USOO9115366B2

(12) United States Patent (10) Patent No.: US 9,115,366 B2 Tissier et al. (45) Date of Patent: *Aug. 25, 2015

(54) SYSTEM FOR PRODUCING TERPENOIDS IN WO WO99,38957 * 8, 1999 ...... C12N 15/82 PLANTS WO WO99,38957 A1 8/1999 WO WOOOf 17327 A3 3.2000 Fre WO WO 01/20008 A2 3, 2001 (75) Inventors: Alain Tissier, Pertuis (FR); Christophe WO WO 2004/111183 A2 12/2004 Sallaud, Montpellier (FR); Denis WO WO 2006/04.0479 4/2006 Rontein,ontein, GreouxG les Bains (FR(FR) OTHER PUBLICATIONS (73) Assignee: PHILIP MORRIS PRODUCTS S.A., Aharoni, Aetal. The Plant Cell (Dec. 2003), vol. 15: pp. 2866-2884.* Neuchatel (CH) Besumbes, O. et al. Biotechnology and Bioengineering; Oct. 20. 2004; vol. 88, No. 2: pp. 168-175.* (*) Notice: Subject to any disclaimer, the term of this Wang, E. et al. Nature Biotechnology, Apr. 2001; vol. 19, pp. 371 patent is extended or adjusted under 35 37.4% U.S.C. 154(b) by 900 days. Wang, E. et al. Journal of Experimental Botany, Sep. 2002, vol. 53, No. 376; pp. 1891-1897.* This patent is Subject to a terminal dis Walker K. et al. Phytochemistry (2001) vol. 58; pp. 1-7.* claimer. Gutiérrez-Alcalá et al., A versatile promoter for the expression of proteins in glandular and non-glandular trichomes from a variety of plants, 56 J of Exp Botany No. 419, 2487-2494 (2005).* (21) Appl. No.: 11/814,943 Besumbes et al. (Metabolic Engineering of Isoprenoid Biosynthesis in Arabidopsis for the Production of Taxadiene, the First Committed (22) PCT Filed: Jan. 27, 2006 Precursor of Taxol. 88 Biotechnology and Bioengineering No. 2, 165-175 (2004)).* (86). PCT No.: PCT/FR2006/OOO188 Wang et al. (Isolation and characterization of the CYP71D16 trichome-specific promoter from Nicotiana tabacum L., 53J of Exp S371 (c)(1), Botany No. 37, 1891-1897 at 1895-1897 (2002) (hereinafter Wang et (2), (4) Date: Jul. 27, 2007 al.2002)).* Wang et al. (Suppression of a P450 hydroxylase gene in plant (87) PCT Pub. No.: WO2006/079727 trichome glands enhances natural-product-based aphid resistance, 19 Nature Biotechnology, 371-374 (2001) (hereinafter Wang et PCT Pub. Date: Aug. 3, 2006 al.2001).* Walker et al. (Taxol biosynthetic genes, 58 Phytochemistry, 1-7 (65) Prior Publication Data (2001)).* Stegemann et al. (Experimental Reconstruction of Functional gene US 2008/O281135A1 Nov. 13, 2008 Transfer from the Tobacco Plastid Genome to the Nucleus, 18 Plant Cell, 2869-2878 (2006)).* (30) Foreign Application Priority Data Lange, B. M. etal. "Genetic engineering of essential oil production in mint' Current Opinion in Plant Biology, 1999, pp. 139-144, vol. 2, Jan. 27, 2005 (FR) ...... O5 OO855 XP-00910.1099. Wang, E. et al. “Isolation and characterization of the CYP7 ID 16 (51) Int. Cl. trichome-specific promoter from Nicotiana tabacum L. Journal of CI2N IS/II3 (2010.01) Experimental Botany, Sep. 2002, pp. 1891-1897, vol. 53, No. 376, CI2N 5/14 (2006.01) XP-002318244. AOIH I/O (2006.01) (Continued) CI2N 15/82 (2006.01) CI2N 9/88 (2006.01) Primary Examiner — Russell Kallis CI2P 5/00 (2006.01) Assistant Examiner — Rebecca Stephens CI2P 15/00 (2006.01) (74) Attorney, Agent, or Firm — Saliwanchik, Lloyd & (52) U.S. Cl. Eisenschenk CPC ...... CI2N 15/8243 (2013.01); C12N 9/88 (2013.01); C12N 15/8223 (2013.01); C12P (57) ABSTRACT 5/007 (2013.01); CI2P 15/00 (2013.01); C12N The invention concerns a method for producing terpenes of 15/I 137 (2013.01); C12N 15/8205 (2013.01) interestin plants having glandular trichomes, as well as plants (58) Field of Classification Search useful for producing said terpenes of interest. Said plants USPC ...... 800/278 comprise a sequence encoding a heterologous terpene Syn See application file for complete search history. thase under the control of a promoter enabling it to be spe cifically expressed in the trichomes. Moreover, the pathway (56) References Cited for producing endogenous diterpenes is preferably blocked in U.S. PATENT DOCUMENTS the trichomes of the plants, to increase the flow in the heter ologous pathway. The secretion of heterologous terpenes is 6,730,826 B2 5/2004 Wagner et al. spontaneous resulting in easy collection. The present inven 2004/0234968 A1 11/2004 Croteau et al. tion also concerns plants exhibiting a blocked production of a 2006/0150283 A1* 7/2006 Alexandrov et al...... 800,288 compound having antibiotic properties at the Surface of 2009/03OO791 A1 12/2009 Tissier et al. leaves exhibiting enhanced efficiency of transformation by a FOREIGN PATENT DOCUMENTS bacterium. WO WO 93.07.266 A1 4f1993 19 Claims, 10 Drawing Sheets WO WO99, 1946O A1 4f1999 (1 of 10 Drawing Sheet(s) Filed in Color) US 9,115,366 B2 Page 2

(56) References Cited the Peltate Glands of Three Cultivars of Basil” Plant Physiology, Nov. 2004, pp. 3724-3736, vol. 136. OTHER PUBLICATIONS Liu, H.-C. etal. “Cloning and Promoter Analysis of the Cotton Lipid Aharoni, A. et al. “Terpenoid Metabolism in Wild-Type and Transfer Protein Gene Lip3" Biochimica et Biophysica Acta, 2000, Transgenic Arabidopsis Plants' The Plant Cell, Dec. 2003, pp. 2866 pp. 106-111, vol. 1487. 2884, vol. 15. Mahmoud, S.S. etal. "Metabolic Engineering of Essential Oil Yield Besumbes, O. et al. "Metabolic Engineering of Isoprenoid and Composition in Mint by Altering Expression of Deoxyxylulose Biosynthesis in Arabidopsis for the Production of Taxadiene, the Phosphate Reductoisomerase and Menthofuran Synthase” PNAS, First Committed Precursor of Taxol” Biotechnology and Jul. 17, 2001, pp. 8915-8920, vol. 98, No. 15. Bioengineering, Oct. 20, 2004, pp. 168-175, vol. 88, No. 2. Wang, E. et al. “Elucidation of the Functions of Genes Central to Hermann, S. R. et al. “Promoters Derived from Banana Bunchy Top Diterpene Metabolism in Tobacco Trichomes Using Post Virus-Associated Components S1 and S2 Drive Transgene Expres transcriptional Gene Silencing” Planta, 2003, pp. 686-691, vol. 216. sion in Both Tobacco and Banana' Plant Cell Rep. 2001, pp. 642-646, Hohn, T. et al. “Expression of a Fungal Sesquiterpene Cyclase Gene vol. 20. in Transgenic Tobacco” Plant Physiol. 1991, pp. 460-462, vol. 97. Iijima, Y. etal. “The Biochemical and Molecular Basis for the Diver gent Patterns in the Biosynthesis of Terpenes and Phenylpropenes in * cited by examiner

U.S. Patent Aug. 25, 2015 Sheet 3 of 10 US 9,115,366 B2

20 -

15 -

H 10 9. o 3.

.9 o s X t 5 -

O -T ------WT 35s TS NSTPS-02a TS

FIGURE 5 U.S. Patent Aug. 25, 2015 Sheet 4 of 10 US 9,115,366 B2

100

s

a. 50 C

O - WT ihpTPS

10 FIGURE 6

s s CYPD16p s f C e35S-CYPD16p o

0.1 t s O s 0.01 -

0.001 FIGURE 7 U.S. Patent US 9,115,366 B2

IH8GHRHQ5)

