And Two Pseudogenes (Adenylyl Cyclase/Guanine Nucleotide-Binding Protein-Coupled Receptor/Gene Amplification/Termination Codon/Transient Expression) DAVID K

Proc. Natl. Acad. Sci. USA Vol. 88, pp. 9175-9179, October 1991 Physiology/Pharmacology Multiple human D5 dopamine receptor genes: A functional receptor and two pseudogenes (adenylyl cyclase/guanine nucleotide-binding protein-coupled receptor/gene amplification/termination codon/transient expression) DAVID K. GRANDY*, YUAN ZHANG*, CLAUDIA BOUVIER*, QUN-YONG ZHOU*t, ROBERT A. JOHNSON*, LEE ALLEN*, KARi BUCK*§, JAMES R. BUNZOW*, JOHN SALON*, AND OLIVIER CIVELLI*1¶I *Volium Institute for Advanced Biomedical Research, and Departments of tBiochemistry and Molecular Biology, tMedical Genetics, WMedical Psychology, and lCell Biology and Anatomy, Oregon Health Sciences University, 3181 S.W. Sam Jackson Park Road, Portland, OR 97201 Communicated by Avram Goldstein, July 15, 1991 (receivedfor review May 17, 1991)

ABSTRACT Three genes closely related to the DI dopa- human genomic DNA was prepared from leukocytes (16) and mine receptor were identified in the human genome. One ofthe 5 ,ug was digested with EcoRI and electrophoresed in a 0.7% genes lacks introns and encodes a functional human dopamine agarose gel. The 5- to 6-kilobase (kb) region was excised and receptor, Ds, whose deduced amino acid sequence is 49% the DNA was purified using GeneClean (Bio 101, La Jolla, identical to that of the human D1 receptor. Compared with the CA), ligated to AgtlO arms (Stratagene), and packaged in vitro human D, dopamine receptor, the Ds receptor displayed a using Gigapack packaging extracts (Stratagene). The library higher affinity for dopamine and was able to stimulate a was replicated on duplicate nylon filters (DuPont/NEN) and biphasic rather than a monophasic intracellular accumulation probed with a nick-translated 3-kb genomic EcoRI-Sac I of cAMP. Neither of the other two genes was able to direct the fragment containing the coding region of the human D1 synthesis of a receptor. Nucleotide sequence analysis revealed dopamine receptor (9). The reported nucleic acid sequences that these two genes are 98% identical to each other and 95% were determined in both orientations (Sequenase, United identical to the Ds sequence. Relative to the Ds sequence, both States Biochemical). Sequence analysis was aided by Intel- contain insertions and deletions that result in several in-frame ligenetics and Genetics Computer Group software. RNA was termination codons. Premature termination of translation is prepared by the guanidinium isothiocyanate method and the most likely explanation for the failure of these genes to analyzed as described (1). High molecular weight human and produce receptors in COS-7 and 293 cells even though their rat genomic DNA was Southern blotted to nitrocellulose messages are transcribed. We conclude that the two are (Schleicher & Schuell) as described (17). pseudogenes. Blot hybridization experiments performed on rat Polymerase Chain Reaction (PCR) and Expression Cloning. genomic DNA suggest that there is one D5 gene in this species Twenty-five cycles of PCR (strand separation for 1 min at and that the pseudogenes may be the result ofa relatively recent 95°C, annealing for 2 min at 55°C, and extension for 3 min at evolutionary event. 72°C) were performed in a Coy Tempcycler using 1 unit of Replinase (NEN), 1 ng oftemplate DNA, and 50 pmol ofeach The dopamine receptors are integral membrane proteins that synthetic oligodeoxynucleotide primer (5'-CCGAAT- interact with guanine nucleotide-binding proteins (G pro- TCGCCTTCGACATCATGTGC-3' and 5'-CCGGATCCGT- teins) to transduce dopamine stimulation into intracellular CACGATCATGATGGC-3'). The PCR product was gel- responses. The majority of dopamine receptors are concen- purified, digested, ligated into M13 phage, and sequenced. trated in the mesocortico-mesolimbic, nigrostriatal, and tu- For expression studies, DNAs were synthesized by PCR beroinfundibular pathways. These neuronal circuits are from HGRI-4, -6, and -8 templates with the primers 5'- known to influence mood, behavior, initiation of movement, CCGTCGACGATCGCGCACAAACCGAC-3' and 5'- and prolactin secretion. Prior to the cloning of the rat D2 CCGTCGACAGTACTGGAAAGGCATGTAT-3'. The dopamine receptor gene (1) only D1 and D2 receptors were 1.56-kb products were cloned into the transient expression generally acknowledged to account for the diverse physio- vector pBC12BI (18). logical effects of dopamine (2-4), although some pharmaco- Expression and Pharmacological Evaluation. A modified logical evidence was inconsistent with this view (5). calcium phosphate method (19) was used for the transfection With nucleic acid probes based on the sequence of the of COS-7 and 293 cells. Forty-eight hours after transfection, cloned rat D2 receptor gene it was quickly revealed that at COS-7 cells were harvested as described (9). Binding assays least four dopamine receptor genes exist in humans and rats were performed in duplicate and competition curves in trip- (6-15). Based on their genomic organization these genes can licate. Reaction mixtures contained 50 mM Tris buffer (pH be divided into two types: those with (D2, D3, and D4) and 7.4), 0.9% NaCl, 0.025% ascorbic acid, 0.001% bovine serum those without (D1) introns in their coding regions. During a albumin, and various concentrations of [3H]SCH23390 (Am- structural analysis of the human D1 dopamine receptor gene ersham, 69 Ci/mmol; 1 Ci = 37 GBq). Membranes (5-50 ,ug) we obtained evidence that the human genome contains a and [3H]SCH23390 (0.7-1.0 nM) were combined with various sequence that is similar but not identical to the D1 gene. To concentrations of unlabeled drugs at 37°C for 1 hr. Nonspe- determine whether or not this sequence encoded a dopamine cific binding was defined in the presence of 5 ,uM (+)- receptor, we undertook its cloning and characterization.** butaclamol. Samples were filtered through glass-fiber filters (Schleicher & Schuell, no. 32) and the retained material was MATERIALS AND METHODS washed three times with 4 ml of ice-cold 50 mM Tris buffer to scintillation counting (Packard Genomic Library Screening, DNA Sequencing, and DNA (pH 7.4) prior liquid and RNA Blot Hybridization Analysis. High molecular weight Abbreviations: G protein, guanine nucleotide-binding protein; G,, stimulatory G protein; TMD, transmembrane domain. The publication costs of this article were defrayed in part by page charge IlTo whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" **The sequences reported in this paper have been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. -GenBank data base (accession nos. M67439-M67441).

