Identification of Cell Surface Markers from Multidimensional

Home , Dopamine receptor D5, Integrin alpha 10, Vasopressin receptor 1A, Vasopressin receptor 2

Identification of cell surface markers

from multidimensional microarray data utilizing spherical Self Organizing Maps

March 2016

Yuh Sugii

The Graduate School of Natural Science and Technology

(Doctor’s Course)

OKAYAMA UNIVERSITY

ABBREVIATIONS BSA: bovine serum albumin DMEM: Dulbecco’s modified Eagle’s medium EGFR: epithelial growth factor receptor FBS: fetal bovine serum FITC: fluorescein isothiocyanate GPI: glycosylphosphatidylinositol HEPES: 4-(2-HydroxyEthyl)-1-Piperazineethanesulfonic acid IP: ideal point MEM: minimum essential medium PBS: phosphate-buffered saline PCR: polymerase chain reaction qPCR: quantitative RT-PCR RFI: relative fluorescent intensity RPMI: Roswell Park Memorial Institute RT-PCR: reverse transcription polymerase chain reaction SDS: sodium dodecyl sulfate SSC: standard saline citrate sSOM: spherical Self-Organizing Map

Table of contents

GENERAL INTRODUCTION ------1

CHAPTERⅠ ------2

Identification of cell surface markers on glioma cells

Abstract ------3

Introduction ------4

Materials and Methods ------5

Cell lines and culturing ------5

RNA preparation ------5

Reverse transcription and qPCR ------6

DNA microarray ------7

sSOM analysis ------7

Immunostaining ------8

Results and Discussion ------9

Design of microarray for cell surface proteins ------9

Cell surface markers commonly expressed in glioma ------10

Gene expression profiles on sphere surfaces ------11

Mining genes commonly expressed in glioma cell lines

but not in brain tissues ------13

Evaluation of genes commonly expressed in glioma cell lines ------15

Conclusion ------20

References ------20

CHAPTERⅡ ------25

A spherical self-organizing map clustering of human breast cancer cell lines

Abstract ------25

Introduction ------26

Materials and Methods ------27

Cell lines and cell culture ------27

Preparation of total RNA and cDNA synthesis ------27

Microarray analysis ------28

Data filtering in breast cancer cell ------29

sSOM analysis of gene expression ------29

Results and discussion ------30

sSOM clustering of human breast cancer cell lines ------30

Conclusions ------34

References ------35

ACKNOWLEDGEMENTS ------39

APPENDIX ------40

GENERAL INTRODUCTION The technology of high throughput screening is nowadays widely available in life science especially in the fields of molecular diagnosis and drug discovery. This is due to the establishment of microarray procedure, which deals with huge number of genes at one time. Cluster analysis is usually performed on the results of DNA microarray experiments. However, the routine procedure of data mining dealing with the huge number of signal information obtained from microarray is not fixed yet. We can find various way of clustering in hierarchical and non-hierarchical methods, which are applied for the analyses. The most popular ones appear non-hierarchical clustering such as k-means (MacQueen, 1965), partitioning around medoids (Kaufman and Rousseeuw, 1990) and cluster affinity search technique (Ben-Dor et al., 1999). We have employed spherical self-organizing map (sSOM), which is also a non-hierarchical clustering, to cluster genes by gene expression profiles of cells and tissues (Tuoya et al., 2008). Analyzing various types of carcinoma cells and normal tissues, we could find interesting cell surface molecules, which should serve as the molecular markers. This procedure, which we are demonstrating, is rather new to the data analyses of gene clustering from the gene expression profiles obtained from DNA microarray technique. Flexible arrangement of the data obtained allows us to cluster cells and tissues as well as genes to find definitely fantastic direction of further advancement of study. In the future this

1 procedure should be extremely helpful in the field of drug discovery as well as those of molecular biology and oncology.

References Ben-Dor A, Shamir R, Yakhini Z. Clustering gene expression patterns. J Comput Biol; 1999:6(3-4)281-297.

Kaufman L, Rousseeuw PJ. Finding Groups in Data: An Introduction to Cluster Analysis. John Wiley & Sons; 1990;ISBN:978-0-471-73578-6, New York.

MacQueen J. Some Methods for Classification and Analysis of Multivariate Observations. In: Proceedings of the 5th Berkeley Symposium on Mathematical Statistics and Probability; 1965:281-297.

Tuoya, Sugii Y, Satoh H, Yu D, Matsuura Y, Tokutaka H, Seno M. Spherical self-organizing map as a helpful tool to identify category-specific cell surface markers. Biochem Biophys Res Commun; 2008: 376(2)414-418.

CHAPTERⅠ

Identification of cell surface markers on glioma cells

Abstract To identify cell-specific markers, we designed a DNA microarray platform with oligonucleotide probes for human membrane-anchored proteins. Human glioma cell lines were analyzed using microarray and compared with normal and fetal brain tissues. For the microarray analysis, we employed a spherical self-organizing map, which is a clustering method suitable for the conversion of multidimensional data into two-dimensional data and displays the relationship on a spherical surface. Based on the gene expression profile, the cell surface characteristics were successfully mirrored onto the spherical surface, thereby distinguishing normal brain tissue from the disease model based on the strength of gene expression. The clustered glioma-specific genes were further analyzed by polymerase chain reaction procedure and immunocytochemical staining of glioma cells. Our platform and the following procedure were successfully demonstrated to categorize the genes coding for cell surface proteins that are specific to glioma cells. Our assessment demonstrates that a spherical self-organizing map is a valuable tool for distinguishing cell surface markers and can be employed in marker discovery studies for the treatment of cancer.

Introduction Currently, the high-throughput screening technology is widely available in the field of life science, especially in relation to molecular diagnosis and drug discovery. The versatility of the microarray technology enables the simultaneous analysis of a large number of genes at any given time. Cluster analysis is usually performed on the results of DNA microarray experiments. However, the routine procedure of data mining dealing with huge number of signals obtained from microarray has not yet been optimized. Various methods of hierarchical and non-hierarchical clustering have been employed in previous analyses. The most popular methods include non-hierarchical clustering such as k-means (MacQueen 1965), partitioning around medoids (Kaufman et al. 1990), and the cluster affinity search technique (Ben-Dor et al. 1999). We have employed a spherical self-organizing map (sSOM), which is also a non-hierarchical clustering method, to cluster genes by the gene expression profiles of cells and tissues (Ritter. 1999; Kihato et al. 2008; Tuoya et al. 2005, 2008; Abou-Sharieha et al. 2009; Sugii et al. 2011). In this study, we attempted to identify human glioma-specific cell surface markers by analyzing nine glioma-derived cell lines and compared normal adult and fetal brain tissues. Because the information relating to marker proteins on cells are extremely useful in identifying and targeting cells specifically, a sophisticated and conventional procedure to identify cell specific surface markers is highly desirable.

Our procedure proposed here is rather new and innovative in the analysis of data from gene clustering of the expression profiles obtained from the DNA microarray technique.

Materials and Methods Cell lines and culturing. We employed nine glioma cell lines for this study: A172, Gli36, U251MG, U373MG, GI-1, KG1C, T98G, CCFSTTG1, and TM31. A172, Gli36, U251MG, U373MG, GI-1, and KG1C cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), containing 4 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin. T98G and CCFSTTG1 cells were cultured in RPMI 1640 with 10% FBS, containing 2 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin. TM31 cells were cultured in minimum essential medium (MEM) with 10% FBS, 2 mM L-glutamine, 100 U/mL penicillin, and 100 μg/μL streptomycin. All cell lines were maintained at 37°C in a 5% CO2-humidified incubator.

RNA preparation. Total RNA was prepared from the cells using an RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. RNAs were essentially treated with DNase I to remove genomic DNA. To synthesize cDNA for DNA microarray analysis, 20 μg of total RNA was reverse-transcribed using SuperScript II (Invitrogen) with an oligo dT18 and dNTP-containing amino alkylated dUTP (0.4 mM, Ambion).

