DOCSLIB.ORG

Supplementary Materials

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Materials Supplementary Materials OH 8 H H8 H C N OH 3 7 3 2 4 H1 1 5 O H4 O 6 H6’ H3 OH H6 H1’ H2 H5 3.9 3.8 3.7 3.6 3.5 3.4 3.3 3.2 ppm 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 2.4 2.2 ppm Figure S1. 1D 1H spectrum of 1-dglcnac and signal assignments ppm 2.0 H8 2.5 OH 8 H H C N OH 3 7 3 2 4 3.0 1 5 H1 O H5 O 6 H4 H3 OH 3.5 H6 H2 H6’ H1’ 4.0 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 2.4 2.2 2.0 ppm Figure S2. 1H-1H TOCSY 2D NMR spectra for 1-dglcnac and signal assignments ppm 3.0 H1 3.2 H5 H4 3.4 H3 3.6 H6 H6’ H2 3.8 H1’ 4.0 4.1 4.0 3.9 3.8 3.7 3.6 3.5 3.4 3.3 3.2 3.1 3.0 ppm Figure S3. 1H-1H COSY 2D NMR spectra for 1-dglcnac and signal assignment ppm -0.02 -0.01 0.00 0.01 0.02 H1’ H6’ H2 H6 H3 H4 H5 H1 3.9 3.8 3.7 3.6 3.5 3.4 3.3 3.2 3.1 ppm Figure S4. 1H-1H JRES 2D NMR spectra for 1-dglcnac and signal assignments ppm 20 C8(22.9) 40 OH 8 H H C N OH C2(53.2) 3 7 3 2 4 60 1 5 C6(63.2) C6(63.2) O 6 C1(69.2) C1(69.2) O C4(72.6) C3(77.0) OH 80 C5(82.7) 100 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 2.4 2.2 2.0 ppm Figure S5. The 1H-13C HSQC NMR spectra for 1-dglcnac and signal assignments ppm 20 40 C2 C6 60 C1 C4 C3 C5 80 OH 100 8 H H C N OH 3 7 3 2 4 120 1 5 O O 6 140 OH 160 C7 180 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 2.4 2.2 2.0 ppm Figure S6. The 1H-13C HMBC NMR spectra for 1-dglcnac and signal assignments Figure S7. 1HNMR spectroscopy of isolated compound (a), chemically synthetic compound of 2-acetamido-1,5-anhydro-2-deoxy-D-mannitol (b), chemically synthetic compound of 2-acetamido-1,5-anhydro-2-deoxy-D-glucitol Figure S8. Calculated and experimental ECD spectra of the isolated and synthesized compound. Table S1. DNA primers used in this study. Name Sequence (5´ -3´) 16S-F TGGCAACTAAGGACAAGGG 16S-R AAGCGGTGGAGTATGTGG rpfF-F GTTGGTCTGATAGCGGGTGA rpfF-R TGAAGAACCGCAGCGTGAG gumD-F TTTCATAGTGCGTGTTGTGCT gumD-R AACGACGCACGCATCACG ftsZ-F CTGCTGGACGATGTGAACCTG ftsZ-R ATAATCGTTGGGCAGGTCAGC glmS-F CCCCAGCGATTTGGCGTAC glmS-R GCGTATGCGAACCCACAGC Table S2. The top 300 pharmacophore candidates identified via pharmMapper PDB Number of Fit Normalized Rank Target Name ID Feature Score Fit Score 1 1XIE Xylose isomerase 8 3.96 0.495 2 2C68 Cell division protein kinase 2 6 2.875 0.4792 3 1UOU Thymidine phosphorylase 6 2.841 0.4736 4 1NB6 Genome polyprotein 6 2.84 0.4734 5 1UKG NONE 12 5.665 0.4721 6 1G0I Inositol-1-monophosphatase 6 2.828 0.4714 7 2AFU Glutaminyl-peptide cyclotransferase 8 3.752 0.469 8 2H15 Carbonic anhydrase 2 6 2.813 0.4688 9 1DMJ Nitric oxide synthase, endothelial 6 2.78 0.4634 10 1O9W F17a-G fimbrial adhesin 12 5.527 0.4606 11 1LG1 Chitotriosidase-1 6 2.763 0.4606 12 1TW5 Beta-1,4-galactosyltransferase 1 10 4.582 0.4582 3,4-dihydroxy-2-butanone 4-phosphate 13 1TKU 8 3.616 0.452 synthase 14 1TDB Thymidylate synthase 10 4.509 0.4509 15 6RSA Ribonuclease pancreatic 10 4.421 0.4421 Ribosome-inactivating protein 16 1MRK 6 2.647 0.4411 alpha-trichosanthin 17 1O70 Fasciclin-1 8 3.524 0.4405 18 1QFX 3-phytase B 6 2.621 0.4368 2-amino-4-hydroxy-6-hydroxymethyldihy 19 1Q0N 8 3.441 0.4301 dropteridine pyrophosphokinase 20 6CGT Cyclomaltodextrin glucanotransferase 10 4.261 0.4261 21 1T7Q Carnitine O-acetyltransferase 8 3.398 0.4248 22 1O7D Lysosomal alpha-mannosidase 10 4.215 0.4215 23 1FA2 Beta-amylase 8 3.361 0.4201 24 1UQX Probable sugar-binding lectin protein 