9175 9176 Physiology/Pharmacology: Grandy et al. Proc. Natl. Acad. Sci. USA 88 (1991)

CCCGGCCCACCCCACGGTCAGC GOS: GGGGCTCGAGGGTCCCTTGGCTGAG GGGGCGCATCCTC GGGGSTGCCCGATzGGGGCTGCCTGGGGGTCGCA",GGC TGAAG- T -3 I-';A-CG'G";CAC dA^UCCfAC^C c x CA',-;TfC-CAGC "' -, '..?

MET Leu Pro Pro Gly Ser Asn Gly Thr Ala Tyr Pro Gly Gin Phe Ala Leu Tyr GCo Gin. Leu Ala Gin Gly Asn Ala Val Giy GCy Ser hD5 ATG CTG CCG CCA GGC AGC AAC GGC ACC GCC TAC CCC GGG CAG TTC CCT CTA TAC GAG GA.G'-C! CCC CG CAG CCC AAC GCC CCC GC GGCC O hDSTW 1 A G A G hD5T2 A G A C C Ala Gly Ala Pro Pro Leu Gly Pro Ser Gln Val Val Thr Ala Cx's Leu Leu Thr Leo Leu Ile Ile Trp Thr Leu Leu Gly Asn Val Leo hD5 GCG GGG CCA CCG CCA CTG SGG CCC TCA CAG GTG GTC ACC GCC TGC CTG CTG ACC CCA C';'C ACc ATC TGC ACC CTC CTC GCC AAC GCT C"'C hD5%j CTG GTG .~~~~~~~~~~~~~9C ValC1 s Ala Ala Ile Val Arg Ser Arg His Leu Arg Ala Asn MET Thr Asn aiPhe Val Set Leu Ala Vai Ser Asp Leu Phe Va1 hD5 GTG TGC GCA GCC ATC GTG CGG AGC CGC CAC CTG CGC CCC AAC ATG ACC AAC GTC CTC ATC GCCC TCC CTG GCC CTC TCT GAC CCC TC G hD59'1 A C G _ A C 2 1 hD5T2 C G A Alaa uLe Leo-Val MET Pro Trp Lys. Aia:ValAl-a- Gin- Val AlaGly Tyr Trp Pro Phe Illy A-l The Cys Asp Val Trp Val Ala Phe Asp hD, GCG CTC CTG GTC ATG CCC TGG AAG CCA GTC GCC GAG GTG GCC GGT TAC TGG CCC TCC GGA GICG TC 7GC_ GAC CTC CGC GTG GCC TTC AC T A A Ilie MET Cy's Ser Thr :Ala Ser lie ~Leo Asn Leo Cys Val. Ile Ser al Asp Arg Tyr Crv Ala lie Ser Arc Pro PlTe Arg Tyr Lys Arg hD5 ATC ATG TGC TCC ACT GCC TCC ATC CTG AAC CTG TGC GTC ATC AGC GTG GAC CGC TAC TGU CCC ATC ICC AGCC CCC TTC CCC TAC AACS CGC hD,4% C G~CACG(TCA C h ° 5M2 C GCAGGTCA C v__ IV Lys MET Thr Gin Arg ME T 2 Leu Vai1JNE VallAMAIaYLam :Ti Leo Ser Ile Leu Ile Ser Phe lie: Pro Vel Gin LeunArn TrP hD5 AAG AWG32T CAG CGC ATG GCC TTG GTC ATG CTC GGC CTG GCA TGG ACC TTG TCC ATC CTC ACC TCC TTC ACT CCG CTC CAC CTC AAC TGG hD5'Fl C C C hDSMy2 C C C C C c : ..

