Letters to the Editor SHOX Point Mutations in Dyschondrosteosis

Total Page:16

File Type:pdf, Size:1020Kb

Letters to the Editor SHOX Point Mutations in Dyschondrosteosis J Med Genet 2001;38:323–351 323 Letters to the Editor J Med Genet: first published as 10.1136/jmg.38.5.323 on 1 May 2001. Downloaded from SHOX point mutations in dyschondrosteosis Céline Huber, Veronica Cusin, Martine Le Merrer, Michèle Mathieu, Véronique Sulmont, Nathalie Dagoneau, Arnold Munnich, Valérie Cormier-Daire Dyschondrosteosis (DCS) has been recently Table 2 SHOX point mutations identified in DCS patients ascribed to mutations of the SHOX gene on the pseudoautosomal region of the X and Y chro- Sequence change Exon Protein eVect mosomes.12 Most cases are accounted for by Family 4 106–107 del CG 2 77X large scale deletions3–7 and only two point Family 5 334 C→T 3 Q112X Family 6 445 G→T 3 E149X mutations have been hitherto identified in exon Family 7 481 ins GT 3 181X 4 (R195 X and Y199X12). Here, we show that Family 8 517 C→T 4 R173C point mutations in various regions of the 1 SHOX gene also play an important role in the one nonsense mutation ). Studying eight addi- pathogenesis of the disease. tional DCS families, we describe here three A total of 22 aVected subjects belonging to deletions and five point mutations of SHOX. Taken together, these data suggest that SHOX eight families were included in the study. deletion is the most frequent common disease Inclusion criteria for aVected status were short causing mechanism in DCS (10/16, 62.5%) stature (2 SD below normal) with short and that point mutations also account for a sig- forelimbs and distal radioulnar deformity on nificant fraction of our patients (6/16, 37.5%). forearm x rays. This study also supports the view that hap- The 22 patients and their relatives were loinsuYciency is the most frequent mech- genotyped using microsatellite DNA markers anism in DCS (10 deletions and five nonsense of the pseudoautosomal region (CA-SHOX, and frameshift mutations in 15/16 families). DXYS233, DXYS234, DXYS228). Linkage Among the five novel mutations reported here, J Med Genet studies supported the mapping of the disease only one was a missense mutation resulting in 2001;38:323 gene to Xp22.3 in all families and hemizygos- an amino acid change in the homeodomain of ity at the CA-SHOX locus was observed in SHOX. Interestingly, this family was not clini- Department of cally diVerent from the others. Indeed, all Genetics and INSERM three families (families 1-3, data not shown). http://jmg.bmj.com/ U393, Hôpital Necker In families 4-8, PCR amplification and patients had short stature and x ray deformity Enfants Malades, 149 sequence analysis of the five translated exons of of the forearms although intrafamilial variabil- rue de Sèvres, 75743 the SHOX gene (table 1) led to the detection of ity was consistently observed with males being Paris Cedex 15, France five diVerent mutations which consistently usually less severely aVected. C Huber cosegregated with the disease (table 2). In fam- In conclusion, this study shows that point V Cusin mutations of the SHOX gene account for a sig- M Le Merrer ily 4, a two base pair deletion in exon 2 led to a N Dagoneau frameshift and a translation termination at nificant number of DCS patients and shows