Commercially obtained total RNA derived from normal adult and fetal brain (Stratagene) was compared as control throughout this study.

Reverse transcription and qPCR. Using 2 µl of diluted cDNA (corresponding to 0.1 µg of original total RNA), RT-PCR was performed with the primers listed in Table 1. The PCR profiles were 94°C for 5 minutes for initial denaturation followed by 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds, followed by 72°C for 7 minutes final elongation. The cycling conditions were different and were carried out as follows: 25 cycles (for ID 287 and 1,286 and GAPDH), 28 cycles (for ID 2, 45 259, 314 339, 998, and 1,012), and 30 cycles (for the remaining candidates and epithelial growth factor receptor [EGFR]). For CD44s, caveolin-1, and GAPDH, quantitative RT-PCR (qRT-PCR) was performed using a LightCycler DX400 (Roche) with SYBR Green Realtime PCR Master Mix (Toyobo). The PCR profile was 40 cycles of 95°C for 10 seconds, 60°C for 10 seconds, and 72°C for 25 seconds. Table 1: Primer sets for RT-PCR and quantitative PCR

Gene ID Forward (5’-3’) Reverse (5’-3’) ID 2 (AGPAT2) TGTACTGCGCGCTGTGCTTC ACCTGCACTGTGACTGTTCCTG ID45 (ADORA2B) CTTTGGCATCGGATTGACTC CCACTCTTGACATCTGCTTG ID259 (CAV1) CTCGGAGGGACATCTCTACACCGTT GCAAGTTGATGCGGACATTGCTGA ID287 (CD44s) AACCGTGATGGCACCCGCTATG TGGCCTCTCCGTTGAGTCCACTT ID314 (TXNDC14) GTGCGGCGACTTTCACGATG GGGTGATGTGCTCACTTTGTACC ID339 (CMTM6) GTGTACAGCCCCACTACGGA GCTCAGGCACCACAATGCAG ID428 (CNIH) GCGGCCTTCTGCTACATGCT CAGATTCCACAGGCTACTCTTGGAC ID910 (LEPROTL1) TCTTACAACGGGCATTGTCG CTTGACCAGTAATAGAGCCG ID998 (M11S1) GCAGAACACTGGATTTCCACGTAG GGCTCAAGATGACGCTTAGGACA ID1012 (MET) ACAGCTGAATCTGCAACTCC CTCTTGCATCGTAGCGAACT ID1282 (PTPRS) GCCCTATATTGCAGCTCGCTT GAGAGCTTGAGGCTGTCGTT ID1286 (PLP2) CATAGCGGCAATCCTCTACCTG AACCTAGGGCCTGGACTCTG ID1389 (RECK) GTGTGCTTCTGTCAAGTGTC AACCAGCAGTCCTGAATGTC EGFR TCCCTCAGCCACCCATATGTAC GTCTCGGGCCATTTTGGAGAATTC GAPDH CCCTTCATTGACCTCAACTAC CCACCTTCTTGATGTCATCAT

DNA microarray. We originally designed the DNA microarray, which focused on cell membrane-bound proteins to identify cell surface markers specific to the cells (Tuoya et al. 2008; Abou-Sharieha et al. 2009; Sugii et al. 2011). It was designed to contain 1,795 oligonucleotide probes corresponding to human genes. To avoid the effect of alternative splicing, the coding sequence for the membrane-bound region or glycosylphosphatidylinositol (GPI) anchor-modified region was focused to design the oligonucleotide probes. The probes were conjugated on the slide glass coated with diamond-like carbon, as previously described (Tuoya et al. 2005; Sugii et al. 2011). The Cy3-labeled cDNA synthesized above was hybridized to the cell surface marker DNA microarray and then scanned with a FLA8000 scanner (Fuji Film, Japan). Intensity for each spot of the array was captured by GenePix® Pro5.1 image analysis software (Axon Instrument).

sSOM analysis. For the initial screening of the genes, the obtained intensity of each spot from the microarray analysis of duplicates was evaluated by the following criteria: |A − G| − V > 0, where A denotes the gene expression level in normal brain tissue in adult or fetus, G denotes the average expression level of each gene from the nine glioma cell lines, and V denotes the standard deviation of each expressed gene among the nine glioma cell lines. The genes that were not expressed above zero were considered insignificant and filtered out. The values were

7 then plotted on to the sSOM software “Blossom” obtained from SOM, Japan Co. Ltd. To find genes whose expression was significantly upregulated in glioma cell lines, we applied the following formula: G − V > 0, where G denotes the average of the difference between each expressed gene from the nine glioma (Gi) cell lines and gene expression level in adult or fetal brain (N); V denotes the standard deviation of (Gi − N). The SOM algorithm was previously described by Tokutaka et al. (1999) and Okita et al. (2004).

Immunostaining. Glioma cells grown on 18 mm cover slips were washed with phosphate-buffered saline (PBS) twice, prior to fixation with 4% paraformaldehyde for 10 minutes. The fixed samples were incubated with blocking solution (PBS containing 10% FBS, 1% bovine serum albumin [BSA], and 0.02% NaN3), followed by incubation with anti-CD44 mouse monoclonal antibody (Cell signaling Technology, diluted 1:100 in PBS containing 1% BSA) at 4°C overnight or with anti-caveolin-1 rabbit polyclonal antibody (Cell Signaling Technology, diluted 1:200) at room temperature for one hour. After incubation, the samples were washed with PBS three times and then incubated with Alexa-488 conjugated secondary antibody (Life Technologies) at a dilution of 1:300 for 30 minutes. After washing three times with PBS, the samples were mounted, and fluorescent images were captured using LSM 510 Meta (Zeiss).

Results and Discussion Design of microarray for cell surface proteins. We designed 1,795 oligonucleotide probes for human cDNA-coding transmembrane proteins and GPI-anchored proteins, which are located on the cell surface (Fig. 1A). Each probe was synthesized based on the nucleotide sequence coding for the transmembrane region or the region containing amino acid residues attached to GPI as a 60-mer modified with NH2 at the 5′-end. The duplicated probes were covalently conjugated to the activated surface of diamond-like carbon-coated slide glass, as previously described (Tuoya et al. 2005; Sugii et al. 2011).

Figure 1A: Typical protein types integrated or anchored on cellular membrane. Transmembrane type has at least one region spanning the lipid bilayer. GPI- anchored type has a hydrophobic C- terminal tail (red) in the precursor form, and a processed C-terminal (brown) is attached to GPI and retained on the cell surface. Figure 1B: Expression of EGFR in the nine glioma cell lines and adult and fetal brain tissues. Evaluation was performed by reverse transcription PCR.

Cell surface markers commonly expressed in gliomas. We analyzed nine cell lines, A172, Gli36, U251MG, U373MG, GI-1, T98G, CCFSTTG1, TM31, and KG1C, which were derived from human glioma. It is well known that EGFR overexpression in tumor samples of low-grade glioma (Andersson et al. 2004) and anaplastic astrocytoma (Wrensch et al. 2006) has been associated with poor prognosis. As shown in Figure 1B, EGFR was overexpressed in all cell lines evaluated in this study. However, EGFR is also clearly expressed in normal brain tissues, suggesting that EGFR is still not a good marker to distinguish glioma from normal cells. To screen for candidate markers specific and common to gliomas, total RNA from nine glioma cell lines and brains from adult and fetus was analyzed on our DNA microarray.

Figure 2: Extraction of focused genes with feature. Each gene was plotted by nine glioma cell lines vs normal adult brain (A) and vs fetal brain (B) according to │A - G│ in horizontal axis and V in vertical axis. The border is lined by V =│A - G│. The area around where │A - G│- V > 0 is circled with red.

The genes were plotted in the two dimensions of V and |A − G| in Figure 2. Because the genes, which had good differences in intensity between glioma and brain tissues and had very low V between gliomas, were considered helpful in characterizing glioma cells, the genes were selected for further spherical sSOM analysis. As a result, 1,174 and 179 genes were selected for the analyses of normal adult brain and fetal brain tissues, respectively.

