Genetic Mapping of a Third Li-Fraumeni Syndrome Predisposition Locus to Human Chromosome 1Q23

Research Article

Genetic Mapping of a Third Li-Fraumeni Syndrome Predisposition Locus to Human Chromosome 1q23

Linda L. Bachinski,1 Shodimu-Emmanuel Olufemi,1 Xiaojun Zhou,3 Chih-Chieh Wu,3 Linwah Yip,1 Sanjay Shete,3 Guillermina Lozano,1 Christopher I. Amos,3 Louise C. Strong,2 and Ralf Krahe1,4

Sections of 1Cancer Genetics and 2Clinical Cancer Genetics, Department of Molecular Genetics and 3Department of Epidemiology, University of Texas M.D. Anderson Cancer Center, Houston, Texas and 4Human Cancer Genetics Program, Department of Molecular Virology, Immunology and Medical Genetics, Comprehensive Cancer Center, Ohio State University, Columbus, Ohio

Abstract tumors, both alleles are altered—one by inherited mutation, the Li-Fraumeni syndrome (LFS) is a clinically and genetically other by somatic loss of the wild-type allele (10, 11). To date, heterogeneous inherited cancer syndrome. Most cases (f70%) germ line p53 mutations have been identified in approximately identified and characterized to date are associated with 70% to 75% of LFS families fulfilling the classic criteria (12–14). dominantly inherited germ line mutations in the tumor Based on updated information of the types of tumors and the suppressor gene TP53 (p53) in chromosome 17p13.1. In a subset ages of onset in affected families, Birch et al. (12, 15) defined Li- of non-p53 patients with LFS, CHEK2 in chromosome 22q11 Fraumeni–like syndrome (LFL) as a proband with any childhood has been identified as another predisposing locus. Studying a cancer, or a sarcoma, brain tumor, or adrenocortical tumor age series of non-p53 LFS kindred, we have shown that there is <45 years plus a first- or second-degree relative in the same lineage with a typical LFS tumor at any age, and an additional additional genetic heterogeneity in LFS kindred with inherited predisposition at loci other than p53 or CHEK2. Using a genome- first- or second-degree relative in the same lineage with any wide scan for linkage with complementing parametric and cancer age <60 years. Brugieres et al. (16) defined incomplete nonparametric analysis methods, we identified linkage to a LFS (LFI) as any kindred with at least two cases consistent with region of approximately 4 cM in chromosome 1q23, a genomic LFS at any age instead of the minimum of three cases required region not previously implicated in this disease. Identification for classic LFS or LFL. Germ line mutations in p53 have been of a third predisposing gene and its underlying mutation(s) identified in 40% of LFL (12, 17–23) and 6% of LFI (24). Based should provide insight into other genetic events that predispose on segregating germ line mutations, CHEK2 in 22q12.2 was to the genesis of the diverse tumor types associated with LFS recently implicated as a second predisposing LFS locus and a tumor suppressor gene (25). The role of CHEK2 mutations has and its variants. (Cancer Res 2005; 65(2): 427-31) been somewhat controversial due to the presence of related genes on various other chromosomes in the human genome. Introduction However, the 1100delC sequence variant clearly seems to be a Li and Fraumeni (1, 2) reported a rare, familial cancer disease-causing mutation in LFS (17, 18, 25–29). syndrome characterized by autosomal dominant inheritance and early onset of tumors, multiple tumors within an individual, and multiple affected family members (3, 4). In contrast to other Materials and Methods inherited cancer syndromes, which are predominantly character- Subjects. We previously ascertained a large cohort of LFS and LFL kindred ized by site-specific cancers, Li-Fraumeni syndrome (LFS; MIM through systematic surveys of childhood and adolescent patients with 151623) families present with a variety of tumor types. The most sarcoma (9, 30, 31). In several of these LFS kindred direct sequencing of all common types are soft tissue sarcomas (STS) and osteosarcomas coding exons and splice junctions and Southern blot analysis revealed no (OST), breast cancer, brain tumors, leukemia, and adrenocortical mutations or deletions in p53 (32). Linkage analysis with microsatellite carcinoma. Other less frequent tumors include melanoma and markers within and flanking p53 also showed no evidence for linkage (32). carcinomas of the lung, pancreas, cervix, and prostate (2). Subsequent mutation analysis excluded the most common CHEK2 mutation Classic LFS is defined as a proband with a sarcoma before the (1100delC; data not shown). Together these data provide significant evidence age of 45 years and a first-degree relative age <45 years with any for high-risk LFS families with a clinical phenotype similar to that of classic cancer and one additional first- or second-degree relative in the LFS with no detectable p53 or CHEK2 germ line mutations, hereafter collectively referred to as non-p53 LFS. Based on the phenotypic similarities same lineage with any cancer age <45 years or a sarcoma at any between p53 and non-p53 LFS kindred, we hypothesize that the inherited age (1, 3). susceptibility in these kindreds is the result of a highly penetrant, dominantly The inheritance of a single mutant p53 allele results in acting tumor suppressor gene. predisposition to tumor development with high penetrance, and Genotyping and Analysis. To map this predisposition locus, we p53 germ line mutation carriers have a dramatically elevated carried out a genome-wide scan for linkage initially focused on four cancer risk relative to non–mutation carriers (5–9). In most extended, non-p53 LFS pedigrees (STS1, STS2, STS3, and OST1) shown in Fig. 1, with a total of 62 constitutive DNA samples. In power simulations (33), these kindreds were found most likely to provide the highest LOD scores in parametric linkage analysis. We did a genome-wide scan for linkage with 400 highly polymorphic microsatellite markers [Linkage Requests for reprints: Ralf Krahe, Section of Cancer Genetics, Unit 11, Mapping Set Version 2 (LMSv2), ABI, Foster City, CA] at an average Department of Molecular Genetics, University of Texas M.D. Anderson Cancer resolution of f10 cM (62 samples Â 400 markers = f25,000 genotypes). Center, 1515 Holcombe Boulevard, Houston, TX 77030-4009. Phone: 713-792-2071; Fax: 713-792-8382; E-mail: [email protected]. For linkage analysis, we used a combination of parametric (two-point I2005 American Association for Cancer Research. and multipoint) and nonparametric linkage analyses, done using www.aacrjournals.org 427 Cancer Res 2005; 65: (2). January 15, 2005

