DOCSLIB.ORG

The Role of Proteoglycans in the Initiation of Neural Tube Closure

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of Proteoglycans in the Initiation of Neural Tube Closure The role of proteoglycans in the initiation of neural tube closure Oleksandr Nychyk Thesis submitted to UCL for the degree of Doctor of Philosophy 2017 Developmental Biology of Birth Defects Developmental Biology & Cancer Programme UCL Great Ormond Street Institute of Child Health Declaration of contribution I, Oleksandr Nychyk confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in my thesis. ___________________________________________ Oleksandr Nychyk 2 Abstract Neurulation is the embryonic process that gives rise to the neural tube (NT), the precursor of the brain and spinal cord. Recent work has emphasised the importance of proteoglycans in convergent extension movements and NT closure in lower vertebrates. The current study is focused on the role of proteoglycans in the initiation of NT closure in mammals, termed closure 1. In this project, the initial aim was to characterise the ‘matrisome’, or in vivo extracellular matrix (ECM) composition, during mammalian neurulation. Tissue site of mRNA expression and protein localisation of ECM components, including proteoglycans, were then investigated showing their distinct expression patterns prior to and after the onset of neural tube closure. The expression analysis raised various hypothesis that were subsequently tested, demonstrating that impaired sulfation of ECM proteoglycan chains worsens the phenotype of planar cell polarity (PCP) mutant loop tail (Vangl2Lp) predisposed to neural tube defects. Exposure of Vangl2Lp/+ embryos to chlorate, an inhibitor of glycosaminoglycan sulfation, during ex vivo whole embryo culture prevented NT closure, converting Vangl2Lp/+ to the mutant Vangl2Lp/Lp pathophenotype. The same result was obtained by exposure of Vangl2Lp/+ + embryos to chondroitinase or heparitinase. Taken together, it indicated that the PCP pathway functionally interacts with chondroitin and heparan sulfate proteoglycans during initiation of NT closure. In order to investigate the possible role of proteoglycans in mammalian convergent extension, the node of Vangl2Lp/+ embryos was labelled with DiO. The study revealed that the PCP-proteoglycan interaction is mediated independently of convergent extension. The failure of neural fold apposition and reduced Fgfr1 signalling was proposed as potential causative mechanism underlying failure of closure 1. In fish, the cilia motility is dependent on heparan sulfate chains, but this has not been studied in mammals. The present study identified a novel cellular localisation of cohesin/proteoglycan protein Smc3 and its GAG chains. Both Smc3 and CS-E are expressed in the midbody, primary and motile cilia. For the first time, this study showed the nuclear expression of CS chains in mouse embryo. The coordinated movement of Smc3 and CS-E chains during cytokinesis and ciliogenesis suggests conserved role of this protein in mouse cilia and cytokinetic apparatus. 3 Acknowledgements I would like to thank my supervisor, Andrew Copp, for excellent supervision and guidance over these four years. I have been extremely lucky to have a supervisor who cared so much about my work, and who responded to my questions and queries so promptly, and corrected my English. Thanks to my secondary supervisor Philip Stanier and a group leader Nick Greene for giving me a support and advice when I needed. I would like also to thank Paula and J.P. for providing me valuable suggestions and feedback. I am especially indebted to Gabe for being such a great mentor that always wheeling to help and support me. Many thanks to Matteo for being a good friend and a wonderful colleague from a Matrix field. I would also like to thank Sandrita and Dorothee for always finding a moment to talk and help me in the lab. Special thanks to Ana for giving me the SEM data and to Dale for being a great helper in the microscopy field. Also, I would like to thank all other members of Neural Tube Defects group. I am extremely thankful to my Mum and Dad for believing in me and giving me a chance to be what I am today. Finally, I am so thankful to my wife Jolita and my son Alexander for all their love, a huge patience and encouragement. I couldn’t have done this work without them. 4 Table of Contents Abstract………………………………………………………………………………………………………………………………………………3 Acknowledgments……………………………………………………………………………………………………………………………. 