Gene expression profiles on sphere surfaces. The expression profiles were shown on each sphere surface for the selected genes (Fig. 3). The longitude and latitude were fixed in all sphere surfaces so that the profiles could be distinguished at a glance. Gene expression profiles were compared as two sets between normal adult brain vs glioma, and fetal brain vs glioma. From the intensity of the gene expression plotted on the sSOM, it appears that the pattern of expression profiles were considerably different between the two comparisons. When compared with normal adult brain, the profiles of glioma appear very similar to one another while there was no significant gene expression visible in the normal adult brain on the same side of the sphere. Fetal brain had the same expression profile on the same side. However, the pattern was different from the patterns of the glioma cell lines, which were again quite similar. When we compared the glioma cell panels alone, shown in Figure 3A and 3B, the heat map characteristics were entirely different between each other, based on the comparison with adult or fetal brain. The heat map characteristics shown in Figure 3 clearly emphasize that there is similarity in the expression patterns within the

11 glioma cell lines compared with those within adult or fetal brain. sSOM was able to show the glioma-specific characteristics irrespective of the different stages of the normal adult or fetal brain. Thus, some genes were specifically and commonly expressed in gliomas, as suggested by the red part of the profiles of glioma cell lines, which were localized in almost the same part of the sphere surfaces.

Figure 3: Gene expression profiles of nine glioma cell lines and brain tissues presented on sphere surfaces. Profiles of intensity of each gene were plotted on the sphere surface with the longitude and latitude fixed at the same positions. Nine glioma cell lines vs normal adult brain (A) and vs fetal brain (B). Intensity of the spot is depicted in red, yellow, white, blue, and dark blue as very high, high, medium, low, and very low, respectively.

Mining genes commonly expressed in glioma cell lines but not in brain tissues. Although it was possible to select the genes of interest from the aforementioned procedure, we further considered the extraction of the genes to be focused by overlaying the profiles in one sSOM (Fig. 4A). As the ideal point (IP), the virtual gene that was expressed in all glioma cell lines at the highest level, but not expressed in brain tissues, were inserted in the dataset for reference. Based on these calculations, we generated the gene expression profiles against the adult brain and fetal brain separately compared with glioma. In Figure 4A, both of the gene expression profiles were shown on the same side of the sphere surface with IP at the center. The genes located close to IP are interpreted as the genes expressed in all glioma cell lines but not in brain tissues. The dark part of the sphere surface translates to the distances apart from each other so that the dotted lines were able to clearly show the border of clusters. The genes evident in Figure 4A are listed in Table 2.

Figure 4A: Mining genes upregulated in gliomas by sSOM. Each number denotes the gene’s identity. IP denotes the ideal point, where the expression in every glioma is maximum but zero expression in brain tissue. The points close to the IP could be nominated as the best candidates of the glioma marker. Dark areas (with broken lines) show the borders of each cluster of genes. Numbers in red, yellow, and blue represent close, good, and little relationship with IP, respectively, as the results of RT-PCR. Figure 4B: Evaluation of the expression of genes selected through sSOM procedure. Genes in groups I and II are the genes for which numbers are shown in red and yellow, respectively. Evaluation was performed by reverse transcription PCR using agarose gel. The experiment was repeated three times and same results were obtained.

Table 2: List of genes localized close to the ideal point in sSOM

Gene ID Gene Name

2 1-acylglycerol-3-phosphate O-acyltransferase 2 (AGPAT2)

45 adenosine A2b receptor (ADORA2B)

259 caveolin-1, caveolae protein, 22kD (CAV1)

287 CD44 antigen (homing function and Indian blood group system)

314 CGI-31 protein (TXNDC14)

339 Chemokine-like factor super family member 6 (CMTM6)

428 cornichon-like (CNIH)

910 leptin receptor overlapping transcript-like 1(LEPROTL1)

998 membrane component, chromosome 11, surface marker 1 (M11S1)

1012 met proto-oncogene (MET)

1282 protein tyrosine phosphatase, receptor type, S (PTPRS)

1286 proteolipid protein 2 (colonic epithelium-enriched) (PLP2)

1389 reversion-inducing-cysteine-rich protein with kazal motifs (RECK)

Evaluation of genes commonly expressed in glioma cell lines. Nineteen genes are shown in Figure 4A. The expression of these genes was evaluated by reverse transcription PCR (Fig. 4B), and CD44 and caveolin-1 were investigated by qRT-PCR (Fig. 5). In Figure 4B, 13 genes showed a good relationship with glioma-specific expression. Genes expressed in all glioma cell lines were denoted as group I. Genes in group II were not expressed in few of the glioma cell lines. The genes in group I were shown in red, and those in group II were shown in yellow (Fig. 4A). The remaining six genes shown in blue could not be confirmed as being positively expressed in glioma. Based on these observations, the genes located close to IP were

15 depicted in red, whereas the genes depicted in blue were located distant from IP (Fig. 4A).

Figure 5: Gene expression levels of CD44 (A) and caveolin-1 (B). The relative expression levels of each cell line were confirmed by quantitative PCR. The graph shows the average levels of cell lines compared to adult brain.

This suggests that sSOM clustering almost correlated with the results of gene expression results confirmed by PCR. In Figure 4A, the 13 genes depicted in red and yellow has been tabulated in Table 2. Not only are there well-known genes but genes, whose function is not yet clear, are also listed. Because hyaluronic acid is abundant in the brain tissue, CD44 (hyaluronic acid receptor) might be a good marker of glioma among the listed genes. CD44 is known to have various forms resulting from alternative splicing (Kaaijk et al. 1995; Eibl et al. 1995) so that the variant form of CD44 in glioma cell lines was assessed by reverse transcription PCR (Fig. 6). As a result, the standard CD44 (CD44s) form was found to be dominantly expressed in the cell lines. Moreover, CD44 directly/indirectly contributes to antioxidant status, drug resistance, and migration in cancer cells (Tamada et al. 2012; Chetty et al. 2012). The high expression levels of CD44 in glioma correlate with malignancy and prognosis (Yoshida et al. 2012; Wei et al. 2010) because CD44 is not only associated with astrocytes but also with cancer stem cells (Pietras et al. 2014; Sugihara et al. 2012).

Figure 6: Evaluation of the variable forms of CD44 in glioma cell lines. CD44 is known to be variable due to the alternative splicing. Primers were designed to amplify the variable region. RT-PCR was performed and the fragment of 500 bp, which corresponds to the shortest form, was only amplified in each glioma cell line. M; size marker.

Translation of the gene of interest is considered the most crucial point in tumor marker discovery. The gene should transcribe and eventually be translated into protein because protein expression is an absolute requirement for the invasion, migration, and various signaling aspects of cancer cells. For the confirmation of protein expression in the cells, CD44 and caveolin-1 in the genes of group I were the best candidates, which cross-reacted with antibodies that could easily detect proteins; these two proteins were evaluated by immunostaining (Fig. 7A and 7B). Both antibodies against CD44 and caveolin-1 showed clear staining in all nine glioma cell lines. Because this staining was not observed by the secondary antibody, there was no nonspecific binding by the secondary antibody. We concluded that the proteins were present on the cellular membrane because of the observation of staining on cell connections.

Figure 7A: Immunostaining of glioma cells with anti- CD44 antibody. Nine glioma cell lines were stained with anti-CD44 antibody followed by the secondary antibody labeled with FITC. The secondary antibody did not show any background staining. The observation was performed by confocal microscopy at a magnification of ×64. Figure 7B: Immunostaining of glioma cells with anti- caveolin-1 antibody. Nine glioma cell lines were stained with anti-caveolin- 1 antibody followed by the secondary antibody labeled with FITC. The secondary antibody did not show any background staining. The observation was performed by confocal microscopy at a magnification of ×64. The experiment was repeated three times and same results were obtained.

Conclusion sSOM coupled with DNA microarray analysis has been successfully demonstrated to show gene expression profiles. Through this procedure, the identification of specific genes is possible for the nomination of cell surface markers, such as CD44 that are specific to glioma.

