WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of
Omelchenko et al. Biology Direct 2010, 5:31 http://www.biology-direct.com/content/5/1/31 RESEARCH Open Access Non-homologousResearch isofunctional enzymes: A systematic analysis of alternative solutions in enzyme evolution Marina V Omelchenko, Michael Y Galperin*, Yuri I Wolf and Eugene V Koonin Abstract Background: Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. Results: We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. -
ATP-Citrate Lyase Has an Essential Role in Cytosolic Acetyl-Coa Production in Arabidopsis Beth Leann Fatland Iowa State University
Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 2002 ATP-citrate lyase has an essential role in cytosolic acetyl-CoA production in Arabidopsis Beth LeAnn Fatland Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Molecular Biology Commons, and the Plant Sciences Commons Recommended Citation Fatland, Beth LeAnn, "ATP-citrate lyase has an essential role in cytosolic acetyl-CoA production in Arabidopsis " (2002). Retrospective Theses and Dissertations. 1218. https://lib.dr.iastate.edu/rtd/1218 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. ATP-citrate lyase has an essential role in cytosolic acetyl-CoA production in Arabidopsis by Beth LeAnn Fatland A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Plant Physiology Program of Study Committee: Eve Syrkin Wurtele (Major Professor) James Colbert Harry Homer Basil Nikolau Martin Spalding Iowa State University Ames, Iowa 2002 UMI Number: 3158393 INFORMATION TO USERS The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. -
Protein Expression Profile of Gluconacetobacter Diazotrophicus PAL5, a Sugarcane Endophytic Plant Growth-Promoting Bacterium
Proteomics 2008, 8, 1631–1644 DOI 10.1002/pmic.200700912 1631 RESEARCH ARTICLE Protein expression profile of Gluconacetobacter diazotrophicus PAL5, a sugarcane endophytic plant growth-promoting bacterium Leticia M. S. Lery1, 2, Ana Coelho1, 3, Wanda M. A. von Kruger1, 2, Mayla S. M. Gonc¸alves1, 3, Marise F. Santos1, 4, Richard H. Valente1, 5, Eidy O. Santos1, 3, Surza L. G. Rocha1, 5, Jonas Perales1, 5, Gilberto B. Domont1, 4, Katia R. S. Teixeira1, 6 and Paulo M. Bisch1, 2 1 Rio de Janeiro Proteomics Network, Rio de Janeiro, Brazil 2 Unidade Multidisciplinar de Genômica, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil 3 Departamento de Genética, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil 4 Laboratório de Química de Proteínas, Departamento de Bioquímica, Instituto de Química, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil 5 Laboratório de Toxinologia, Departamento de Fisiologia e Farmacodinâmica- Instituto Oswaldo Cruz- Fundac¸ão Oswaldo Cruz, Rio de Janeiro, Rio de Janeiro, Brazil 6 Laboratório de Genética e Bioquímica, Embrapa Agrobiologia, Seropédica, Brazil This is the first broad proteomic description of Gluconacetobacter diazotrophicus, an endophytic Received: September 25, 2007 bacterium, responsible for the major fraction of the atmospheric nitrogen fixed in sugarcane in Revised: December 18, 2007 tropical regions. Proteomic coverage of G. diazotrophicus PAL5 was obtained by two independent Accepted: December 19, 2007 approaches: 2-DE followed by MALDI-TOF or TOF-TOF MS and 1-DE followed by chromatog- raphy in a C18 column online coupled to an ESI-Q-TOF or ESI-IT mass spectrometer. -
A Polyketoacyl-Coa Thiolase-Dependent Pathway for the Synthesis of Polyketide Backbones