14 5.841 0.4172 Atrial natriuretic peptide clearance 25 1JDN 6 2.493 0.4155 receptor 26 1UBY Farnesyl pyrophosphate synthetase 7 2.905 0.415 Phosphopantothenoylcysteine 27 1MVN 6 2.438 0.4064 decarboxylase Proto-oncogene tyrosine-protein kinase 28 1O41 8 3.232 0.404 Src 29 1DY4 Exoglucanase 1 8 3.195 0.3994 30 1IMB Inositol monophosphatase 12 4.767 0.3972 31 1NLJ Cathepsin K 7 2.767 0.3953 32 1C7S Chitobiase 12 4.703 0.3919 Purine nucleoside phosphorylase 33 1PR1 11 4.297 0.3906 deoD-type 34 1GIC Concanavalin-A 12 4.656 0.388 35 1PTG 1-phosphatidylinositol phosphodiesterase 12 4.594 0.3828 36 1GPJ Glutamyl-tRNA reductase 8 3.047 0.3809 Imidazole glycerol phosphate synthase 37 1OX6 7 2.647 0.3782 hisHF 38 1MZE Hypoxia-inducible factor 1-alpha inhibitor 9 3.398 0.3776 39 1UNL Cyclin-dependent kinase 5 activator 1 7 2.634 0.3762 40 1MSA Mannose-specific lectin 12 4.513 0.3761 41 1LT5 Heat-labile enterotoxin B chain 12 4.498 0.3748 42 1GOR Endo-1,4-beta-xylanase 10 3.738 0.3738 Baculoviral IAP repeat-containing protein 43 2I3I 8 2.982 0.3728 7 44 1LJN Lysozyme C 12 4.463 0.3719 45 1QCI Antiviral protein I 8 2.969 0.3712 46 1E70 Myrosinase MA1 14 5.196 0.3711 47 2FOY Carbonic anhydrase 1 10 3.704 0.3704 48 9LDB L-lactate dehydrogenase A chain 7 2.589 0.3699 ADP-ribose pyrophosphatase, 49 1Q33 16 5.914 0.3696 mitochondrial 50 1FWY Bifunctional protein glmU 18 6.648 0.3693 2-dehydro-3-deoxyphosphooctonate 51 1PHW 8 2.95 0.3688 aldolase 52 1S3F Purine trans deoxyribosylase 10 3.683 0.3683 53 1FYS Guanyl-specific ribonuclease T1 10 3.646 0.3646 54 1UWZ Cytidine deaminase 10 3.632 0.3632 55 1KR6 Thermolysin 8 2.906 0.3632 56 1SQ5 Pantothenate kinase 10 3.618 0.3618 57 1MQ6 Coagulation factor X 8 2.891 0.3614 58 1CW7 Isocitrate dehydrogenase [NADP] 8 2.884 0.3605 59 1REF Endo-1,4-beta-xylanase 2 10 3.597 0.3597 60 1D7U 2,2-dialkylglycine decarboxylase 8 2.866 0.3583 61 1L8L Phosphoserine phosphatase 8 2.864 0.358 62 1M7P Triosephosphate isomerase 6 2.148 0.3579 63 2ANG Angiogenin 8 2.859 0.3574 64 1V0P Cell division control protein 2 homolog 7 2.493 0.3561 65 1PFY Methionyl-tRNA synthetase 10 3.56 0.356 66 1OD8 Endo-1,4-beta-xylanase A 12 4.269 0.3558 67 2BKV Glucosamine-6-phosphate deaminase 1 10 3.558 0.3558 68 1RFG Purine nucleoside phosphorylase 10 3.55 0.355 69 1JDZ S-methyl-5-thioadenosine phosphorylase 12 4.243 0.3536 70 1IJE Elongation factor 1-alpha 8 2.826 0.3533 71 1KEJ DNA nucleotidylexotransferase 10 3.508 0.3508 72 1L0G Beta-lactamase 8 2.797 0.3497 73 1FA9 Glycogen phosphorylase, liver form 14 4.864 0.3474 74 1XOG Neuraminidase 8 2.777 0.3472 75 1EQC Glucan 1,3-beta-glucosidase 12 4.163 0.3469 76 1TG2 Phenylalanine-4-hydroxylase 10 3.446 0.3446 77 1AHA Ribosome-inactivating protein momordin I 7 2.4 0.3428 Acetolactate synthase catalytic subunit, 78 1T9B 8 2.731 0.3414 mitochondrial 79 1M8E Nitric oxide synthase, inducible 6 2.049 0.3414 80 1OCQ Endoglucanase 5A 10 3.402 0.3402 81 1W55 Bifunctional enzyme ispD/ispF 8 2.721 0.3401 82 1KI3 Thymidine kinase 8 2.718 0.3398 83 1MQO Beta-lactamase II 11 3.685 0.335 Peroxisomal carnitine 84 1XL8 8 2.677 0.3347 O-octanoyltransferase 85 1W7M Kynurenine--oxoglutarate transaminase 1 8 2.656 0.332 86 1GVG Clavaminate synthase 1 10 3.318 0.3318 87 1C1L Congerin-1 12 3.975 0.3313 88 1O51 UPF0166 protein TM_0021 8 2.642 0.3302 Nicotinamide-nucleotide 89 1HYB 13 4.285 0.3296 adenylyltransferase 90 1AX0 Lectin 10 3.291 0.3291 91 1M4G Aminoglycoside 