References Abou-Sharieha S, Sugii Y, Tuoya, Yu D, Chen L, Tokutaka H, Seno M. Identification of TM9SF2 as a candidate of the cell surface marker common to breast carcinoma cells. Clin Oncol Cancer Res; 2009:6(1)1-9, ISSN: 1674-5361.

Andersson U, Guo D, Malmer B, Bergenheim AT, Brännström T, Hedman H, Henriksson R. Epidermal growth factor receptor family (EGFR, ErbB2-4) in gliomas and meningiomas. Acta Neuropathol; 2004: 108(2)135-142.

Ben-Dor A, Shamir R, Yakhini Z. Clustering gene expression patterns. J Comput Biol; 1999:6(3-4)281-297.

Chetty C, Vanamala SK, Gondi CS, Dinh DH, Gujrati M, Rao JS. MMP-9 induces CD44 cleavage and CD44 mediated cell migration in glioblastoma xenograft cells. Cell Signal; 2012:24(2)549-559.

Eibl RH, Pietsch T, Moll J, Skroch-Angel P, Heider KH, von Ammon K, Wiestler OD, Ponta H, Kleihues P, Herrlich P. Expression of variant CD44 epitopes in human astrocytic brain tumors. J Neurooncol; 1995: 26(3)165-170.

Kaaijk P, Troost D, Morsink F, Keehnen RM, Leenstra S, Bosch DA, Pals ST. Expression of CD44 splice variants in human primary brain tumors. J Neurooncol; 1995:26(3)185-190.

Kaufman L, Rousseeuw PJ. Finding Groups in Data: An Introduction to Cluster Analysis. John Wiley & Sons; 1990;ISBN:978-0-471-73578-6, New York.

Kihato PK, Tokutaka T, Ohkita M, Fujimura K, Kotani K, Kurozawa Y, Maniwa Y. Spherical and torus SOM approaches to metabolic syndrome evaluation. Volume 4985 of the series Lecture Notes in Computer Science. 2008. pp 274-284.

MacQueen J. Some Methods for Classification and Analysis of Multivariate Observations. In: Proceedings of the 5th Berkeley Symposium on Mathematical Statistics and Probability; 1965:281-297.

Okita M, Tokutaka H, Yoshihara K, Oyabu M. Comparison of spectrum cluster analysis with PCA and spherical SOM and related issues not

21 amenable to PCA. Advances in Self-Organizing Maps and Learning Vector Quantization; Volume 295 of the series Advances in Intelligent Systems and Computing. 2004. pp 239-248.

Pietras A, Katz AM, Ekström EJ, Wee B, Halliday JJ, Pitter KL, Werbeck JL, Amankulor NM, Huse JT, Holland EC. Osteopontin-CD44 signaling in the glioma perivascular niche enhances cancer stem cell phenotypes and promotes aggressive tumor growth. Cell Stem Cell; 2014:14(3)357-369.

Ritter H. Self-organizing maps in non-euclidean spaces. Kohonen Maps. Oja E, Kaski S (Eds); Amsterdam: Elsevier: 1999. 97-109. DOI:10.1016/B978-044450270-4/50007-3

Sugihara E, Saya H. Complexity of cancer stem cells. Int. J. Cancer; 2012:132(6)1249-1259.

Sugii Y, Kudoh T, Otani T, Ikeda M, Tokutaka H, Seno M. Clustering Genes, Tissues, Cells and Bioactive Chemicals by Sphere SOM. Self Organizing Maps-applications and novel algorithm design edited by JI Mwasiagi Published by InTech; 2011:pp.371-386. DOI: 10.5772/13926

Tamada M, Nagano O, Tateyama S, Ohmura M, Yae T, Ishimoto T, Sugihara E, Onishi N, Yamamoto T, Yanagawa H, Suematsu M, Saya H. Modulation of glucose metabolism by CD44 contributes to antioxidant

22 status and drug resistance in cancer cells. Cancer Res; 2012: 72(6):1438-1448.

Tokutaka H, Yoshihara K, Fujimura K, Iwamoto K, Obu-Cann K. Application of self-organizing maps (SOM) to auger electron spectroscopy (AES). Surface and Interface Analysis; 1999:27(8)783-788.

Tuoya, Hirayama K, Nagaoka T, Yu D, Fukuda T, Tada H, Yamada H, Seno M. Identification of cell surface marker candidates on SV-T2 cells using DNA microarray on DLC-coated glass. Biochem Biophys Res Commun; 2005:334(1)263-268.

Wei KC, Huang CY, Chen PY, Feng LY, Wu TW, Chen SM, Tsai HC, Lu YJ, Tsang NM, Tseng CK, Pai PC, Shin JW. Evaluation of the prognostic value of CD44 in glioblastoma multiforme. Anticancer Res; 2010: 30(1):253-259.

Wrensch M, Wiencke JK, Wiemels J, Miike R, Patoka J, Moghadassi M, McMillan A, Kelsey KT, Aldape K, Lamborn KR, Parsa AT, Sison JD,

Prados MD. Serum IgE, tumor epidermal growth factor receptor expression, and inherited polymorphisms associated with glioma survival. Cancer Res; 2006:66(8)4531-4541.

Yoshida T, Matsuda Y, Naito Z, Ishiwata T. CD44 in human glioma correlates with histopathological grade and cell migration. Pathol Int; 2012:62(7):463-470.

CHAPTERⅡ

A spherical self-organizing map clustering of

human breast cancer cell lines

Abstract We have been clustering genes by gene expression of profiles of cells and tissues using spherical self-organizing map (sSOM). Especially, the screening of genes specific to carcinoma cells has been challenged. Working on various types of carcinoma cells such as neuroblastomas, gliomas and breast cancers, we could find interesting cell surface molecules, which should serve as the molecular target of therapy. This procedure, which we are demonstrating, is rather new to the data analyses of gene clustering from the gene expression profiles obtained from DNA microarray technique. Flexible arrangement of the data obtained allows us to cluster cells and tissues as well as genes to find definitely fantastic direction of further advancement of study. In the future we would like to extend this procedure to apply to the field of drug discovery as well as that of molecular biology and oncology.

Introduction Due to the rapid progress of molecular biology, many kinds of high throughput procedures have become available during the decades. As the results, accumulation of data is extensively growing and growing in the field of biological science. For example, we can find databases of DNA sequences, protein sequences and 3D-structure of proteins together with various annotations at their web sites. Gene expression profiles obtained through DNA microarray techniques are also accumulating. Although this kind of data is also freely available at the websites, further data mining is still being required to understand the data obtained. Only when the data mining is performed in a satisfactory and successful manner, we should come to a novel finding or acquire new knowledge. We propose here in this chapter the application of sSOM to depict comprehensive patterns of gene expression at a glance to distinguish cells or tissues clustering genes by their expression levels. It will be extremely easy to pick up some genes characteristic to the cells or tissues of interest resulting in finding or proposing new biomarkers. We have employed spherical self-organizing map (sSOM), which is also a non-hierarchical clustering, to cluster genes by gene expression profiles of cells and tissues (Tuoya et al.,2008). Analyzing various types of carcinoma cells and normal tissues, we could find interesting cell surface molecules, which should serve as the molecular markers. This procedure, which we are demonstrating, is rather new to the data analyses of gene clustering from the gene expression profiles obtained from DNA microarray technique.

Flexible arrangement of the data obtained allows us to cluster cells and tissues as well as genes to find definitely fantastic direction of further advancement of study.