U.S. Patent US 9,115,366 B2

6CHRIÍTIÐIH

U.S. Patent US 9,115,366 B2

{}ICHRIÍTIÐIH

U.S. Patent Aug. 25, 2015 Sheet 9 of 10 US 9,115,366 B2

U.S. Patent Aug. 25, 2015 Sheet 10 of 10 US 9,115,366 B2

FIGURE 13A FIGURE 13B TS TS -- T5H

CBT-dio CBT-diol

Taxadiene

FIGURE 3C FIGURE 3D

Oxidized Taxadienc Taxadiene Af US 9,115,366 B2 1. 2 SYSTEM FOR PRODUCING TERPENOIDS IN division between primary and secondary metabolites takes PLANTS place through a tight regulation of the metabolic availability of GGPP. In this respect, it is relevant to note that plant species CROSS-REFERENCE TO RELATED which accumulate large amounts of diterpenes are equipped APPLICATION with specialised organs, the Secreting trichomes, dedicated to the synthesis thereof. Tobacco and in particular Nicotiana This application is the U.S. national stage application of Sylvestris, are a typical example where there is an abundant International Patent Application No. PCT/FR2006/000188, GGPP pool in the trichomes in order to ensure a high flow of filed Jan. 27, 2006, the disclosure of which is hereby incor cembranoid synthesis, and hence the high accumulation porated by reference in its entirety, including all figures, 10 thereof at the surface of the aerial parts. tables and amino acid or nucleic acid sequences. The steps leading to the biosynthesis of CBT-diol in tobacco have been partially elucidated and can be broken FIELD OF THE INVENTION down into two different parts: biosynthesis of the universal precursor of all diterpenes, The invention relates to a method for producing com 15 geranylgeranyl pyrophosphate (GGPP), via the pounds of interest in plants and to genetically modified plants so-called “Rohmer pathway (Rohmer et al., 1996), prepared for use in said method. The invention also relates to takes place in the chloroplast. genetically modified plants enabling an enhanced efficiency biosynthesis of CBT-diol from GGPP. Wang and Wagner of transformation. (2003) have proposed the following biosynthetic path INTRODUCTION way: Trichomes are organs located at the Surfaces of the aerial GGPP-CBT-o-eCBT-dio. parts of higher plants (reviewed in Wagner et al., 2004). They The first cyclization step would be carried out by an take various forms and are classified into two main categories. 25 enzyme from a large family of enzymes known as terpene The first includes hairs, or non-secreting trichomes, unicel synthases (Bohlmann et al., 1998). The diterpene synthase of lular or multicellular. They do not secrete substances to the tobacco would use GGPP as substrate to form CBT-ol. The exterior, or at least not in appreciable amounts. The second second step whereby CBT-diol is produced from CBT-ol is a group comprises all trichomes described as secreting or glan hydroxylation catalyzed by an enzyme from the cytochrome dular, which have an increased capacity to synthesize and 30 P450 family. Professor G. Wagner's group (University of secrete various substances to the exterior. Several types of Kentucky) has used subtractive PCR to identify two N. secreting trichomes are found in this category. In particular tabacum candidate genes for each of these steps: these include the peltate trichomes, from the Lamiaceae fam a sequence displaying high homology with sequences cod ily for example (mint, basil, lavender, thyme, etc.) and the ing for terpene synthases (CYC-2: Genbank No. glandular trichomes found among others in the Solanaceae 35 AF401234. NID: AY495694), (tomato, tobacco, potato, pepper, eggplant, etc.), Asteraceae a sequence coding for a cytochrome P450-type enzyme (Sunflower, etc.) and Cannabaceae (eg. Cannabis sativa) (CYP71D16, NID: AF 166332) (Wang et al., 2001, families. Wang & Wagner 2003). The peltate trichomes of Lamiaceae are the site of produc Studies of the silencing of expression of these genes by tion of volatile molecules, such as monoterpenes (eg., men 40 co-suppression and RNA interference in N. tabacum have thol, terpineol). Their structure is characterized by an oil sac shown (i) a decrease in CBT-diol and CBT-ol correlated with located between the apical periplasma membrane of the a decrease in CYC-2 gene expression, and (ii) an increase in secretory cells and a wall, in which the Volatile oils accumu CBT-ol accumulation and a decrease in CBT-diol formation late (Turner et al., 2000). It is when these sacs break, for correlated with a decrease in CYC71D16 gene expression in example when the leaf is crumpled, that the essential oils are 45 the trichomes. These studies have Suggested that (i) the released. CYC-2 gene codes for the CBT-ol cyclase responsible for Trichomes described as secreting preferably synthesize CBT-ol synthesis and (ii) the CYP71D16 gene codes for a molecules which have low or no volatility at ambient tem CBT-ol hydroxylase which converts CBT-ol to CBT-diol. perature. Such as sesquiterpenes or diterpenes (Wagner et al., Moreover, a genomic sequence of a gene very similar to 2004). The glandular trichomes of cultivated tobacco (Nic 50 CYC-2 mRNA has recently been deposited in the data base Otiana tabacum) for example, produce a secretion over half of (CYC-1, NID: AY049090), which suggests the existence of which is composed of dipterpenes belonging to two classes, not one but several CBT-ol cyclase genes. the cembranes and the labdanes (Heemann et al., 1983). In Certain diterpenoids have been commercially exploited, Some species of wild tobacco such as Nicotiana Sylvestris, particularly in the pharmaceutical sector. This is true in par only the cembranoids, and more particularly cembratriene 55 ticular for diterpenoids from the taxane class, paclitaxel and diol (CBT-diol), are present and the quantities which accu docetaxel, used in the treatment of breast and ovarian cancer. mulate at the leaf surface account for about 15% of the leaf Paclitaxel is a natural molecule extracted from the yew (Taxus dry matter (Severson et al., 1985). sp.), while docetaxel is a semi-synthetic molecule, derived All diterpenes originate from the same precursor Substrate, from a paclitaxel precursor, 10-deacetyl baccatin III (or geranylgeranyldiphosphate (GGPP). What accounts for the 60 10-DAB III), also extracted from yew. Most of the paclitaxel diversity of diterpenes are the terpene synthases which use biosynthetic genes of yew have been described (Jennewein & GGPP to produce an olefin, cyclic or not. GGPP is also the Croteau, 2001; Jennewein et al., 2004). These molecules are precursor of tetraterpenes, among which are found the caro costly to produce due to the relatively low abundance of tenoid pigments. The diterpenes include molecules of pri 10-DAB III and especially of paclitaxel in yew extracts, and mary metabolism, such as the gibberellins, which are plant 65 due to the absence of a synthetic method that can be scaled up growth hormones, and secondary metabolites which account industrially, on account of the structural complexity of the for most of the metabolic diversity of these molecules. This molecules. US 9,115,366 B2 3 4 Thus there is a high demand for methods for producing tively, the polynucleotide sequence encoding a farnesylpyro terpenes of interest at a lower cost, but also for producing phosphate synthase can be carried by a second construct terpene derivatives that are not yet easily accessible to Syn different from the first. thesis. In yet another preferred embodiment, the heterologous terpene synthase is a triterpene synthase and the construct SUMMARY OF THE INVENTION additionally comprises polynucleotide sequences coding for a farnesylpyrophosphate synthase, a squalene synthase and a The present invention describes a novel method for pro squalene epoxidase under the control of a promoter enabling ducing terpenes of interest in plants having glandular tri them to be expressed in the trichomes. Alternatively, the chomes, as well as plants useful for said production. Said 10 polynucleotide sequences encoding the farnesylpyrophos novel method is based on introducing into the plant a heter phate synthase, the squalene synthase and the squalene epoxi ologous terpene synthase enabling production of the terpene dase can be carried by one or more constructs different from of interest. The expression of said heterologous terpene Syn the first. thase is controlled by a promoter enabling an expression, In a preferred embodiment, the plant having glandular 15 trichomes is a plant from the Asteraceae, Cannabaceae, preferably specific, in the glandular trichomes of the plant. To Solanaceae or Lamiaceae family. Preferably the plant is increase the yield, it is preferable to block the synthesis of tobacco, and more particularly Nicotiana Sylvestris. endogenous diterpenes in the trichomes of the plant. In a second aspect, the present invention concerns a plantor A first object of the invention relates to a method for pro seed of a transgenic plant having glandular trichomes, char ducing a terpene of interest in a plant having glandular tri acterized in that the endogenous diterpene production path chomes comprising: way is blocked in the trichomes. More particularly, the endog a) introducing into a cell of said plant a construct containing enous diterpene production pathway can be blocked by an expression cassette comprising a polynucleotide sequence blocking the expression of endogenous diterpene synthases. encoding a heterologous terpene synthase enabling the Syn Preferably, the plant having glandular trichomes is a plant thesis of said terpene of interest under the control of a pro 25 from the Asteraceae, Cannabaceae, Solanaceae or Lamiaceae moter enabling an expression, preferably specific, in the tri family. Even more preferably, the plant is tobacco, and more chomes; particularly Nicotiana Sylvestris. In a particular embodiment, b) reconstituting a plant from said cell and selecting trans the endogenous diterpene synthase is cembratriene-ol Syn genic plants expressing said terpene synthase; and thase. c) recovering the terpene of interest contained in the tri 30 In a third aspect, the invention concerns a transgenic seed chomes of said transgenic plants. or plant having glandular trichomes characterized in that it Preferably, the expression of the terpene synthase is under comprises an expression cassette containing a polynucleotide the control of a trichome-specific promoter. sequence encoding a heterologous terpene synthase enabling Preferably, the recovery of the terpene of interest in the the synthesis of a terpene of interest under the control of a trichomes of said transgenic plants is carried out by collecting 35 promoter enabling an expression, preferably specific, in the the terpene of interest contained in the trichome exudate. trichomes. Preferably, the expression of the terpene synthase In a particular preferred embodiment, said expression cas is under the control of a trichome-specific promoter. In a sette comprises at least one enhancer sequence operably preferred embodiment, said expression cassette comprises at linked to the promoter. In a particular embodiment, the least one enhancer sequence operably linked to the promoter. enhancer sequence comprises the sequence SEQID No 9. 40 Preferably, the pathway for producing endogenous diterpenes Preferably, the method additionally comprises blocking is blocked in the trichomes of said plant. More particularly, the pathway of endogenous diterpene production in the tri the endogenous diterpene production pathway can be blocked chomes. More particularly, the endogenous diterpene produc by blocking the expression of the endogenous diterpene Syn tion pathway can be blocked by blocking the expression of thase. Preferably, the plant having glandular trichomes is a endogenous diterpene synthase(s). Preferably, blocking the 45 plant from the Asteraceae, Cannabaceae, Solanaceae or endogenous diterpene production pathway in the trichomes is Lamiaceae family. Even more preferably, the plant is tobacco, carried out by crossing the transgenic plant selected in b) with and more particularly Nicotiana Sylvestris. In a particular a transgenic plant in which the endogenous diterpene produc embodiment, the endogenous diterpene synthase is cem tion pathway is blocked in the trichomes. In a particular bratriene-ol Synthase. embodiment, one of the endogenous diterpene synthases is 50 A fourth aspect of the invention relates to the use of a plant cembratriene-ol synthase. according to the invention for producing terpenes of interest. In a preferred embodiment, the heterologous terpene syn A fifth aspect of the invention concerns a method for recov thase is a diterpene synthase. Preferably, the diterpene syn ering heterologous terpenes in the exudate of the trichomes of thase is taxadiene synthase or casbene synthase. a plant, comprising a) harvesting the aerial parts of the plant; In another preferred embodiment, the heterologous terpene 55 b) incubating said aerial parts in a solvent of the low polarity synthase is a monoterpene synthase and the construct addi or apolar type; and c) eliminating the solvent. tionally comprises a polynucleotide sequence coding for a A sixth aspect of the invention further concerns plants geranylpyrophosphate synthase under the control of a pro exhibiting an increased efficiency for transformation by bac moter enabling it to be expressed in the trichomes. Alterna teria enabling the transfer of DNA into plant cells, and the tively, the polynucleotide sequence encoding a geranylpyro 60 uses thereof. Thus, the present invention concerns a cell of a phosphate synthase can be carried by a second construct plant exhibiting a blocked production of a compound having different from the first. antibiotic activity at the leaf surface in order to transform said In an additional preferred embodiment, the heterologous cell with a bacterium enabling DNA transfer into the plant terpene synthase is a sesquiterpene synthase and the construct cells. The invention also concerns a method for transforming additionally comprises a polynucleotide sequence encoding a 65 a plant cell comprising contacting a bacterium enabling DNA farnesylpyrophosphate synthase under the control of a pro transfer into plant cells with a cell of a plant exhibiting a moter enabling it to be expressed in the trichomes. Alterna blocked production of a compound having antibiotic activity US 9,115,366 B2 5 6 at the leaf surface. The invention further concerns a method encoding terpene synthase activity (cembratrien-ol synthase for obtaining transformed plants characterized in that it com in the case of Nicotiana Sylvestris) is sufficient to virtually prises the following steps: a) obtaining a recombinant bacte eliminate the production of endogenous diterpenes. rial host cell enabling DNA transfer into plant cells compris (3) The secretion of the diterpenes of interest in the trichome ing a transgene; b) transforming a plant exhibiting a blocked 5 exudate and the recovery of the diterpenoid-containing exu production of a compound having antibiotic properties at the date produced by the trichomes by using a solvent of the low leaf surface, by infection with the recombinant bacterial host polarity (methylene chloride, chloroform, etc.) or apolar type cells obtained in Step a); c) selecting plants having integrated (eg., pentane, hexane, etc.). Indeed, the inventors have dis the transgene in their genome. Preferably, the bacterium covered the non-obvious and unforeseeable possibility of belongs to the genus Agrobacterium, in particular Agrobac 10 secreting terpenes other than endogenous terpenes in the exu terium tumefaciens, Rhizobium, Sinorhizobium, or date of trichomes. Mesorhizobium. Preferably, the plants are plants having glan The inventors have also discovered that plants, in which the dular trichomes. In a preferred embodiment, the plant having production of a compound having antibiotic activity at the glandular trichomes is a plant from the Asteraceae, Canna leaf surface is blocked, exhibit a higher efficiency of trans baceae, Solanaceae or Lamiaceae family. Preferably it is from 15 formation by bacteria enabling DNA transfer into plant cells. the Solanaceae family and can be selected from among In fact, the elimination of CBT-diol production by trichomes tobacco, tomato, sunflower and potato. Preferably, the com at the leaf surface of N. Sylvestris leads to a highly significant pound having antibiotic activity is a terpene and in particular enhancement of the efficiency of genetic transformation by a diterpene. In particular, the compound is CBT-diol. Prefer Agrobacterium tumefaciens. This can be explained by the ably, blocking the production of terpenes, in particular of antibacterial activity of CBT-diol, which would prevent the diterpenes such as CBT-diol, is carried out by blocking the growth of Agrobacterium tumefaciens and hence the trans expression of endogenous terpene synthases in the trichomes, formation of N. Sylvestris cells. in particular cembratriene-ol synthase. Blocking can also be Moreover, the inventors have identified several interesting carried out by specifically blocking in trichomes the expres properties of plants in which the CBT-diol synthetic pathway sion of geranylgeranylpyrophosphate synthase (GGPPS), 25 is blocked in the trichomes. In fact, CBT-diol is a major which produces geranylgeranylpyrophopshate, the precursor contaminant considering the amounts which are produced. Its of all diterpenes. presence makes the detection of minor components difficult. A seventh aspect of the invention concerns the use of a Thus, a plant producing little or no CBT-diol facilitates the plant, in which the pathway of endogenous diterpene produc purification of molecules produced in the trichomes by trans tion, in particular of CBT-diol, is blocked in the trichomes, in 30 genesis. In addition, such a plant is extremely useful for order to identify the function of terpenoid biosynthetic genes. identifying the function of terpenoid biosynthetic genes. In More particularly, blocking the CBT-diol production path fact, the low level of CBT-diol in the leaf exudates of such a way can be carried out by blocking the expression of cem plant facilitates the “in vivo’ identification of the function of bratriene-ol Synthase. genes involved in terpene biosynthesis such as for example 35 terpene synthases, cytochrome P450 monooxygenases, DETAILED DESCRIPTION OF THE INVENTION acetyltransferases, benzoyltransferases or N-benzoyltrans ferases. The inventors have shown that the tobacco Nicotiana The present invention therefore consists in a system for Sylvestris by virtue of its aforementioned metabolic charac producing terpenes of interest selected in the group consisting teristics is an ideal host in which to graft the taxolbiosynthetic 40 of diterpenes, monoterpenes, sesquiterpenes and triterpenes pathway on the endogenous GGPP pool. More generally, any in a plant having glandular trichomes. terpene synthase, and more particularly any diterpene Syn In a first embodiment, the invention consists in a system for thase, as long as its coding sequence is known, could be producing diterpenes of interest, and more particularly tax integrated into the tobacco genome in order to yield an abun anes, by glandular trichomes. dant production of the diterpenoids which are derived there 45 Studies of diterpene synthase expression in Nicotiana from. This can be generalized for other terpene classes Sylvestris show that tobacco trichomes constitute a natural (monoterpenes, sesquiterpenes, or triterpenes for example) to platform suited to the denovo production of diterpenoids, and plants having glandular trichomes. in particular taxadiene or casbene. The production of taxadi The invention essentially comprises three elements Sum ene or casbene in the trichome exudate shows that the tri marized below. 