2-N-acetyltransferase 12 3.946 0.3288 Baculoviral IAP repeat-containing protein 92 3HL5 9 2.956 0.3284 4 93 1UA4 ADP-dependent glucokinase 20 6.532 0.3266 94 1VL1 6-phosphogluconolactonase 8 2.611 0.3264 Acyl-[acyl-carrier-protein]--UDP-N-acetyl 95 1J2Z 10 3.259 0.3259 glucosamine O-acyltransferase 96 1MVQ Mannose/glucose-specific lectin Cramoll 12 3.906 0.3255 97 1W1A Probable polysaccharide deacetylase pdaA 10 3.255 0.3255 98 1LP6 Orotidine 5-phosphate decarboxylase 12 3.903 0.3253 99 1JS3 Aromatic-L-amino-acid decarboxylase 11 3.578 0.3253 100 1DCP Pterin-4-alpha-carbinolamine dehydratase 8 2.582 0.3227 101 1MD9 2,3-dihydroxybenzoate-AMP ligase 12 3.852 0.321 102 1NP0 Beta-hexosaminidase subunit beta 8 2.567 0.3209 1-deoxy-D-xylulose 5-phosphate 103 1T1S 8 2.557 0.3197 reductoisomerase 104 1HQL GSI-B4 isolectin 12 3.809 0.3174 105 5FIV Pol polyprotein 9 2.852 0.3169 106 3BM9 Heat shock protein HSP 90-alpha 8 2.535 0.3169 107 1JCJ Deoxyribose-phosphate aldolase 8 2.532 0.3164 108 1GQT Ribokinase 14 4.397 0.3141 109 1LIJ Adenosine kinase 14 4.394 0.3139 110 1H0R 3-dehydroquinate dehydratase 14 4.384 0.3131 111 3FZK Heat shock cognate 71 kDa protein 10 3.128 0.3128 112 4CTS Citrate synthase, mitochondrial 9 2.811 0.3123 Hypoxanthine-guanine-xanthine 113 1QK5 12 3.744 0.312 phosphoribosyltransferase Glyceraldehyde-3-phosphate 114 1DC4 12 3.74 0.3117 dehydrogenase A 115 1DOG Glucoamylase I 12 3.737 0.3114 116 1GHV Prothrombin 7 2.175 0.3108 117 1ISS Metabotropic glutamate receptor 1 9 2.796 0.3106 118 1MS6 Cathepsin S 9 2.775 0.3084 119 1HI3 Non-secretory ribonuclease 12 3.696 0.308 120 1UV5 Glycogen synthase kinase-3 beta 9 2.762 0.3069 121 1F0U Cationic trypsin 8 2.455 0.3068 122 1LTK Phosphoglycerate kinase 10 3.067 0.3067 UDP-4-amino-4-deoxy-L-arabinose--oxogl 123 1MDO 12 3.677 0.3065 utarate aminotransferase 124 1JC9 Techylectin-5A 8 2.45 0.3063 125 1PQP Aspartate-semialdehyde dehydrogenase 10 3.057 0.3057 126 1DYT Eosinophil cationic protein 8 2.443 0.3054 127 1MUO Serine/threonine-protein kinase 6 7 2.125 0.3036 128 1KIZ Trichodiene synthase 9 2.728 0.3032 129 5ENL Enolase 1 10 3.031 0.3031 130 1DAR Elongation factor G 12 3.636 0.303 6-phosphofructo-2-kinase/fructose-2,6-bip 131 3BIF 10 3.028 0.3028 hosphatase 4 132 1QF3 Galactose-binding lectin 10 3.016 0.3016 133 1A0G D-alanine aminotransferase 14 4.221 0.3015 Glucosamine--fructose-6-phosphate 134 1MOQ 14 4.218 0.3013 aminotransferase [isomerizing] 135 1GJ8 Urokinase-type plasminogen activator 12 3.601 0.3001 136 1UOW Synaptotagmin-1 8 2.393 0.2992 137 1J1R Antiviral protein S 7 2.088 0.2983 138 1XL1 Glycogen phosphorylase, muscle form 14 4.163 0.2973 139 1AMR Aspartate aminotransferase 14 4.161 0.2972 140 1HV6 Alginate lyase 12 3.562 0.2969 141 1T31 Chymase 12 3.557 0.2964 142 1IH7 DNA polymerase 8 2.37 0.2963 Glutamate-1-semialdehyde 143 3GSB 12 3.541 0.2951 2,1-aminomutase
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Structure-Based Virtual Screening of Hypothetical Inhibitors of the Enzyme Longiborneol Synthase—A Potential Target to Reduce Fusarium Head Blight Disease