Materials and Methods Cell lines and cell culture. Human breast cancer derived cell lines Hs-578T, MCF-7, MDA-MB-134, MDA-MB-231, SK-BR-3, T-47D and ZR-75-1 were obtained from American Type Culture Collection (ATCC, VA). Hs-578T cells were cultured in DMEM containing 10 % fetal bovine serum (FBS), 10 µg/mL insulin and 2 mM L-glutamine. MCF-7 cells were cultured in MEM containing 10 % FBS, 10 μg/mL insulin and 2 mM L-glutamine. MDA-MB-134 cells were cultured in Leibovitz-15 containing 10 % FBS, 2 mM L-glutamine buffered with 10 mM HEPES. MDAMB-231 cells were cultured in DMEM containing 10 % FBS and 2 mM L-glutamine. SK-BR-3 cells were cultured in RPMI 1640 containing 20 % FBS and 2 mM L-glutamine. T-47D cells cultured in RPMI 1640 containing 10 % FBS, 2 mM L-glutamine, 10 μg/mL insulin and 30 ng/mL EGF. ZR-75-1 cells were cultured in RPMI 1640 containing 10 % FBS. All cells were maintained at 37 ˚C in a humidified 5 % CO2 atmosphere except MDA-MB-134 cells, which were maintained in 100 % air.

Preparation of total RNA and cDNA synthesis. Total RNA was extracted from the cells used in this study. Cells were harvested at a confluence of 80% for preparation using RNeasy Mini kits (Qiagen),

27 following the manufacturer’s instructions. Total RNA from human normal breast was purchased from Stratagene (CA). RNA integrity and purity were assessed by OD260/280 measurements and by the ratio of 28S and 18S rRNA with Experion system (BioRad Labs, VA). The total RNA was further treated with DNase and purified. The integrity of template RNA was assessed by OD260/280 measurements. Twenty micrograms of total RNA was used to synthesize cDNA in the presence of aminoalkyl-dUTP. To monitor the efficiency of cDNA synthesis and hybridization control RNAs were added in the reaction as describe previously (Tuoya et al., 2008; Abou-Sharieha et al. 2009). Cy3-labeled cDNAs were prepared by indirect labeling method adapted from the Brown Web site (http://cmgm.stanford.edu/pbrown/protocols).

Microarray analysis. We originally proposed DNA microarray, which focused cell membrane-bound proteins to identify cell surface marker specific to the cells (Tuoya et al., 2008; Abou-Sharieha et al. 2009). Microarray was designed to contain 1,795 oligonucleotide probes corresponding to human genes. These genes were limited to those coding membrane-bound proteins so as to cover cell surface proteins. To avoid the effect of alternative splicing, the coding sequence for the membrane-bound region or GPI-anchor modified region was focused to design the oligonucleotide probes. The probes were conjugated on the slide glass coated with diamond-like carbon as described previously (Tuoya et al., 2005). The Cy3-labeled cDNA synthesized above was hybridized to the

28 cell surface marker DNA microarray in 5x SSC/0.5 % SDS solution at 55 °C for 15 h. After washing, arrays were scanned on a FLA8000 scanner (Fuji Film, Japan). Intensity for each spot of the array was captured by GenePix® Pro5.1 image analysis software (Axon Instrument). The fluorescent intensity of each spot referred as ‘‘relative fluorescent intensity (RFI)’’, which represented the expression level of each gene. Gene expression levels were compared to one another by RFI value to identify differentially expressed genes.

Data filtering in breast cancer cell. In order to eliminate genes that did not change significantly between cancer cell lines and normal tissue, each gene was given a score S by a formula: S = N − C − VC where N, C and VC denote the expression level of the gene in normal breast, the average of the expression levels of the gene in the seven cancer cell lines and the standard deviation of the gene expression level in the seven cancer cell lines, respectively. Genes were eliminated from further consideration when S<0 or S=0, since only the genes with a score greater than a threshold (i.e., zero) are deemed potentially significant (Tuoya et al., 2008).

sSOM analysis of gene expression. The expression levels of each gene were normalized among the breast cancer cell lines and normal breast tissue. First, the maximal RFI value of each gene was taken as 1, the

29 minimum RFI was taken as 0 and other RFI values were linearly calculated into the values between 0 and 1. Secondly the average expression levels of each gene were calculated and each average was divided by the maximal average value. The resultant values were further multiplied to each normalized value calculated above. The normalized data were clustered and displayed by sSOM software Cluster Blossom (Ver. 1.0.2, SOM Japan Co-Ltd., http://www.somj.com/). The training of Cluster Blossom was performed 50 times. Other parameters were automatically set by the software. Then the dendrograms were drawn from the final map after training by group average method with a glyph value 1.0.

Results and discussion sSOM clustering of human breast cancer cell lines. We performed DNA microarray gene expression analysis in order to screen genes commonly and specifically expressed in the seven cell lines derived from breast cancer when compared to normal breast. As the result of data filtering, 840 genes were found to suffice the criteria described in “Data filtering in breast cancer cell”. The expression levels of these genes were then normalized and clustered by sSOM. The gene expression profiles were visualized on the sphere surface map and the dendrogram indicating themselves classified by the origin of the cells (Fig. 1). It is interesting to note that Hs-578T and MDA-MB-231 cells, which are derived from basal-like breast cancer known to have poor prognosis, are clustered in the same group (Ray et al., 2010). T-47D, ZR-75-1, MCF-7 and MDA-MB-

134 cells, which are derived from luminal breast cancer, are well known to have good prognosis. Since SK-BR-3 cells are Her2 positive, which is an efficient target for the cancer therapy, and derived from breast cancer of medium level of prognosis. Thus, the gene expression profiles were successfully visualized by the sSOM clustering, suggesting the clusters of prognosis. From the patterns, cells derived from luminal breast cancer appear to be clustered into three groups of “close to normal”, “medium” and “poorer”. Namely, it might be possible to diagnose SK-BR-3 cells as “close to normal” while MDA-MB-134 as poorer than the other luminal derived cells. In order to find genes highly expressed in all the seven cancer cell lines, sSOM was performed with an assumptive gene inserted into the dataset of the 840 genes. The assumptive gene stood for an ideal point (IP), which was supposed to be expressed in all the breast cancer cell lines analyzed in this study but not in the normal breast tissue, so that the genes clustered close to IP should be potential diagnostic markers of breast cancer. In the result of sSOM clustering, IP was mapped in the red part of the pattern in all the seven cancer cell lines (Fig. 1) but blue in normal breast tissue. Since this mapped position of IP is consistent with the assumption, the genes close to IP should be selected as candidates of cancer-specific genes on the sSOM. Each spot on the surface of sSOM contains a group of clustered genes (Fig. 2). The spots mapped close to IP are shown in Fig. 2 and the candidate genes clustered in each spot are listed in Table 1. It is noteworthy that ErbB3 and ROBO2 have been nominated as potential

31 diagnostic markers here and some reports are found describing their relationships with breast cancers (Lemoine et al., 1992; Gasparini, 1994; Quinn et al. 1994 Travis et al., 1996; Naidu et al., 1998; Fogel et al., 1999; Holbro et al., 2003; Barnes et al., 2005; Schabath et al., 2006; Shiau et al. 2008). MUC1 is also known as a diagnostic marker in various cancers including breast cancers (Singh et al., 2008). Considering the results that contain these potential candidates, the other genes listed in Table 1 could be a potential candidate for the diagnostic marker of breast cancers still unknown.

Figure 1: The gene expression profiles analyzed by sSOM for cancer derived cell lines and normal breast. The normalized data set was clustered and visualized by Cluster Blossom. Each position of genes is fixed on the global surface. The colors indicate the expression level for each gene. Red, high; yellow, slightly high; white, median; light blue, slightly low; deep blue, low. See text for the names of cell lines and diagnostic levels. The alignment of cells is the result of sSOM clustering, which was drawn by dendrogram.