A Munnich codon 77. In families 5 and 6, base changes at that haploinsuYciency is the most frequent on September 26, 2021 by guest. Protected copyright. V Cormier-Daire nucleotides 334 and 445 respectively created a disease causing mechanism in DCS. stop codon in exon 3 (Q112X and E149X). In Service de Génétique, family 7, a GT insertion at codon 161 led to a 1 Belin V, Cusin V, Viot G, Girlich D, Toutain A, Moncla A, Amiens, France Vekemans M, Le Merrer M, Munnich A, Cormier-Daire V. M Mathieu premature stop codon. All four mutations SHOX mutations in dyschondrosteosis (Leri-Weill syn- resulted in a premature translation termination. drome). Nat Genet 1998;19:67-9. → 2 Shears DJ, Vassal HJ, Goodman FR, Palmer RW, Reardon Department of Finally, in family 8, a C T transition in exon 4 W, Superti-Furga A, Scambler PJ, Winter RM. Mutation Pediatrics, American changed an arginine into a cysteine in the and deletion of the pseudoautosomal gene SHOX cause Leri-Weill dyschondrosteosis. Nat Genet 1998;19:70-3. Memorial Hospital, protein (R173C). This mutation was found in 3 Kosho T, Muroya K, Nagai T, Fujimoto M, Yokoya S, Reims, France the aVected mother and her three aVected chil- Sakamoto H, Hirano T, Terasaki H, Ohashi H, Nishimura V Sulmont G, Sato S, Matsuo N, Ogata T.Skeletal features and growth dren but neither in the healthy father nor in 90 patterns in 14 patients with haploinsuYciency of SHOX: control chromosomes. implications for the development of Turner syndrome. J Correspondence to: Clin Endocrinol Metab 1999;84:4613-21. Dr Cormier-Daire, We have reported on SHOX deletions and a 4 Calabrese G, Fischetto R, Stuppia L, Capodiferro F, [email protected] nonsense mutation in DCS (seven deletions, Mingarelli R, Causio F, Rocchi M, Rappold GA, Palka G. X/Y translocation in a family with Leri-Weill dyschon- Table 1 Detailed PCR conditions for SHOX exon amplification. The exon numbers have drosteosis. Hum Genet 1999;105:367-8. been assigned according to Blaschke and Rappold8 5 Stuppia L, Calabrese G, Borrelli P, Gatta V, Morizio E, Mingarelli R, Di Gilio MC, Crino A, Giannotti A, Rappold GA, Palka G. Loss of the SHOX gene associated with Leri- Annealing Product size Weill dyschondrosteosis in a 45,X male. J Med Genet 1999; Primer sequence temperature (°C) (bp) 36:711-13. 6 Spranger S, Schiller S, Jauch A, WolV K, Rauterberg-Ruland Exon 2 5' GAGACGCGCGCATCCACCA 64 I, Hager D, Tariverdian G, Troger J, Rappold G. Leri-Weill Exon 2 3' GAGGCGCCGAACCCCAGGAG 64 382 syndrome as part of a contiguous gene syndrome at Exon 3 5' AAAACCTCCCCGGCCTCAG 64 Xp22.3. Am J Med Genet 1999;83:367-71. Exon 3 3' GTGGCTGTACGCGTGCGCTGTG 64 332 7 Schiller S, Spranger S, Scheshinger B, Fukami M, Merker S, Exons 4–5 5' GGGAGGCTGGGCTGGGTTC 64 Drop S, Tröger J, Knoblauch H, Kunze J, Seidel J, Rappold Exons 4–5 3' GGGGAAGGGAGCAGCCAGGAA 64 378 GA. Phenotypic variation and genetic heterogeneity in Leri-Weill syndrome. Eur J Hum Genet 2000;8:54-62. Exon 6a 5' TTCACCATGTTAGCCAGGAA 64 8 Blaschke RJ, Rappold GA. SHOX: growth, Léri-Weill and Exon 6a 3' ATCACCTGAGGTCAGGAGTT 64 376 Turner syndromes. Trends Endocrinol Metab 2000;6:227-30. www.jmedgenet.com 324 Letters Phenotypic heterogeneity of CYP1B1: mutations J Med Genet: first published as 10.1136/jmg.38.5.323 on 1 May 2001. Downloaded from in a patient with Peters’ anomaly Andrea Vincent, Gail Billingsley, Megan Priston, Donna Williams-Lyn, Joanne Sutherland, Tom Glaser, Edward Oliver, Michael A Walter, Godfrey Heathcote, Alex Levin, Elise Héon Congenital glaucoma refers to a genetically entirely well with no other malformations and J Med Genet heterogeneous group of distinctive clinical dis- no significant family history. 