His Arg Asp Gln Ala Ala Ser Trp Gly Gly Leu Asp Leu Pro Asn Asn Len Ala Asn .1 rp iihr ProC rp GCu Glu Aso Phe Tr GClu P hD, CAC AGC GAC CAG GCG GCC TCT TGG GGC GGG CTG GAC CTG CCA AAC AAC CCG CCC AAC TG ACC"CCC CCC GAG GAG CAC CCCT TGC GCAG hD5T, T A ho5T2 A V Asp Val Asn Ala Glu Asn Cys Asp Ser Ser Leo Asn Arg Thr a.Ear Ser Ser Ieo Ile Ser P2e TYr Ile Pro VaLA1k1a 1Ie hD, GAC GTG AAT GCA GAG AAC TCT GAC TCC A=C CTG AAT CGA ACC TAC GCC ATC TCT TCC TCG CCC ATC AGC CCC TAC ATC CCC GTT GoC ATC A A r- -7 2 f hCD,'!2D5%1 GCCG AG

MET 1le Val Thr Tyr CTr Arg lie Tyr Arg Ile Ala Gln Val Gln Iie Arg Arc Lie Sex SceILe Gu Ar-g Ala Ala GI 1His Ala G hD5 ATG ATC GTG ACC TAC ACG CGC ATC TAC CGC ATC GCC CAG GTG CAG ATC CGC AGC ACC C- TCC CCG GAG ACC CCC CCA GAG CAC GC CA^ hD~S. T LxsLs

Ser Cys Arg Ser Ser Ala Ala Cys Ala Pro Asp Thr Ser Leu Arg Ala Ser Iie Cl:; Thr Lys Val Leo Lys[Thr Leu Ser Val hD5 ACC TGC CGG AGC AGC GCA CCC TGC GCC CCC GAC ACC AGC CTG CCC GCT TCC ATC AAC AAC GAG ACC AC- GCC CTC AACG ACC CTC TCG GTCC hD51F, G A G TT *- r0

ID54`2 G G TT Ivv I le.:ET :; ly._Val- Phe -Va l-C'. C ys Trp Leu Pro :Phe Phe I le Leo Asn Cys -MET Vai1 P0roi Phio Cxys Ser Cixy His Pro -Gu GCy P r :rtr hD, ATC ATC GGG CTC TTC GTG TGT TGC TGG CTG CCC TTC TTC ATC CTT AAC TCC ATCG CT CC-'C! CCC cC. AGC CCA CAC CCC C_CAA CCC C hD,5, A.A'ttttt_<^Q7:.^ \3,.. 4h DSF2 Vil Ala Gly Phe Pro Cys Val Ser Gul[Thr CTh Phie. -AsP Val, Phe Val Trp Phe CIV Trp Ala Asn Se r *Ser Leu Asn Pro Val Ile Tyr Ala hDS GCC GGC TTC CCC TGC GCC AGT GAG ACC ACC TTC GAC GTC TTC GTC TGG TTC GGCC CCC CCC C CCC CA CTC AAC CCC GC ACC AT CD5 CC C A T A C A A C