4 Table of Contents ………………………………………………………………………………………………………………………………5 List of Figures and Tables …………………………………………………………………………………………………………………10 Abbreviations …………………………………………………………………………………………………………………………………..13 1. General introduction ………………………………………………………………………………………………15 1.1. Neurulation ……………………………………………………………………………………………………15 1.1.1. The primary neurulation sequence: closure sites and timing …………………………..........………..15 1.1.2. Neural plate shaping and bending ……………………………………………………………………...........……17 1.1.3. Fusion of neural folds ……………………………………………………………………………….........……………...19 1.1.4. Neural tube defects ……………………………………………………………………………………………..........……20 1.2. The planar cell polarity pathway ……………………………………………………………………………………………21 1.2.1. Vertebrate PCP genes ……………………………………………………………………………………………………….21 1.2.2. PCP-dependent NT closure ……………………………………………………………………………………………….23 1.2.3. The loop-tail mouse model ……………………………………………………………………………………………….25 1.3. Glycosaminoglycans and proteoglycans ………………………………………………………………………………..28 1.3.1. Glycosaminoglycans ………………………………………………………………………………………………………….28 1.3.1.1. Biosynthesis of GAG chains …………………………………………………………………………29 1.3.1.2. Impairment of HS biosynthesis …………………………………………………………………...33 1.3.1.3. Impairment of CS biosynthesis …………………………………………………………………...33 1.3.2. Proteoglycans …………………………………………………………………………………………………………………..34 1.3.2.1. Syndecans and glypicans ……………………………………………………………………………34 1.3.2.2. Basement membrane proteoglycans ………………………………………………………….37 1.3.2.3. Versican, aggrecan, phosphocan and bamacan ..………………………………………..37 1.4. FGF/FGFR expression and signalling during development .........................................................39 1.5. Left-right asymmetry …………………………………………………………………………………………………………….41 1.6. Thesis hypothesis, aims and objectives ..............................………………………………...…………………45 2. Materials and Methods ……………………………………………………………………………………………………………..47 5 2.1. Mouse strains and genotyping ……………………………………………………………………………………………...47 2.1.1. Vangl2Lp ………………………………………………………………………………………………………………………….…47 2.1.2. Vangl2flox ……………………………………………………………………………………………………………………….....47 2.1.3. β-actincre …………………………………………………………………..………………………………………………………47 2.1.4. Wild type ..………………………………………………………………………………………………………………………..47 2.1.5. Genotyping ……………………………………………………………………………………………………………………….47 2.1.5.1. DNA extraction ……………………………………………………………………………………………47 2.1.5.2. Vangl2 genotyping assays ..…………………………………………………………………….…..48 2.1.5.3. Cre genotyping assays …………………………………………………………………………………50 2.1.5.4. Agarose gel electrophoresis …………………………………………………………………….….51 2.2. Mouse embryology ……………………………………………………..………………………………………………………..51 2.2.1. Embryo collection, dissection and storage .……………………………………………………………………...51 2.2.2. Preparation of rat serum for embryo culture ……………………………………………………………….……51 2.2.3. Whole embryo culture ……………………………………………………………………………………………….……..52 2.2.3.1. Assessment of embryos after the culture .……………….…………………………….……52 2.2.3.2. Chlorate treatment ………………………………………………………………………….............53 2.2.3.3. Chondroitinase ABC and HeparitinaseIII treatment ........................................53 2.2.3.4. DiO labelling of the node .……………………………………………………………………….....54 2.2.3.5. Embryonic measurements …………………………………………………………………………..54 2.3. RNA-seq ………………………………………………………………………….........................................................55 2.3.1. Tissue collection for RNA-seq, RNA extraction and quality control .......................................55 2.3.2. Generation of library and sequencing ...................................................................................55 2.3.3. Bioinformatics analysis ..........................................................................................................56 2.3.4. Analysis of the transcriptome of mid-gestation mouse embryos (MGME) from Werber 2014 study ………………………………………………………………………….........................................................57 2.4. Histology ………………………………………………………………………..........................................................57 2.4.1. Cryo-embedding ………………………………………………………………………..........................................57 2.4.2. Cryosectioning …………………………………………………………………...................................................57 2.5. 