2001;38:324–326 eases characterised by increased intraocular A diagnosis of congenital glaucoma and pressure most often associated with increased Peters’ anomaly with no significant family his- Department of corneal diameter, corneal oedema, and conse- tory was made. Bilateral trabeculotomies were Ophthalmology, The quent visual impairment. Primary congenital performed to decrease the IOP followed by a Hospital for Sick Children, Toronto, glaucoma (PCG) is associated with a primary left corneal transplant for visual rehabilitation. Ontario, Canada angle defect, whereas secondary congenital At surgery, the undersurface of the cornea A Vincent glaucoma is associated with a more generalised showed a central, Y shaped, posteriorly project- J Sutherland developmental anomaly of the anterior seg- ing opacity that corresponded to a raised opac- A Levin ment such as seen in Peters’ anomaly. The ity on the anterior capsule of the lens. This E Héon inheritance of PCG is usually autosomal reces- overlapped the position of the fetal sutures and The Research sive. suggested the existence of previous keratolen- Institute, The Hospital Peters’ anomaly consists of corneal opacity, ticular adhesions during development. The for Sick Children, defects in the posterior structures of the lens also showed a pulverulent (powdery) cata- University of Toronto, cornea, and iridocorneal and/or keratolenticu- ract through which there was a good red reflex. Toronto, Ontario, lar adhesions, and it most frequently occurs Subsequently, the IOPs were diYcult to Canada sporadically.1 Over 50% of subjects develop A Vincent control in both eyes, requiring frequent surgery G Billingsley glaucoma in childhood. Numerous aetiologies and medication. At the most recent examina- A Levin have been proposed including chromosomal tion at 6 years of age, his right eye showed signs E Héon abnormalities, teratogens,1 and mutations in of advanced but controlled glaucoma with a the eye developmental genes PAX62–4 and cup:disc ratio of 0.8 to 0.9 OD. His left eye The Vision Science PITX2.5 However, large subsets of Peters’ became phthisical (shrunken). Research Program, anomaly cases are without molecular charac- Microscopic examination of the left corneal University Health Network, Toronto terisation. button removed at transplantation showed that Western Hospital, Primary congenital glaucoma has been the corneal epithelium was of normal thick- Toronto, Ontario, linked to chromosomes 1p36 (GLC3B) and ness, although there was some oedema of the http://jmg.bmj.com/ Canada 2p21 (GLC3A), but only the GLC3A gene has basal cells (fig 1, below). Bowman’s membrane A Vincent been identified. This gene, CYP1B1, encodes a was not recognisable and the anterior stroma G Billingsley broadly expressed cytochrome P450 enzyme M Priston was hypercellular with a disordered lamellar D Williams-Lyn (P4501B1) whose natural substrate is un- pattern.