V s n I:SE. Ser r Pro Val G: 1 u .; Vai Aso InS? Phe Asn Ala Asp Phe Gin Lys Val Phe Ala Gln Leu Leu GCy Cys Ser His Phe Cys Arc 71 hDs TTC AAC GCC GAC TTT CAG AAG GTG TCT GCC CAG CTG CC GGCC TGC AGC GAG CCC TCC 'CC CC CCC GAG ACCI GTG .PA,' hTi AC;; hoDS! C TG C hD54!2 G Asn Gli Leo lie Ser Cyr Asn alm Asp lie Val Phe H.is Lys GiU lie Ala Ala Ala2vr C AC E'ICC MEIC"' ro. Asr. A.l.a. Val C. Pr hD5 AAT GAG CCC ATC TCC TAC AAC CAA GAC ATC GTC TTC CAC AAG GAA ATC GCA CCC GCC TAC A''C "'A" AlC ACG CCC AAC CCC CC AC'T G G hDST2 CG CGly Asn Arg Glu Val Asp Asn Asp Glu Glu Glu Gly Pro Phe Asp Arg ME' PlIleC_ n Thr Ser -c Asp AlAso: Proar. ho5 GGC AAC CGG GAG GTG GAC AAC GAC GAG GAG §A GGC CCC CCC GAT CGC AATC Ti'.' AG ACG G.CCC';R AGA GAG CC C ho5!'CT C AA C A A: hD5o2 G G T AGG A Ala Glu Ser Val Trp Glu Leo Asp Cys Glu Gly GiL 'le Ser Leo Asp Lys 'leTt-rPrc Asn t H: ho, GCT GAG TCT GTC TCC GAG CTG GAC TGC GAG GGG GAG ACT CCC TTA GAC AlA A A ACA C_-T --. A'; '-A`7Si t I 5OD A Ai' ho,5'2 A A C AAGAAACCCCCATGGATCCTGCATAACCAGACAGACTGACAAGCACGCACAACAGC.AGCTA''ACTC7G'-W.--.C'C'CA;-'

FIG. 1. Nucleotide and deduced amino acid sequences of the human D5 receptor gene, hD5 (HGRI-4), and the two pseudogenes, hDs5* (HGRI-6) and hD5st (HGRI-8). Only the nucleotide differences in the coding region are given for the pseudogenes, with dashes indicating deletions and expanded carets, insertions. The in-frame stop codon is boxed with a solid triangle over it. The seven proposed transmembrane domains (TMDs) are shaded and numbered I-VII. Putative N-glycos'ylation sites are indicated by stars, protein kinase A phosphorylation sites are overlined, and protein kinase C sites are overlined with a dashed line. A solid box identifies the cysteine residue that may be palmitoylated. The D5 stop codon is identified by a dot.

