DOCSLIB.ORG

ABSTRACT Title of Document: DEVELOPMENT of A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ABSTRACT Title of Document: DEVELOPMENT of A ABSTRACT Title of Document: DEVELOPMENT OF A PROTEOMIC STRATEGY FOR ANALYSIS OF PLASMA MEMBRANE PROTEINS Waeowalee Choksawangkarn, Doctor of Philosophy, 2013 Directed By : Professor Catherine Fenselau, Department of Chemistry and Biochemistry Plasma membrane (PM) proteins play crucial roles in cell signaling and communications, and they are the targets of more than two thirds of drugs currently under development. Studies on changes in protein content, quantity and modifications of the PM proteins indicate metabolic alteration of disease related cells; therefore, mass spectrometry-based proteomic studies may lead to improved understanding of the pathology, the characterization of novel biomarkers, and discovery of future drug targets. The main objectives of my research are to develop an effective enrichment strategy and to optimize the proteomic workflow for analysis of PM proteins from cells in suspension. Strategies were optimized with human multiple myeloma cells cultured in suspension, and optimized strategies were applied to study the PM proteome of myeloid-derived suppressor cells (MDSC) collected from an animal model. We focus on optimization of the cationic nanoparticle pellicle method for enrichment of PM proteins. The principle of this method is to attach cationic nanoparticles to the cell surface by electrostatic interaction between the positively charged nanoparticles and the negatively charged cell surface. Thus, the heavier coated-plasma membrane sheets can be separated more easily from cellular organelles by centrifugation after cell lysis. The isolated PM proteins were identified by LC- MS/MS analysis. We have also optimized the workflow for proteolysis to enhance identification of hydrophobic PM proteins. Our studies reveal that higher density nanoparticle pellicles provide higher enrichment efficiency of the PM proteins and that a procedure using digestion in the gel matrix enhances the analysis of highly hydrophobic proteins. The most effective enrichment technique and optimized proteomic procedures were applied to characterize the PM proteins from MDSC obtained from BALB/c mice carrying 4T1 mammary carcinomas. These cells are known to accumulate in individuals with cancer and suppress anti-tumor immunity. Their accumulation and activity are increased with heightened-levels of inflammation. Comparative studies of the PM proteins expressed in the cells derived from basal- and heightened- levels of inflammation were performed using the spectral counting method. This work reveals a set of protein candidates that have a high potential to be involved in the inflammation-driven immunosuppressive activity of the MDSC. DEVELOPMENT OF A PROTEOMIC STRATEGY FOR ANALYSIS OF PLASMA MEMBRANE PROTEINS By Waeowalee Choksawangkarn Dissertation submitted to the Faculty of the Graduate School of the University of Maryland, College Park, in partial fulfillment of the requirements for the degree of PhD 2013 Advisory Committee: Professor Catherine Fenselau, Chair Professor Robert Peters, Dean’s Representative Professor Douglas Julin Professor Nicole LaRonde-LeBlanc Professor Kwaku Dayie © Copyright by Waeowalee Choksawangkarn 2013 Dedication This thesis is dedicated to my parents, Mr. Prasert Choksawangkarn and Mrs. Wanna Choksawangkarn, who have always encouraged and inspired me. ii Acknowledgements Completion of the work in this dissertation would not have been possible without the support and assistance of many people. Above all, I would like to express my deepest gratitude to my advisor, Prof. Catherine Fenselau, for her continued guidance, invaluable support, and exceptional mentorship throughout my graduate career. She has not only mentored my research project with her knowledge and expertise, but also helped shape my scientific and academic philosophy. I appreciate this great opportunity to work with her. In the years to come, she will always be my inspiring role model. Besides my advisor, I would like to thank my committee members, Prof. Douglas Julin, Prof. Nicole LaRonde-LeBlanc, Prof. Kwaku Dayie, and Prof. Robert Peters for their time and intellectual contributions throughout my graduate studies. I would like to acknowledge several collaborators and colleagues who have strongly contributed to this interdisciplinary