Recommended publications
  • Genome-Wide Meta-Analysis of Common Variant Differences Between Men and Women
    Human Molecular Genetics, 2012, Vol. 21, No. 21 4805–4815 doi:10.1093/hmg/dds304 Advance Access published on July 27, 2012 Genome-wide meta-analysis of common variant differences between men and women Vesna Boraska1,2,∗, Ana Jeroncˇic´ 3, Vincenza Colonna1,5, Lorraine Southam1, Dale R. Nyholt 6, Nigel William Rayner1,7,8, John R.B. Perry7,9,10, Daniela Toniolo11, Eva Albrecht12, Wei Ang13, StefaniaBandinelli14, MajaBarbalic15, IneˆsBarroso1,16, Jacques S.Beckmann18,19, ReinerBiffar20, Dorret Boomsma22, Harry Campbell23, Tanguy Corre11, Jeanette Erdmann24,25,To˜ nu Esko27,28,29, Krista Fischer27, Nora Franceschini30, Timothy M. Frayling9, Giorgia Girotto31, Juan R. Gonzalez32,33, Tamara B. Harris34, Andrew C. Heath35, Iris M. Heid36,37, Wolfgang Hoffmann21, Albert Hofman38,40, Momoko Horikoshi7,8, Jing Hua Zhao17, Anne U. Jackson41,42, Jouke-Jan Hottenga22, Antti Jula43, Mika Ka¨ho¨ nen44,46, Kay-Tee Khaw47, Lambertus A. Kiemeney48, Norman Klopp52, Zolta´n Kutalik18,54, Vasiliki Lagou7,8, Downloaded from Lenore J.Launer34, TerhoLehtima¨ki45,46, Mathieu Lemire55, Marja-LiisaLokki56, Christina Loley26, Jian’an Luan17, Massimo Mangino10, Irene Mateo Leach58, Sarah E. Medland6, Evelin Mihailov28, Grant W. Montgomery6, Gerjan Navis59, John Newnham13, Markku S. Nieminen61, Aarno Palotie1,57,62,63, Kalliope Panoutsopoulou1, Annette Peters53, Nicola Pirastu31, http://hmg.oxfordjournals.org/ Ozren Polasˇek4, Karola Rehnstro¨ m1,57, Samuli Ripatti57, Graham R.S. Ritchie1,64, Fernando Rivadeneira38,39,40, Antonietta Robino31, Nilesh J. Samani65, So-Youn Shin1, Juha Sinisalo61, Johannes H. Smit66, Nicole Soranzo1,10, Lisette Stolk39,40, Dorine W. Swinkels49, Toshiko Tanaka68, Alexander Teumer69, Anke To¨ njes70,71, Michela Traglia11, Jaakko Tuomilehto72,73,74,75, Armand Valsesia18,54,76, Wiek H.
    [Show full text]
  • Letters to the Editor SHOX Point Mutations in Dyschondrosteosis
    J Med Genet 2001;38:323–351 323 Letters to the Editor J Med Genet: first published as 10.1136/jmg.38.5.323 on 1 May 2001. Downloaded from SHOX point mutations in dyschondrosteosis Céline Huber, Veronica Cusin, Martine Le Merrer, Michèle Mathieu, Véronique Sulmont, Nathalie Dagoneau, Arnold Munnich, Valérie Cormier-Daire Dyschondrosteosis (DCS) has been recently Table 2 SHOX point mutations identified in DCS patients ascribed to mutations of the SHOX gene on the pseudoautosomal region of the X and Y chro- Sequence change Exon Protein eVect mosomes.12 Most cases are accounted for by Family 4 106–107 del CG 2 77X large scale deletions3–7 and only two point Family 5 334 C→T 3 Q112X Family 6 445 G→T 3 E149X mutations have been hitherto identified in exon Family 7 481 ins GT 3 181X 4 (R195 X and Y199X12). Here, we show that Family 8 517 C→T 4 R173C point mutations in various regions of the 1 SHOX gene also play an important role in the one nonsense mutation ). Studying eight addi- pathogenesis of the disease. tional DCS families, we describe here three A total of 22 aVected subjects belonging to deletions and five point mutations of SHOX. Taken together, these data suggest that SHOX eight families were included in the study. deletion is the most frequent common disease Inclusion criteria for aVected status were short causing mechanism in DCS (10/16, 62.5%) stature (2 SD below normal) with short and that point mutations also account for a sig- forelimbs and distal radioulnar deformity on nificant fraction of our patients (6/16, 37.5%).