Table 1: Candidate genes for the potential diagnostic marker for breast cancer as picked up from genes commonly expressed in all the cancer derived cells studied in this paper

Figure 2: The locations of ideal point IP (white spot) clustered by sSOM. This global surface is the same with those in Fig. 1 without colors. Each gray spot on the surface of sSOM contains a group of clustered genes, which were depicted with the gene numbers in red. The genes clustered close to IP are summarized in Table 1

Conclusions In order to characterize cells, gene expression profiling is one of the most popular procedures nowadays. Through these procedures, identification of cell surface markers specific to some cells is a key for diagnosing and molecular targeting. DNA microarray is a high-throughput technology believed to be a powerful tool to find genes differentially expressed in the cells or tissues. Although it can provide critically important and useful information even from one experiment, the amount of data is usually too large to be handled. Therefore, highly sophisticated software is expected to support to transform the multidimensional datasets into simple dimensions or glyphs. For example, visual cues such as shape and color, which make it comprehensive for researchers to recognize and analyze the patterns hidden in the datasets. Here we successfully demonstrated cell surface marker analyses using our DNA microarray coupled with novel sSOM clustering procedure. The cell surface markers, which are common and specific to cancer derived cells, are proposed in this study and further assessment is now underway. Thus, we conclude sSOM is a powerful tool for data mining, knowledge discovery and visualization of multidimensional data.

References Abou-Sharieha, S; Sugii, Y; Tuoya; Yu, D; Chen, L; Tokutaka, H & Seno, M. (2009) Identifi cation of TM9SF2 as a candidate of the cell surface marker common to breast carcinoma cells. Clin. Oncol. Cancer Res. 6(1), 1-9, ISSN: 1674-5361.

Barnes, N.L.; Khavari, S.; Boland, G.P.; Cramer, A.; Knox, W.F. & Bundred, N.J. (2005) Absence of HER4 expression predicts recurrence of ductal carcinoma in situ of the breast. Clin. Cancer Res. 11(6), 2163-2168, ISSN: 1078-0432.

Ben-Dor, A.; Shamir, R. & Yahkini, Z. (1999) Clustering gene expression patterns. Journal of Computational Biology, 6(3/4) 281-297, ISSN: 1557-8666.

Fogel, M.; Friederichs, J.; Zeller,Y.; Husar, M.;, Smirnov, A.; Roitman, L.; Altevogt, P. & Sthoeger, Z.M. (1999) CD24 is a marker for human breast carcinoma. Cancer Lett. 143(1), 87-94, ISSN: 0304-3835.

Gasparini, G.; Gullick, W.J.; Maluta, S.; Dalla Palma, P.; Caffo, O.; Leonardi, E.; Boracchi, P.; Pozza, F.; Lemoine, N.R.; & Bevilacqua, P. (1994) C-erbB-3 and c-erbB-2 protein expression in node-negative breast carcinoma-an immunocytochemical study. Eur J Cancer, 30A(1), 16-22, ISSN: 0014-2964.

Holbro, T.; Civenni, G.; Hynes, N.E. (2003) The ErbB receptors and their role in cancer progression. Exp Cell Res. 284(1), 99-110, ISSN: 0014-4827.

Kaufman, L. & Rousseeuw, P.J. (1990) Finding Groups in Data: An Introduction to Cluster Analysis. John Wiley & Sons, ISBN: 978-0-471-73578-6, New York.

Lemoine, N.R.; Barnes, D.M.; Hollywood, D.P.; Hughes, C.M.;Smith, P.; Dublin, E.; Prigent, S.A.; Gullick, W.J.;& Hurst HC. (1992) Expression of the ERBB3 gene product in breast cancer. Br J Cancer 66(6), 1116-1121, ISSN 0007-0920.

MacQueen, J. (1965) Some methods for classification and analysis of multivariate observations. In: Proceedings of the 5th Berkeley Symposium on Mathematical Statistics and Probability, pages 281-297.

Naidu, R.; Yadav, M.; Nair, S. & Kutty, M.K.(1998) Expression of c-erbB3 protein in primary breast carcinomas. Br J Cancer. 78(10), 1385-1390, ISSN 0007-0920.

Quinn, C.M.; Ostrowski, J.L.; Lane, S.A.; Loney, D.P.; Teasdale, J., Benson, F.A. (1994) CerbB- 3 protein expression in human breast cancer:

36 comparison with other tumor variables and survival. Histopathology, 25(3), 247-252, ISSN 0309-0167.

Ray, P.S.; Wang, J.; Qu, Y.; Sim, M.S., Shamonki, J; Bagaria, S.P.; Ye, X.; Liu, B.; Elashoff, D.; Hoon, D.S.; Walter, M.A.; Martens, J.W.; Richardson, A.L.; Giuliano, A.E.& Cui, X. (2010) FOXC1 is a potential prognostic biomarker with functional significance in basal-like breast cancer. Cancer Res., 70(10), 3870-3786, ISSN 0008-5472.

Schabath, H.; Runz, S.; Joumaa, S. & Altevogt, P. (2006) CD24 affects CXCR4 function in pre- B lymphocytes and breast carcinoma cells. J Cell Sci., 119(Pt2), 314-325, ISSN: 0021-9533.

Shiau, C.E.; Lwigale, P.Y.; Das, R.M.; Wilson, S.A.& Bronner-Fraser M. (2008) Robo2-Slit1 dependent cell-cell interactions mediate assembly of the trigeminal ganglion. Nat. Neurosci., 11(3), 269-276, ISSN: 1097-6256.

Singh, A.P.; Senapati, S.; Ponnusamy, M.P.;, Jain, M.; Lele, S.M.; Davis, J.S.; Remmenga, S.&Batra SK. (2008) Clinical potential of mucins in diagnosis, prognosis, and therapy of ovarian cancer. Lancet Oncol. 9(11), 1076-1085, ISSN: 1470-2045.

Travis, A.; Pinder, S.E.; Robertson, J.F.; Bell, J.A.; Wencyk, P.; Gullick, W.J.; Nicholson, R.I.; Poller, D.N.; Blamey, R.W.; Elston, C.W. & Ellis,

I.O. (1996) C-erbB-3 in human breast carcinoma: expression and relation to prognosis and established prognostic indicators. Br J Cancer 74(2), 229-233, ISSN 0007-0920.

Tuoya; Hirayama, K; Nagaoka, T; Yu, D; Fukuda, T; Tada, H; Yamada, H. & Seno M. (2005) Identification of cell surface marker candidates on SV-T2 cells using DNA microarray on DLC-coated glass. Biochem. Biophys. Res. Commun. 334(1), 263-268, ISSN: 0006-291X.

Tuoya; Sugii, Y.; Satoh, H.; Yu, D.; Matsuura, Y.; Tokutaka, H. & Seno, M. (2008) Spherical self-organizing map as a helpful tool to identify category-specific cell surface markers. Biochem Biophys Res Commun. 376(2), 414-418, ISSN: 0006-291X.

ACKNOWLEDGEMENTS I would like to express my sincere appreciation to my supervisor, Professor M. Seno, Graduate School of Natural Science and Technology, Okayama University, for his continuing guidance and suggestions helped me in all the time of research and manuscript writing. I greatly appreciate Dr. T. Kasai and Dr. A. Vaidyanath, Graduate School of Natural Science and Technology, Okayama University, for their valuable guidance, helpful discussion and warm encouragement. It is my pleasure to acknowledge all my current and previous colleagues of Nanobiotechnology Laboratory.

APPENDIX List of human genes.

Oligo GenBank Gene Name No. Accession No.