ARTICLES https://doi.org/10.1038/s41929-020-0471-8 A polyketoacyl-CoA thiolase-dependent pathway for the synthesis of polyketide backbones Zaigao Tan1,3, James M. Clomburg1,2, Seokjung Cheong1, Shuai Qian1 and Ramon Gonzalez 1,2 ✉ Polyketides found in nature originate from backbones synthesized through iterative decarboxylative Claisen condensations catalysed by polyketide synthases (PKSs). However, PKSs suffer from complicated architecture, energy inefficiencies, complex regulation, and competition with essential metabolic pathways for extender unit malonyl-CoA, all combining to limit the flux of polyketide biosynthesis. Here we show that certain thiolases, which we term polyketoacyl-CoA thiolases (PKTs), catalyse polyketide backbone formation via iterative non-decarboxylative Claisen condensations, hence offering a synthetic and effi- cient alternative to PKSs. We show that PKTs can synthesize polyketide backbones for representative lactone, alkylresorcinolic acid, alkylresorcinol, hydroxybenzoic acid and alkylphenol polyketide families, and elucidate the basic catalytic mechanism and structural features enabling this previously unknown activity. PKT-catalysed reactions offer a route to polyketide formation that leverages the simple architecture of thiolases to achieve higher ATP efficiencies and reduced competition with essential metabolic pathways, all of which circumvent intrinsic inefficiencies of PKSs for polyketide product synthesis. olyketides represent a large class of secondary metabolites that Here we show that enzymes other -
The Phylogenetic Extent of Metabolic Enzymes and Pathways José Manuel Peregrin-Alvarez, Sophia Tsoka, Christos A
Downloaded from genome.cshlp.org on October 8, 2021 - Published by Cold Spring Harbor Laboratory Press Letter The Phylogenetic Extent of Metabolic Enzymes and Pathways José Manuel Peregrin-Alvarez, Sophia Tsoka, Christos A. Ouzounis1 Computational Genomics Group, The European Bioinformatics Institute, EMBL Cambridge Outstation, Cambridge CB10 1SD, UK The evolution of metabolic enzymes and pathways has been a subject of intense study for more than half a century. Yet, so far, previous studies have focused on a small number of enzyme families or biochemical pathways. Here, we examine the phylogenetic distribution of the full-known metabolic complement of Escherichia coli, using sequence comparison against taxa-specific databases. Half of the metabolic enzymes have homologs in all domains of life, representing families involved in some of the most fundamental cellular processes. We thus show for the first time and in a comprehensive way that metabolism is conserved at the enzyme level. In addition, our analysis suggests that despite the sequence conservation and the extensive phylogenetic distribution of metabolic enzymes, their groupings into biochemical pathways are much more variable than previously thought. One of the fundamental tenets in molecular biology was ex- reliable source of metabolic information. The EcoCyc data- pressed by Monod, in his famous phrase “What is true for base holds information about the full genome and all known Escherichia coli is true for the elephant” (Jacob 1988). For a metabolic pathways of Escherichia coli (Karp et al. 2000). Re- long time, this statement has inspired generations of molecu- cently, the database has been used to represent computational lar biologists, who have used Bacteria as model organisms to predictions of other organisms (Karp 2001). -
Guanylate Kinase (Ec 2.7.4.8)
Enzymatic Assay of GUANYLATE KINASE (EC 2.7.4.8) PRINCIPLE: Guanylate Kinase GMP + ATP > GDP + ADP Pyruvate Kinase ADP + PEP > ATP + Pyruvate Pyruvate Kinase GDP + PEP > GTP + Pyruvate Lactic Dehydrogenase 2 Pyruvate + 2 ß-NADH > 2 Lactate + 2 ß-NAD Abbreviations used: GMP = Guanosine 5'-Monophosphate ATP = Adenosine 5'-Triphosphate GDP = Guanosine 5'-Diphosphate ADP = Adenosine 5'-Diphosphate PEP = Phospho(enol)phosphate ß-NADH = ß-Nicotinamide Adenine Dinucleotide, Reduced Form ß-NAD = ß-Nicotinamide Adenine Dinucleotide, Oxidized Form CONDITIONS: T = 30°C, pH = 7.5, A340nm, Light path = 1 cm METHOD: Continuous Spectrophotometric Rate Determination REAGENTS: A. 200 mM Tris HCl Buffer, pH 7.5 at 30°C (Prepare 50 ml in deionized