50 chome secretory system is not specific of a class of diterpe (1) The genetic engineering of tobacco in order to enable de nes. In view of a culture for the production of said diterpenes, novo expression of the heterologous terpene synthase in the the specific expression of diterpene synthase in trichomes secreting trichomes. The examples described herein are those confers a significant advantage over constitutive expression of taxadiene synthase and casbene synthase which respec which is characterized by slower growth. tively lead to the production of taxadiene and casbene. These 55 The choice of tobacco and in particular Nicotiana Sylves examples should not be considered to be limiting of the pos tris, as well as plants having glandular trichomes, is equally sibilities for producing diterpenoids by tobacco trichomes. adapted for an abundant production of diterpenes. In fact, the Moreover, the importance of specifically expressing the diter expression of taxadiene synthase under the control of a con pene synthases in the tobacco trichomes relative to a consti stitutive promoter (35S) in the species Arabidopsis thaliana tutive expression will be highlighted. 60 leads to an accumulation of taxadiene which is restricted to (2) The increase in diterpene production obtained by inhibit the leaves and in small amounts (100 times less than that in N. ing endogenous diterpene synthesis in tobacco. To increase Sylvestris) (Besumbes et al., 2004: Botella-Pavia et al., 2004). the level of diterpene production by the secreting trichomes, This difference is related to the physiology of Arabidopsis the endogenous diterpene production pathway is blocked at thaliana trichomes which are not glandular. the terpene synthase step. This makes it possible to reduce, if 65 As shown by the inventors, casbene and taxadiene Syn not eliminate, any competition for GGPP, the substrate com thase, which are derived from phylogenetically distant plants mon to all diterpene synthases. Inactivation of the genes (castor oil plant and yew, respectively), are both functional in US 9,115,366 B2 7 8 tobacco trichomes. In light of these observations, the inven For example, it has been shown that a 1852 bp regulatory tors consider that tobacco trichomes constitute a biological sequence, located upstream of the ATG of the CYP71D16 factory capable of expressing all kinds of diterpene synthases, gene, specifically directs the expression of the uidA reporter regardless of their origins. gene in the secretory cells of tobacco trichomes (application The use of a silencing strategy for endogenous terpene US 2003/0100050 A1, Wagner et al., 2003). Furthermore, synthase genes leads to a significant increase in taxadiene several promoter sequences extracted from different species accumulation in the trichomes. Said strategy is therefore par have been shown to direct the expression of a heterologous ticularly adapted to increasing the levels of diterpene produc gene in tobacco trichomes (Table 1). tion by tobacco trichomes. Generally, silencing the endog Among said promoters, that of the LTP3 gene, coding for a enous diterpenoid pathway by any means whatsoever in order 10 cotton protein involved in lipid transfer (LTP), is specifically to increase the biosynthesis of the grafted genetically engi expressed in cotton fiber cells. The regulatory sequence of the neered pathway represents a clear advantage for producing gene (1548 bp) has been studied in tobacco. Said sequence high yields of diterpenoids of interest. specifically directs the expression of the uidA gene in leaf In a general manner, an expression cassette is composed of 15 trichomes. The 315 bp sequence located between positions a promoter enabling transcription initiation, a transcribed -614 and -300 upstream of the ATG is thought to underlie the nucleic acid, containing introns or not and whose translation promoter's specificity. The promoter of the LTP6 gene can enables the production of a heterologous terpene synthase, also enable trichome-specific expression in cotton. Based on and a transcription terminator. The transcribed nucleic acids the literature, however, it would appear that the expression can be genomic DNA, complementary DNA (cDNA) or syn occurs in cells at the foot of the trichome, and not in the thetic DNA. In the scope of the invention, the transcribed secretory cells. Moreover, when said promoters are intro nucleic acids are preferably cDNA devoid of introns. The duced into tobacco, expression is no longer highly specific, transcribed nucleic acids can be synthetic or semi-synthetic, with in particular a signal in epidermal cells (see Table 1). recombinant molecules, possibly amplified or cloned into This is why, in a preferred embodiment of the present vectors, chemically modified or comprising unnatural bases. 25 invention, the promoter used in the cassette is derived from Typically they are isolated DNA molecules, synthesized by the NsTPS-02a, 02b,03, and 04 genes of the species Nicoti recombinant methods well known to those skilled in the art. ana Sylvestris showing high sequence homology with CYC-2 They are typically used in their full length, namely, with the (CBT-ol cyclase: NID: AF401234). The sequence of said ATG initiation codon of the genes of origin and with their promoters is given in SEQID Nos. 5 to 8. Thus, the promoter coding sequence for the chloroplast transit peptide. Gener 30 ally, the diterpene synthases of plants are transported to chlo contained in the expression cassette comprises a nucleic acid roplasts and therefore possess a transit peptide, whereas the having functional transcriptional promoter activity in glan diterpene synthases of organisms which do not possess chlo dular trichomes, characterized in that it comprises all or part roplasts, such as bacteria or fungi, do not possess a chloro of the sequence SEQID No. 5, 6, 7 or 8 or a functional variant plast transit peptide. In order to correctly express said diter 35 thereof. More particularly, a functional variant thereof shall pene synthases in the chloroplasts of plants and in particular be understood to mean a sequence displaying at least 80, 85 or of tobacco, it will be necessary to create a fusion with a transit 90% identity with one of said sequences obtained by blastN peptide, such as that of the Rubisco small subunit, well known sequence alignment software (Altschul et al., 1990), and is to those skilled in the art. specific of glandular trichomes, in particular of the secretory The term expression cassette designates a nucleic acid 40 cells of glandular trichomes. Said promoter sequences are construct comprising a coding region and a regulatory region, more fully described in patent application FR No. 04 10799 operably linked. The expression “operably linked indicates filed on 13 Oct. 2004. that the elements are combined in Such away that the expres Among terminator sequences, one can cite the NOS termi sion of the coding sequence (the gene of interest) and/or the nator (Bevanet al., 1983, Nucleic Acids Res. 11(2), 369-385), targeting of the encoded protein are under the control of the 45 and the histone gene terminator (EPO 633317). transcriptional promoter and/or the transit peptide. Typically, In a particular embodiment, the expression cassette can the promoter sequence is placed upstream of the gene of comprise a sequence enabling increased expression ('en interest, at a distance therefrom which is compatible with hancer), for example certain elements of the CaMV35S pro control of expression. Similarly, the transit peptide sequence moter and of octopine synthase genes (U.S. Pat. No. 5.290, is generally fused upstream of the sequence of the gene of 50 924). Preferably the enhancer of the CaMV35S promoter is interest, and in frame with it, and downstream of any pro used. An example of an enhancer is given in sequence SEQID moter. Spacer sequences may be present, between the regu No 9. latory elements and the gene, as long as they do not prevent The transcribed nucleic acid codes for the terpene synthase expression and/or targeting. capable of synthesizing the terpene of interest. The expression cassette comprises a promoter enabling an 55 expression, preferably specific, in the trichomes of the plant. In a particular embodiment of the invention, the terpene of Such promoters are known to those skilled in the art. interest is a diterpene. Preferably, the diterpene of interest is In the spirit of the invention, “specific' promoter shall be a taxane. More particularly, the taxane can be taxadiene. The understood to mean a promoter which is mainly active in a heterologous terpene synthase which is introduced into the given tissue or cell group. It shall be understood that a residual 60 plant is a diterpene synthase, more particularly the diterpene expression, generally lower, in other tissues or cells cannot be synthase capable of synthesizing the diterpene of interest. For entirely ruled out. A particular feature of the invention is example, for taxadiene, the diterpene synthase is a taxadiene based on the ability to construct promoters specific of secre synthase. More particularly, the taxadiene synthase is that of tory cells of glandular trichomes, enabling a modification of the yew. FIG. 8 illustrates the strategy for producing taxadi the composition of the leaf secretions of the plant, and in 65 ene in tobacco trichomes. Many coding sequences and pro particular enabling the expression therein of the terpene Syn tein sequences are known for the taxadiene synthase of yew. thase enabling preparation of the terpene of interest. A non-exhaustive list of references is given below. US 9,115,366 B2 9 10 the international nomenclature for Arabidopsis genes, are as Coding sequence ref. Protein sequence ref. follows: Atsg48110, At3g29410, At3 g14490, Atlg31950, AY365 032 AAR153291 At4g 15870, At2g23230, Atlg48800, Atlg66020, AY364470 AAR138611 At3g291 10, Atlg70080, Atlg33750, At3.g32030, AY364469 AA1386O1 At3g14520, At3g14540, At5g44630, Atag13280, AY461450 AAS186031 At4g 13300, Atag20210, At3g29190, Atag20230, U48796 AAC493.10.1 At4g20200. The proteins encoded by the genes At3g29410, At3g14540, Atlg33750, At3.g32030 and Atlg48800, also Moreover, for casbene, the diterpene synthase is a casbene have a (D/E)EDD motif of the class II type in the N-terminal synthase. More particularly, the casbene synthase is that of 10 domain, which makes them similar to the bifunctional diter the castor oil plant. By way of non-limiting example, one can pene synthases in class I. Said enzymes cantherefore produce cite reference L32134 for the coding sequence and reference labdanoid type diterpenes in a single step. None of the pro P59287 for the protein sequence. teins encoded by these sequences has been authenticated. More generally, the present invention relates to any diter However, the inventors have attempted to characterize two pene synthase which is known or whose sequence corre 15 proteins encoded by the genes At3g29410, At3g 14540. sponds to the characteristics of diterpene synthases, as indi In another particular embodiment of the invention, the cated hereinbelow. terpene of interest is a monoterpene. For example, the monot The genes of several diterpenes synthases have been erpene of interest can be limonene. Non-limiting examples cloned and their functions confirmed. These include: taxadi are also carene, pinene, thujene, or linalool. The heterologous ene synthase (Wildung and Croteau, 1996), abietadiene syn terpene synthase which is introduced into the plant is a thase (Peters et al., 2000), levopimaradiene synthase (Schep monoterpene synthase, more particularly the monoterpene mann et al., 2001), isopimaradiene synthase (Martin et al., synthase capable of synthesizing the monoterpene of interest. 2004), casbene synthase (Mau and West, 1994), cem However, monoterpeneproduction also requires the introduc bratriene-ol synthase (Wang and Wagner, 2003), ent-cassadi 25 tion of a geranylpyrophosphate synthase expressed in tri ene synthase (Cho et al., 2004), labdene synthase (Seo et al., chomes. Non-limiting examples of geranylpyrophosphate 2003), syn-pimaradiene synthase (Wilderman et al., 2004), synthase are referenced below. ent-copalyl diphosphate synthase and ent-kaurene synthase (Sun et al., 1994, Prisic et al., 2004). Other diterpene synthase genes are currently being characterized in rice (Syn 30 Organism Coding sequence ref. Protein sequence ref. stemarene synthase, Syn-pimaradiene synthase, ent-sandara Vitis vinifera AY3S1862 AARO8151 copimaradiene synthase and ent-cassadiene synthase) and Mentha piperata AF182828 AAFO8793 tobacco (cis-abienol synthase). Abies grandis AFS13112 AANO1134 The protein sequences of diterpene synthases share com Arabidopsis i. Y17376 CAC16849 mon features. The immature proteins all contain a chloroplast 35 transit peptide at the N-terminal end. All diterpene synthases FIG. 9 illustrates the strategy for producing monoterpenes contain two characteristic domains. The N-terminal domain in tobacco trichomes. For example, for limonene, the monot is called the glycosyl hydrolase-like domain; the C-terminal erpene synthase is a limonene synthase. Many coding domain contains the catalytic site. sequences and protein sequences are known for limonene The diterpene synthases are subdivided into three large 40 synthase. Non-exhaustive examples of references are given classes. Enzymes in class 1 have a DDXXD consensus motif below. in the C-terminal domain. Enzymes in class II have a (D/E) XD(D/N) consensus motif located in the N-terminal domain (Prisic et al., 2004). Enzymes in classes I and II act sequen Coding sequence ref. Protein sequence ref. 45 tially to generate carbon skeletons of the labdane type and are AY473624 AAS47694.1 generally characteristic of primary metabolism (eg.: ent-co AFS14289 AAM53946.1 palyl diphosphate synthase and ent-kaurene synthase), but AFS14287 AAM53944.1 also participate in secondary metabolism as in rice (eg.: ent AF317695 AAKO6663.1 AF241793 AAG31438.1 copalyl diphosphate synthase and ent-cassadiene synthase). AF241792 AAG31437.1 Other enzymes specific of secondary metabolism in gymno 50 AF241791 AAG61436.1 sperms contain these two motifs and are therefore bifunc AF241790 AAG31435.1 tional with two catalytic sites (eg.: abietadiene synthase). AF233894 AAF65545.1 Despite being bifunctional they are listed in class I. All these AF175323 AADSO3O4.1 enzymes (classes I and II) are further characterized by a sequence in the N-terminal domain called CDIS for Conifer 55 Carene synthase, pinene synthase, thujene synthase, and Diterpene Internal Sequence. Said sequence is generally linalool synthase are other examples of monoterpene Syn about 215 amino acids and is located between the signal thases. peptide and the glycosyl hydrolase-like domain (Trapp and In another particular embodiment of the invention, the Croteau, 2001). terpene of interest is a sesquiterpene. For example, the ses In angiosperms, enzymes in class III have the DDXXD 60 quiterpene of interest can be valencene, Santalene, germa consensus in the C-terminal region, but not the CDIS of crene or epi-aristolochene. classes I and II. Said enzymes act in a single reaction step. The heterologous terpene synthase which is introduced Casbene synthase is an example of a class III diterpene Syn into the plant is a sesquiterpene synthase, more particularly thase. the sesquiterpene synthase capable of synthesizing the ses The Arabidopsis thaliana genome contains 21 sequences 65 quiterpene of interest. However, sesquiterpene production which meet the criteria for class III diterpene synthases (Au also requires the introduction of a farnesylpyrophosphate bourg et al., 2002). Their genomic coordinates, according to synthase expressed in trichomes. US 9,115,366 B2 12