    [Show full text]
  • Notes and References
    Notes and References Caveat: The Dangers of Behavioral Biology The contents of this book are known to be dangerous. I do not mean that in the sense that all ideas are potentially dangerous. Specifically, ideas about the biological basis of behavior have encouraged political tendencies and movements later regretted by all decent people and condemned in school histories. Why, then, purvey such ideas? Because some ideas in behavioral biology are true—among them, to the best of my knowledge, the ones in this book—and the truth is essential to wise action. But that does not mean that these ideas cannot be distorted, nor that evil acts cannot arise from them. I doubt, in fact, that what I say can prevent such distortion. Political and social movements arise from worldly causes, and then seize whatever congenial ideas are at hand. Nonethe- less, I am not comfortable in the company of scientists who are content to search for the truth and let the consequences accumulate as they may. I therefore recount here a few pas- sages in the dismal, indeed shameful history of the abuse of behavioral biology, in some of which scientists were willing participants. The first episode is recounted in William Stanton’s The Leopard’s Spots: Scientific Atti- tudes Toward Race in America, 1815–59 (Chicago: University of Chicago, 1960). Such names as Samuel George Morton, George Robins Gliddon, and Josiah Clark Nott mean little to present-day students of anthropology, but in the difficult decades between the death of Jeffer- son and the Civil War, they founded the American School of Anthropology.
    [Show full text]
  • Global Technologies of Sperm Donation from Conception to Connection
    Review essay: Global technologies of sperm donation from conception to connection ▪ Alison Wheatley, Newcastle University Rikke Andreassen Mediated Kinship: Gender, Race and Sexuality in Donor Families London and New York: Routledge, 2019, £115.00 hbk, (ISBN: 978-0-8153- 7795-5) 190pp. Rosanna Hertz and Margaret K. Nelson Random Families: Genetic Strangers, Sperm Donor Siblings, and the Creation of New Kin New York: Oxford University Press, 2018, $27.95 hbk, (ISBN: 978-0-19- 088827-5)) 296pp. Sebastian Mohr Being a Sperm Donor: Masculinity, Sexuality, and Biosociality in Denmark New York: Berghahn, 2018, £85.00 hbk, (ISBN: 978-1-78533-946-2) 185pp. Ayo Wahlberg Good Quality: The Routinization of Sperm Banking in China Oakland, California: University of California Press, 2018, £29.00 pbk, (ISBN: 978-0-520-29778-4) 229pp. The sociological study of Assistive Reproductive Technologies (ARTs) is situated within a landscape that is continuously shifting. New technologies are developed as legislation catches up with the implications of the old ones. Cohorts of donor-conceived childreni born in the early days of donor insemination (and their parents) are likely to have different experiences to those born today, where identity-release donationii has become much more common and, moreover, other technologies have also developed and changed. The internet allows for instantaneous communication between people who have never met in person, facilitated by the social media applications that are now ubiquitous in everyday life. This is fertile ground for connections between those linked via donated gametes to develop. While the debate about how new forms of kinship and relatedness emerge within the context of ARTs has been ongoing in the field for quite some time, these technological shifts mean that there is space for the new perspectives offered by these books.
    [Show full text]
  • Relish Plays a Dynamic Role in the Niche to Modulate
    RESEARCH ARTICLE Relish plays a dynamic role in the niche to modulate Drosophila blood progenitor homeostasis in development and infection Parvathy Ramesh1,2, Nidhi Sharma Dey1,2†, Aditya Kanwal1,2, Sudip Mandal1,3, Lolitika Mandal1,2* 1Department of Biological Sciences, Indian Institute of Science Education and Research (IISER) Mohali, Knowledge City, India; 2Developmental Genetics Laboratory, IISER Mohali, SAS Nagar, Punjab, India; 3Molecular Cell and Developmental Biology Laboratory, IISER Mohali, SAS Nagar, Punjab, India Abstract Immune challenges demand the gearing up of basal hematopoiesis to combat infection. Little is known about how during development, this switch is achieved to take care of the insult. Here, we show that the hematopoietic niche of the larval lymph gland of Drosophila senses immune challenge and reacts to it quickly through the nuclear factor-kB (NF-kB), Relish, a component of the immune deficiency (Imd) pathway. During development, Relish is triggered by ecdysone signaling in the hematopoietic niche to maintain the blood progenitors. Loss of Relish causes an alteration in the cytoskeletal architecture of the niche cells in a Jun Kinase-dependent manner, resulting in the trapping of Hh implicated in progenitor maintenance. Notably, during *For correspondence: infection, downregulation of Relish in the niche tilts the maintenance program toward precocious [email protected] differentiation, thereby bolstering the cellular arm of the immune response. Present address: †York Biomedical Research Institute, Hull York Medical School, University of York, York, United Introduction Kingdom The larval blood-forming organ, the lymph gland, is the site for definitive hematopoiesis in Drosoph- Competing interests: The ila (Banerjee et al., 2019; Evans et al., 2003; Jung et al., 2005; Lanot et al., 2001; Mandal et al., authors declare that no 2004).