    J Mol Model (2016) 22: 163 DOI 10.1007/s00894-016-3021-1 ORIGINAL PAPER Structure-based virtual screening of hypothetical inhibitors of the enzyme longiborneol synthase—a potential target to reduce Fusarium head blight disease E. Bresso1 & V. L ero ux 2 & M. Urban3 & K. E. Hammond-Kosack3 & B. Maigret2 & N. F. Martins1 Received: 17 December 2015 /Accepted: 27 May 2016 /Published online: 21 June 2016 # Springer-Verlag Berlin Heidelberg 2016 Abstract Fusarium head blight (FHB) is one of the most compounds from a library of 15,000 drug-like compounds. destructive diseases of wheat and other cereals worldwide. These putative inhibitors of longiborneol synthase provide a During infection, the Fusarium fungi produce mycotoxins that sound starting point for further studies involving molecular represent a high risk to human and animal health. Developing modeling coupled to biochemical experiments. This process small-molecule inhibitors to specifically reduce mycotoxin could eventually lead to the development of novel approaches levels would be highly beneficial since current treatments to reduce mycotoxin contamination in harvested grain. unspecifically target the Fusarium pathogen. Culmorin pos- sesses a well-known important synergistically virulence role Keywords Fusarium mycotoxins . Culmorin . Inhibitors . among mycotoxins, and longiborneol synthase appears to be a Homology modeling . Molecular dynamics . Ensemble key enzyme for its synthesis, thus making longiborneol syn- docking thase a particularly interesting target. This study aims to dis- cover potent and less toxic agrochemicals against FHB. These compounds would hamper culmorin synthesis by inhibiting Introduction longiborneol synthase. In order to select starting molecules for further investigation, we have conducted a structure- Fusarium head blight (FHB), caused by Fusarium based virtual screening investigation.
    [Show full text]
  • Folic Acid Antagonists: Antimicrobial and Immunomodulating Mechanisms and Applications
    International Journal of Molecular Sciences Review Folic Acid Antagonists: Antimicrobial and Immunomodulating Mechanisms and Applications Daniel Fernández-Villa 1, Maria Rosa Aguilar 1,2 and Luis Rojo 1,2,* 1 Instituto de Ciencia y Tecnología de Polímeros, Consejo Superior de Investigaciones Científicas, CSIC, 28006 Madrid, Spain; [email protected] (D.F.-V.); [email protected] (M.R.A.) 2 Consorcio Centro de Investigación Biomédica en Red de Bioingeniería, Biomateriales y Nanomedicina, 28029 Madrid, Spain * Correspondence: [email protected]; Tel.: +34-915-622-900 Received: 18 September 2019; Accepted: 7 October 2019; Published: 9 October 2019 Abstract: Bacterial, protozoan and other microbial infections share an accelerated metabolic rate. In order to ensure a proper functioning of cell replication and proteins and nucleic acids synthesis processes, folate metabolism rate is also increased in these cases. For this reason, folic acid antagonists have been used since their discovery to treat different kinds of microbial infections, taking advantage of this metabolic difference when compared with human cells. However, resistances to these compounds have emerged since then and only combined therapies are currently used in clinic. In addition, some of these compounds have been found to have an immunomodulatory behavior that allows clinicians using them as anti-inflammatory or immunosuppressive drugs. Therefore, the aim of this review is to provide an updated state-of-the-art on the use of antifolates as antibacterial and immunomodulating agents in the clinical setting, as well as to present their action mechanisms and currently investigated biomedical applications. Keywords: folic acid antagonists; antifolates; antibiotics; antibacterials; immunomodulation; sulfonamides; antimalarial 1.