Figure 1. Pedigrees of four non-p53 Li-Fraumeni syndrome kindred included in the genome-wide scan for linkage. Males are represented by squares and females by circles. Filled symbols are considered affected. A slash through a symbol indicates the person is deceased.

LINKAGE/FASTLINK (34), GENEHUNTER (35, 36), SIMPLE (37), VITESSE Table 1. Twenty liability classes and penetrances for (38), and SIMWALK2 (39, 40). Linkage analysis was conducted assuming the genetic model defined by Lustbader et al. (31) in which individuals unaffected and affected individuals derived from Lust- from 159 families ascertained through early-onset soft tissue sarcomas bader et al. (31) used for linkage analyses and simulation were classified into 10 age-, sex-, and cohort-specific groups according to studies similarity in population-based risks. Segregation analysis of these families provided estimates of the cumulative risks for all cancers. We applied the Liability Penetrance approach first suggested by Margaritte et al. (41) in which interval- and classes genotype-specific probabilities were assigned to individuals who devel- Gg (noncarriers) Gg (carriers) GG (carriers) oped cancers, and genotype-specific disease free probabilities were used for noncarriers (Table 1). This approach to analysis gave highest weight Unaffected to early-onset cancers and very little weight to late-onset cancers. 1 0.00000 0.00008 0.00008 2 0.00003 0.00365 0.00365 Results 3 0.00009 0.01159 0.01159 4 0.00107 0.12432 0.12432 Consistent with the previous exclusion of p53 (32), the 17p13.1 5 0.00334 0.30821 0.30821 region containing p53 showed no evidence of linkage. Moreover, no 6 0.00770 0.50764 0.50764 linkage to the 22q12.1 region containing CHEK2 was observed. No 7 0.01692 0.69568 0.69568 evidence of suggestive linkage to any of the other previously 8 0.03741 0.83772 0.83772 considered and excluded LFS candidate genes was seen, namely, 9 0.07987 0.92019 0.92019 MDM2/HDM2 in 12q15, PTEN in 10q23.3, CDKN2A in 9p21.3, BCL2 10 0.15778 0.96136 0.96136 in 18q21.3, TP73L (p63) in 3q28, CHEK1 in 11q24.2, and TP73 in Affected 1p36.32. 11 0.00000 0.00008 0.00008 Initially, the highest genome-wide LOD scores providing 12 0.00003 0.00357 0.00365 evidence for suggestive linkage were obtained by two-point 13 0.00009 0.00794 0.01159 linkage analysis for marker D1S196 at 169.40 cM (LOD = 1.81 at 14 0.00107 0.11273 0.12432 u = 0.02, HomogLOD = 2.04). Examination of kindred-specific 15 0.00334 0.18389 0.30821 LOD scores indicated that both STS1 and STS3 contributed 16 0.00770 0.19943 0.50764 positively (with STS3 providing the strongest evidence for 17 0.01692 0.18804 0.69568 linkage), whereas STS2 contributed little, and OST1 contributed 18 0.03741 0.14204 0.83772 negatively to the overall LOD score. Multipoint linkage analysis 19 0.07987 0.08247 0.92019 provided further evidence for suggestive linkage with the highest 20 0.15778 0.04117 0.96136 LOD scores approaching 3.00 in the region between D1S484/