Organism Coding sequence ref. Protein sequence ref. Gene (Genbank accession Terpene skeleton Arabidopsis L46367 AAF44787 Enzyme No.) modified Artemisia AY3O8477 AAP7472O Taxoid 2-alpha hydroxylase AYS18383 Taxa iene AY289209 Taxa iene Mentha AF384040 AAK63847 Taxadiene 5-alpha hydroxylase Taxoid 7-beta hydroxylase AY307951 Taxa iene Taxoid 10-beta hydroxylase AY563635 Taxa iene 5-alpha-taxadienol-10-beta AY453403 Taxa iene 10 hydroxylase FIG. 10 illustrates the strategy for producing sesquiterpe Taxane 14b-hydroxylase AY1881.77 Taxa iene nes in tobacco trichomes. For example, for Valencene, the Taxane 13-alpha-hydroxylase AYOS6O19 Taxa iene sesquiterpene synthase is a Valencene synthase. More particu Taxane hydroxylase AY374652 Taxa iene Taxadien-5-alpha-ol-O-acetyl AY628434 Taxa iene larly, the Valencene synthase is that of Sweet orange. By way transferase of non-limiting example, one can cite reference AF441124 15 Taxadienol acetyltransferase AF1901.30 Taxa iene for the coding sequence and reference AAG04608.1 for the 0-deacetylbaccatin III-10-O-acetyl AF19376S Taxa iene protein sequence. transferase 2-debenzoyl-7,13-diacetylbaccatin AF297618 Taxadiene Germacrene synthase (SSTLH1 gene, reference II-2-O-benzoyl transferase 3'-N-debenzoyltaxol N-benzoyl AF297618 Taxadiene AF279455) and epi-aristolochene synthase (reference transferase AAA19216) are other examples of sesquiterpene synthases. Taxoid phenylpropanoyltransferase AYO82804 Taxa iene Taxane 2-alpha-O-benzoyltransferase AY67SSS7 Taxa iene In another particular embodiment of the invention, the Taxoid-O-acetyltransferase AY6284.33 Taxa iene terpene of interest is a triterpene. For example, the triterpene 5-epi-aristolochene-1,3-dihydroxylase AF368376 5-epi-aristolochene of interest can be lanosterol, cycloartenol, lupeol or beta Abietadienolabietadienal oxidase AY779538 Abietadiene, amyrin. ehydroabietadiene, 25 levopimaradiene, The heterologous terpene synthase which is introduced isopimaradiene into the plant is a triterpene synthase, more particularly the Limonene-3-hydroxylase AAQ18708 Limonene (-)-isopiperitenol dehydrogenase AY641428 Limonene triterpene synthase capable of synthesizing the triterpene of (-)-isopiperitenone reductase AY300162 Limonene interest. However, triterpene production also requires the (+)-pulegone reductase AY3001 63 Limonene introduction of a farnesylpyrophosphate synthase, a squalene 30 Menthol dehydrogenase AY288138 Limonene synthase, and squalene epoxidase expressed in trichomes. The expression cassette so formed is inserted in a vector. The vector can be DNA or RNA, circular or not, single- or Enzyme Coding sequence ref. Protein sequence ref. double-stranded. Typically it is a plasmid, phage, virus, 35 Squalene synthase D29017 BAA06103 cosmid, artificial chromosome, etc. Advantageously it is a Squalene epoxidase NM 104624 NP 564734 plant vector, that is to say, capable of transforming a plant cell. Examples of plant vectors are described in the literature, FIG. 11 illustrates the strategy for producing triterpenes in including in particular the A. tumefaciens T-DNA plasmids tobacco trichomes. For example, for lanosterol, the triterpene 40 pBIN19 (Bevan, 1984), pPZP100 (Hajdukewicz et al., 1994), synthase is a lanosterol synthase. Many coding sequences and pCAMBIA series (R. Jefferson, CAMBIA, Australia). The protein sequences are known for lanosterol synthase. vectors of the invention can additionally comprise an origin of replication and/or a selection gene and/or a plant recombina Lanosterol synthase, cycloartenol synthase, lupeol Syn tion sequence, etc. The vectors can be constructed by conven thase and beta-amyrin synthase are other examples of triter 45 tional molecular biology methods, well known to those pene synthases. skilled in the art, using for example restriction enzymes, In addition to the introduction of a construct containing an ligation, clonings, replication, etc. expression cassette comprising a polynucleotide sequence The selection genes comprise, in a non-exclusive manner, encoding a heterologous terpene synthase, the method can the use of marker genes such as genes conferring resistance to comprise the introduction into the plant cell of one or more 50 an antibiotic or to herbicides, or positive selection systems, in transgenes each encoding a terpene modification enzyme. In particular the system based on selection on mannose, in the particular, the terpene modification can be a hydroxylation, presence of the MPI selection gene (mannose-6-phosphate an acylation and in particular an acetylation, a benzoylation, isomerase) (Hansen and Wright, 1999), or selection systems a dehydrogenation, etc. The introduction of the transgene coupled to elimination of the marker genes after selection preferably takes place by introducing an expression cassette 55 (Ebinuma et al., 1997). Finally, the transformed plants can also be selected by PCR screening in the absence of selectable comprising a polynucleotide sequence encoding a terpene marker genes (McGarvey and Kaper, 1991). modification enzyme. The polynucleotide sequence encoding Introduction of the inventive constructs into a plant cell or a terpene modification enzyme is under the control of a pro tissue, including a seed or plant, can be carried out by any moter enabling expression intrichomes, preferably trichome 60 method known to those skilled in the art, and comprise for specific. The transgene can be carried by the construct com example the use of the bacterium Agrobacterium tumefa prising the polynucleotide sequence encoding a heterologous ciens, electroporation, conjugative transfer, gene gun meth terpene synthase or by a different construct. For example, said ods, transfection with a viral vector in particular, and any modification enzyme can be a P450 monooxygenase, an acyl other method known to those skilled in the art. transferase, a benzoyltransferase, a reductase, among others. 65 A commonly used method is based on the use of the bac A non-exhaustive list of genes coding for terpene modifica terium Agrobacterium tumefaciens, which mainly consists in tion enzymes is given in the following table. introducing the construct of interest (nucleic acid, cassette, US 9,115,366 B2 13 14 vector, etc.) in the bacterium A. tumefaciens, then contacting terpene of interest is meant to be secreted. This can also be said bacterium with the leaf discs of the chosen plant. The done by analyzing the presence of the heterologous terpene expression cassette is typically introduced in the bacterium synthase in the leaves and, more particularly, in the trichome by using as vector the Tiplasmid (or T-DNA), which can be cells (for example by analyzing mRNA or genomic DNA with transferred into the bacterium for example by heat shock. specific primers or probes). Optionally the plants can be Incubation of the transformed bacteria with leaf discs leads to selected, crossed, treated, etc. in order to obtain plants dis transfer of the Tiplasmid into the genome of the disc cells. playing improved levels of expression. The latter can optionally be cultivated in suitable conditions In this regard, another object of the invention is based on a in order to regenerate a transgenic plant the cells of which modified cell comprising a cassette or a vector Such as defined comprise the construct of the invention. For further details or 10 hereinabove. For example it can be a plant cell, in particular variant implementations of the A. tumefaciens transformation from the Solanaceae, Asteraceae, Cannabaceae or Lamiaceae method, reference can be made to Horsch et al., 1985 or family. The cells can be cultivated in vitro, and used to recon Hooykaas and Schilperoort, 1992 for example. stitute tissues or whole plants, in order to produce terpenes of Thus, in a particular embodiment, the expression cassette interest in culture, or else to study the properties of heterolo so formed is inserted between the left and right borders of the 15 gous terpene synthases (for example by functional genom transfer DNA (T-DNA) of a disarmed Tiplasmid for transfer ics). into plant cells by Agrobacterium tumefaciens. The T-DNA Another object of the invention is also based on a plant or also comprises a gene whose expression confers resistance to seed comprising an expression cassette or a vector Such as an antibiotic and which enables the selection of transfor defined hereinabove. More particularly, the invention relates mants. to a transgenic seed or plant having glandular trichomes and Another method of plant transformation is based on pro comprising an expression cassette containing a polynucle jecting microparticles (typically microbeads) to which gene otide sequence encoding a heterologous terpene synthase constructs are attached, directly on plant cells, then culturing enabling the synthesis of a terpene of interest under the con said cells in order to reconstitute a transgenic plant. The trol of a promoter enabling an expression, preferably specific, particles which are used are typically gold particles, which 25 in the trichomes. When the terpene synthase is a monoterpene are typically projected by means of a particle gun (see in synthase, the transgenic seed or plant additionally comprises particular Russellet al., InVitro Cell. Dev. Biol., 1992,28P. p. an expression cassette containing a polynucleotide sequence 97-105). encoding a geranylpyrophosphate synthase under the control The microinjection method is based primarily on injecting of a promoter enabling it to be expressed in the trichomes. the gene constructs into plant protoplasts or embryos, then 30 When the terpene synthase is a sesquiterpene synthase, the cultivating said tissues so as to regenerate whole plants. Other transgenic seed or plant additionally comprises an expression plant transgenesis methods are well known, or other protocols cassette containing a polynucleotide sequence encoding a implementing the above methods are described in the prior art farnesylpyrophosphate synthase under the control of a pro (Siemens, J and Schieder, 1996) and can be employed in the moter enabling it to be expressed in the trichomes. When the invention. 35 terpene synthase is a triterpene synthase, the transgenic seed In particular the present invention can be used for produc or plant additionally comprises an expression cassette con ing terpenes of interest specifically in the secretory cells of taining a polynucleotide sequence coding for a farnesylpyro glandular trichomes of higher plants (in particular the phosphate synthase, a squalene synthase and a squalene Angiosperms). The invention is applicable in particular to all epoxidase under the control of a promoter enabling them to be the plants from families having glandular trichomes, for 40 expressed in the trichomes. example Asteraceae (Sunflower, etc.), Solanaceae (tomato, In a preferred embodiment of the invention, the plant addi tobacco, potato, pepper, eggplant, etc.), Cannabaceae (eg. tionally exhibits a blocked endogenous terpene production Cannabis sativa) and Lamiaceae (mint, basil, lavender, pathway in the trichomes. In a preferred embodiment, the thyme, etc). The invention is particularly adapted to plants endogenous terpene production pathway is specifically from the Solanaceae family, Such as for example the genuses 45 blocked in the trichomes, meaning that it is hardly if at all Solanum, Lycopersicon, Capsicum, Petunia, Datura, Atropa, affected in the other parts of the plant. The endogenous ter etc., and to Nicotianeae, for example tobacco, and more par pene production pathway is preferably blocked by blocking ticularly the wild tobacco Nicotiana Sylvestris. In a non the expression of endogenous terpene synthases. However, limiting manner, the invention can be applied to plants from the invention also provides for blocking the pathway for the following genuses: Populus, Lycopersicon, Nicotiana, 50 producing endogenous terpenes at another level. Cannabis, Pharbitis, Apteria, Psychotria, Mercurialis, Chry The expression of endogenous terpene synthases can be Santhemum, Polypodium, Pelargonium, Mimulus, Matri blocked by many available techniques known to those skilled caria, Monarda, Solanum, Achillea, Valeriana, Ocimum, in the art. The terpene synthase genes can be deleted, mutated Medicago, Aesculus, Plumbago, Pityrogramma, Phacelia, (for eg., chemical mutation by EMS or irradiation) or inter Avicennia, Tamarix, Frankenia, Limonium, Foeniculum, Thy 55 rupted (insertional mutagenesis). Furthermore, the expres mus, Salvia, Kadsura, Beyeria, Humulus, Mentha, Artemisia, sion of endogenous terpene synthases can also be blocked by Nepta, Geraea, Pogostemon, Majorana, Cleome, Cnicus, gene silencing by expressing a transcript inhibitor. The tran Parthenium, Ricinocarpos, Hymennaea, Larrea, Primula, script inhibitor is an RNA which can take the form of a Phacelia, Dryopteris, Plectranthus, Cypripedium, Petunia, double-stranded RNA, an antisense RNA, a ribozyme, an Datura, Mucuna, Ricinus, Hypericum, Myoporum, Acacia, 60 RNA which can form a triple helix, and which has some Diplopeltis, Dodonaea, Halgania, Cyanostegia, Prostan complementarity or specificity with the transcript of the thera, Anthocercis, Olearia, Viscaria. endogenous diterpene. Once regenerated, the transgenic plants can be tested for According to a particular embodiment of the present inven expression of the heterologous terpene synthase or for pro tion, the transcript inhibitor is in the form of an antisense duction of the terpene of interest in the trichomes. This can be 65 RNA. The latter generally comprises a nucleotide sequence done by collecting the leaf exudate and testing for the pres complementary to at least a part of the transcript of endog ence of the terpene of interest in said exudate, when the enous terpene synthases, and selectively hybridizes with said US 9,115,366 B2 15 16 transcripts via classical Watson-Crick type interactions. The which the endogenous diterpene synthesis pathway is transcript inhibitor(s) of the antisense RNA type cantherefore blocked in the trichomes with a transgenic plant comprising bind to the transcripts of the terpene synthases and for an expression cassette containing a polynucleotide sequence example block access to the cellular translation machinery at encoding a heterologous terpene synthase enabling the Syn the 5' end of the transcript of interest when the latter is an thesis of a terpene of interest under the control of a promoter mRNA, hinder the translation thereof into protein, and enable enabling an expression in the trichomes. the Suppression of expression of the transgene of interest in Yet another object of the invention is a method for obtain vivo (Kumar et al., Microbiol. Mol. Biol. Rev, 62 (1993) ing transformed plants characterized in that it comprises the 1415-1434). For example such polynucleotides are described following steps: a) obtaining a recombinant plant host cell in patents EP 92574 and EP 140308. When the transcript 10 comprising an expression cassette according to the invention; inhibitor is of the antisense RNA type, it can cover all or part b) regenerating a whole plant from the recombinant host cell of the coding sequence of the diterpene synthase transcript, or obtained in step a); c) selecting plants obtained in step b) all or part of the 3' or 5' noncoding sequence. In a preferred having integrated an expression cassette Such as defined manner, the antisense transcript inhibitor is complementary herein. to the ribosome binding and translation initiation sequence. In 15 The invention also has as object a method for obtaining a a preferred manner, the transcript inhibitor has a length of at transformed plant characterized in that it comprises the fol least 10 ribonucleotides. lowing steps: a) obtaining a recombinant host cell of Agro In a preferred embodiment, the transcript inhibitor makes bacterium tumefaciens according to the invention; b) trans use of the mechanism of RNA interference (reviewed in Baul forming a plant of interest by infection with Agrobacterium combe, 2004). Preferably, said silencing is carried out by the tumefaciens recombinant host cells obtained in step a); c) intron-spliced hairpin RNA or ihpRNA method (Smith et al., selecting plants having integrated into their genome an 2000). This consists in producing a double-stranded RNA of expression cassette Such as defined herein. the target gene(s) by means of a construct comprising a sense The invention also has as object a method for obtaining a fragment and this same fragment in the antisense orientation, transformed plant characterized in that it comprises the fol the two being separated by an intron (Wesley et al., 2001; 25 lowing steps: a) transfecting at least one plant cell with an Wang et al., patent application, 1999). Said construct is pref expression cassette or with a recombinant vector according to erably under the control of a promoter enabling trichome the invention; b) regenerating a whole plant from the recom specific expression. binant plant cell obtained in step a); c) selecting plants having However, the present invention also considers any means integrated into their genome an expression cassette according known to those skilled in the art for blocking the endogenous 30 to the invention. terpene production pathway in trichomes. In fact, it is impor Any one of the foregoing methods for obtaining a trans tant to specify that the TPS gene silencing method can be formed plant can also comprise the following additional accomplished by other approaches. For example, it can con steps: d) crossing two transformed plants such as obtained in sistincreating a library of deletion mutants by irradiation, for step c) with a plant of the same species; e) selecting plants that example with gamma rays or fast-neutron radiation. The dele 35 are homozygous for the transgene. tions affecting a given locus can be detected by various meth In a second particular embodiment, any one of the forego ods on the DNA extracted from the mutants (Tissier & Mon ing methods for obtaining a transformed plant can also com tané, 1999). One advantage of radiation mutagenesis is the prise the following additional steps: f) crossing a transformed possibility of isolating deletions covering an entire gene clus plant obtained in step c) with a plant of the same species; g) ter. This is particularly relevant in the case of the cembrane 40 selecting plants resulting from the cross in step f) having synthases of Nicotiana, since the genes encoding these conserved the transgene. enzymes form a family of very similar genes clustered on one The hybrid transgenic plants, obtained by crossing at least locus (Tissier et al., 2004; Sallaudet al., unpublished data). one plant according to the invention with another, are also part The present invention also concerns a transgenic seed or of the invention. plant according to the invention additionally comprising a 45 Lastly, the present invention concerns a method for recov transgene coding for a terpene modification enzyme. ering heterologous terpenes or terpenes of interest in the In particular the invention concerns a plant in which the trichome exudate of a plant, comprising a) harvesting the endogenous diterpene synthesis pathway is blocked in the aerial parts of the plant; b) incubating said aerial parts in a trichomes. Said plant represents an important intermediate Solvent of the low polarity or apolar type; and c) eliminating for preparing the final plant capable of producing the terpene 50 the solvent. Preferably, said plant is a transgenic plant accord of interest. In fact, said plant can be obtained by crossing a ing to the invention and in particular tobacco. Aerial parts plant capable of producing the terpene of interest with a plant shall be understood to mean preferably the leaves and stems. in which the endogenous diterpene synthesis pathway is The low polarity solvent can be methylene chloride or chlo blocked in the trichomes. More particularly, then, the inven roform. In a particular embodiment, the solvent is apolar, tion concerns a plant in which the endogenous diterpene 55 preferably very apolar. For example, the solvent can be pen synthesis pathway is blocked in the trichomes. The invention tane or hexane or any solvent having the same polarity, pref also concerns the use of a transgenic plant in which the erably pentane. The incubation step can last from a few sec endogenous diterpene synthesis pathway is blocked in the onds with shaking to several hours in a bath without shaking. trichomes for preparing a transgenic seed or plant comprising Preferably, the chosen solvent is volatile at room temperature an expression cassette containing a polynucleotide sequence 60 and is chemically inert towards the terpenes of interest. Pref encoding a heterologous terpene synthase enabling the Syn erably, the solvent is eliminated by evaporation thereof. How thesis of a terpene of interest under the control of a promoter ever, any method whereby the solvent is eliminated is encom enabling an expression in the trichomes. The invention fur passed in the invention. ther concerns a method for preparing a transgenic seed or Moreover, the inventors have discovered that plants, in plant in which the endogenous diterpene synthesis pathway is 65 which the production of a compound having antibiotic prop blocked in the trichomes and which is capable of producing a erties at the leaf Surface is blocked, display an enhanced terpene of interest comprising crossing a transgenic plant in efficiency of transformation by a bacterium enabling DNA US 9,115,366 B2 17 18 transfer into plant cells. The compound can have antibacterial species; g) selecting plants resulting from the cross in step f) properties. In a preferred embodiment, the blocked produc having conserved the transgene tion of the compound is specific of the trichomes. The present invention concerns the use of a plant, in which In fact, terpenes, particularly those secreted at the leaf the pathway for producing endogenous diterpenes, in particu Surface, are compounds which often have antibiotic activity 5 lar CBT-diol, is blocked in the trichomes, for identifying the (see for example the references: Trombetta et al., 2005; function of terpenoid biosynthetic genes. More particularly, Chorianopoulos et al., 2004: Friedman et al., 2004: Rios & the CBT-diol production pathway can be blocked by blocking Recio, 2005; Saroglou et al., 2005). Consequently, the pres the expression ofcembratriene-ol synthase. ence of said terpenes having antibiotic activity represents an Other aspects and advantages of the invention will become obstacle to the transformation of said plants by bacteria used 10 apparent in the following examples, which are given for pur for this purpose, in particular of the genus Agrobacterium, poses of illustration and not by way of limitation. Rhizobium, Mesorhizobium or Sinorhizobium (Broothaerts et The patent or application file contains at least one drawing al., 2005). This is because said molecules will inhibit the executed in color. Copies of this patent or patent application proliferation of the bacteria during transformation and 15 publication, with color drawing(s), will be provided by the thereby inhibit DNA transfer into the plant cells. As a result, Office upon request and payment of the necessary fee. the elimination of said terpenes having antibiotic activity could either make it possible to transform recalcitrant species, DESCRIPTION OF FIGURES or increase the transformation frequencies of hard-to-trans form species. The patent or application file contains at least one drawing Preferably, said bacterium belongs to the genus Agrobac executed in color. Copies of this patent