2200CA TriCarb). The GRAPHPAD computer program was RESULTS used for data analysis and curve fitting with K; values determined as described (9). The cAMP assays were per- Cloning and Sequencing of the Human Genes. The human formed on 293 cells as described (9). D1 receptor gene (9) was used to probe a Southern blot of Physiology/Pharmacology: Grandy et al. Proc. Natl. Acad. Sci. USA 88 (1991) 9177 human genomic DNA. Autoradiography revealed that it pseudogenes failed to bind (3H]SCH23390 (data not shown) hybridized to a 5-kb EcoRI fragment and was washed off at even though the HGRI-6 and -8 mRNA was expressed at higher temperatures. A human genomic library enriched in 5- levels equivalent to the levels of pBCHGRI-4 (Fig. 2). In to 6-kb EcoRI fragments was prepared in AgtlO and screened contrast, membranes prepared from cells transfected with with the human DI receptor gene. Of the many positive pBCHGRI-4 expressed high levels of saturable [3H]SCH- plaques, DNAs from 10 were prepared and each was found 23390 binding upon Scatchard analysis, with an average to contain a 5-kb insert. One of these clones, HGRI-6, was dissociation constant, Kd, of0.35 nM (n = 7) and an average further characterized by sequencing (Fig. 1). At the nucleo- B, of4 pmol per mg ofprotein (n = 7) (Fig. 3A Inset). These tide sequence level HGRI-6 is 65% identical to the human D, values are similar to those obtained in parallel experiments receptor gene. The nucleotide sequences encoding the seven with the human D, dopamine receptor. putative TMDs are 74% identical to those of the human D1 To pharmacologically characterize this Dj-like binding receptor (9). However, HGRI-6 contains an in-frame stop site, experiments were performed with agonists and antago- codon, suggesting that it is a receptor pseudogene (hD541). nists in competition with [3H]SCH23390 (Fig. 3A). The To establish whether the human genome contains a func- antagonist data were fit best by assuming one class ofbinding tional homologue to HGRI-6, we performed PCR on DNA site. Based on these studies the rank order of antagonist prepared from nine more genomic clones. Nucleotide se- potency (Kj) was SCH23390 (0.6 nM) > (+)-butaclamol (9.1 quence analysis ofthe PCR products revealed two additional nM) > cis-flupenthixol (23.6 nM) > haloperidol (156 nM) > unique genomic clones, HGRI-4 and HGRI-8. The nucleotide clozapine (406 nM) >> (-)-butaclamol (>10 P&M). This is the sequences of their putative coding regions are 95% and 98% same relative rank order of potency as previously observed identical to that ofHGRI-6, respectively (Fig. 1). Translation for the human D, receptor (9). When the agonists were of the HGRI-8 sequence revealed that it also contains an evaluated all three competition curves (Fig. 3A) had slopes in-frame stop codon (hD5q,2). Of the three genes, only that were <1 (0.6). Based on these results the data were fit HGRI-4 (hD5) has an open reading frame that is sufficiently by assuming the presence ofboth high- and low-affinity sites. long to encode a G-protein-coupled receptor (Fig. 1). The The rank order of potency for the agonists was SKF82526 deduced protein consists of 477 residues (relative molecular (fenoldopam) > SKF38393 > dopamine, with average (n = 3) mass, Mr = 52,950) with seven putative TMDs. Six aspar- K1 values of0.6 nM and 27 nM, 0.52 nM and 469 nM, and 12.8 agines are potential N-linked glycosylation sites and the nM and 1806 nM, respectively. In parallel experiments the presence of one of them near the amino terminus of the human D, receptor also displayed high and low affinity for protein (Asn6) is a structural feature shared by all of the dopamine, but the average (n = 2) K1 values, 32 nM for the cloned dopamine receptors. Another potential N-glycosyla- high-affinity site and 9109 nM for the low-affinity site, were tion site, Asn351, is unusual in that it is located in a TMD. higher than those observed for the D5 dopamine receptor. Interestingly, both human and rat D, receptors also display These pharmacological data strongly suggest that pBCH- this feature. The two cysteine residues Cys'13 and Cys21' are GRI-4 encodes a Di-like binding site, D5, with a high affinity conserved among dopamine receptors and may be important for dopamine. for stabilizing the receptor's tertiary structure. Several po- Whether or not D5 is a functional receptor was examined tential protein kinase phosphorylation target sites are present by its ability to stimulate intracellular cAMP accumulation in in the deduced receptor sequence: four for protein kinase A the human embryonic kidney cell line 293. Cells expressing (20) and three for protein kinase C (21). Five of these are pBCHGRI-4 displayed a concentration-dependent and satu- located in the putative third cytoplasmic loop of the mole- rable increase in intracellular cAMP levels when exposed to cule. This domain is thought to be important for the coupling dopamine (Fig. 3B). Furthermore, this stimulation could be of the receptor to G proteins (22), which suggests that these antagonized by 250 nM SCH23390 (Fig. 3B Inset). Of par- sites may serve a regulatory function. In addition, there are ticular interest is the shape of the dopamine/cAMP dose- several serines and threonines in the carboxyl-terminal por- response curve. The data from three independent experi- tion of the protein that may be phosphorylated by receptor ments were best fit by a two-site model, and two half- kinase (23). Also, Cys375 may be palmitoylated, providing the maximal stimulation concentrations (EC50) for dopamine receptor with a point of attachment to the plasma membrane were calculated: 5.0 nM and 275 nM. In parallel experiments, (24, 25). Comparison of the HGRI-4 deduced amino acid sequence (0 with the four other published human dopamine receptors a cac reveals significant conservation in their putative TMDs. ('4 Overall the seven TMDs of HGRI-4 are 82% identical to the O O C) m En m human D, dopamine receptor. Noteworthy among the con- CL mCL CL CL served residues are Asp'20, Ser229, and Ser233, which are found in TMDs III and V of all the cloned catecholamine receptors. These residues are thought to coordinate the amino and catechol hydroxyl moieties of catecholamine ligands (26, 27). In addition, the putative third cytoplasmic loop and carboxyl tail of HGRI-4 are similar in size to their 2 kb- counterparts in the human D, dopamine receptor. Taken together, these structural characteristics strongly suggest that HGRI-4 could encode a Dl-like dopamine receptor that may couple to the stimulatory G protein (Gj). Expression and Pharmacological Evaluation. To establish the pharmacological profile ofthis putative receptor, the gene was cloned into the vector pBC12BI and transiently ex- FIG. 2. Northern blot analysis of the human D5 genes transiently pressed in COS-7 monkey kidney cells, which lack expressed in COS-7 cells. Total RNA was prepared from cells [3H]SCH23390 binding sites (9). The putative pseudogenes, transfected with pBCHGRI-8, pBCHGRI-6, pBCHGRI-4, or HGRI-6 and HGRI-8, as well as the human DI dopamine pBC12BI (vector control). Each lane contained 5 tzg of total RNA. receptor gene were also cloned into pBC12BI. Membranes Hybridization was with a 32P-labeled fragment spanning TMDs III-V prepared from cells transfected with each ofthe two putative of HGRI-4. 9178 Physiology/Pharmacology: Grandy et al. Proc. Natl. Acad. Sci. USA 88 (1991) A