Cancer Res 2005; 65: (2). January 15, 2005 428 www.aacrjournals.org

Figure 2. Graph showing separate and combined results of SIMWALK2 multipoint analysis for all four non-p53 LFS kindred on whom the genome- wide scan for linkage was done. Chromosome 1 gave the highest results; shown are the results for 54 markers in the analysis. The LOD score for kindred STS3 shows a significant peak value of 3.455 at 155 cM from pter (in 1q23). This strong positive signal is also seen in the total and heterogeneity LOD (H-LOD) scores. Kindred OST1 seems to exclude chromosome 1 over most of its length. Most of the remainder of the chromosome is excluded.

Figure 3. SIMWALK2 LOD scores for all 400 microsatellite markers across the genome. X axis, cM on the deCODE map; Y axis, LOD scores. Each family is represented by a separate graph. www.aacrjournals.org 429 Cancer Res 2005; 65: (2). January 15, 2005

157.51 cM and D1S413/194.98 cM in 1q23.3-q32.1 with STS1 and STS3 again making the largest contributions. Using additional markers in the 1q candidate region, we confirmed the initial linkage results and obtained definitive evidence for linkage with multipoint LOD scores >3.00 between D1S2635/154.28 cM and D1S1677/161.50 cM (HomogLOD = 2.42; SIMWALK2, H-LOD = 3.57). The same region seemed to be excluded in OST1 with LOD scores VÀ2.00 throughout, indicating possible additional genetic heterogeneity. The results of the SIMWALK2 analysis for chromosome 1 are shown in Fig. 2. SIMWALK2 LOD scores across the entire genome are shown for each family separately in Fig. 3. Consistent with linkage, affected patients from the linked kindreds (STS1 and STS3) showed excess marker and haplotype Figure 4. Alleles on disease-associated chromosomes of six affected sharing for the candidate region. Whereas kindred STS1 showed individuals and four obligate carriers in family STS3 are shown. The nucleotide a LOD score >2.0, this was much less than the maximum locations of the microsatellites genotyped are from the July 2003 genome build. Tumor types for each affected individual and age at diagnosis (where expected by simulation (ELODmax = 4.967). Therefore, for known) are indicated: RMS, rhabdomyosarcoma; NHL, non-Hodgkin’s purposes of defining the critical region, we elected to make lymphoma; BL, bladder; WT, Wilms’ tumor; IBD, identical by descent. Obligate the conservative assumption that this peak might represent a carriers are identified. Inferred alleles are indicated in parentheses. false-positive result in this family. Based on a region shared identical-by-descent in affected individuals of kindred STS3, which had a significant positive LOD score, the critical region markers were included in the haplotype analysis and 54 were was initially found to be located between D1S2635/152.9cM and used for the linkage analysis. Primer sequences for novel D1S1677/161.50 cM, an interval of f8.6 cM contained within a markers are provided in Table 2. 4.6-Mb region. Further fine mapping of the critical region was significantly aided by the recent completion of the human Discussion genome draft sequence (42) and subsequent completion of the The existence of familial predisposition to cancer has been finished sequence. By using additional microsatellite markers instrumental in the mapping and subsequent cloning of several from the region, both known and novel, we identified tumor suppressor genes, such as BRCA1 (43) and BRCA2 (44). informative cross-overs in affected members of pedigree STS3, The identification of high-penetrance inherited cancer genes in, which provided the strongest evidence for linkage, and further for example, breast cancer or colorectal cancer, has provided narrowed the critical region to less than 1.88 Mb. On the considerable fundamental and unexpected insights into many centromeric side, individual III:4 has a cross-over between intron aspects of cancer biology (45–47). LFS, as a childhood cancer, is a 1ofKCNJ10 and marker D1S2771. On the telomeric side, unique model system to study the underlying genetic events individual IV:1 has a cross-over between a (GT)n repeat located associated with a complex cancer syndrome, presumably because in NR1I3 and a (GT)n repeat located in intron 1 of ATF6. Alleles fewer somatic alterations are needed to give rise to the associated seen for microsatellite markers on the affected chromosomes in cancers. Successful mapping of a novel LFS predisposition locus in the critical region are shown in Fig. 4. For reasons of space and 1q23 and, subsequently, the identification and characterization of readability, it is impractical to display the entire pedigree with the gene and its mutation(s) will be significant in several respects. all alleles and haplotypes. However, a total of 73 microsatellite First, it will immediately benefit affected patients and their