    [Show full text]
  • Segmental Duplications and Gene Conversion: Human Luteinizing Hormone/Chorionic Gonadotropin ␤ Gene Cluster
    Downloaded from genome.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Letter Segmental duplications and gene conversion: Human luteinizing hormone/chorionic gonadotropin ␤ gene cluster Pille Hallast, Liina Nagirnaja, Tõnu Margus, and Maris Laan1 Institute of Molecular and Cell Biology, University of Tartu, Riia 23, 51010 Tartu, Estonia Segmental duplicons (>1 kb) of high sequence similarity (>90%) covering >5% of the human genome are characterized by complex sequence variation. Apart from a few well-characterized regions (MHC, ␤-globin), the diversity and linkage disequilibrium (LD) patterns of duplicons and the role of gene conversion in shaping them have been poorly studied. To shed light on these issues, we have re-sequenced the human Luteinizing Hormone/Chorionic Gonadotropin ␤ (LHB/CGB) cluster (19q13.32) of three population samples (Estonians, Mandenka, and Han). The LHB/CGB cluster consists of seven duplicated genes critical in human reproduction. In the LHB/CGB region, high sequence diversity, concentration of gene-conversion acceptor sites, and strong LD colocalize with peripheral genes, whereas central loci are characterized by lower variation, gene-conversion donor activity, and breakdown of LD between close markers. The data highlight an important role of gene conversion in spreading polymorphisms among duplicon copies and generating LD around them. The directionality of gene-conversion events seems to be determined by the localization of a predicted recombination “hotspot” and “warm spot” in the vicinity of the most active acceptor genes at the periphery of the cluster. The data suggest that enriched crossover activity in direct and inverted segmental repeats is in accordance with the formation of palindromic secondary structures promoting double-strand breaks rather than fixed DNA sequence motifs.
    [Show full text]
  • The Ohio Academy of Science 122Nd Annual Meeting
    A-2 THE OHIO JOURNAL OF SCIENCE VOL. 1131 The Ohio Academy of Science Online payment option 122nd Annual Meeting http://ohiosci.org/ index_store.html Hosted by Saturday, April 6: Registration in the center lobby of The University of Findlay 300 Davis Street Building. 300 Davis Street Findlay OH 45840 7:30 AM-2:00 PM. On-site registration at a higher April 6, 2013 rate by check, VISA, or MasterCard. We discourage cash. Theme: Interdisciplinary Teaching and Scholarship in Support of STEMM Education PARKING ON CAMPUS: Watch for signs and see map in program. Please park in lots on the north or ABOUT THE ANNUAL MEETING south side of 300 Davis Street Building, 300 Davis The Ohio Academy of Science’s Annual Meeting is Street, Findlay OH 45840. for academic, governmental, and industry scientists and engineers, university and pre-college educators SMOKING POLICY: Smoking is not permitted in and teachers, and pre-college, undergraduate, and graduate any building. students, and interested lay citizens in the Ohio region. HOUSING: See options: http://www.tripadvisor. Welcome! com/Hotels-g50336-Findlay_Ohio-Hotels.html The University of Findlay welcomes you to the 122nd Annual Meeting of The Ohio Academy of Science. MEALS: Saturday, April 6 We invite you to explore our campus and to share in Lunch tickets for the dining hall may be pre-ordered the excitement and opportunities provided in this with registration for $8.00 each and may be picked up program. at registration table. Lunch can also be purchased at the dining hall the day of the meeting, but at a higher REGISTRATION rate.