or patent application terium, in particular Agrobacterium tumefaciens, Rhizobium, publication, with color drawing(s), will be provided by the Sinorhizobium or Mesorhizobium. Office upon request and payment of the necessary fee. The compound having antibiotic properties can be a ter FIG. 1: Non-specific taxadiene synthase expression cas pene. For example, it can be a diterpene. In a preferred 25 sette in cells of tobacco. embodiment, the compound is CBT-diol. In this case, the FIG. 2: Taxadiene synthase expression cassette in tobacco production of this terpene can be blocked by blocking the trichomes. expression of endogenous terpene synthases in the trichomes, FIG. 3: RNAi construct for NsTPS gene silencing. in particular a diterpene synthase, preferably cembratriene-ol FIG. 4: Casbene synthase expression cassette in tobacco synthase. The means available to carry out this block have 30 trichomes. been described in detail hereinabove. In particular, these FIG. 5: Taxadiene secretion in lines expressing taxadiene include physicochemical mutagenesis of the gene, deletion of synthase under the control of the 35S or NsTPS-02a pro the gene, insertional mutation thereof or “gene silencing. moter. The constructs with 35S or NsTPS-02a promoter con The latter method is preferred. trolling taxadiene synthase expression, were cloned into the Alternatively, the compound having antibiotic properties 35 genome of Nicotiana Sylvestris. Taxadiene secreted in the can be one of the following compounds, the list of which is exudate of plants carrying a single copy of the transgene was not exhaustive: C-pinene, myrcene, ocymene, C-terpinene, extracted with pentane and quantified by GC-MS. The taxa p-cymene, carvacrol, thymol, linalool, camphor, terpineol. diene contentis expressed ing/g of fresh matter. A total of 12 B-caryophyllene, caryophyllene oxide, patchoulol, germa and 5 plants were analysed for the S and NsTPS-02a pro crenes (A, B, C or D), B-selinene, cadinene, bisabolenes (C. B. 40 moter, respectively. (TS: Taxadiene Synthase, WT: Wild Y), bisabolol, Santalenes (C. et B), Santalols, etc., but also the Type) sesquiterpene lactones present in many Asteraceae species. FIG. 6: CBT-diol secretion in plants expressing the ihpTPS The present invention therefore relates to the use of one RNAi. CBT-diol was extracted from Nicotiana Sylvestris exu Such transgenic plant for transforming said plant with a bac date with pentane and quantified by GC-MS. The CBT-diol terium enabling DNA transfer into plant cells. The invention 45 content was set at 100% for WT. Plants (Ti) originating from also relates to a method for transforming a plant, said plant the descendants of transformants are represented by ihpTPS. exhibiting a blocked production of a compound having anti FIG. 7: Effect of 35S promoter enhancer on expression in biotic properties at the leaf Surface, comprising contacting a the trichomes. Total RNA from tobacco leaves (N. Sylvestris) bacterium enabling DNA transfer into plant cells and carrying was extracted and converted to complementary DNA by a transgene with a cell of said plant. Preferably, the cell of said 50 reverse transcription. The expression ratio was determined by plant is comprised in a leaf fragment, in particular a leaf disc. quantitative duplex PCR (VIC fluorophore for CYP71D16 Yet another object of the invention is a method for obtaining and FAM for the transgene). N=5 plants were analysed. transformed plants characterized in that it comprises the fol (e35S: enhancer of promoter 35S, p: promoter). lowing steps: a) obtaining a recombinant host cell of a bacte FIG. 8: Outline of the steps leading to taxadiene production rium enabling DNA transfer into plant cells comprising a 55 in tobacco trichomes (Nicotiana Sylvestris). GGPP: gera transgene, preferably Agrobacterium tumefaciens; b) trans nylgeranyl pyrophosphate; CBT-ol: cembratriene-ol; CBT forming a plant exhibiting a blocked production of a com diol: cembratriene-diol; CBTS: cembratriene-ol synthase: pound having antibiotic properties at the leaf surface by infec CBTol-OH: cembratriene-olhydroxylase. Prom: designates a tion with the recombinant bacterial host cells obtained in step promoter enabling expression in trichomes, preferably in a a); c) selecting plants having integrated the transgene into 60 specific manner. TS: taxadiene synthase; term: transcription their genome. The foregoing method for obtaining a trans terminator. CBTS RNAi: designates a tobacco plant in which formed plant can also comprise the following additional the genes enabling CBTS synthesis have been silenced by a steps: d) crossing two transformed plants such as obtained in construct of the ihpRNA type (see example). step c) with a plant of the same species; e) selecting plants that FIG. 9: Outline of the steps leading to monoterpene pro are homozygous for the transgene. In addition, the method 65 duction in tobacco trichomes (Nicotiana Sylvestris). Legend: can comprise the following additional steps: f) crossing a GGS. geranylgeranylpyrophosphate synthase; GS: gera transformed plant obtained in step c) with a plant of the same nylpyrophosphate synthase and idem FIG. 7. US 9,115,366 B2 19 20 FIG.10: Outline of the steps leading to sesquiterpene pro (Fray et al., 1995; Besumbes et al., 2004). GGPP is an impor duction in tobacco trichomes (Nicotiana Sylvestris). Legend: tant metabolite in the synthesis of hormones Such as the FS: farnesylpyrophosphate synthase and idem FIGS. 7 and 8. gibberellins and abscisic acid. FIG. 11: Outline of the steps leading to triterpene produc Trichome-Specific Production of Taxadiene in the Tobacco tion in tobacco trichomes (Nicotiana Sylvestris). 5 Nicotiana Sylvestris. FIG. 12: Illustration of the increased efficiency of genetic In this example, taxadiene synthase was placed under the transformation obtained on leaf discs from the leaves of N. control of the trichome-specific promoter NSCBTS-02a (Tis Sylvestris plants in which CBT-diol production was sharply sier et al., 2004; patent No. FR 0410799) so as to restrict the reduced. The photograph was taken three weeks after co production of taxadiene to the trichomes. culture with the same Agrobacterium tumefaciens strain con 10 Expression Vector taining a kanamycin resistance gene and a transgene of inter The expression cassette was constructed as follows (see est. WT. N. Sylvestris; ihpTPS: N. Sylvestris containing the diagram in FIG. 2): ihpTPS transgene. The 1 kilobase NSCBTS-02a promoter. FIG. 13. FIG. 13A. TS: Chromatogram of exudate from 15 Taxadiene synthase cDNA. plants expressing taxadiene synthase alone. Taxadiene was The NSCBTS-02a gene terminator detected in the exudate by GC/MS by extracting the ion 122, The sequence of this construct is given in sequence SEQID characteristic of taxadiene. FIG. 13B. TS+T5H: GC-MS No. 2. chromatogram (ion extracted: 191) of exudate from plants Analysis of Transformed Plants expressing taxadiene synthase (TS) and taxadiene 5-hy The regeneration process led to the isolation of transgenic droxylase (T5H). Taxadiene was no longer visible and no tobacco plants expressing taxadiene synthase specifically in other product was visible other than CBT-diol. FIG. 13C. the trichome secretory cells. Plants containing a single copy TS+ihpTPS. GC-MS chromatogram (ion extracted: 122) of of the transgene were selected. GC-MS analysis of the exu exudate from plants expressing TS in an ihpTPS background. date revealed a taxadiene content similar to that measured in CBT-diol was eliminated, facilitating the detection of taxadi 25 the case of non-specific expression of taxadiene synthase ene. FIG. 13D. TS+T5H+ihpTPS. GC-MS chromatogram under control of the 35S promoter (10+1 ug/g of FM, FIG. 5). (ion extracted: 191) of exudate from plants expressing TS and The growth of these plants was identical to that of the wild T5H in an ihpTPS background. CBT-diol was no longer type (non-transformed) plants. Moreover, the flowers had detectable, but a peak corresponding to an oxidized taxadiene normal fertility. This shows that the trichome-specific synthe (product of the action of taxadiene 5-hydroxylase on taxadi 30 sis of taxadiene did not have any deleterious effect on the plant, and therefore demonstrates the Superiority of trichome ene) was easily detected. specific expression over non-specific expression. EXAMPLES Increased Taxadiene Production in Nicotiana Sylvestris Tri chomes by Inhibition of Expression of NSCBTS Genes 35 The NSCBTS genes were inactivated by gene silencing, Production of Taxadiene in the Tobacco Plant which involves the mechanism of RNA interference (re Nicotiana Sylvestris by Expression of Taxadiene viewed in Baulcombe, 2004). Silencing was carried out by the Synthase Under the Control of a Non-Specific intron-spliced hairpin RNA or ihpRNA method (Smith et al., Promoter 2000). It consists in producing a double-stranded RNA of the 40 target gene or genes by means of a construct comprising a The constructs described below enabled an expression in sense fragment and this same fragment in the antisense ori all the cells of the plant, including in the trichomes. Said entation, the two fragments being separated by an intron expression is described as non-specific of trichomes. (Wesley et al., 2001; Wang et al., patent application 1999). Expression Vector More specifically, the cassette was constructed as follows The expression cassette was constructed as follows (see 45 (FIG. 3): diagram in FIG. 1): A 1.7 kb fragment of the NSCBTS-02a promoter (patent A constitutive promoter of the type 35S (extracted from No. FR 0410799). cauliflower mosaic virus) well known to those skilled in the A fragment comprising exon 2 and intron 2 of the art. NSCBTS-02a gene followed by exon 2 of this same gene in Taxadiene synthase cDNA. 50 the antisense orientation. The OCS terminator (extracted from octopine synthase The NOS terminator. gene of an Agrobacterium tumefaciens Ti plasmid) well Transformation of said cassette by Agrobacterium tumefa known to those skilled in the art. ciens yielded transgenic plants expressing the ihpRNA con The sequence of this construct is given in sequence SEQID struct for the CBTS genes. Plants containing a single copy of No 1. 55 the transgene were selected. The descendants of these plants Analysis of Transformed Plants were analysed for CBT-diol content. FIG. 6 shows that CBT The regeneration process led to the isolation of transgenic diol secretion was almost completely blocked in ihpTPS plants expressing taxadiene synthase. Plants containing a plants (0.1 to 1% of WT). single copy of the transgene were selected and analysed by Said plants were then crossed with plants expressing taxa gas chromatography coupled to mass spectrometric detection 60 diene synthase specifically in the trichomes (see herein (GC-MS). The exudate of said plants contained 14+3 g/g of above). In the descendants of this cross, plants carrying both FM (fresh matter) (FIG. 5). The growth of these plants was constructs were selected on selective media and analysed for slower than the wild-type control (non-transformed) making taxadiene content by GC-MS. it unsuitable for culture. These effects have previously been Taxadiene production in these plants was approximately observed in the case of diterpene synthase overexpression in 65 30 times higher than in plants expressing only the taxadiene the tomato or Arabidopsis thaliana and are attributed to the expression cassette under the control of a trichome-specific decrease in the available GGPP pool in transgenic plants promoter. US 9,115,366 B2 21 22 Trichome-Specific Production of Casbene in the Tobacco taxadiene in the exudate (FIG. 13A). Plants containing both Nicotiana Sylvestris. transgenes did not produce taxadiene, confirming that taxa Expression Vector diene is the substrate of T5H. In ihpTPS plants, a new major Trichome-specific expression of casbene synthase product became highly visible on the GC-MS chromatogram required the use of the specific promoter NSCBTS-02a in an 5 (FIG.13D). Due to the abundance of CBT-diol in the exudates expression cassette as follows (FIG. 4: diagram and of N. Sylvestris plants, said product was not detectable in these sequence): plants which also contained the two transgenes (FIG. 13B). In The 1 kilobase NsCBTS-02a promoter. conclusion, the very low levels of CBT-diol in the exudate of The complete cDNA of casbene synthase. the ihpTPS line made it easier to identify the product of an The NSCBTS-02a terminator 10 Analysis of Transformed Plants enzyme expressed in the trichomes and therefore to deter The regeneration process led to the isolation of transgenic mine the function of the corresponding genes. Furthermore, plants expressing casbene synthase specifically in the tri the product can also be purified easily, thereby enabling the chome secretory cells. GC-MS analysis of plants containing a characterization and production thereof. single copy of the transgene revealed a casbene content of 15 approximately 15ug/g of FM. The growth of these plants was REFERENCES identical to that of wild-type (non-transformed) plants. This confirms, as for taxadiene, that the specific synthesis of cas Altschul S F, Gish W. Miller W. Myers E. W. Lipman, DJ bene synthase in trichomes has no deleterious effect on the (1990).J. Mol. Biol. 215:403-410 plant. Aubourg S. Lecharny A, Bohlmann J (2002) Genomic analy Increased Expression of a Transgene by Using a 35S Tran sis of the terpenoid synthase (AtTPS) gene family of Ara Scriptional Activator (Enhancer) bidopsis thaliana. Mol. Genet. Genomics 267:730-745. The expression of taxadiene synthase under the control of Bohlmann J. Meyer-Gauen G. Croteau R (1998) Plant terpe the 1.8 kb promoter of the CYP71D16 gene was compared noid synthases: molecular biology and phylogenetic analy with expression of the gene encoding taxadiene-5C.-hydroxy 25 sis. Proc. Natl. Acad. Sci. USA 95:4126-33. lase under the control of the same promoter but preceded by Baulcombe D (2004) RNA silencing in plants. Nature 431: an enhancer of the 35S promoter (SEQID No. 9). Quantita 356-363. tive analysis of expression was carried out by real-time quan Besumbes O. Sauret-Gueto S, Phillips MA, Imperial S. Rod titative PCR and by the use of TaqMan(R) probes specific of the riguez-Concepcion M. Boronat A (2004) Metabolic engi genes. The results in FIG. 7 indicate that expression of the 30 neering of isoprenoid biosynthesis in Arabidopsis for the taxadiene-5C.-hydroxylase gene was 1000-fold higher than production of taxadiene, the first committed precursor of expression of the taxadiene synthase gene. It can be deduced Taxol. Biotechnol. Bioeng. 88:168-75. that the 35S promoter enhancer was responsible for this acti Botella-Pavia P. Besumbes O, Phillips MA, Carretero-Paulet Vation since the promoters were identical in all other respects. L. Boronat A. Rodriguez-Concepcion M (2004) Regula Increased Efficiency of Genetic Transformation by Agrobac 35 terium tumefaciens. tion of carotenoid biosynthesis in plants: evidence for a key A homozygote line carrying the ihpTPS transgene (line role of hydroxymethylbutenyl diphosphate reductase in #804) was generated from Nicotiana Sylvestris. This line no controlling the Supply of plastidial isoprenoid precursors. longer produces CBT-diol at the leaf surface (see FIG. 6). Plant J. 40:188-99. Leaf discs obtained from leaves of N. Sylvestris and from line 40 Broothaerts W. Mitchell HJ, Weir B, Kaines S, Smith LM, #804 were infected with different strains of Agrobacterium Yang W. Mayer J E. Roa-Rodriguez C. Jefferson RA tumefaciens containing a T-DNA carrying a kanamycin resis (2005). Gene transfer to plants by diverse species of bac tance gene and different transgenes of interest (Table 2). After teria. Nature 433:629-633. three days of co-culture with Agrobacterium tumefaciens, the Cho E. M., Okada A, Kenmoku H, Otomo K, Toyomasu T. leaf discs were transferred to selective medium containing 45 Mitsuhashi W. Sassa T, Yajima A, Yabuta G. Mori K. kanamycin (150 mg/L). After four weeks of selection, a larger Oikawa H, Toshima H, Shibuya N, Nojiri H, Omori T. number of resistant calluses appeared on leaf discs from line Nishiyama M. Yamane H (2004) Molecular cloning and #804 (FIG. 12). Altogether, the number of transformed plants characterization of a cDNA encoding ent-cassa-12, 15-di obtained with line #804 was 5 to 10 times higher than with the ene synthase, a putative diterpenoid phytoalexin biosyn N. Sylvestris control. These findings were confirmed by sev 50 thetic enzyme, from Suspension-cultured rice cells treated eral experiments using Agrobacterium strains carrying differ with a chitin elicitor. Plant J. 37:1-8. ent transgenes (Table 2). In conclusion, eliminating CBT-diol Chorianopoulos N. Kalpoutzakis E, Aligiannis N. Mitaku S, secretion at the leaf surface improves the efficiency of genetic Nychas G. J. Haroutounian SA (2004). Essential oils of transformation. Satureja, Origanum, and Thymus species: chemical com Identification of the Function of a Gene Encoding a Cyto 55 position and antibacterial activities against foodborne chrome P450 Monooxygenase from Yew. pathogens. JAgric Food Chem. 52:8261-8267. A transgene coding for taxadiene synthase (NID: U48796) Ebinuma H. Sugita K. Matsunaga E. Yamakado M (1997) under the control of a trichome-specific promoter (patent Selection of marker-free transgenic plants using the iso application No. FR 0410799) and a transgene coding for a pentenyl transferase gene. Proc. Natl. Acad. Sci. USA taxadiene 5-hydroxylase (T5H, NID: AY289209) under the 60 March 18; 94(6):2117-2121. control of the same promoter were introduced by Agrobacte Fray RG, Wallace A, Fraser PD, Valero D, Hedden P. Bram rium tumefaciens into N. Sylvestris and into line ihpTPS ley PM, Grierson D (1995) Constitutive expression of a (#804). The exudate of the leaves of transformed plants was fruit phytoene synthase gene in transgenic tomatoes causes extracted by soaking the leaves in pentane. The compounds dwarfism by redirecting metabolites from the gibberellin present in the exudate were analysed by gas chromatography 65 pathway. Plant J. 8:693-701. followed by mass spectrometric detection (GC-MS). Plants Friedman M, Henika PR, Levin C E. Mandrell RE (2004). containing only the taxadiene synthase transgene produced Antibacterial activities of plant essential oils and their US 9,115,366 B2 23 24 components against Escherichia coli O157:H7 and Salmo Severson R F Johnson A. W. Jackson D M (1985) Cuticular nella enterica in applejuice. JAgric Food Chem. 52:6042 constituents of tobacco: factors affecting their production 6048. and their role in insect and disease resistance and Smoke Hansen G. Wright MS (1999) Recent advances in the trans quality. Recent Advances in Tobacco Science 11:105-173. 5 Siemens J, and Schieder A (1996) Plant Tiss. Cult. Biotech formation of plants. Trends Plant Sci. 4: 226-231. mol. 2:66-75. Heemann V. Brümmer U, Paulsen C. Seehofer F (1983) Com Smith NA. Singh SP. Wang M B, Stoutjesdijk PA, Green A position of the leaf surface gum of some Nicotiana species G. Waterhouse P M (2000) Total silencing by intron and Nicotiana tabacum cultivars. Phytochem. 22:133-135. spliced hairpin RNAs. Nature 407:319-20. Hooykaas PJ, Schilperoort RA (1992) Agrobacterium and Sun T P. Kamiya Y (1994) The Arabidopsis GA1 locus plant genetic engineering. Plant Mol. Biol. 20:175. 10 encodes the cyclase ent-kaurene synthetase A of gibberel Horsch RB, Rogers SG, Fraley RT (1985) Transgenic plants. lin biosynthesis. Plant Cell. 6:1509-1518. Cold Spring HarbSymp. Ouant. Biol. 50:433-7. Tissier A, MontanéM-H (1999) Methods for producing a Jennewein S, Croteau R (2001) Taxol: biosynthesis, molecu library of mutants and applications thereof. French patent lar genetics, and biotechnological applications. Appl. No. 9913515. Microbiol. Biotechnol. 57:13-9. 15 Tissier A. Sallaud C. Rontein D (2004) Plant promoters and Jennewein S, Wildung MR, Chau M, Walker K, Croteau R uses thereof. French patent application No. FR 0410799. (2004) Random sequencing of an induced Taxus cell Trapp SC, Croteau RB (2001) Genomic organization of plant cDNA library for identification of clones involved in Taxol terpene synthases and molecular evolutionary implica biosynthesis. Proc. Natl. Acad. Sci. USA 101:9149-9154. tions. Genetics 158:811-832. Martin D M. Faldt J. Bohlmann J (2004) Functional charac Trombetta D, Castelli F. Sarpietro MG, Venuti V. Cristani M, terization of nine Norway Spruce TPS genes and evolution Daniele C, Saija A, Mazzanti G. Bisignano G (2005) of gymnosperm terpene synthases of the TPS-d subfamily. Mechanisms of antibacterial action of three monoterpenes. Plant Physiol. 135:1908-1927. Antimicrob Agents Chemother. 49:2474-2478 Mau C J, West C (1994) Cloning of casbene synthase cDNA: Turner GW, Gershenzon.J. Croteau R (2000) Development of evidence for conserved structural features among terpe 25 peltate glandular trichomes of peppermint. Plant Phys. noid cyclases in plants. Proc. Natl. Acad. Sci. USA 124:665-680. 91:8497-85O1. Wagner GJ. Wang E. Shepherd RW (2004) New approaches McGarvey P. Kaper J M (1991) A simple and rapid method for for studying and exploiting an old protuberance, the plant Screening transgenic plants using the PCR. Biotechniques trichome. Annals of Botany 93:3-11. October; 11 (4):428-32. 30 Wang E. Wang R, DeParasis J. Loughrin J H. Gan S. Wagner Peters RJ, Flory J. E. Jetter R, Ravn M. M. Lee HJ. Coates R GJ (2001) Suppression of a P450 hydroxylase gene in M. Croteau RB (2000) Abietadiene synthase from grand fir plant trichome glands enhances natural-product-based (Abies grandis): characterization and mechanism of action aphid resistance. Nat. Biotechnol. 19:371-374. of the “pseudomature' recombinant enzyme. Biochemistry Wang E. Wagner GJ (2003) Elucidation of the functions of 39:15592-156O2. 35 genes central to diterpene metabolism in tobacco tri Prisic S, Xu M, Wilderman P R, Peters RJ (2004) Rice chomes using posttranscriptional gene silencing. Planta Contains Two Disparate ent–Copalyl Diphosphate Syn 21 6:686-691. thases with Distinct Metabolic Functions. Plant Physiol. Wang M-B, Graham M. W. Waterhouse PM (1999) Methods 136:4228-4236. and means for obtaining modified phenotypes. Patent Rios J. L. Recio MC (2005). Medicinal plants and antimicro 40 application WO9953050. bial activity.J Ethnopharmacol. 100:80-84. Wesley SV. Helliwell CA, Smith NA, Wang M. B. Rouse D Saroglou V. Karioti A, Demetzos C, Dimas K, Skaltsa H T. Liu Q. Gooding PS, Singh SP. Abbott D. Stoutesdijk P (2005) Sesquiterpene lactones from Centaurea spinosa A, Robinson SP, Gleave AP, Green AG, Waterhouse PM and their antibacterial and cytotoxic activities. J Nat Prod. (2001) Construct design for efficient, effective and high 68:1404-1407. 45 throughput gene silencing in plants. Plant J. 27:581-90. Schepmann H. G. Pang J. Matsuda S P (2001) Cloning and Wilderman PR, Xu M, Jin Y. Coates RM, Peters RJ (2004) characterization of Ginkgo biloba levopimaradiene syn Identification of syn-pimara-7, 15-diene synthase reveals thase which catalyzes the first committed step in functional clustering of terpene synthases involved in rice ginkgolide biosynthesis. Arch. Biochem. Biophys. phytoalexin/allelochemical biosynthesis. Plant Physiol. 392:263-269. 50 135:2098-2105. Seo S. Seto H, Koshino H, Yoshida S, Ohashi Y (2003) A Wildung MR, Croteau R (1994) AcDNA clone for taxadiene diterpene as an endogenous signal for the activation of synthase, the diterpene cyclase that catalyses the commit defense responses to infection with tobacco mosaic virus ted step of taxol biosynthesis. J. Biol. Chem. 271:9201 - and wounding in tobacco. Plant Cell. 15:863-873. 92O4. TABLE 1.