Table 2. Primer sequences for custom markers

c Marker Forward primer sequence* Reverse primer sequence

KCNJ9-e1_CA CAGATGGAGGTTAACTTGGCAATGG CTTATTTCTTTCAGTGTGTAGGGAC KCNJ9-i1_GT CCTTCAAGACAGATAGGTGAGAAG CTGGGTGGAGAGAAGAGGTGTTC KCNJ10_i1_GT GAGACTAATGAGAGCCTTCACCAC GAATGGGTAGTTTCTGCTATTCTCTG RhoGap_i5_TC GCATACAATTTAAGAGGTAGAGAAGGG CTCAGCCCCACCAAACTTCCCAATC ADAMTS4_CA GGGTCCCTCCCTACCCACTTTTC CTCTGCTCCAGGTGTAGACATAC NR1I3_GT GACAGAGTGACAGACTCCATCTC GAAACAACCCCAGGATAGGCAGG ATF6_i1_GT GTTATAGCAATCCCCATGAGTTAC CATGCAAGAGTTCTTTGCACTGT

NOTE: PCR was carried out using 3 primers; a forward primer containing a 5V universal tail, a reverse primer containing the 5V pigtail sequence, and a Universal primer with the sequence GGGACACCGCTGATCGTTTA. Reaction conditions are described in Bachinski et al. (48). *Each forward primer was designed with a Universal tail at its 5V end, having the sequence GACGGGACACCGCTGATCGTTTA. cEach reverse primer contains a pigtail sequence (GTTTCTT) at its 5V end to facilitate nontemplated polyadenylation of the PCR product.

Cancer Res 2005; 65: (2). January 15, 2005 430 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. A Third Li-Fraumeni Syndrome Locus families, if so desired, by providing the means for DNA-based Acknowledgments genetic testing either for linkage or for specific mutations (once the Received 10/14/2004; accepted 11/11/2004. actual gene has been identified). Second, identification of the Grant support: National Cancer Institute grants P01 CA34936 and in part P30 mutated gene and determination of its mutational spectrum will CA16058 and the Kleberg Foundation. The costs of publication of this article were defrayed in part by the payment of provide the basis to determine phenotype/genotype correlations to page charges. This article must therefore be hereby marked advertisement in explain the highly variable clinical phenotype seen in the affected accordance with 18 U.S.C. Section 1734 solely to indicate this fact. LFS kindred. Given the importance of p53 in cancer in general, one We thank the participating families for their cooperation. R. Krahe thanks N.Z. Moore and T. Ahmed and M. Holloway, A. Bonner, and the Human Cancer Genetics possibility is that non-p53 LFS genes are also involved in the Program Genotyping-Sequencing Unit (Ohio State University) for technical assistance genesis of common cancers. with genotyping in the early stages of this study.