project. I am especially grateful to Prof. Nathan Edwards for his invaluable advice and insightful assistance with bioinformatics. I would like to show my greatest appreciation to Dr. Yan Wang, the director of the Proteomics Core Facility, for her enormous help and fruitful discussion of method development and instrumentation. I acknowledge Prof. Peter Gutierrez who always provides me constructive comments and warm encouragement. I would like to acknowledge Prof. Sang Bok Lee, Dr. Sung-Kyoung Kim, and Lauren Graham, for hands on and intellectual contributions to the nanoparticle work and helpful comments about experimental design. I would also like to thank Prof. Suzanne Ostrand-Rosenberg for providing myeloid-derived suppressor cells and for iii her generous assistance with interpreting experimental data. I acknowledge the support of Laboratory for Biological Ultrastructure, and the Maryland NanoCenter and its NispLab for providing a facility for scanning and transmission electron microscopy. Special thanks go to Tim Maugel for assisting with the SEM and TEM processing. My graduate study would not have been successful without academic and social interactions from all former and current Fenselau Lab members: Meghan Burke, Rebecca Rose, Sara Moran, Dr. Karen Lohnes, Dr. Colin Wynne, Dr. Jinxi Li, Maria Oei, Amanda Lee, and Sitara Chauhan. I acknowledge all of them for many scientific discussions and friendship. I would like to offer my special appreciation to Dr. Joe Cannon, who has always supported me with his invaluable guidance, intellectual knowledge, and optimism, which has helped me pass through the most difficult times. I would like to address another special thanks to Avantika Dhabaria, for her scientific support, friendship, and encouragement throughout my graduate studies. The work presented in this dissertation was funded by grant from National Institutes of Health (GM 021248). Also, I acknowledge the financial support from the Royal Thai government fellowship. I also thank many friends and colleagues for encouraging me with their best wishes. I deeply appreciate generous supports from Dr. Salil Chanroj and Dr. Nuttinee Teerakulkittipong, who have always cheered me up and been there for me. Finally, I would like to thank and dedicate this thesis to my parents and family members for their unconditional love and support. iv Table of Contents Dedication .....................................................................................................................ii Acknowledgements .....................................................................................................iii Table of Contents ..........................................................................................................v List of Tables .............................................................................................................viii List of Figures ...............................................................................................................x List of Abbreviations...................................................................................................xv List of Appendix Tables...........................................................................................xviii List of Appendix Figure..............................................................................................xix Chapter 1: Introduction .................................................................................................1 Research Significance and Objectives....................................................................1 Plasma Membrane Protein Enrichment..................................................................3 Mass Spectrometry-based Proteomics....................................................................6 Bottom-up Proteomics............................................................................................7 Electrospray Ionization (ESI).................................................................................9 Tandem Mass Spectrometry.................................................................................11 LTQ-Orbitrap........................................................................................................12 Bioinformatics......................................................................................................14 Myeloid-Derived Suppressor