Gene Transformed abbreviation Name of gene Plants Promoter (bp) plant Expression References LTP3 Lipid transfer Cotton 1548 Tobacco Trichomes, peripheral Liu et al., 2000, BBA, protein 1143 epidermis of leaves 1487: 106111 614 and vascular tissues LTP6 Lipid transfer Cotton 447 Tobacco Trichomes and stomata Hsu et al., 1999, Plant protein 272 guard cells Science, 143: 6370 wax9D Lipid transfer Brassica 972 Tobacco Epidermis of leaves, Pyee and Kolattukudy, protein oleracea stems and flowers, 1995, Plant J. 7:4559 petals, sepals, ovules, US 9,115,366 B2 25 26 TABLE 1-continued

Gene Transformed abbreviation Name of gene Plants Promoter (bp) plant Expression References LTP1 Lipid transfer Arabidopsis 1149 Arabidopsis Epidermal cells of Thoma et al., 1994, protein various tissues Plant Physiol. 105 3545 CYC71D16 CBTO Tobacco 1852 Tobacco Trichomes Wang et al., 2002, J. hydroxylase Exp. Bot. 1891 1897

Table 2. with a chloroplast transit peptide. SSTLH: gene (Genbank Comparison of transformation efficiency for N. Sylvestris accession No. AF279455) encoding germacrene synthase of versus line #804. Km: Kanamycin; No.: number; #804: N. tomato. TPSSTLH: SSTLH with a chloroplast transit peptide. Sylvestris carrying the ihpTPS transgene. Legend of trans Casbene: gene (Genbank accession No. L32134) encoding genes. FPS: gene (Genbank accession No. AF048747) encod 15 casbene synthase of castor oil plant. GUSi: Escherichia coli ing farnesyl pyrophosphate synthase of tomato; TPFPS: FPS uidA gene with an intron to prevent expression in bacteria.