B 25 24 23 U

I- e -S 3- 0 o D D DE QDU. E _ Ur,.ransfectec 0 m I0 r Dsiv- 5 .. D DA 5 .k DA-SCH233v9.}

0 --- . -12 -10 -8 -6 -4 -2 ,1 1 10 100 1000 10000 Log Drug Concentration (M) DA (nM)

FIG. 3. Pharmacological profile and second-messenger coupling of the human D5 genes. (A) Binding of [3H]SCH23390 to membranes prepared from COS-7 cells transiently expressing pBCHGRI-4. (Inset) Scatchard transformation of the saturation binding data. (B) Dopamine (DA)-stimulated cAMP accumulation in human 293 cells. A representative dose-response curve is shown with each point the average ofduplicate plates. (Inset) SCH23390 (250 nM) was used to antagonize both dopamine-stimulated and SKF38393-stimulated cAMP production in 293 cells. Values are the average of two independent experiments. 293 cells transfected with the two putative pseudogenes the two EC50 values to the high- and low-affinity states ofthe pBCHGRI-6 and -8 showed no significant accumulation of D5 receptor as seen in the binding experiments. However, if intracellular cAMP when exposed to agonist (Fig. 3 Inset). a portion of the dose-response curve were due to the low- Genomic Analysis of Human and7Rat Ds Genes. To inves- affinity form of the receptor, it would be difficult to reconcile tigate whether multiple D5 genes are unique to humans we with the widely held view that only the high-affinity form of performed a Southern blot analysis of both rat and human the receptor couples to G,. Another possibility is that in 293 genomic DNA. With the human D5 probe, very strong signals cells the D5 dopamine receptor may stimulate adenylyl cy- were seen in the human lanes with weaker signals seen in the clase by coupling, with different affinities, to more than one rat lanes (Fig. 4A). To demonstrate that the signal intensities type ofG-protein a subunit. Such an effect could be mediated corresponded to gene copy number and not species differ- by the receptor's third cytoplasmic loop, a domain thought to ences between the rat and human genes, the filter was be involved in coupling the receptor to the G protein complex stripped of human probe and exposed to a rat D5 gene probe (22). One consequence of this model is that the receptor may (D.K.G., unpublished data). The signals obtained with the regulate several different effector enzymes. Therefore D5 two probes were essentially equivalent (Fig. 4B). may not only stimulate adenylyl cyclase directly through G. DISCUSSION but also indirectly through GP, which couples to phospholi- pase C, as is the case for the muscarinic acetylcholine In this report we present the cloning and expression of a receptor subtypes M1 and M3 (29). Finally, it is possible that functional human dopamine receptor, D5, and two related we are observing a novel response of the adenylyl cyclase pseudogenes, Ds/1 and D502. While this manuscript was in sequence ofa human preparation the amino acid D5 dopamine A Human Rat B Human Rat was receptor identical to ours reported (28). However, in C- Ir a:

0 0v 0 Q 0 0 the o 0 00- addition to the pharmacological characterization of D5 0 c CZ 0 U CZ u dopamine receptor we present the results of second- LU un LU C/) LU ur (j /) messenger experiments and genomic analyses that expand kb our knowledge about the D5 dopamine receptor system. In agreement with Sunahara et al, (28) our data indicate .-5.0w- that the pharmacological profile of the human D5 dopamine .;::'.:I...... s 3.5 receptor is similar but not identical to that of the human D1 ,. dopamine receptor. The human D5 receptor binds agonists 2.0- t and antagonists with the same rank order of potency as does the human D1 receptor, but its high- and low-affinity sites display higher affinities for dopamine than the corresponding sites in the D1 dopamine receptor. FIG. 4. Southern blot analysis of human and rat D5 receptor Furthermore, human D5 differs from D1 in its dose- genes. Each lane contained 3 ,ug of human or rat genomic DNA dependent stimulation of adenylyl cyclase. D5 receptors are digested with EcoRI or Sac I restriction endonuclease. (A) Autora- able to stimulate adenylyl cyclase in 293 cells, but unlike the diogram ofthe filter after it was probed with a fragment from HGRI-4 spanning TMDs III-V. (B) Autoradiogram of the same filter after it D1 receptor (9), the data from these dose-response experi- was stripped (15 mM NaCl/1.5 mM trisodium citrate, pH 7/0.1% ments are fit best to a biphasic curve with two EC50 values for SDS, 800C) and probed with a rat D5 fragment spanning TMDs 111-V dopamine of 5 nM and 275 nM. Although the physiological (D.K.G., unpublished data). The faint signal visible with both D5 significance of this biphasic dose response is difficult to probes in the human and rat DNA cut with Sac I is due to assess without further investigation, it is tempting to relate cross-hybridization with the D1 receptor gene. Physiology/Pharmacology: Grandy et al. Proc. Natl. Acad. Sci. USA 88 (1991) 9179 present in 293 cells. The recent cloning and expression of K. J., Bunzow, J. R., Server, A. C. & Civelli, O. (1989) Proc. several different forms of adenylyl cyclase has revealed that Nati. Acad. Sci. USA 86, 9762-9766. a 7. Dal Toso, R., Sommer, B., Ewert, M., Herb, A., Pritchett, the activity of these enzymes is regulated in complex D. B., Bach, A., Shivers, B. D. & Seeberg, P. H. (1989) EMBO manner. Indeed, the activity of the type I (calmodulin- J. 8, 4025-4034. sensitive) form of the enzyme has been shown to be stimu- 8. Selbie, L. A., Hayes, G. & Shine, J. (1989) DNA 8, 683-689. lated by a. subunits and inhibited by fry subunits (30). In 9. Zhou, Q.-Y., Grandy, D. K., Thambi, L., Kushner, J., Van contrast to the type I form of the enzyme, which is predom- Tol, H. H. M., Cone, R., Pribnow, D., Salon, J., Bunzow, inantly expressed in brain tissue, the type II enzyme is J. R. & Civelli, 0. (1990) Nature (London) 347, 76-80. 10. Dearry, A., Gingrich, J. A., Falardeau, P., Fremeau, R. T., Jr., ubiquitously expressed (including in 293 cells) and may Bates, M. D. & Caron, M. G. (1990) Nature (London) 347, respond differently to f8y (30). If, for example, the type II 72-76. enzyme were stimulated by fy, the resultant effect on cyclase 11. Sunahara, R. K., Niznik, H. B., Weiner, D. M., Stormann, might be to potentiate the effects of a.. If this model is T. M., Brann, M. R., Kennedy, J. L., Gelernter, J. E., Rozma- correct, then all receptors that couple to G. in 293 cells should hel, R., Yang, Y., Israel, Y., Seeman, P. & O'Dowd, B. F. display a biphasic dose-response curve. We failed to observe (1990) Nature (London) 347, 80-83. 12. Monsma, F. J., Mahan, L. C., McVittie, L. D., Gerfen, C. R. this phenomenon with D1 (9); however, its stimulation of & Sibley, D. R. (1990) Proc. Nati. Acad. Sci. USA 87, 6723- cAMP accumulation was so robust (200-fold) that a subtle 6727. response may have been overlooked. With this in mind it will 13. Sokoloff, P., Giros, B., Martres, M.-P., Bouthenet, M.-L. & be of interest to reexamine the dose response of D1 in more Schwartz, J.-C. (1990) Nature (London) 347, 146-151. detail. 14. Giros, B., Martres, M.