Cells.......................................................................16 Chapter 2: Enrichment of Plasma Membrane Proteins using Silica Nanoparticle Pellicles..................................................................................................18 Introduction...........................................................................................................18 v Materials and Methods.........................................................................................21 Results and Discussion.........................................................................................28 Summary...............................................................................................................36 Chapter 3: Optimization of Proteomic Workflow for Analysis of Plasma Membrane Proteins..........................................................................................39
Load more

Recommended publications
  • Bacteria Belonging to Pseudomonas Typographi Sp. Nov. from the Bark Beetle Ips Typographus Have Genomic Potential to Aid in the Host Ecology
    insects Article Bacteria Belonging to Pseudomonas typographi sp. nov. from the Bark Beetle Ips typographus Have Genomic Potential to Aid in the Host Ecology Ezequiel Peral-Aranega 1,2 , Zaki Saati-Santamaría 1,2 , Miroslav Kolaˇrik 3,4, Raúl Rivas 1,2,5 and Paula García-Fraile 1,2,4,5,* 1 Microbiology and Genetics Department, University of Salamanca, 37007 Salamanca, Spain; [email protected] (E.P.-A.); [email protected] (Z.S.-S.); [email protected] (R.R.) 2 Spanish-Portuguese Institute for Agricultural Research (CIALE), 37185 Salamanca, Spain 3 Department of Botany, Faculty of Science, Charles University, Benátská 2, 128 01 Prague, Czech Republic; [email protected] 4 Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology of the Academy of Sciences of the Czech Republic, 142 20 Prague, Czech Republic 5 Associated Research Unit of Plant-Microorganism Interaction, University of Salamanca-IRNASA-CSIC, 37008 Salamanca, Spain * Correspondence: [email protected] Received: 4 July 2020; Accepted: 1 September 2020; Published: 3 September 2020 Simple Summary: European Bark Beetle (Ips typographus) is a pest that affects dead and weakened spruce trees. Under certain environmental conditions, it has massive outbreaks, resulting in attacks of healthy trees, becoming a forest pest. It has been proposed that the bark beetle’s microbiome plays a key role in the insect’s ecology, providing nutrients, inhibiting pathogens, and degrading tree defense compounds, among other probable traits. During a study of bacterial associates from I. typographus, we isolated three strains identified as Pseudomonas from different beetle life stages. In this work, we aimed to reveal the taxonomic status of these bacterial strains and to sequence and annotate their genomes to mine possible traits related to a role within the bark beetle holobiont.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Exploring Prostate Cancer Genome Reveals Simultaneous Losses of PTEN, FAS and PAPSS2 in Patients with PSA Recurrence After Radical Prostatectomy
    Int. J. Mol. Sci. 2015, 16, 3856-3869; doi:10.3390/ijms16023856 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Exploring Prostate Cancer Genome Reveals Simultaneous Losses of PTEN, FAS and PAPSS2 in Patients with PSA Recurrence after Radical Prostatectomy Chinyere Ibeawuchi 1, Hartmut Schmidt 2, Reinhard Voss 3, Ulf Titze 4, Mahmoud Abbas 5, Joerg Neumann 6, Elke Eltze 7, Agnes Marije Hoogland 8, Guido Jenster 9, Burkhard Brandt 10 and Axel Semjonow 1,* 1 Prostate Center, Department of Urology, University Hospital Muenster, Albert-Schweitzer-Campus 1, Gebaeude 1A, Muenster D-48149, Germany; E-Mail: [email protected] 2 Center for Laboratory Medicine, University Hospital Muenster, Albert-Schweitzer-Campus 1, Gebaeude 1A, Muenster D-48149, Germany; E-Mail: [email protected] 3 Interdisciplinary Center for Clinical Research, University of Muenster, Albert-Schweitzer-Campus 1, Gebaeude D3, Domagkstrasse 3, Muenster D-48149, Germany; E-Mail: [email protected] 4 Pathology, Lippe Hospital Detmold, Röntgenstrasse 18, Detmold D-32756, Germany; E-Mail: [email protected] 5 Institute of Pathology, Mathias-Spital-Rheine, Frankenburg Street 31, Rheine D-48431, Germany; E-Mail: [email protected] 6 Institute of Pathology, Klinikum Osnabrueck, Am Finkenhuegel 1, Osnabrueck D-49076, Germany; E-Mail: [email protected] 7 Institute of Pathology, Saarbrücken-Rastpfuhl, Rheinstrasse 2, Saarbrücken D-66113, Germany; E-Mail: [email protected] 8 Department