No. of No. of No. of plants plants Exp Agrobacterium T-DNA leaf obtained (N. obtained N strain resistance Transgene discs Sylvestris) (#804)

1 LBA4404 Km FPS - SSLTH 1OO 4 41 LBA4404 Km Casbene 65 3 27 3 LBA4404 Km GUS/TPFPS. 140 9 40 TPSSTLEH

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 9

<21 Os SEQ ID NO 1 &211s LENGTH: 472O &212s. TYPE: DNA <213> ORGANISM: artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: taxadiene synthase expression cassette

<4 OOs SEQUENCE: 1 gaatticcaat cocacaaaaa totgagctta acagcacagt togct cotctic agagcagaat 60

cggg tatt ca acacic ct cat at caact act acgttgttgta taacggtoca catgc.cggta 12O tatacgatga ctggggttgt acaaaggcag caacaaacgg cqtt cocgga gttgcacaca 18O

agaaatttgc cact attaca gaggcaa.gag cagcagctga cqcgtataca acaagt cagc 24 O aaacagatag gttgaactt C at CCC caaag gaga agctica acticaa.gc.cc aagagctttg 3 OO ctaaggc cct aacaag.ccca ccaaa.gcaaa aag.cccact g got cacgcta ggaaccaaaa 360 ggcc.ca.gcag tatctago C ccaaaagaga totCctittgc cc.cggagatt acaatggacg 42O

act tcct ct a totctacgat ctaggaagaa agttcgacgg taaggtgac gacaccatgt 48O

tolaccactga taatgagaag attagcct ct tcaattt cag aaagaatgct gacccacaga 54 O

tggittagaga ggcct acgca gCaggcctica to aagacgat ct accc.gagt aacaat ct co 6 OO aggagat caa at acctt CCC aagaaggitta aagatgcagt caaaagattic aggactaact 660 gcatcaagaa cacagagaaa gatatatttic to aagat cag aagtactatt coagtatgga 72O cgattcaagg cttgctt cat aalaccalaggc aagtaataga gattggagtic totaaaaagg 78O

tagttcc tac taatcaaag gC catggagt caaagattica aatagaggac Ctalacagaac 84 O

togcc.gtgaa aactggcgaa cagttcatac agagticttitt acgact caat gaCaagaaga 9 OO

aaatctitcqt caacatggtg gagcacgaca ct cittgttcta ct coaaaaat atcaaagata 96.O

US 9,115,366 B2 33 34 - Continued aaaagttt ca Ctgagggagt aaa.gagatgg gatacat citt totacatga gattic cagag 3 OOO tgitatgcaaa cittgctittaa agtttggttcaaattaatgg aagaagtaaa taatgatgtg 3 O 6 O gttalaggtac aaggacgtga catgctcgct Cacataagaa aaccctggga gttgtacttic 312 O aattgttatg tacaagaaag ggagtggctt gaa.gc.cgggt atataccaac titttgaagag 318O tact taaaga cittatgctat at cagtaggc cittgg accogt gtaccctaca accaatact a 324 O

Ctaatgggtg agcttgttgaa agatgatgtt gttgagaaag tic act atcc Ctcaaatatg 33 OO tittgagcttg tat cottgag ctgg.cgacta acaaacgaca ccaaaacata t caggctgaa 3360 aaggct cag gaCaacaa.gc ct caggcata gcatgctata taaggataa ticcaggagca 342O actgaggaag atgcc attaa gCacatatgt catgttgttg atcgggcctt gaaagaa.gca 3480 agctittgaat atttcaaacc atccaatgat atcc.caatgg gttgcaagtic ctittatttitt 354 O aaccittagat tdtgtgtc.ca aatcttttac aagtttatag atggg tacgg aatcgc.caat 36OO gaggagatta aggact at at aagaaaagtt tat attgat C caattcaagt atgaggit acc 366 O ttatatataa caatgcagac acaccittcaa agctgagtat ttggagcaaa tatggaagca 372 O ttttgt attgtc.catgtaac ctataagt ca cqtgtttggg caatggcaac atttactaat 378 O atttgcatta togg taggttg tttacat cac accitatcggg gg.cgaccct t c ctaalacct g 384 O acatgaatgt gtgatgctty gtgcacctgg cqgct cattt ttact atttic actgttacaa 3900 cittatttgga cqgttgttac ctattgaatc atgtag tatt gttacttgaa tacaatgttt 396 O attittaatta t tacttaa at tittatt citat catat cqtta aatc.cat cat tacgtaacaa 4 O2O tgaaaagngt cactitt atgg aatgacggat ttagtgtggit ggtgt cattt CCttgcattt 4 O8O ttct ct catc ttgacct tcc titatt attag ataat catct tittat cattt atcct actitt 414 O ttatacaata attctact col at atcc tatt ttitt cittagt aatgttgcaa gtttatt citt 42OO catattgtta gtgcgt attg gatcc 4225

<210s, SEQ ID NO 3 &211s LENGTH: 344 O &212s. TYPE: DNA <213> ORGANISM: artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi construct for NsTPS gene silencing <4 OOs, SEQUENCE: 3 gagctcaaag aggtgaaacc taatc tagta togcaaac cat gttaa attct caattgttitt 6 O gatagataat gagttittctgataattaata aattattaga taattaaagg accaaattta 12 O tatgacttitt gttttittatc atc.ttgat ca tatatacaat gtaatggata caa.gcttata 18O gttgtataaa ttctatataa ttagttatt catacattaat tagatatatt caattgttct 24 O ttataaatat aattcaaacc togaaagcaat act tattittg taagaattgc aatattgtta 3OO ttttgttatg gacittaaata ttaac catgt tataatc.tta agtttatatt attagaaaaa 360 cittagtttitt gaaagacitaa tatgaacatt agtact tatt toaaaaataa gogcttagat 42O atatgaaatt actittaagta cittatttalaa ataattaagt accacacata catacatatic 48O tctacaaact gttaaagttt totatatgag tact tattitt aaaataagag cataaatata 54 O ataaattatgttaaattctt atttaaaata ataaagg acc aaa catgcat aaaataaagt 6OO atgagcttaa taagttcaaga agctaattga taa.gcattga tigccaaatgc act tactaac 660 tgttctatat tdtaggaaaa atctaactitt tat attaaaa atttattitt cataaaacttic 72 O US 9,115,366 B2 35 36 - Continued cctaatttitt gaacaaaatc titatattgat tttittaatca aagccaaaat atttatttaa 78O citatgaaaat tttittaacaa ctaatttatt atggtaaata at attgatat gigtaactitt c 84 O agcacatgac aaaaattata actaactgca gaagtttact gtc.tc.tctga atc.ttgttggc 9 OO tatgtcattc tat cataa.ca aatacttgta gctaatacgc caacgatgtt citcgattitca 96.O tataatttga attittaaaat agcttittaaa tittaatattt atttcaaatc attattgttga O2O ctaa catgtt at aaccogcag taatatttgg agatgcaata cittatattta gctacaaaat O8O tittattgtat cataataagt ttgtagct at taagttagtt tttgccacaa atttittataa 14 O ttgaagcaaa aatacctatt caact acaat attttgtatic gagtaatatt ttgttgac tag 2OO aagattaata ttattacagt aatttctgac gtgtggcaaa aact cataat tat ctacaaa 26 O at attgtcgt agcaataatt ttittatat ct attaatccaa ttattgctac atgctttitat 32O aacttgaggc aaaaatat ct atttagctat aacattttgt tagaagtaat ttttgttgact 38O ataaagttgt tattgctaca gtaatttcaa atgcgtggca aaaaaaatac gattagctac 44 O gaaattitt at tdtagcaata aatttgtagc tatttgggta at attgctac gacagttagc SOO aattatagca aaaatgctaa at cagctttgtcgatttaat tttgtagcta atttitttitat 560 gaatttgtaa atagot atga aattittaatt tttgtggcta ttgttaggta ttago cacat 62O atagotaaga atttgtagct atatatacat aatgttgtag toggcaaattic taacattgta 68O agcttggctg cctttitttitt tttittgggct acaaaactict aaagtaaagg aac tagaaaa 74 O Ctcgtttggc gagagaaaga gggat.ccctg. Caggaaatta ct acc Caaga gaaaaatgaa 8OO Catgaaatgc taaaagaaat agttcggalaa atgttgg tag aaact CC aga taatagtaca 860 caaaaactag tottgattga cacaattcaa agattgggat tag catat catttcaatgat 92 O gagattgaaa act coattica aaa catctitt aatttgtctic aaaatagtga agatgacgat 98 O gaacacaa.cc tittatgttgc tigctic titcgt titt cqacttig cigaggcaa.ca aggat attac 2O4. O atgtc.ttcag gtacct taca tttctg.ccct titc.ccgcaca gct tcatttt ttitt.cgttgt 21OO taaaagacag titcggcgcat aaaat atcto atgtatacgc agggit cagga Calaccgc.cc 216 O c caaggggtg taaagtatgc aacttaccct aatactaaat atctogtgta tacacagggit 222 O Caggacaagt cqc acccaag gggtgtaatg tagacaactt atcctaatgc tattagtaac 228O tgattittatg gct cqaacac ataaattata ggit cacacag taacaactitt accqttgctic 234 O aaag acticgc ct tcct ctitt ttittagttat cqcaccittat ttgtgcagag aatagcaagt 24 OO titcgagat cit gcttctatat agaag acttic tdt attatac titttittattt tdtcc ttctg 246 O cittaaaaata gtaaaaaact at agtgtgga aattgtaaat ttcttaact a gctgtgaaat 252O caaatagitta ttataggaat attatttalag act coactta toggaaaacca citgggttgtt 2580 gttgttattgtcaataataa cittgggg tac gatt tacttic tttitt coat g gcttgtccac 264 O gactatatt c ct attaacaa togttgttgact atgctitt citt tdagt.cgagg gttctattgat 27 OO aacaggct ct cqatctttac aaggtaaaag taatgtctgc gtacacactic tactic cqcag 276 O actic cacttg taggattitca citgaatattt tttgttgttgttgttgttgt aataact tag 282O ggtttaattt cittgatgcta atgaaattica tttctittcaa aatataalaca toggtgttcaa 288O ccagatgtgt toaa.gcaatt cactalaccat gag tact tac ctdaaga cat gtaatat cot 294 O tgttgcct cq Caagtcgaaa acgaagagca gcaa.cat aaa ggttgttgttc atcgt. Catct 3 OOO t cactattitt gagacaaatt aaagatgttt tdaatggagt tittcaat ct c at cattgaaa 3 O 6 O tgatatgcta atcc caatct ttgaattgtg tdaat caaga citagtttittg td tact atta 312 O US 9,115,366 B2 37 38 - Continued tctggagttt ctaccaac at titt cogaact atttcttitta gcattt catgttcatttitt c 318O t cittgggtag taattt cotc gaggtttctt aagattgaat cct gttgcc g g to ttgcgat 324 O gattat cata taatttctgt tdaattacgt taa.gcatgta ataattaa.ca totaatgcat 33 OO gacgittattt atgagatggg tttittatgat tagagtic ccg caattataca tittaatacgc 3360 gatagaaaac aaaatatagc gcgcaaacta ggataaatta t cqcgc.gcgg tt Catctat 342O gttact agat cqggtctaga 344 O

<210s, SEQ ID NO 4 &211s LENGTH: 3442 212. TYPE : DNA <213> ORGANISM: artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Casbene synthase expression cassette in tobacco trichomes 22 Os. FEATURE: <221 > NAMEAKEY: misc feature &222s. LOCATION: (3245) . . (3245 ) <223> OTHER INFORMATION: n = a, t, g or c <4 OOs, SEQUENCE: 4 gagct caatt tattitttgta aaact tct Ct aatttittgga caaactotta tattgattitt 6 O ttaatcgaag CCaaaatatt tatttalacta tgaaaaaatt ttaacaacta atttatt atg 12 O gtaaataata ttgatatggit aacttcaa.gc acatgacaaa aattata act aactgcagaa 18O gtttattgtc t citctgaatc ttgttggct at at Catalacaa. at acttgtag ctaataagcc 24 O aacgatgttc tcggttt cat ataatttgaa ttittaaaata gtttittaaat ttaat attta 3OO tttcaaat Ca ttattgttggc taa catgtta taatcgcagt aat atttgga gatgcaatac 360 titat atttag Ctacaaaatt ttattgtatic agaataagtt tgtagctatt aagttagttt ttgccacaaa tttittataat tgaagcaaaa a tact tatto agctacagta ttttgtatcg agtaat attt tgttgact aga agattaat at tgctacagta atttcagacg tgtggcaaaa 54 O acticataatt agctacaaaa tattgtcgta gcaataattit tittatat Cta ttaatgcaat tatt actaca tgcttittata actitgaggca aaaat at Cta atagotataa cattttgtta 660 gaagtaattit ttgttggct at aaaattggta ttgctacagt aattt Calaat gcgtggcaaa 72 O aaaatacgat taactacgaa attittattgt agcaataact ttgtagctat ttgggtaata ttgctacgac agittagcaat tatagcaaaa atgccaaatc agctttgtca atttaattitt 84 O gtagctaatt ttitt tatgaa attgtaaata gctatgaaat tittaattitt t gtggctattg 9 OO t cagg tatta gcc acatata gctaagaatt tgtagctata tataCataat gttgtag tig 96.O