2.5 In situ hybridization ………………………………………………………………….........................................57 2.5.1. RNA isolation and cDNA synthesis ........................................................................................58 6 2.5.2. RNA probe preparation for in situ hybridization ..................................................................58 2.5.2.1. Probe design ...................................................................................................58 2.5.2.2. Ligation of the probe into the vector system .................................................61 2.5.2.3. Transformation of competent cells ................................................................61 2.5.2.4. Preparation of plasmid and transcription of DIG probe .................................61 2.5.3. Whole mount in situ hybridization ........................................................................................62
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Works Neuroembryology
    Swarthmore College Works Biology Faculty Works Biology 1-1-2017 Neuroembryology D. Darnell Scott F. Gilbert Swarthmore College, [email protected] Follow this and additional works at: https://works.swarthmore.edu/fac-biology Part of the Biology Commons Let us know how access to these works benefits ouy Recommended Citation D. Darnell and Scott F. Gilbert. (2017). "Neuroembryology". Wiley Interdisciplinary Reviews: Developmental Biology. Volume 6, Issue 1. DOI: 10.1002/wdev.215 https://works.swarthmore.edu/fac-biology/493 This work is brought to you for free by Swarthmore College Libraries' Works. It has been accepted for inclusion in Biology Faculty Works by an authorized administrator of Works. For more information, please contact [email protected]. HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Wiley Interdiscip Manuscript Author Rev Dev Manuscript Author Biol. Author manuscript; available in PMC 2018 January 01. Published in final edited form as: Wiley Interdiscip Rev Dev Biol. 2017 January ; 6(1): . doi:10.1002/wdev.215. Neuroembryology Diana Darnell1 and Scott F. Gilbert2 1University of Arizona College of Medicine 2Swarthmore College and University of Helsinki Abstract How is it that some cells become neurons? And how is it that neurons become organized in the spinal cord and brain to allow us to walk and talk, to see, recall events in our lives, feel pain, keep our balance, and think? The cells that are specified to form the brain and spinal cord are originally located on the outside surface of the embryo. They loop inward to form the neural tube in a process called neurulation.
    [Show full text]
  • Environmental Influences on Endothelial Gene Expression
    ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community.
    [Show full text]
  • The Mutational Landscape of Myeloid Leukaemia in Down Syndrome
    cancers Review The Mutational Landscape of Myeloid Leukaemia in Down Syndrome Carini Picardi Morais de Castro 1, Maria Cadefau 1,2 and Sergi Cuartero 1,2,* 1 Josep Carreras Leukaemia Research Institute (IJC), Campus Can Ruti, 08916 Badalona, Spain; [email protected] (C.P.M.d.C); [email protected] (M.C.) 2 Germans Trias i Pujol Research Institute (IGTP), Campus Can Ruti, 08916 Badalona, Spain * Correspondence: [email protected] Simple Summary: Leukaemia occurs when specific mutations promote aberrant transcriptional and proliferation programs, which drive uncontrolled cell division and inhibit the cell’s capacity to differentiate. In this review, we summarize the most frequent genetic lesions found in myeloid leukaemia of Down syndrome, a rare paediatric leukaemia specific to individuals with trisomy 21. The evolution of this disease follows a well-defined sequence of events and represents a unique model to understand how the ordered acquisition of mutations drives malignancy. Abstract: Children with Down syndrome (DS) are particularly prone to haematopoietic disorders. Paediatric myeloid malignancies in DS occur at an unusually high frequency and generally follow a well-defined stepwise clinical evolution. First, the acquisition of mutations in the GATA1 transcription factor gives rise to a transient myeloproliferative disorder (TMD) in DS newborns. While this condition spontaneously resolves in most cases, some clones can acquire additional mutations, which trigger myeloid leukaemia of Down syndrome (ML-DS). These secondary mutations are predominantly found in chromatin and epigenetic regulators—such as cohesin, CTCF or EZH2—and Citation: de Castro, C.P.M.; Cadefau, in signalling mediators of the JAK/STAT and RAS pathways.