    [Show full text]
  • Articles Catalytic Cycling in Β-Phosphoglucomutase: a Kinetic
    9404 Biochemistry 2005, 44, 9404-9416 Articles Catalytic Cycling in â-Phosphoglucomutase: A Kinetic and Structural Analysis†,‡ Guofeng Zhang, Jianying Dai, Liangbing Wang, and Debra Dunaway-Mariano* Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico 87131-0001 Lee W. Tremblay and Karen N. Allen* Department of Physiology and Biophysics, Boston UniVersity School of Medicine, Boston, Massachusetts 02118-2394 ReceiVed March 26, 2005; ReVised Manuscript ReceiVed May 18, 2005 ABSTRACT: Lactococcus lactis â-phosphoglucomutase (â-PGM) catalyzes the interconversion of â-D-glucose 1-phosphate (â-G1P) and â-D-glucose 6-phosphate (G6P), forming â-D-glucose 1,6-(bis)phosphate (â- G16P) as an intermediate. â-PGM conserves the core domain catalytic scaffold of the phosphatase branch of the HAD (haloalkanoic acid dehalogenase) enzyme superfamily, yet it has evolved to function as a mutase rather than as a phosphatase. This work was carried out to identify the structural basis underlying this diversification of function. In this paper, we examine â-PGM activation by the Mg2+ cofactor, â-PGM activation by Asp8 phosphorylation, and the role of cap domain closure in substrate discrimination. First, the 1.90 Å resolution X-ray crystal structure of the Mg2+-â-PGM complex is examined in the context of + + previously reported structures of the Mg2 -R-D-galactose-1-phosphate-â-PGM, Mg2 -phospho-â-PGM, and Mg2+-â-glucose-6-phosphate-1-phosphorane-â-PGM complexes to identify conformational changes that occur during catalytic turnover. The essential role of Asp8 in nucleophilic catalysis was confirmed by demonstrating that the D8A and D8E mutants are devoid of catalytic activity.
    [Show full text]
  • 35 Disorders of Purine and Pyrimidine Metabolism
    35 Disorders of Purine and Pyrimidine Metabolism Georges van den Berghe, M.- Françoise Vincent, Sandrine Marie 35.1 Inborn Errors of Purine Metabolism – 435 35.1.1 Phosphoribosyl Pyrophosphate Synthetase Superactivity – 435 35.1.2 Adenylosuccinase Deficiency – 436 35.1.3 AICA-Ribosiduria – 437 35.1.4 Muscle AMP Deaminase Deficiency – 437 35.1.5 Adenosine Deaminase Deficiency – 438 35.1.6 Adenosine Deaminase Superactivity – 439 35.1.7 Purine Nucleoside Phosphorylase Deficiency – 440 35.1.8 Xanthine Oxidase Deficiency – 440 35.1.9 Hypoxanthine-Guanine Phosphoribosyltransferase Deficiency – 441 35.1.10 Adenine Phosphoribosyltransferase Deficiency – 442 35.1.11 Deoxyguanosine Kinase Deficiency – 442 35.2 Inborn Errors of Pyrimidine Metabolism – 445 35.2.1 UMP Synthase Deficiency (Hereditary Orotic Aciduria) – 445 35.2.2 Dihydropyrimidine Dehydrogenase Deficiency – 445 35.2.3 Dihydropyrimidinase Deficiency – 446 35.2.4 Ureidopropionase Deficiency – 446 35.2.5 Pyrimidine 5’-Nucleotidase Deficiency – 446 35.2.6 Cytosolic 5’-Nucleotidase Superactivity – 447 35.2.7 Thymidine Phosphorylase Deficiency – 447 35.2.8 Thymidine Kinase Deficiency – 447 References – 447 434 Chapter 35 · Disorders of Purine and Pyrimidine Metabolism Purine Metabolism Purine nucleotides are essential cellular constituents 4 The catabolic pathway starts from GMP, IMP and which intervene in energy transfer, metabolic regula- AMP, and produces uric acid, a poorly soluble tion, and synthesis of DNA and RNA. Purine metabo- compound, which tends to crystallize once its lism can be divided into three pathways: plasma concentration surpasses 6.5–7 mg/dl (0.38– 4 The biosynthetic pathway, often termed de novo, 0.47 mmol/l). starts with the formation of phosphoribosyl pyro- 4 The salvage pathway utilizes the purine bases, gua- phosphate (PRPP) and leads to the synthesis of nine, hypoxanthine and adenine, which are pro- inosine monophosphate (IMP).
