P F H S G V P R Agtll library were never successful, probably because the 230-bp clone was propagated preferentially during library CTAGAGGCCAGGAAATTCATCGATCTATACGAAGCTGATATTGAATGCCGGAATGAAACT 900 259 L E A R K F I D L Y E A D I E C R N E T amphlfcation. We suspect that the truncated pCS4 clone arose after incomplete EcoRI methylase protection of syn- CTGCTCGAGTTTGCAAAGTTGGATTATAATAGAGTTCAGTTATTGCACCAACAAGAGCTG 960 L L E F A K L D Y N R V Q L L H 0 Q E L thesized double-stranded cDNA was followed by subsequent 279 cloning steps into EcoRI-digested Agtll vector.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages5 Page
-
File Size-