    [Show full text]
  • Analysis of the Role of Two Autophagy Pathway Related Genes, Becn1 and Tsc1, in Murine Mammary Gland Development and Differentiation
    University of Kentucky UKnowledge Theses and Dissertations--Biology Biology 2014 ANALYSIS OF THE ROLE OF TWO AUTOPHAGY PATHWAY RELATED GENES, BECN1 AND TSC1, IN MURINE MAMMARY GLAND DEVELOPMENT AND DIFFERENTIATION Amber N. Hale University of Kentukcky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Hale, Amber N., "ANALYSIS OF THE ROLE OF TWO AUTOPHAGY PATHWAY RELATED GENES, BECN1 AND TSC1, IN MURINE MAMMARY GLAND DEVELOPMENT AND DIFFERENTIATION" (2014). Theses and Dissertations--Biology. 18. https://uknowledge.uky.edu/biology_etds/18 This Doctoral Dissertation is brought to you for free and open access by the Biology at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Biology by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • In Mammalian Oocyte and Ovarian Follicle Development
    The function of gametocyte specific factor 1 (GTSF1) in mammalian oocyte and ovarian follicle development By Georgios Liperis Submitted in accordance with the requirements for the degree of Doctor of Philosophy The University of Leeds School of Medicine August, 2013 I confirm that the work submitted is my own and that appropriate credit has been given where reference has been made to the work of others This copy has been supplied on the understanding that it is copyright material and that no quotation from this thesis may be published without proper acknowledgement II ACKNOWLEDGEMENTS I would like to express my special appreciation to Professor Helen Picton for giving me the opportunity to work on such an enthusiastic project and for all the help and support she has provided me over the last 4 years. You have been a tremendous mentor for me. I would like to thank you for all the support and encouragement and for allowing me to grow as a research scientist and as a person. The good advice, support and friendship of my second supervisor, Dr. John Huntriss, has been invaluable and for that I am extremely grateful. This work couldn’t have been completed without the help from several people. Special thanks to Matt Cotterill and Jian-Ping Liu whose help has been invaluable. Also many thanks to the bioinformatics team, David Illes, Lee Hazelwood and Praveen Baskaran. Over the course of the past 4 years, I have been surrounded by many people that have all contributed to the completion of this study and with some of which I have become close friends.
    [Show full text]
  • Role of Hypoxia-Mediated Autophagy in Tumor Cell Death and Survival
    cancers Review Role of Hypoxia-Mediated Autophagy in Tumor Cell Death and Survival Rania F. Zaarour 1 , Bilal Azakir 2, Edries Y. Hajam 3,4, Husam Nawafleh 1, Nagwa A. Zeinelabdin 1, Agnete S.T. Engelsen 5 ,Jérome Thiery 6, Colin Jamora 3 and Salem Chouaib 1,6,* 1 Thumbay Research Institute for Precision Medicine, Gulf Medical University, Ajman 4184, UAE; [email protected] (R.F.Z.); [email protected] (H.N.); [email protected] (N.A.Z.) 2 Faculty of Medicine, Beirut Arab University, Beirut, Lebanon; [email protected] 3 IFOM-inStem Joint Research Laboratory, Institute for Stem Cell Science and Regenerative Medicine (inStem), Bangalore, Karnataka 560065, India; [email protected] (E.Y.H.); [email protected] (C.J.) 4 School of Chemical and Biotechnology (SCBT), Shanmugha Arts, Science, Technology and Research Academy (SASTRA), deemed to be University, Thanjavur 613401, Tamil Nadu, India 5 Department of Biomedicine, Centre for Cancer Biomarkers CCBIO, University of Bergen, 5007 Bergen, Norway; [email protected] 6 INSERM UMR 1186, Integrative Tumor Immunology Immunotherapy, Gustave Roussy, Faculty of Medicine University of Paris-Sud, University of Paris-Saclay, F-94805 Villejuif, France; [email protected] * Correspondence: [email protected] Simple Summary: Autophagy is a self-eating mechanism that is involved in the degradation of organelles and cellular materials. It is initiated by intracellular and extracellular stress stimuli. In the context of tumor development, microenvironmental hypoxic stress regulates autophagy that, in turn, promotes cancer-cell death or cancer-cell survival. Autophagy functions and shares molecular players with other cell-death promoting pathways such as apoptosis.