    [Show full text]
  • Ten Commandments for a Good Scientist
    Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Wageningen 2010 Thesis committee Thesis supervisors Prof. dr. ir. Ivonne M.C.M. Rietjens Professor of Toxicology Wageningen University Prof. dr. Albertinka J. Murk Personal chair at the sub-department of Toxicology Wageningen University Thesis co-supervisor Dr. ir. Jacques J.M. Vervoort Associate professor at the Laboratory of Biochemistry Wageningen University Other members Prof. dr. Michael R. Muller, Wageningen University Prof. dr. ir. Huub F.J. Savelkoul, Wageningen University Prof. dr. Everardus J. van Zoelen, Radboud University Nijmegen Dr. ir. Toine F.H. Bovee, RIKILT, Wageningen This research was conducted under the auspices of the Graduate School VLAG Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Thesis submitted in fulfillment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Tuesday 14 September 2010 at 4 p.m. in the Aula Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds. Ana María Sotoca Covaleda Thesis Wageningen University, Wageningen, The Netherlands, 2010, With references, and with summary in Dutch. ISBN: 978-90-8585-707-5 “Caminante no hay camino, se hace camino al andar. Al andar se hace camino, y al volver la vista atrás se ve la senda que nunca se ha de volver a pisar” - Antonio Machado – A mi madre.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • Metabolic Control of Hyaluronan Synthases
    MATBIO-00997; No of Pages 6 Matrix Biology xxx (2013) xxx–xxx Contents lists available at ScienceDirect Matrix Biology journal homepage: www.elsevier.com/locate/matbio Metabolic control of hyaluronan synthases Davide Vigetti, Manuela Viola, Evgenia Karousou, Giancarlo De Luca, Alberto Passi ⁎ Dipartimento di Scienze Chirurgiche e Morfologiche, Università degli Studi dell'Insubria, via J.H. Dunant 5, 21100 Varese, Italy article info abstract Available online xxxx Hyaluronan (HA) is a glycosaminoglycan composed by repeating units of D-glucuronic acid (GlcUA) and N-acetylglucosamine (GlcNAc) that is ubiquitously present in the extracellular matrix (ECM) where it has a Keywords: critical role in the physiology and pathology of several mammalian tissues. HA represents a perfect environment Glycosaminoglycan in which cells can migrate and proliferate. Moreover, several receptors can interact with HA at cellular UDP-GlcUA level triggering multiple signal transduction responses. The control of the HA synthesis is therefore critical UDP-GlcNAc in ECM assembly and cell biology; in this review we address the metabolic regulation of HA synthesis. In AMPK O-GlcNAcylation contrast with other glycosaminoglycans, which are synthesized in the Golgi apparatus, HA is produced at the HBP plasma membrane by HA synthases (HAS1-3), which use cytoplasmic UDP-glucuronic acid and UDP-N- acetylglucosamine as substrates. UDP-GlcUA and UDP-hexosamine availability is critical for the synthesis of GAGs, which is an energy consuming process. AMP activated protein kinase (AMPK), which is considered a sensor of the energy status of the cell and is activated by low ATP:AMP ratio, leads to the inhibition of HA secretion by HAS2 phosphorylation at threonine 110.
    [Show full text]
  • 1/05661 1 Al
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date _ . ... - 12 May 2011 (12.05.2011) W 2 11/05661 1 Al (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12Q 1/00 (2006.0 1) C12Q 1/48 (2006.0 1) kind of national protection available): AE, AG, AL, AM, C12Q 1/42 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, (21) Number: International Application DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US20 10/054171 HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (22) International Filing Date: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, 26 October 2010 (26.10.2010) ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (25) Filing Language: English SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, (26) Publication Language: English TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 61/255,068 26 October 2009 (26.10.2009) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, (71) Applicant (for all designated States except US): ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, MYREXIS, INC.