Calaatt Ctaa cattgtacgc ttggctgc cc tttitt tttitt ttittggctac aaaactictaa agtaaaggaa ctagaaaact cgtttggcga gagaaagaga gagcc atggc attgc catca gctgctatgc aat CCaac Co. tgaaaagctt aact tatttic acagattgtc aagcttaccc 14 O accactagot tggaatatgg caataatcgc tto cott tot titt cott catc. tgccaagtica 2OO

CaCtttaaaa. aac Caact Ca agcatgttta to Ctcaacaa. cccaccalaga agttcgt.cca 26 O ttagcatact t to citcc tact tgttctggggc aatcgctittg citt cottgac Ctt Caatcca 32O tcggaatttg aatcg tatga tgaacgggta attgttgctga agaaaaaagt taaggacata ttaattt cat Ctacaagtga ttcagtggag accottattt taatcgacitt attatgtcgg 44 O

Cttggcgitat Catlatcactt tgaaaatgat attgaagagc tactaagtaa aat Cttcaac SOO

accttgtcga tgaaaaagaa tgttgat citct acactg.cggc aattig tatt c 560

US 9,115,366 B2 41 42 - Continued tgtc.tc.tctgaat cittgtgg c tatgtcatt citat cataac aaatacttgt agctaatacg 24 O c caacgatgt tot cqatttic atata atttgaattittaaaa tagcttittaa atttaatatt 3OO tatttcaaat cattattgtg act aa catgt tataaccoca gtaat atttg gagatgcaat 360 actitat attt agctacaaaa ttittattgta t cataataag tttgtagcta ttaagttagt 42O ttittgccaca aatttittata attgaagcaa aaatacct at t caactacaa tattttgtat 48O cgagtaat at tttgttgacta gaagattaat attattacag taattitcaga cqtgtggcaa. 54 O aaact cataa ttatctacaa aatattgtcg tag caataat tttittatatic tattaatcca 6OO attattgcta catgcttitta taacttgagg caaaaat atc tatttagcta taacattttg 660 ttagaagtaa tttttgttgac tataaagttgttattgctac agtaattitca aatgcgtggc 72 O aaaaaaaata cqattagcta cqaaattitta ttgtagcaat aaatttgtag c tatttgggit 78O aatattgcta cqacagttag caattatago: aaaaatgcta aat cagottt gtcgatttaa 84 O ttttgtagct aattitttitta tdaatttgta aatagot atgaaattittaat ttttgtggct 9 OO attgttaggt attagccaca tatagctaag aatttgtagc tatatataca taatgttgta 96.O gtggcaaatt cita acattgt aagcttggct gcc titttittt ttttittggct acaaaactict 1 O2O aaagtaaagg alactagaaaa citcgtttggc gagagaaaga gagagatg 1068

<210s, SEQ ID NO 6 &211s LENGTH: 106 O &212s. TYPE: DNA <213> ORGANISM: Nicotiana Sylvestris < 4 OO SEQUENCE: 6 aatttattitt totaaaactt citctaattitt tdgacaaact cittatattga titttittaatc 6 O aaagccaaaa tatttattta act atgaaaa aattittaa.ca actaattitat tatgg taaat 12 O aatattgata tdgtaactitc aag cacatga caaaaattat aactaactgc agaagttitat 18O tgtc.tc.tctgaat cittgtgg ctatat cata acaaatactt gtagctaata agccaacgat 24 O gttctic ggitt toatataatt tdaattittaa aatagitttitt aaatttaata tittatttcaa 3OO at cattattg toggctaac at gttataatcg cagtaatatt toggagatgca at acttatat 360 ttagctacaa aattittattg tat cagaata agtttgtagc tattaagtta gtttittgc.ca 42O caaatttitta taattgaagc aaaaatactt attcagotac agtattttgt atcgagtaat 48O attttgttgac tagaagatta at attgctac agtaattitca gacgtgtggc aaaaact cat 54 O aattagctac aaaatattgt cqtagcaata atttitttata t ct attaatg caattattac 6OO tacatgcttt tataacttga gqcaaaaata t ctaatagot ataac attitt gttagaagta 660 attitttgtgg ctataaaatt gg tattgcta cagtaattitc aaatgcgtgg caaaaaaata 72 O cgattalacta cqaaattitta ttgtagcaat aactttgtag ctatttgggit aatattgcta 78O cgacagttag caattatago: aaaaatgcta aat cagottt gtcaatttaa ttttgtagct 84 O aattitttitta tdaaattgta aatagctatog aaattittaat ttttgttggct attgttaggit 9 OO attago caca tatagotaag aatttgtagc tatatataca taatgttgta gtggcaaatt 96.O ctaacattgt acgcttggct gcc ctitttitt tttitttittgg ctacaaaact ctaaagtaaa 1 O2O ggaact agaa alacticgtttg gcgagaga aa gagagagatg 1060

<210s, SEQ ID NO 7 &211s LENGTH: 106 O 212. TYPE : DNA <213> ORGANISM: Nicotiana Sylvestris US 9,115,366 B2 43 44 - Continued

<4 OO > SEQUENCE: 7 aatttattitt cqtaaaattt citctaatttg gacaaactict tatattgatt tttittaatca 6 O aagccaaaat atttatttaa citatgaaaat tttittaacaa citaatttatt atggtaaata 12 O at attgatat gigtaacttica agcacatgat aaaaattata actaactgca gaagtttact 18O gtct ctittga atc.ttgtggit tatat cattc tat catalaca aatacttgta gctaataagc 24 O caacgatgtt citcggttt ca tataatttga attittaaaat agtttittaaa tittaatattt 3OO atttcaaatt attattgtgg cta acatgtt at aacco cag taatatttgg agatgcaata 360 cittatattta gcttgaaaat tittattgtat cagaacaagt ttgtagctat taagttagtt 42O tittgccacaa atttittataa ttgaa.gcaaa aatacctatt cagctacagt attttgtatic 48O gagtaatatt ttgttgactag aagattaata ttgctacagt aattt cagac gtgtggcaaa 54 O aact cataat tagctacaaa at attgtcgt agcaataatt ttittatat ct attaatccaa 6OO ttattgctac atgcttitt at aacttgaggc aaaaatat ct atttagctat aacatttitat 660 taaaagtaat ttttgtggct ataaagttgt tattgctaca gtaatttcaa atgcgtggca 72 O aaaaaaatac gattagctac gaaattitt at tdtag caata aatttgtagc tatttgggta 78O at attgctac gacagttago: aattatagca aaaatgctaa attagctttgttaatttaat 84 O tttgtagcta aacttittitta tdaaattitta attitttgtgg ctattgatag g tattagcta 9 OO caattitt cat atatgtagct aagaatttgt agctatatat acataatgtt gtagt ggcaa. 96.O attctaac at tdtacgcttg gctg.cccttt ttttittggct acaaaactict aaagtaaagg 1 O2O aact agaaaa citcgtttggc gagagaaaga gagagagatg 1060

<210s, SEQ ID NO 8 &211s LENGTH: 1087 &212s. TYPE: DNA <213> ORGANISM: Nicotiana Sylvestris <4 OOs, SEQUENCE: 8 aatttattitt cqtaaaattt citctaattitt tdgacaaact cittatattgg ttttittaatc 6 O aaagccaaaa tatttattta act atgaaat tttgttgaac aactaattta t tatggtaaa 12 O taat attgat atggta actt caa.gcacatg acaaaaatta taactaact g cagaagttta 18O ctgtct ct ct gaatcttgtg gctatat cat tctatataac aaatacttgt agctaataag 24 O c caacgatgt tot cqgttt catata atttgaattittaaaa tagtttittaa atttaatatt 3OO tatttcaaat cattattgtg gctagoatgt tataaccoca gtaat atttg gagatgcaat 360 actitat attt agctacaaaa ttittattgta t cagaataag tttgtaact a ttaagttagt 42O ttittgccaca aatttittata attgaagcaa aaatacct at t cago tacga tattttgtat 48O cgagtaat at tttgttgacta gaagattaat attgctagag taattt Caga C9tgtggcaa. 54 O aaact cataa ttagctacaa aatattgtcg tag caataat tdtttatatic tattaatcca 6OO attattgcta tatgcttitta taacttgagg caaaaatatt tatttagcta taacattttg 660 ttagaagtaa tttttgttggc tataaagttgttattgctac gigtaattitca aatgcgtggc 72 O aaacaaatac gattagctac gaaattitt at tdtag caata aatttgtagc tatttgggta 78O at attgctac gacagttago: aattatagca aaaatgctaa attagctttgtcaatttaat 84 O tttittagcta aattitttitta taaaattgta aatagocatgaaattittaat ttttgtggct 9 OO attgttaggt attagccaca attitt catat atgitatic taa gaatttgtag ctatatatac 96.O US 9,115,366 B2 45 46 - Continued ataatgttgt agtggcaaat t citaa cattg taagcttagc tigc cctttitt tttitttittitt 1 O2O tittggctaca aaactictaaa gtaaaggaac tagaaaactic gtttggc gag agaaagaggg 108 O atccatg 1087

<210s, SEQ ID NO 9 &211s LENGTH: 630 &212s. TYPE: DNA <213> ORGANISM: artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: an enhancer of the 35S promoter <4 OOs, SEQUENCE: 9 tacagt ct ca galagaccalaa gggct attga gacttittcaa caaagggitaa tat ciggaaa 6 O cctic ct cqga t t c cattgcc cagctatotg toactitcatc aaaaggacag tagaaaagga 12 O aggtggcacc tacaaatgcc at cattgcga taaaggaaag gct at cott C aagatgcct c 18O tgc.cga-cagt ggtc.ccaaag atggaccc.cc acccacgagg agcatcgtgg aaaaagaaga 24 O cgttccalacc acgt.cttcaa agcaa.gtgga ttgatgtgaa catggtggag cacga cactic 3OO tcqtct actic caagaatat c aaagatacag tot cagaaga ccaaagggct attgagacitt 360 ttcaacaaag gigtaatat cq ggaaacct co toggatt coa ttgcc cagot atctgtcact 42O t catcaaaag gacagtagaa aaggalaggtg gCacctacaa atgc.cat cat tdgataaag 48O gaaaggct at C9ttcaagat gcctctgc.cg acagtggtcc caaagatgga CCC ccaccca 54 O cgaggagcat cqtggaaaaa galagacgttc Caaccacgt.c ttcaaagcaa gtggattgat 6OO gtgatatic to Cactgacgta agggatgacg 630

The invention claimed is: 35 transgenic Solanaceae plant is carried out by recovering the 1. A transgenic Solanaceae plant or a seed thereof compris terpene of interest contained in the exudate of the trichomes. ing an expression cassette that comprises a polynucleotide 8. The method according to claim 5, further comprising sequence encoding a heterologous terpene synthase operably blocking an endogenous terpene production pathway by linked to a trichome-specific promoter, the trichome-specific inhibiting the expression of an endogenous diterpene Syn promoter comprising a sequence selected from the group 40 thase. consisting of SEQID NOs: 5, 6, 7 and 8, wherein a terpene of 9. The method according to claim 5, wherein said heter interest is synthesized. ologous terpene synthase is a diterpene synthase. 2. The transgenic Solanaceae plant or seed according to 10. The method according to claim 9, wherein said diter claim 1, wherein an endogenous terpene production pathway pene synthase is taxadiene synthase. is blocked by inhibiting the expression of an endogenous 45 11. The method according to claim 5, further comprising diterpene synthase. introducing into the cell of said transgenic Solanaceae planta 3. The transgenic Solanaceae plant or seed according to transgene coding for a terpene modification enzyme. claim 1, wherein said expression cassette comprises at least 12. A method for recovering heterologous terpenes in the one enhancer sequence operably linked to the trichome-spe exudate of the trichomes of a Solanaceae plant, comprisinga) cific promoter. 50 harvesting the aerial parts of the transgenic Solanaceae plant 4. The transgenic Solanaceae plant or seed according to according to claim 1; b) incubating said aerial parts in an claim 1, further comprising a transgene encoding a terpene apolar or low polarity solvent; and c) eliminating the solvent. modification enzyme. 13. The transgenic Solanaceae plant or seed according to 5. A method for producing a terpene of interest in a Solan claim 1, wherein the heterologous terpene synthase is a diter aceae plant, comprising growing a transgenic Solanaceae 55 pene synthase. plant comprising an expression cassette that comprises a 14. The transgenic Solanaceae plant or seed according to polynucleotide sequence encoding a heterologous terpene claim 13, wherein the diterpene synthase is taxadiene Syn synthase operably linked to a trichome-specific promoter, thase. said trichome-specific promoter comprising a sequence 15. The transgenic Solanaceae plant or seed according to selected from the group consisting of SEQID NOs: 5, 6, 7 and 60 claim 3, wherein said at least one enhancer sequence com 8 and recovering the terpene of interest contained in the prises SEQID NO: 9. trichomes of said transgenic Solanaceae plant. 16. The transgenic Solanaceae plant or seed according to 6. The method according to claim 5, wherein said expres claim 1, wherein the trichome-specific promoter comprises sion cassette comprises at least one enhancer sequence oper SEQID NO: 5. ably linked to the promoter. 65 17. The transgenic Solanaceae plant or seed according to 7. The method according to claim 5, wherein the recovery claim 1, wherein the trichome-specific promoter comprises of the terpene of interest contained in the trichomes of said SEQID NO: 6. US 9,115,366 B2 47 48 18. The transgenic Solanaceae plant or seed according to claim 1, wherein the trichome-specific promoter comprises SEQID NO: 7. 19. The transgenic Solanaceae plant or seed according to claim 1, wherein the trichome-specific promoter comprises 5 SEQID NO: 8. UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION PATENT NO. : 9,115,366 B2 Page 1 of 1 APPLICATIONNO. : 1 1/814943 DATED : August 25, 2015 INVENTOR(S) : Alain Tissier, Christophe Sallaud and Denis Rontein It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:

In the Specification

Column 15 Lines 37-38, “Montané should read --Montané--.

Column 18 Line39, “’S and should read -35S and--.

Signed and Sealed this Nineteenth Day of April, 2016 74-4-04- 2% 4 Michelle K. Lee Director of the United States Patent and Trademark Office