    [Show full text]
  • Passion. Curiosity. Ingenuity. Resolve. Today, It's All in Focus
    Passion. Curiosity. FROM THE PRESIDENT Ingenuity. Resolve. Today, it’s all in focus. Welcome to the 18th Annual I am so pleased you have joined us for one Capital University of the most celebrated days of our academic year. The Symposium on Undergraduate Scholarship is a point of distinction for our Symposium on learning community – a showcase event that demonstrates ideals that are central to the way Undergraduate Scholarship we teach and learn at Capital University. Wednesday, April 16, 2014 As you scan the titles and abstracts on the pages that follow, you will note the breadth of Capital’s academic offerings and our emphasis on experiential and cross-disciplinary learning. Even more impressive, as you engage with our student presenters and their faculty mentors, Keynote Address by David Pogue, Ph.D. you will experience for yourself their curiosity Thursday, April 10 // 7:00 p.m. and passion for exploring, discovering and Mees Hall communicating about their world. Poster Presentations For 18 years, Capital has embraced Wednesday, April 16 // 11:30 a.m. to 1:30 p.m. undergraduate research as a powerful learning tool. After all, we believe in educating the whole Field House, The Capital Center person. Our classrooms and labs, through research and experience, extend into our Oral Presentations community and our world. Wednesday, April 16 // 2:00 to 4:30 p.m. Battelle Hall, Blackmore Library and Ruff Learning Center Congratulations to those who are presenting their research today. I encourage you to The symposium is funded in part by a gift from Battelle. continue exploring your research area, to ask new questions and test new theories.
    [Show full text]
  • Treading Trails and Telling Tales of Lesbian Mothering
    DESIRE LINES: TREADING TRAILS AND TELLING TALES OF LESBIAN MOTHERING A Thesis Submitted to the Faculty of Graduate Studies and Research In Partial Fulfillment of the Requirements For the Degree of Master of Arts in Women’s and Gender Studies University of Regina By Elizabeth Bailey Regina, Saskatchewan March, 2016 ©2016: E. Bailey UNIVERSITY OF REGINA FACULTY OF GRADUATE STUDIES AND RESEARCH SUPERVISORY AND EXAMINING COMMITTEE Elizabeth Bailey, candidate for the degree of Master of Arts in Women’s and Gender Studies, has presented a thesis titled, Desire Lines: Treading Trails and Telling Tales of Lesbian Mothering, in an oral examination held on March 15, 2016. The following committee members have found the thesis acceptable in form and content, and that the candidate demonstrated satisfactory knowledge of the subject material. External Examiner: *Dr. May Friedman, Ryerson University Supervisor: Dr. Darlene Juschka, Department of Women’s and Gender Studies Committee Member: Dr. James McNinch, Faculty of Education Committee Member: Dr. Charity Marsh, Media, Art and Performance Chair of Defense: Dr. Leesa Streifler, Department of Visual Arts *Via SKYPE ABSTRACT This study highlights the ways in which the marginalization of lesbian families in Canada and the United States is perpetuated by heterobias and exacerbated by the legislation that continues to exclude non-hetero families. As demonstrated in this study, however, this marginalization is actively being countered as lesbian mothers disrupt the hegemonic notions of motherhood and family by seeking to make their voices heard and stories known in the public sphere. The focus on lesbian parented families in this thesis is important and timely in its engagement of the social debate that continues to surround the queer community as a whole.
    [Show full text]