    [Show full text]
  • Microsatellites As EWS/FLI Response Elements in Ewing's Sarcoma
    Microsatellites as EWS/FLI response elements in Ewing’s sarcoma Kunal Gangwal*†, Savita Sankar*†, Peter C. Hollenhorst*†, Michelle Kinsey*†, Stephen C. Haroldsen†, Atul A. Shah†, Kenneth M. Boucher*†, W. Scott Watkins‡, Lynn B. Jorde‡, Barbara J. Graves*†, and Stephen L. Lessnick*†§¶ʈ *Department of Oncological Sciences, †Huntsman Cancer Institute, ‡Department of Human Genetics, §Huntsman Cancer Institute Center for Children, and ¶Division of Pediatric Hematology/Oncology, University of Utah, Salt Lake City, UT 84112 Edited by Robert N. Eisenman, Fred Hutchinson Cancer Research Center, Seattle, WA, and approved May 3, 2008 (received for review February 4, 2008) The ETS gene family is frequently involved in chromosome trans- in close proximity to low affinity binding sites for other tran- locations that cause human cancer, including prostate cancer, scription factors that allow for cooperative DNA binding. leukemia, and sarcoma. However, the mechanisms by which on- Ewing’s sarcoma was the first tumor in which ETS family cogenic ETS proteins, which are DNA-binding transcription factors, members were shown to be involved in chromosomal transloca- target genes necessary for tumorigenesis is not well understood. tions and serves as a paradigm for ETS-driven cancers (10). Ewing’s sarcoma serves as a paradigm for the entire class of Ewing’s sarcoma is a highly malignant solid tumor of children ETS-associated tumors because nearly all cases harbor recurrent and young adults that usually harbors a recurrent chromosomal chromosomal translocations involving ETS genes. The most com- translocation, t(11;22)(q24;q12), that encodes the EWS/FLI mon translocation in Ewing’s sarcoma encodes the EWS/FLI onco- fusion oncoprotein (10).
    [Show full text]
  • A Dissertation Entitled the Androgen Receptor
    A Dissertation entitled The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit Submitted to the Graduate Faculty as partial fulfillment of the requirements for the PhD Degree in Biomedical science Dr. Manohar Ratnam, Committee Chair Dr. Lirim Shemshedini, Committee Member Dr. Robert Trumbly, Committee Member Dr. Edwin Sanchez, Committee Member Dr. Beata Lecka -Czernik, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2011 Copyright 2011, Mesfin Gonit This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit As partial fulfillment of the requirements for the PhD Degree in Biomedical science The University of Toledo August 2011 Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of gene activation by AR, ligand activated AR signals through binding to the androgen response elements (AREs) in the target gene promoter/enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of androgen.
    [Show full text]
  • An Evolving Hierarchical Family Classification for Glycosyltransferases
    doi:10.1016/S0022-2836(03)00307-3 J. Mol. Biol. (2003) 328, 307–317 COMMUNICATION An Evolving Hierarchical Family Classification for Glycosyltransferases Pedro M. Coutinho1, Emeline Deleury1, Gideon J. Davies2 and Bernard Henrissat1* 1Architecture et Fonction des Glycosyltransferases are a ubiquitous group of enzymes that catalyse the Macromole´cules Biologiques transfer of a sugar moiety from an activated sugar donor onto saccharide UMR6098, CNRS and or non-saccharide acceptors. Although many glycosyltransferases catalyse Universite´s d’Aix-Marseille I chemically similar reactions, presumably through transition states with and II, 31 Chemin Joseph substantial oxocarbenium ion character, they display remarkable diversity Aiguier, 13402 Marseille in their donor, acceptor and product specificity and thereby generate a Cedex 20, France potentially infinite number of glycoconjugates, oligo- and polysacchar- ides. We have performed a comprehensive survey of glycosyltransferase- 2Structural Biology Laboratory related sequences (over 7200 to date) and present here a classification of Department of Chemistry, The these enzymes akin to that proposed previously for glycoside hydrolases, University of York, Heslington into a hierarchical system of families, clans, and folds. This evolving York YO10 5YW, UK classification rationalises structural and mechanistic investigation, harnesses information from a wide variety of related enzymes to inform cell biology and overcomes recurrent problems in the functional prediction of glycosyltransferase-related open-reading frames. q 2003 Elsevier Science Ltd. All rights reserved Keywords: glycosyltransferases; protein families; classification; modular *Corresponding author structure; genomic annotations The biosynthesis of complex carbohydrates and are involved in glycosyl transfer and thus conquer polysaccharides is of remarkable biological import- what Sharon has provocatively described as “the ance.
    [Show full text]