    [Show full text]
  • Protein Expression Profile of Gluconacetobacter Diazotrophicus PAL5, a Sugarcane Endophytic Plant Growth-Promoting Bacterium
    Proteomics 2008, 8, 1631–1644 DOI 10.1002/pmic.200700912 1631 RESEARCH ARTICLE Protein expression profile of Gluconacetobacter diazotrophicus PAL5, a sugarcane endophytic plant growth-promoting bacterium Leticia M. S. Lery1, 2, Ana Coelho1, 3, Wanda M. A. von Kruger1, 2, Mayla S. M. Gonc¸alves1, 3, Marise F. Santos1, 4, Richard H. Valente1, 5, Eidy O. Santos1, 3, Surza L. G. Rocha1, 5, Jonas Perales1, 5, Gilberto B. Domont1, 4, Katia R. S. Teixeira1, 6 and Paulo M. Bisch1, 2 1 Rio de Janeiro Proteomics Network, Rio de Janeiro, Brazil 2 Unidade Multidisciplinar de Genômica, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil 3 Departamento de Genética, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil 4 Laboratório de Química de Proteínas, Departamento de Bioquímica, Instituto de Química, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil 5 Laboratório de Toxinologia, Departamento de Fisiologia e Farmacodinâmica- Instituto Oswaldo Cruz- Fundac¸ão Oswaldo Cruz, Rio de Janeiro, Rio de Janeiro, Brazil 6 Laboratório de Genética e Bioquímica, Embrapa Agrobiologia, Seropédica, Brazil This is the first broad proteomic description of Gluconacetobacter diazotrophicus, an endophytic Received: September 25, 2007 bacterium, responsible for the major fraction of the atmospheric nitrogen fixed in sugarcane in Revised: December 18, 2007 tropical regions. Proteomic coverage of G. diazotrophicus PAL5 was obtained by two independent Accepted: December 19, 2007 approaches: 2-DE followed by MALDI-TOF or TOF-TOF MS and 1-DE followed by chromatog- raphy in a C18 column online coupled to an ESI-Q-TOF or ESI-IT mass spectrometer.
    [Show full text]
  • The Role and Mechanisms of Action of Micrornas in Cancer Drug Resistance Wengong Si1,2,3, Jiaying Shen4, Huilin Zheng1,5 and Weimin Fan1,6*
    Si et al. Clinical Epigenetics (2019) 11:25 https://doi.org/10.1186/s13148-018-0587-8 REVIEW Open Access The role and mechanisms of action of microRNAs in cancer drug resistance Wengong Si1,2,3, Jiaying Shen4, Huilin Zheng1,5 and Weimin Fan1,6* Abstract MicroRNAs (miRNAs) are small non-coding RNAs with a length of about 19–25 nt, which can regulate various target genes and are thus involved in the regulation of a variety of biological and pathological processes, including the formation and development of cancer. Drug resistance in cancer chemotherapy is one of the main obstacles to curing this malignant disease. Statistical data indicate that over 90% of the mortality of patients with cancer is related to drug resistance. Drug resistance of cancer chemotherapy can be caused by many mechanisms, such as decreased antitumor drug uptake, modified drug targets, altered cell cycle checkpoints, or increased DNA damage repair, among others. In recent years, many studies have shown that miRNAs are involved in the drug resistance of tumor cells by targeting drug-resistance-related genes or influencing genes related to cell proliferation, cell cycle, and apoptosis. A single miRNA often targets a number of genes, and its regulatory effect is tissue-specific. In this review, we emphasize the miRNAs that are involved in the regulation of drug resistance among different cancers and probe the mechanisms of the deregulated expression of miRNAs. The molecular targets of miRNAs and their underlying signaling pathways are also explored comprehensively. A holistic understanding of the functions of miRNAs in drug resistance will help us develop better strategies to regulate them efficiently and will finally pave the way toward better translation of miRNAs into clinics, developing them into a promising approach in cancer therapy.