germ line p53 mutations in children with malignant 33. Weeks DE, Ott J, Lathrop GM. SLINK: a general References tumors and a family history of cancer. Cancer Res simulation program for linkage analysis. Am J Hum 1. Li FP, Fraumeni JF Jr. Rhabdomyosarcoma in children: 1993;53:452–5. Genet 1990;47:A204. epidemiologic study and identification of a familial 17. Varley J. TP53, hChk2, and the Li-Fraumeni syn- 34. Cottingham RWJ, Idury RM, Schaffer AA. Faster cancer syndrome. J Natl Cancer Inst 1969;43:1365–73. drome. Methods Mol Biol 2003;222:117–29. sequential genetic linkage computations. Am J Hum 2. Li FP, Fraumeni JF Jr. Soft-tissue sarcomas, breast 18. Varley J, Haber DA. Familial breast cancer and the Genet 1993;53:252–63. cancer, and other neoplasms. A familial syndrome? Ann hCHK2 1100delC mutation: assessing cancer risk. 35. Kruglyak L, Lander ES. Faster multipoint linkage Intern Med 1969;71:747–52. Breast Cancer Res 2003;5:123–5. analysis using Fourier transforms. J Comput Biol 3. Li FP, Fraumeni JF Jr, Mulvihill JJ, et al. A cancer family 19. Lalloo F, Varley J, Ellis D, et al. Prediction of 1998;5:1–7. syndrome in twenty-four kindreds. Cancer Res 1988;48: pathogenic mutations in patients with early-onset 36. Kruglyak L, Daly MJ, Reeve-Daly MP, Lander ES. 5358–62. breast cancer by family history. Lancet 2003;361:1101–2. Parametric and nonparametric linkage analysis: a 4. Hisada M, Garber JE, Fung CY, Fraumeni JF Jr, Li FP. 20. Varley JM. Germline TP53 mutations and Li- unified multipoint approach. Am J Hum Genet Multiple primary cancers in families with Li-Fraumeni Fraumenisyndrome. Hum Mutat 2003;21:313–20. 1996;58:1347–63. syndrome. J Natl Cancer Inst 1998;90:606–11. 21. Varley JM, McGown G, Thorncroft M, et al. Germ-line 37. Irwin M, Cox N, Kong A. Sequential imputation for 5. Malkin D, Jolly KW, Barbier N, et al. Germline mutations of TP53 in Li-Fraumeni families: an extended multilocus linkage analysis. Proc Natl Acad Sci U S A mutations of the p53 tumor-suppressor gene in children study of 39 families. Cancer Res 1997;57:3245–52. 1994;91:11684–8. and young adults with second malignant neoplasms. 22. Varley JM, McGown G, Thorncroft M, et al. A 38. O’Connell JR, Weeks DE. The VITESSE algorithm for N Engl J Med 1992;326:1309–15. previously undescribed mutation within the tetramer- rapid exact multilocus linkage analysis via genotype set- recording and fuzzy inheritance. Nat Genet 1995;11: 6. Birch JM. Li-Fraumeni syndrome. Eur J Cancer isation domain of TP53 in a family with Li-Fraumeni 402–8. 1994;30A:1935–41. syndrome. Oncogene 1996;12:2437–42. 23. Varley JM, Evans DG, Birch JM. Li-Fraumeni syn- 39. Weeks DE, Sobel E, O’Connell JR, Lange K. Computer 7. Malkin D. Chapter 20: Li-Fraumeni Syndrome. In: drome—a molecular and clinical review. Br J Cancer programs for multilocus haplotyping of general pedi- Vogelstein B, Kinzler KW, editors. The genetic basis of 1997;76:1–14. grees. Am J Hum Genet 1995;56:1506–7. cancer. New York (NY): McGraw-Hill; 1998. p. 393–407. 24. Chompret A, Brugieres L, Ronsin M, et al. P53 40. Sobel E, Lange K. Descent graphs in pedigree 8. Malkin D, Li FP, Strong LC, et al. Germ line p53 mu- germline mutations in childhood cancers and cancer analysis: applications to haplotyping, location scores, tations in a familial syndrome of breast cancer, sar- risk for carrier individuals. Br J Cancer 2000;82:1932–7. and marker-sharing statistics. Am J Hum Genet comas, and other neoplasms. Science 1990;250:1233–8. 25. Bell DW, Varley JM, Szydlo TE, et al. Heterozygous 1996;58:1323–37. 9. Hwang SJ, Lozano G, Amos CI, Strong LC. Germline germ line hCHK2 mutations in Li-Fraumeni syndrome. 41. Margaritte P, Bonaiti-Pellie C, King MC, Clerget- p53 mutations in a cohort with childhood sarcoma: Science 1999;286:2528–31. Darpoux F. Linkage of familial breast cancer to sex differences in cancer risk. Am J Hum Genet 26. Vahteristo P,Tamminen A, Karvinen P,et al. p53, Chk2, chromosome 17q21 may not be restricted to early- 2003;72:975–83. and chk1 genes in Finnish families with Li-Fraumeni onset disease. Am J Hum Genet 1992;50:1231–4. 