    [Show full text]
  • Upon Microbial Challenge, Human Neutrophils Undergo Rapid Changes in Nuclear Architecture and Chromatin Folding to Orchestrate an Immediate Inflammatory Gene Program
    Downloaded from genesdev.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press Upon microbial challenge, human neutrophils undergo rapid changes in nuclear architecture and chromatin folding to orchestrate an immediate inflammatory gene program Matthew Denholtz,1,5 Yina Zhu,1,5 Zhaoren He,1 Hanbin Lu,1 Takeshi Isoda,1,4 Simon Döhrmann,2 Victor Nizet,2,3 and Cornelis Murre1 1Division of Biological Sciences, Department of Molecular Biology, University of California at San Diego, La Jolla, California 92039, USA; 2Department of Pediatrics, University of California at San Diego School of Medicine, La Jolla, California 92093, USA; 3Skaggs School of Pharmaceutical Sciences, University of California at San Diego, La Jolla, California 92093, USA Differentiating neutrophils undergo large-scale changes in nuclear morphology. How such alterations in structure are established and modulated upon exposure to microbial agents is largely unknown. Here, we found that prior to encounter with bacteria, an armamentarium of inflammatory genes was positioned in a transcriptionally passive environment suppressing premature transcriptional activation. Upon microbial exposure, however, human neu- trophils rapidly (<3 h) repositioned the ensemble of proinflammatory genes toward the transcriptionally permissive compartment. We show that the repositioning of genes was closely associated with the swift recruitment of cohesin across the inflammatory enhancer landscape, permitting an immediate transcriptional response upon bacterial exposure. We found that activated enhancers, marked by increased deposition of H3K27Ac, were highly enriched for cistromic elements associated with PU.1, CEBPB, TFE3, JUN, and FOSL2 occupancy. These data reveal how upon microbial challenge the cohesin machinery is recruited to an activated enhancer repertoire to instruct changes in chromatin folding, nuclear architecture, and to activate an inflammatory gene program.
    [Show full text]
  • The Genetic Basis of Mammalian Neurulation
    REVIEWS THE GENETIC BASIS OF MAMMALIAN NEURULATION Andrew J. Copp*, Nicholas D. E. Greene* and Jennifer N. Murdoch‡ More than 80 mutant mouse genes disrupt neurulation and allow an in-depth analysis of the underlying developmental mechanisms. Although many of the genetic mutants have been studied in only rudimentary detail, several molecular pathways can already be identified as crucial for normal neurulation. These include the planar cell-polarity pathway, which is required for the initiation of neural tube closure, and the sonic hedgehog signalling pathway that regulates neural plate bending. Mutant mice also offer an opportunity to unravel the mechanisms by which folic acid prevents neural tube defects, and to develop new therapies for folate-resistant defects. 6 ECTODERM Neurulation is a fundamental event of embryogenesis distinct locations in the brain and spinal cord .By The outer of the three that culminates in the formation of the neural tube, contrast, the mechanisms that underlie the forma- embryonic (germ) layers that which is the precursor of the brain and spinal cord. A tion, elevation and fusion of the neural folds have gives rise to the entire central region of specialized dorsal ECTODERM, the neural plate, remained elusive. nervous system, plus other organs and embryonic develops bilateral neural folds at its junction with sur- An opportunity has now arisen for an incisive analy- structures. face (non-neural) ectoderm. These folds elevate, come sis of neurulation mechanisms using the growing battery into contact (appose) in the midline and fuse to create of genetically targeted and other mutant mouse strains NEURAL CREST the neural tube, which, thereafter, becomes covered by in which NTDs form part of the mutant phenotype7.At A migratory cell population that future epidermal ectoderm.
    [Show full text]
  • Structure of the Human Cohesin Inhibitor Wapl
    Structure of the human cohesin inhibitor Wapl Zhuqing Ouyanga,1, Ge Zhenga,1, Jianhua Songb, Dominika M. Borekc, Zbyszek Otwinowskic, Chad A. Brautigamc, Diana R. Tomchickc, Susannah Rankinb, and Hongtao Yua,2 aHoward Hughes Medical Institute, Department of Pharmacology, and cDepartment of Biophysics, University of Texas Southwestern Medical Center, Dallas, TX 75390; and bProgram in Cell Cycle and Cancer Biology, Oklahoma Medical Research Foundation, Oklahoma City, OK 73104 Edited by Douglas Koshland, University of California, Berkeley, CA, and approved May 23, 2013 (received for review March 11, 2013) Cohesin, along with positive regulators, establishes sister-chromatid trigger cohesin release from chromosome arms (15, 18–21). A pool of cohesion by forming a ring to circle chromatin. The wings apart-like cohesin at centromeres is protected by the shugoshin (Sgo1)–protein protein (Wapl) is a key negative regulator of cohesin and forms phosphatase 2A (PP2A) complex (22, 23), which binds to cohesin, a complex with precocious dissociation of sisters protein 5 (Pds5) to dephosphorylates sororin, and protects cohesin from Wapl promote cohesin release from chromatin. Here we report the at centromeres (24). After all sister kinetochores attach properly crystal structure and functional characterization of human Wapl. to the mitotic spindle and are under tension, separase cleaves Wapl contains a flexible, variable N-terminal region (Wapl-N) and centromeric cohesin to initiate sister-chromatid separation. The a conserved C-terminal domain (Wapl-C) consisting of eight HEAT separated chromatids are evenly partitioned into the two daughter (Huntingtin, Elongation factor 3, A subunit, and target of rapamycin) cells through their attachment to microtubules originating from the repeats.