    [Show full text]
  • The Phylogenetic Extent of Metabolic Enzymes and Pathways José Manuel Peregrin-Alvarez, Sophia Tsoka, Christos A
    Downloaded from genome.cshlp.org on October 8, 2021 - Published by Cold Spring Harbor Laboratory Press Letter The Phylogenetic Extent of Metabolic Enzymes and Pathways José Manuel Peregrin-Alvarez, Sophia Tsoka, Christos A. Ouzounis1 Computational Genomics Group, The European Bioinformatics Institute, EMBL Cambridge Outstation, Cambridge CB10 1SD, UK The evolution of metabolic enzymes and pathways has been a subject of intense study for more than half a century. Yet, so far, previous studies have focused on a small number of enzyme families or biochemical pathways. Here, we examine the phylogenetic distribution of the full-known metabolic complement of Escherichia coli, using sequence comparison against taxa-specific databases. Half of the metabolic enzymes have homologs in all domains of life, representing families involved in some of the most fundamental cellular processes. We thus show for the first time and in a comprehensive way that metabolism is conserved at the enzyme level. In addition, our analysis suggests that despite the sequence conservation and the extensive phylogenetic distribution of metabolic enzymes, their groupings into biochemical pathways are much more variable than previously thought. One of the fundamental tenets in molecular biology was ex- reliable source of metabolic information. The EcoCyc data- pressed by Monod, in his famous phrase “What is true for base holds information about the full genome and all known Escherichia coli is true for the elephant” (Jacob 1988). For a metabolic pathways of Escherichia coli (Karp et al. 2000). Re- long time, this statement has inspired generations of molecu- cently, the database has been used to represent computational lar biologists, who have used Bacteria as model organisms to predictions of other organisms (Karp 2001).
    [Show full text]
  • Metabolism of Nucleotides
    METABOLISM OF NUCLEOTIDES Tomáš Kuˇcera Ústav lékaˇrské chemie a klinické biochemie 2. lékaˇrská fakulta, Univerzita Karlova v Praze 2013 NUKLEOTIDY rocy t e c l e e − − − h O O O N −O P O P O P O O O O O O H H H H OH OH heterocycle = nucleobase the name is historic pyrimidine purine nicotinamide, flavine PYRIMIDINE BASES AND NUCLEOSIDES PURINE BASES AND NUCLEOSIDES SOME LESS USUAL BASES AND NUCLEOSIDES 5-formylcytosine 6-methyladenine 4-methylcytosine FUNCTION OF NUCLEOTIDES precursors of DNA and RNA ATP, GTP, CTP, UTP, dATP, dGTP, dCTP, dTTP components of enzyme cofactors NAD(P), FAD, FMN, CoA [(P)APS – (phospho)adenosylphosphosulphate] macroergic “energy quanta” carriers ATP, GTP activated intermediates in biosyntheses UDP-sugars, CDP-diacylglycerols, S-adenosylmethionine second messengers in signal transduction cAMP, cGMP allosteric regulators ATP, ADP, AMP GAINING NUCLEOTIDES pancreatic (deoxy)ribonucleases and intestinal polynucleotidases: NA ! nucleotides nucleotidase of epithelial cells of the intestine: nucleotides ! nucleosides in the intestinal epithelial cells, nucleosides are used intact hydrolyzed by nucleoside (phosphoryl)ases: nucleoside ! base + pentose(-1-phosphate) + [phosphate] — salvage for the cells own need — transport to the blood about 5 % of digested nucleotides into the blood as bases and nucleosides low dietary uptake ) need of biosynthesis PYRIMIDINE NUCLEOSIDES BIOSYNTHESIS 1 PYRIMIDINE NUCLEOSIDES BIOSYNTHESIS 2 UTP SYNTHESIS nucleosidmonophosphate- UMP + ATP kinase UDP + ADP nucleosiddiphosphate- UDP + ATP
    [Show full text]
  • Polymerase Ribozyme with Promoter Recognition
    In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition by Razvan Cojocaru BSc, Simon Fraser University, 2014 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Department of Molecular Biology and Biochemistry Faculty of Science © Razvan Cojocaru 2021 SIMON FRASER UNIVERSITY Summer 2021 Copyright in this work is held by the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Declaration of Committee Name: Razvan Cojocaru Degree: Doctor of Philosophy Title: In vitro Evolution of a Processive Clamping RNA Polymerase Ribozyme with Promoter Recognition Committee: Chair: Lisa Craig Professor, Molecular Biology and Biochemistry Peter Unrau Supervisor Professor, Molecular Biology and Biochemistry Dipankar Sen Committee Member Professor, Molecular Biology and Biochemistry Michel Leroux Committee Member Professor, Molecular Biology and Biochemistry Mani Larijani Internal Examiner Associate Professor, Molecular Biology and Biochemistry Gerald Joyce External Examiner Professor, Jack H. Skirball Center for Chemical Biology and Proteomics Salk Institute for Biological Studies Date Defended/Approved: August 12, 2021 ii Abstract The RNA World hypothesis proposes that the early evolution of life began with RNAs that can serve both as carriers of genetic information and as catalysts. Later in evolution, these functions were gradually replaced by DNA and enzymatic proteins in cellular biology. I start by reviewing the naturally occurring catalytic RNAs, ribozymes, as they play many important roles in biology today. These ribozymes are central to protein synthesis and the regulation of gene expression, creating a landscape that strongly supports an early RNA World.