water using Trizma Base, Sigma Prod. No. T-1503. Adjust to pH 7.5 at 30°C with 1 M HCl.) B. 1 M Potassium Chloride Solution (KCl) (Prepare 10 ml in deionized water using Potassium Chloride, Sigma Prod. No. P-4504.) C. 60 mM Magnesium Sulfate Solution (MgSO4) (Prepare 20 ml in deionized water using Magnesium Sulfate, Heptahydrate, Sigma Prod. No. M-1880.) D. 40 mM Phospho(enol)pyruvate Solution (PEP) (Prepare 50 ml in deionized water using Phospho(enol)Pyruvate, Trisodium Salt, Hydrate, Sigma Prod. No. P-7002. PREPARE FRESH.) Revised: 03/10/94 Page 1 of 4 Enzymatic Assay of GUANYLATE KINASE (EC 2.7.4.8) REAGENTS: (continued) E. 100 mM Ethylenediaminetetraacetic Acid Solution (EDTA) (Prepare 10 ml in deionized water using Ethylenediaminetetraacetic Acid, Tetrasodium Salt, Hydrate, Sigma Stock No. ED4SS.) F. 3.8 mM ß-Nicotinamide Adenine Dinucleotide, Reduced Form (ß-NADH) (Prepare 2 ml in deionized water using ß-Nicotinamide Adenine Dinucleotide, Reduced Form, Dipotassium Salt, Sigma Prod. -
(12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
S-Abscisic Acid
CLH REPORT FOR[S-(Z,E)]-5-(1-HYDROXY-2,6,6-TRIMETHYL-4-OXOCYCLOHEX-2-EN- 1-YL)-3-METHYLPENTA-2,4-DIENOIC ACID; S-ABSCISIC ACID CLH report Proposal for Harmonised Classification and Labelling Based on Regulation (EC) No 1272/2008 (CLP Regulation), Annex VI, Part 2 International Chemical Identification: [S-(Z,E)]-5-(1-hydroxy-2,6,6-trimethyl-4-oxocyclohex-2- en-1-yl)-3-methylpenta-2,4-dienoic acid; S-abscisic acid EC Number: 244-319-5 CAS Number: 21293-29-8 Index Number: - Contact details for dossier submitter: Bureau REACH National Institute for Public Health and the Environment (RIVM) The Netherlands [email protected] Version number: 1 Date: August 2018 Note on confidential information Please be aware that this report is intended to be made publicly available. Therefore it should not contain any confidential information. Such information should be provided in a separate confidential Annex to this report, clearly marked as such. [04.01-MF-003.01] CLH REPORT FOR[S-(Z,E)]-5-(1-HYDROXY-2,6,6-TRIMETHYL-4-OXOCYCLOHEX-2-EN- 1-YL)-3-METHYLPENTA-2,4-DIENOIC ACID; S-ABSCISIC ACID CONTENTS 1 IDENTITY OF THE SUBSTANCE........................................................................................................................1 1.1 NAME AND OTHER IDENTIFIERS OF THE SUBSTANCE...............................................................................................1 1.2 COMPOSITION OF THE SUBSTANCE..........................................................................................................................1 2 PROPOSED HARMONISED -
Relationship to Atherosclerosis
AN ABSTRACT OF THE THESIS OF Marilyn L. Walsh for the degree of Doctor of Philosophy in Biochemistry and Biophysics presented on May 3..2001. Title: Protocols. Pathways. Peptides and Redacted for Privacy Wilbert Gamble The vascular system transports components essential to the survival of the individual and acts as a bamer to substances that may injure the organism. Atherosclerosis is a dynamic, lesion producing disease of the arterial system that compromises the functioning of the organ by occlusive and thrombogenic processes. This investigation was undertaken to elucidate some of the normal biochemical processes related to the development of atherosclerosis. A significant part of the investigation was directed toward developing and combining methods and protocols to obtain the data in a concerted manner. A postmitochondnal supernatant of bovine aorta, usingmevalonate-2-14C as the substrate, was employed in the investigation. Methods included paper, thin layer, and silica gel chromatography; gel filtration, high performance liquid chromatography (HPLC), and mass spectrometry. This current research demonstrated direct incorporation of mevalonate-2- 14Cinto the trans-methyiglutaconic