    [Show full text]
  • Role of Glypican-6 and Ng2 As Metastasis Promoting Factors
    UNIVERSITA’ DEGLI STUDI DI PARMA Dottorato di ricerca in Fisiopatologia Sistemica Ciclo XX ROLE OF GLYPICAN-6 AND NG2 AS METASTASIS PROMOTING FACTORS Coordinatore: Chiar.mo Prof. Ezio Musso Tutor: Chiar.mo Prof.Roberto Perris Dottoranda: Katia Lacrima Anni Accademici 2005-2008 To Indy L'anima libera e' rara, ma quando la vedi la riconosci: soprattutto perché provi un senso di benessere, quando gli sei vicino. (Charles Bukowski ) Index Summary ……………………………………………………..................................................... 3 1. Introduction …………………………………………………………………………………… 5 1.1. Proteoglycans (PGs)………………………………………………………………......... 6 1.2. Membrane associated proteoglycans……………………………………………..…... 8 1.3. Syndecans……………………………………………………………………………..…. 9 1.4. Glypicans……………………………………………………………………………...….. 11 1.5. GPC6……………………………………………………………………………….…….. 13 1.6. NG2/CSPG4……………………………………………………………………….…….. 14 1.7. Metastasis………………………………………………………………………….….…. 16 1.8. Soft Tissue Sarcoma (STS)…………………………………………………………….. 17 1.9. Membrane PGs and tumour……………………………………………………………. 18 1.10. Membrane PGs in sarcoma…………………………………………………………….. 24 2. Material and Methods ……………………………………………………………………… 26 2.1. Cell Culture……………………………………………………………………….………. 27 2.2. RNA extraction……………………………………………………………………….…. 28 2.3. Real Time quantitative PCR……………………………………………….………….. 28 2.4. DNA extraction…………………………………………….……………………………. 30 2.5. Plasmids and Transfection………………………………………….………………… 30 2.6. Western Blotting………………………………………………………………………... 31 2.7. Preparation of ECM substrates………………………………………….……………
    [Show full text]
  • Mirna Let-7 from TPO(+) Extracellular Vesicles Is a Potential Marker for a Differential Diagnosis of Follicular Thyroid Nodules
    cells Article MiRNA let-7 from TPO(+) Extracellular Vesicles is a Potential Marker for a Differential Diagnosis of Follicular Thyroid Nodules Lidia Zabegina 1,2,3, Inga Nazarova 1,2, Margarita Knyazeva 1,2,3, Nadezhda Nikiforova 1,2, Maria Slyusarenko 1,2, Sergey Titov 4 , Dmitry Vasilyev 1, Ilya Sleptsov 5 and Anastasia Malek 1,2,* 1 Subcellular Technology Lab., N.N. Petrov National Medical Research Center of Oncology, 195251 St. Petersburg, Russia; [email protected] (L.Z.); [email protected] (I.N.); [email protected] (M.K.); [email protected] (N.N.); [email protected] (M.S.); [email protected] (D.V.) 2 Oncosystem Ltd., 121205 Moscow, Russia 3 Institute of Biomedical Systems and Biotechnologies, Peter the Great St. Petersburg Polytechnic University, 195251 St. Petersburg, Russia 4 PCR Laboratory; AO Vector-Best, 630117 Novosibirsk, Russia; [email protected] 5 Department of endocrine surgery, Clinic of High Medical Technologies, St. Petersburg State University N.I. Pirogov, 190103 St. Petersburg, Russia; [email protected] * Correspondence: [email protected]; Tel.: +7-960-250-46-80 Received: 19 July 2020; Accepted: 15 August 2020; Published: 18 August 2020 Abstract: Background: The current approaches to distinguish follicular adenomas (FA) and follicular thyroid cancer (FTC) at the pre-operative stage have low predictive value. Liquid biopsy-based analysis of circulating extracellular vesicles (EVs) presents a promising diagnostic method. However, the extreme heterogeneity of plasma EV population hampers the development of new diagnostic tests. We hypothesize that the isolation of EVs with thyroid-specific surface molecules followed by miRNA analysis, may have improved diagnostic potency.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]