    [Show full text]
  • Diagnosis, Treatment and Follow Up
    DOI: 10.1002/jimd.12024 REVIEW International clinical guidelines for the management of phosphomannomutase 2-congenital disorders of glycosylation: Diagnosis, treatment and follow up Ruqaiah Altassan1,2 | Romain Péanne3,4 | Jaak Jaeken3 | Rita Barone5 | Muad Bidet6 | Delphine Borgel7 | Sandra Brasil8,9 | David Cassiman10 | Anna Cechova11 | David Coman12,13 | Javier Corral14 | Joana Correia15 | María Eugenia de la Morena-Barrio16 | Pascale de Lonlay17 | Vanessa Dos Reis8 | Carlos R Ferreira18,19 | Agata Fiumara5 | Rita Francisco8,9,20 | Hudson Freeze21 | Simone Funke22 | Thatjana Gardeitchik23 | Matthijs Gert4,24 | Muriel Girad25,26 | Marisa Giros27 | Stephanie Grünewald28 | Trinidad Hernández-Caselles29 | Tomas Honzik11 | Marlen Hutter30 | Donna Krasnewich18 | Christina Lam31,32 | Joy Lee33 | Dirk Lefeber23 | Dorinda Marques-da-Silva9,20 | Antonio F Martinez34 | Hossein Moravej35 | Katrin Õunap36,37 | Carlota Pascoal8,9 | Tiffany Pascreau38 | Marc Patterson39,40,41 | Dulce Quelhas14,42 | Kimiyo Raymond43 | Peymaneh Sarkhail44 | Manuel Schiff45 | Małgorzata Seroczynska29 | Mercedes Serrano46 | Nathalie Seta47 | Jolanta Sykut-Cegielska48 | Christian Thiel30 | Federic Tort27 | Mari-Anne Vals49 | Paula Videira20 | Peter Witters50,51 | Renate Zeevaert52 | Eva Morava53,54 1Department of Medical Genetic, Montréal Children's Hospital, Montréal, Québec, Canada 2Department of Medical Genetic, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia 3Department of Human Genetics, KU Leuven, Leuven, Belgium 4LIA GLYCOLAB4CDG (International
    [Show full text]
  • Searching for Novel Targets to Control Wheat Head Blight Disease—I-Protein Identification, 3D Modeling and Virtual Screening
    Advances in Microbiology, 2016, 6, 811-830 http://www.scirp.org/journal/aim ISSN Online: 2165-3410 ISSN Print: 2165-3402 Searching for Novel Targets to Control Wheat Head Blight Disease—I-Protein Identification, 3D Modeling and Virtual Screening Natália F. Martins1, Emmanuel Bresso1, Roberto C. Togawa1, Martin Urban2, John Antoniw2, Bernard Maigret3, Kim Hammond-Kosack2 1EMBRAPA Recursos Genéticos e Biotecnologia Parque Estação Biológica, Brasília, Brazil 2Department of Plant Biology and Crop Science, Rothamsted Research, Harpenden, UK 3CNRS, LORIA, UMR 7503, Lorraine University, Nancy, France How to cite this paper: Martins, N.F., Abstract Bresso, E., Togawa, R.C., Urban, M., Anto- niw, J., Maigret, B. and Hammond-Kosack, Fusarium head blight (FHB) is a destructive disease of wheat and other cereals. FHB K. (2016) Searching for Novel Targets to occurs in Europe, North America and around the world causing significant losses in Control Wheat Head Blight Disease— production and endangers human and animal health. In this article, we provide the I-Protein Identification, 3D Modeling and strategic steps for the specific target selection for the phytopathogen system wheat- Virtual Screening. Advances in Microbiol- ogy, 6, 811-830. Fusarium graminearum. The economic impact of FHB leads to the need for innova- http://dx.doi.org/10.4236/aim.2016.611079 tion. Currently used fungicides have been shown to be effective over the years, but recently cereal infecting Fusaria have developed resistance. Our work presents a new Received: June 21, 2016 perspective on target selection to allow the development of new fungicides. We de- Accepted: September 11, 2016 veloped an innovative approach combining both genomic analysis and molecular Published: September 14, 2016 modeling to increase the discovery for new chemical compounds with both safety Copyright © 2016 by authors and and low environmental impact.
    [Show full text]