10. Soussi T. The p53 tumor suppressor gene: from syndrome: further evidence of chk2 in inherited cancer 42. Lander ES, Linton LM, Birren B, et al. Initial molecular biology to clinical investigation. Ann N Y predisposition. Cancer Res 2001;61:5718–22. sequencing and analysis of the human genome. Nature Acad Sci 2000;910:121–37; discussion 37–9. 27. Lee SB, Kim SH, Bell DW, et al. Destabilization of 2001;409:860–921. 11. Olivier M, Eeles R, Hollstein M, Khan MA, Harris CC, CHK2 by a missense mutation associated with Li- 43. Miki Y, Swensen J, Shattuck-Eidens D, et al. A strong Hainaut P. The IARC TP53 database: new online Fraumeni syndrome. Cancer Res 2001;61:8062–7. candidate for the breast and ovarian cancer suscepti- mutation analysis and recommendations to users. 28. Miller CW, Ikezoe T, Krug U, et al. Mutations of the bility gene BRCA1. Science 1994;266:66–71. Hum Mutat 2002;19:607–14. CHK2 gene are found in some osteosarcomas, but are 44. Wooster R, Bignell G, Lancaster J, et al. Identification 12. Birch JM, Hartley AL, Tricker KJ, et al. Prevalence and rare in breast, lung, and ovarian tumors. Genes of the breast cancer susceptibility gene BRCA2. Nature diversity of constitutional mutations in the p53 gene Chromosomes Cancer 2002;33:17–21. 1995;378:789–92. among 21 Li-Fraumeni families. Cancer Res 1994;54: 29. Vahteristo P, Bartkova J, Eerola H, et al. A CHEK2 45. Balmain A, Gray J, Ponder B. The genetics and 1298–304. genetic variant contributing to a substantial fraction genomics of cancer. Nat Genet 2003;33 Suppl:238–44. 13. Frebourg T, Barbier N, Yan YX, et al. Germ-line p53 of familial breast cancer. Am J Hum Genet 2002;71: 46. Fearon ER. Human cancer syndromes: clues to mutations in 15 families with Li-Fraumeni syndrome. 432–8. the origin and nature of cancer. Science 1997;278: Am J Hum Genet 1995;56:608–15. 30. Strong LC, Stine M, Norsted TL. Cancer in survivors 1043–50. 14. MacGeoch C, Turner G, Bobrow LG, Barnes DM, of childhood soft tissue sarcoma and their relatives. 47. Fearon ER. Cancer 11: Tumor suppressor genes. In: Bishop DT, Spurr NK. Heterogeneity in Li-Fraumeni J Natl Cancer Inst 1987;79:1213–20. Vogelstein B, Kinzler KW, editors. The genetic basis of families: p53 mutation analysis and immunohistochem- 31. Lustbader ED, Williams WR, Bondy ML, Strom S, cancer. New York (NY): McGraw-Hill; 1998. p. 229–36. ical staining. J Med Genet 1995;32:186–90. Strong LC. Segregation analysis of cancer in families of 48. Bachinski LL, Udd B, Meola G, et al. Confirmation of 15. Birch JM, Heighway J, Teare MD, et al. Linkage childhood soft-tissue-sarcoma patients. Am J Hum the type 2 myotonic dystrophy (CCTG)n expansion studies in a Li-Fraumeni family with increased Genet 1992;51:344–56. mutation in patients with proximal myotonic myopa- expression of p53 protein but no germline mutation 32. Evans SC, Mims B, McMasters KM, et al. Exclusion of thy/proximal myotonic dystrophy of different European in p53. Br J Cancer 1994;70:1176–81. a p53 germline mutation in a classic Li-Fraumeni origins: a single shared haplotype indicates an ancestral 16. Brugieres L, Gardes M, Moutou C, et al. Screening for syndrome family. Hum Genet 1998;102:681–6. founder effect. Am J Hum Genet 2003;4:835–48.

www.aacrjournals.org 431 Cancer Res 2005; 65: (2). January 15, 2005

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. Genetic Mapping of a Third Li-Fraumeni Syndrome Predisposition Locus to Human Chromosome 1q23

Linda L. Bachinski, Shodimu-Emmanuel Olufemi, Xiaojun Zhou, et al.

Cancer Res 2005;65:427-431.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/65/2/427

Cited articles This article cites 41 articles, 11 of which you can access for free at: http://cancerres.aacrjournals.org/content/65/2/427.full#ref-list-1

Citing articles This article has been cited by 6 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/65/2/427.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/65/2/427. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.