shunt intermediates. The aorta also contains alcohol dehydrogenase activity, which converts dimethylallyl alcohol and isopentenol to dimethylacrylic acid, a constituent of the trans-methylgiutaconate Small, radioactive peptides, named Nketewa as a group, were biosynthesized using mevalonate-2-'4C as the substrate. They were shown to pass through a 1000 D membrane. Acid hydrolysis and dabsyl-HPLC analysis defined the composition of the Nketewa peptides. One such peptide, Nketewa 1, had a molecular weight of 1038 and a sequence of his-gly-val-cys-phe-ala-ser-met (HGVCFASM), with afarnesyl group linked via thioether linkage to the cysteine residue. -
B Number Gene Name Mrna Intensity Mrna Present # of Tryptic
list list sample) short list predicted B number Gene name assignment mRNA present mRNA intensity Gene description Protein detected - Membrane protein detected (total list) detected (long list) membrane sample Proteins detected - detected (short list) # of tryptic peptides # of tryptic peptides # of tryptic peptides # of tryptic peptides # of tryptic peptides Functional category detected (membrane Protein detected - total Protein detected - long b0003 thrB 6781 P 9 P 3 3 P 3 0 homoserine kinase Metabolism of small molecules b0004 thrC 15039 P 18 P 10 P 11 P 10 0 threonine synthase Metabolism of small molecules b0008 talB 20561 P 20 P 13 P 16 P 13 0 transaldolase B Metabolism of small molecules b0009 mog 1296 P 7 0 0 0 0 required for the efficient incorporation of molybdate into molybdoproteins Metabolism of small molecules b0014 dnaK 13283 P 32 P 23 P 24 P 23 0 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins Cell processes b0031 dapB 2348 P 16 P 3 3 P 3 0 dihydrodipicolinate reductase Metabolism of small molecules b0032 carA 9312 P 14 P 8 P 8 P 8 0 carbamoyl-phosphate synthetase, glutamine (small) subunit Metabolism of small molecules b0048 folA 1588 P 7 P 1 2 P 1 0 dihydrofolate reductase type I; trimethoprim resistance Metabolism of small molecules peptidyl-prolyl cis-trans isomerase (PPIase), involved in maturation of outer b0053 surA 3825 P 19 P 4 P 5 P 4 P(m) 1 GenProt membrane proteins (1st module) Cell processes b0054 imp 2737 P 42 P 5 0 0 P(m) 5 GenProt organic solvent tolerance Cell processes b0071 leuD 4770 -
Test Catalog for Pharma
Test Catalog for Pharma Newborn Screening ………………………………………………………………………….. 2 Biochemical Genetic Testing ……………………………………………….. 2 Molecular Genetic Testing ……………………………………………………. 4 Genetic Testing …………………………………………………………………………………… 6 Molecular Genetic Testing ……………………………………………….….. 6 Biochemical Genetic Testing ……………………………………………….. 10 How to order? ………………………………………………………………………………..….. 11 1 Newborn Screening > Biochemical Genetic Testing StepOne® (Comprehensive with SCID) Fatty Acid Oxidation Disorders Organic Acid Disorders Amino Acid Disorders Carnitine/Acylcarnitine Translocase Deficiency 3-Hydroxy-3-Methylglutaryl-CoA Lyase Deficiency Argininemia Carnitine Palmitoyl Transferase Deficiency Type I1 Glutaric Acidemia Type I Argininosuccinic Aciduria 3-Hydroxy Long Chain Acyl-CoA Dehydrogenase Deficiency Isobutyryl-CoA Dehydrogenase Deficiency 5-Oxoprolinuria1 2,4-Dienoyl-CoA Reductase Deficiency1 Isovaleric Acidemia Carbamoyl Phosphate Synthetase Deficiency1 Medium Chain Acyl-CoA Dehydrogenase Deficiency 2-Methylbutyryl-CoA Dehydrogenase Deficiency Citrullinemia Multiple Acyl-CoA Dehydrogenase Deficiency 3-Methylcrotonyl-CoA Carboxylase Deficiency Homocystinuria Neonatal Carnitine Palmitoyl Transferase Deficiency Type II 3-Methylglutaconyl-CoA Hydratase Deficiency Hypermethioninemia Short Chain Acyl-CoA Dehydrogenase Deficiency Methylmalonic Acidemias Hyperammonemia, Hyperornithinemia, Homocitrullinuria Short Chain Hydroxy Acyl-CoA Dehydrogenase Deficiency Methylmalonyl-CoA Mutase Deficiency Syndrome1 Trifunctional Protein Deficiency Some Adenosylcobalamin