-P., Sokoloff, P. & Schwartz, J.-C. The cloning of multiple human D5 genes raises many (1990) C.R. Acad. Sci. Ser. 3 311, 501-508. 15. Van Tol, H. H. M., Bunzow, J. R., Guan, H.-C., Sunahara, questions, including how many D5 genes there are in humans R. K., Seeman, P., Niznik, H. B. & Civelli, 0. (1991) Nature and how and when they arose during evolution. In situ (London) 350, 610-614. hybridization to human metaphase chromosomes has re- 16. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) in Molecular vealed that three distinct loci, located on chromosomes 1 Cloning: A Laboratory Manual, ed. Nolan, C. (Cold Spring (lq21), 2 (2qll.2), and 4 (4p16), hybridize to the human D5 Harbor Lab., Cold Spring Harbor, NY), 2nd Ed. probe (D.K.G. and L.A., unpublished data). Our data indi- 17. Grandy, D. K., Zhou, Q.-Y., Allen, L., Litt, R., Magenis, R. E., Civelli, 0. & Litt, M. (1990) Am. J. Hum. Genet. 47, cate that we have cloned three genes that represent at least 828-834. two of these three loci. There is still the possibility that the 18. Cullen, B. R. (1987) Methods Enzymol. 152, 684-704. two pseudogenes are allelic, leaving another sequence (rep- 19. Chen, C. & Okayama, H. (1987) Mol. Cell. Biol. 7, 2745-2752. resenting the third locus) yet to be identified. How these 20. Kemp, B. E. & Pearson, R. B. (1990) Trends Biochem. Sci. 15, genes came to be duplicated is unknown, but the possibility 342-346. of either transposition or viral retroposition (31) exists. 21. Graff, J. M., Stumpo, D. J. & Blackshear, P. J. (1989) J. Biol. Finally, our interpretation of the Southern blotting data, that Chem. 264, 11912-11919. rats of a gene per haploid 22. O'Dowd, B. F., Hnatowich, M., Regan, J. W., Leader, W. M., possess only one copy D5-like Caron, M. G. & Lefkowitz, R. J. (1988) J. Biol. Chem. 263, genome, suggests that the duplication event(s) may have 15985-15992. occurred at some time after the divergence of the primates. 23. Bouvier, M., Hausdorff, W. P., De Blasi, A., O'Dowd, B. F., Kobilka, B. K., Caron, M. G. & Lefkowitz, R. J. (1988) Na- We thank Richard Goodman and Michael Forte for critical reading ture (London) 333, 370-373. of the manuscript; Lucia Vallar, Lisa Thambi, and Aaron Janowski 24. O'Dowd, B. F., Hnatowich, M., Caron, M. G., Lefkowitz, for helpful discussions; Vicki Robertson, June Shiigi, and Paul R. J. & Bouvier, M. (1989) J. Biol. Chem. 264, 7564-7569. Keating for preparing the artwork; and Julie Tasnady for typing the 25. Ovchinnikov, Y., Abdulaev, N. & Bogachuk, A. (1988) FEBS manuscript. This research was supported by grants from the Scottish Lett. 230, 1-5. Rite (D.K.G., O.C.), the Medical Research Council of Canada 26. Dixon, R. A. F., Sigal, I. S., Rands, E., Register, R. B., Can- (C.B.), and the National Institutes of Health (MH45614 to O.C.). delore, M. R., Blake, A. D. & Strader, C. D. (1987) Nature (London) 326, 73-77. 1. Bunzow, J. R., Van Tol, H. H. M., Grandy, D. K., Albert, P., 27. Strader, C., Candelore, M., Hill, W. S., Sigal, I. S. & Dixon, Salon, J., Christie, M., Machida, C. A., Neve, K. A. & Civelli, R. A. F. (1989) J. Biol. Chem. 264, 13572-13578. 0. (1988) Nature (London) 336, 783-787. 28. Sunahara, R. K., Guan, H.-C., O'Dowd, B. F., Seeman, P., 2. Creese, I. (1986) in The Receptors, ed. Conn, P. M. (Academic, Laurier, L. G., Ng, G., Geirge, S. R., Torchia, J., Van Tol, New York), Vol. 4, pp. 171-212. H. H. M. & Niznik, H. B. (1991) Nature (London) 350, 614- 3. Niznik, H. B. (1987) Mol. Cell. Endocrinol. 54, 1-22. 619. 4. Vallar, L. & Meldolesi, J. (1989) Trends Physiol. Sci. 10, 74-77. 29. Ashkenazi, A., Peralta, E. G., Winslow, J. W., Ramachan- 5. Andersen, P. H., Gingrich, J. A., Bates, M. D., Dearry, A., dran, J. & Capon, D. J. (1989) Trends Pharmacol. Sci. 10, Falardeau, P., Senogles, S. E. & Caron, M. G. (1990) Trends Suppl., 16-22. Physiol. Sci. 11, 231-236. 30. Tang, W.-J., Krupinski, J. & Gilman, A. G. (1991) J. Biol. 6. Grandy, D. K., Marchionni, M. A., Makam, H., Stofko, R. E., Chem. 266, 8595-8603. Alfano, M., Frothingham, L., Fischer, J. B., Burke-Howie, 31. Brosius, J. (1991) Science 251, 753.