1 NM_006411 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) 2 NM_006412 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) 3 NM_020132 1-acylglycerol-3-phosphate O-acyltransferase 3 4 NM_022147 28kD interferon responsive protein 5 NM_000524 5-hydroxytryptamine (serotonin) receptor 1A 6 NM_000863 5-hydroxytryptamine (serotonin) receptor 1B 7 NM_000864 5-hydroxytryptamine (serotonin) receptor 1D 8 NM_000865 5-hydroxytryptamine (serotonin) receptor 1E 9 L05597 5-hydroxytryptamine (serotonin) receptor 1F 10 M86841 5-hydroxytryptamine (serotonin) receptor 2A 11 NM_000867 5-hydroxytryptamine (serotonin) receptor 2B 12 NM_000868 5-hydroxytryptamine (serotonin) receptor 2C 13 BT007204 5-hydroxytryptamine (Serotonin) receptor 3A 14 Y12505 5-hydroxytryptamine (serotonin) receptor 4 15 X81411 5-hydroxytryptamine (serotonin) receptor 5A 16 NM_000871 5-hydroxytryptamine (serotonin) receptor 6 17 L21195 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) 18 NM_002526 5'-nucleotidase, ecto (CD73) 19 NM_002390 a disintegrin and metalloproteinase domain 11 20 NM_003474 a disintegrin and metalloproteinase domain 12 (meltrin alpha) 21 NM_003815 a disintegrin and metalloproteinase domain 15 (metargidin) 22 NM_003183 a disintegrin and metalloproteinase domain 17 (tumor necrosis factor, alpha, converting enzyme) 23 NM_014237 a disintegrin and metalloproteinase domain 18 24 NM_023038 a disintegrin and metalloproteinase domain 19 (meltrin beta) 25 NM_001464 a disintegrin and metalloproteinase domain 2 (fertilin beta) 26 NM_003814 a disintegrin and metalloproteinase domain 20 27 NM_003813 a disintegrin and metalloproteinase domain 21 28 NM_004194 a disintegrin and metalloproteinase domain 22 29 NM_003812 a disintegrin and metalloproteinase domain 23 30 NM_014265 a disintegrin and metalloproteinase domain 28 31 NM_014269 a disintegrin and metalloproteinase domain 29 32 NM_020334 a disintegrin and metalloproteinase domain 30 33 AB055891 A disintegrin and metalloproteinase domain 33 34 AF215824 A disintegrin and metalloproteinase domain 7 35 NM_001109 a disintegrin and metalloproteinase domain 8 36 U41766 a disintegrin and metalloproteinase domain 9 (meltrin gamma) 37 NM_003693 acetyl LDL receptor; SREC=scavenger receptor expressed by endothelial cells 38 NM_000020 activin A receptor type II-like 1 39 NM_001105 activin A receptor, type I 40 NM_004302 activin A receptor, type IB 41 NM_001616 activin A receptor, type II 42 NM_001106 activin A receptor, type IIB 43 S56143 adenosine A1 receptor 44 X68486 adenosine A2a receptor 45 NM_000676 adenosine A2b receptor 46 X76981 adenosine A3 receptor 47 L05500 adenylate cyclase 1 (brain) 48 X74210 adenylate cyclase 2 (brain) 49 NM_004036 adenylate cyclase 3 50 D25538 adenylate cyclase 7 51 NM_001115 adenylate cyclase 8 (brain) 52 NM_001116 adenylate cyclase 9 53 NM_001118 adenylate cyclase activating polypeptide 1 (pituitary) receptor type I 54 AF497516 Adenylate cyclase, type IV 55 AF497517 Adenylate cyclase, type V [Fragment] 56 AF250226 Adenylate cyclase, type VI 57 NM_006566 adhesion glycoprotein 58 NM_001179 ADP-ribosyltransferase 3 59 NM_000680 adrenergic, alpha-1A-, receptor 60 NM_000679 adrenergic, alpha-1B-, receptor 61 NM_000678 adrenergic, alpha-1D-, receptor

62 AF284095 adrenergic, alpha-2A-, receptor 63 NM_000682 adrenergic, alpha-2B-, receptor 64 NM_000683 adrenergic, alpha-2C-, receptor 65 NM_000684 adrenergic, beta-1-, receptor 66 M15169 adrenergic, beta-2-, receptor, surface 67 NM_000025 adrenergic, beta-3-, receptor 68 NM_007264 adrenomedullin receptor 69 M91211 advanced glycosylation end product-specific receptor 70 NM_004262 airway trypsin-like protease 71 NM_001150 alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase M, microsomal aminopeptidase, CD13, p150) 72 NM_001631 alkaline phosphatase, intestinal 73 NM_000478 alkaline phosphatase, liver/bone/kidney 74 NM_001632 alkaline phosphatase, placental (Regan isozyme) 75 NM_031313 alkaline phosphatase, placental-like 2 76 U08895 Alpha-sarcoglycan 77 AH006302 Alpha-tectorin 78 NM_001094 amiloride-sensitive cation channel 1, neuronal (degenerin) 79 NM_001095 amiloride-sensitive cation channel 2, neuronal 80 NM_004769 amiloride-sensitive cation channel 3, testis 81 NM_003734 amine oxidase, copper containing 3 (vascular adhesion protein 1) 82 NM_030943 amnionless protein 83 M30704 amphiregulin (schwannoma-derived growth factor) 84 U62540 anaplastic lymphoma kinase (Ki-1) 85 NM_016108 androgen induced protein 86 A00914 angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 87 NM_004835 angiotensin receptor 1 88 NM_000686 angiotensin receptor 2 89 NM_005161 angiotensin receptor-like 1 90 J04144 Angiotensin-converting enzyme, somatic isoform [Precursor] 91 NM_019847 ankylosis, progressive homolog 92 NM_007332 ankyrin-like with transmembrane domains 1 93 NM_002414 antigen identified by monoclonal antibodies 12E7, F21 and O13 94 NM_005944 antigen identified by monoclonal antibody MRC OX-2 95 NM_020547 anti-Mullerian hormone receptor, type II 96 NM_000385 aquaporin 1 (channel-forming integral protein, 28kD) 97 NM_000486 aquaporin 2 (collecting duct) 98 NM_004925 aquaporin 3 99 U34846 aquaporin 4 100 NM_001651 aquaporin 5 101 NM_001170 aquaporin 7 102 NM_001169 aquaporin 8 103 AB008775 aquaporin 9 104 AB066105 Aquaporin-10 105 AB028147 Aquaporin-11 106 AB040748 Aquaporin-12 107 NM_001629 arachidonate 5-lipoxygenase-activating protein 108 NM_000706 arginine vasopressin receptor 1A 109 NM_000707 arginine vasopressin receptor 1B 110 NM_000054 arginine vasopressin receptor 2 (nephrogenic diabetes insipidus) 111 NM_001671 asialoglycoprotein receptor 1 112 NM_001181 asialoglycoprotein receptor 2 113 AB006627 astrotactin 114 AB028944 ATPase class I type 11A 115 AB023173 ATPase class I type 11B 116 AJ580093 ATPase class I type 11C 117 AB032963 ATPase class I type 8B member 2 118 BC035162 ATPase class I type 8B member 3 119 AB075819 ATPase class I type 8B member 4 120 AB014511 ATPase class II type 9A 121 NM_012069 ATPase, (Na+)/K+ transporting, beta 4 polypeptide 122 NM_016529 ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2 123 NM_001682 ATPase, Ca++ transporting, plasma membrane 1 124 L20977 ATPase, Ca++ transporting, plasma membrane 2 125 U57971 ATPase, Ca++ transporting, plasma membrane 3 126 NM_001684 ATPase, Ca++ transporting, plasma membrane 4 127 NM_005603 ATPase, Class I, type 8B, member 1 128 NM_024490 ATPase, Class V, type 10C 129 NM_012463 ATPase, H+ transporting, lysosomal V0 subunit a isoform 2 130 NM_000704 ATPase, H+/K+ exchanging, alpha polypeptide 131 NM_000705 ATPase, H+/K+ exchanging, beta polypeptide 132 NM_001676 ATPase, H+/K+ transporting, nongastric, alpha polypeptide 133 D00099 ATPase, Na+/K+ transporting, alpha 1 polypeptide 134 NM_000702 ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide

135 NM_001677 ATPase, Na+/K+ transporting, beta 1 polypeptide 136 NM_001678 ATPase, Na+/K+ transporting, beta 2 polypeptide 137 U51478 ATPase, Na+/K+ transporting, beta 3 polypeptide 138 NM_005502 ATP-binding cassette, sub-family A (ABC1), member 1 139 NM_001089 ATP-binding cassette, sub-family A (ABC1), member 3 140 NM_000350 ATP-binding cassette, sub-family A (ABC1), member 4 141 AY219711 ATP-binding cassette, sub-family A, member 12 142 AH010490 ATP-binding cassette, sub-family A, member 2 143 NM_000927 ATP-binding cassette, sub-family B (MDR/TAP), member 1 144 NM_003742 ATP-binding cassette, sub-family B (MDR/TAP), member 11 145 NM_000443 ATP-binding cassette, sub-family B (MDR/TAP), member 4 146 NM_004996 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 147 U63970 ATP-binding cassette, sub-family C (CFTR/MRP), member 2 148 NM_003786 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 149 NM_005845 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 150 NM_005688 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 151 NM_000352 ATP-binding cassette, sub-family C (CFTR/MRP), member 8 152 NM_005691 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 153 AF076622 ATP-binding cassette, sub-family C, member 6 154 NM_004827 ATP-binding cassette, sub-family G (WHITE), member 2 155 NM_022169 ATP-binding cassette, sub-family G (WHITE), member 4 156 NM_022436 ATP-binding cassette, sub-family G (WHITE), member 5 (sterolin 1) 157 NM_022437 ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2) 158 NM_012070 attractin 159 L35233 autocrine motility factor receptor 160 M76125 AXL receptor tyrosine kinase 161 NM_014143 B7-H1 protein 162 L20471 basigin (OK blood group) 163 NM_001188 BCL2-antagonist/killer 1 164 U17077 BENE protein 165 NM_001729 betacellulin 166 NM_012104 beta-site APP-cleaving enzyme 167 AF312827 Beta-tectorin 168 NM_002589 BH-protocadherin (brain-heart) 169 NM_016564 BM88 antigen 170 NM_001727 bombesin-like receptor 3 171 NM_004334 bone marrow stromal cell antigen 1 172 NM_004335 bone marrow stromal cell antigen 2 173 NM_000710 bradykinin receptor B1 174 NM_000623 bradykinin receptor B2 175 NM_015379 brain protein I3 176 NM_001702 brain-specific angiogenesis inhibitor 1 177 NM_001703 brain-specific angiogenesis inhibitor 2 178 NM_001704 brain-specific angiogenesis inhibitor 3 179 NM_001716 Burkitt lymphoma receptor 1, GTP binding protein 180 U90543 Butyrophilin subfamily 2 member A1 181 AL021917 Butyrophilin subfamily 2 member A3 182 NM_001732 butyrophilin, subfamily 1, member A1 183 NM_006995 butyrophilin, subfamily 2, member A2 184 NM_007048 butyrophilin, subfamily 3, member A1 185 NM_007047 butyrophilin, subfamily 3, member A2 186 NM_006994 butyrophilin, subfamily 3, member A3 187 NM_006707 butyrophilin-like 3 188 AY358523 Butyrophilin-like protein 8 [Precursor] 189 AY358358 Butyrophilin-like protein 9 [Precursor] 190 Z13009 cadherin 1, type 1, E-cadherin (epithelial) 191 NM_006727 cadherin 10, type 2 (T2-cadherin) 192 NM_001797 cadherin 11, type 2, OB-cadherin (osteoblast) 193 L34057 cadherin 12, type 2 (N-cadherin 2) 194 L34058 cadherin 13, H-cadherin (heart) 195 NM_004933 cadherin 15, M-cadherin (myotubule) 196 NM_004062 cadherin 16, KSP-cadherin 197 NM_004063 cadherin 17, LI cadherin (liver-intestine) 198 NM_004934 cadherin 18, type 2 199 NM_021153 cadherin 19, type 2 200 M34064 cadherin 2, type 1, N-cadherin (neuronal) 201 NM_031891 cadherin 20, type 2 202 X63629 cadherin 3, type 1, P-cadherin (placental) 203 L34059 cadherin 4, type 1, R-cadherin (retinal) 204 X79981 cadherin 5, type 2, VE-cadherin (vascular epithelium) 205 D31784 cadherin 6, type 2, K-cadherin (fetal kidney) 206 AB035301 cadherin 7, type 2 207 L34060 cadherin 8, type 2

208 NM_016279 cadherin 9, type 2 (T1-cadherin) 209 NM_022124 cadherin related 23 210 NM_014246 cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog) 211 D87469 cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog) 212 AB011536 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog) 213 AL031687 Cadherin-22 [Precursor] 214 AY260901 Cadherin-24 [Precursor] 215 NM_021810 cadherin-like 26 216 L00587 calcitonin receptor 217 NM_005795 calcitonin receptor-like 218 NM_000721 calcium channel, voltage-dependent, alpha 1E subunit 219 NM_005183 calcium channel, voltage-dependent, alpha 1F subunit 220 AF029228 calcium channel, voltage-dependent, alpha 1G subunit 221 NM_021098 calcium channel, voltage-dependent, alpha 1H subunit 222 NM_021096 calcium channel, voltage-dependent, alpha 1I subunit 223 NM_000722 calcium channel, voltage-dependent, alpha 2/delta subunit 1 224 NM_000727 calcium channel, voltage-dependent, gamma subunit 1 225 NM_006078 calcium channel, voltage-dependent, gamma subunit 2 226 NM_006539 calcium channel, voltage-dependent, gamma subunit 3 227 NM_014405 calcium channel, voltage-dependent, gamma subunit 4 228 NM_014404 calcium channel, voltage-dependent, gamma subunit 5 229 NM_031897 calcium channel, voltage-dependent, gamma subunit 6 230 NM_031896 calcium channel, voltage-dependent, gamma subunit 7 231 M94172 calcium channel, voltage-dependent, L type, alpha 1B subunit 232 NM_000719 calcium channel, voltage-dependent, L type, alpha 1C subunit 233 NM_000720 calcium channel, voltage-dependent, L type, alpha 1D subunit 234 NM_000069 calcium channel, voltage-dependent, L type, alpha 1S subunit 235 NM_000068 calcium channel, voltage-dependent, P/Q type, alpha 1A subunit 236 NM_001745 calcium modulating ligand 237 NM_000388 calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism) 238 NM_015722 calcyon; D1 dopamine receptor-interacting protein 239 NM_024734 calponin like transmembrane domain protein 240 NM_014944 calsyntenin 1 241 NM_022131 calsyntenin 2 242 AJ277460 Calsyntenin-3 243 NM_020994 cancer/testis antigen 2 244 NM_001840 cannabinoid receptor 1 (brain) 245 NM_001841 cannabinoid receptor 2 (macrophage) 246 NM_000717 carbonic anhydrase IV 247 NM_001218 carbonic anhydrase XII 248 NM_012113 carbonic anhydrase XIV 249 U65090 carboxypeptidase D 250 NM_001874 carboxypeptidase M 251 J03858 Carcinoembryonic antigen-related cell adhesion molecule 1 252 NM_001815 carcinoembryonic antigen-related cell adhesion molecule 3 253 NM_004363 carcinoembryonic antigen-related cell adhesion molecule 5 254 NM_002483 carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) 255 NM_006890 carcinoembryonic antigen-related cell adhesion molecule 7 256 NM_001816 carcinoembryonic antigen-related cell adhesion molecule 8 257 M65212 catechol-O-methyltransferase 258 NM_020246 cation-chloride cotransporter-interacting protein 259 NM_001753 caveolin 1, caveolae protein, 22kD 260 U32114 caveolin 2 261 NM_001234 caveolin 3 262 NM_000591 CD14 antigen 263 NM_004357 CD151 antigen 264 M21097 CD19 antigen 265 M28825 CD1A antigen, a polypeptide 266 NM_001764 CD1B antigen, b polypeptide 267 NM_001765 CD1C antigen, c polypeptide 268 NM_001766 CD1D antigen, d polypeptide 269 X14975 CD1E antigen, 270 NM_001767 CD2 antigen (p50), sheep red blood cell receptor 271 NM_021155 CD209 antigen 272 NM_014257 CD209 antigen-like 273 NM_001771 CD22 antigen 274 NM_013230 CD24 antigen (small cell lung carcinoma cluster 4 antigen) 275 NM_006139 CD28 antigen (Tp44) 276 M23197 CD33 antigen (gp67) 277 M81104 CD34 antigen 278 M24795 CD36 antigen (collagen type I receptor, thrombospondin receptor) 279 NM_005505 CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1 280 NM_001774 CD37 antigen

281 NM_001775 CD38 antigen (p45) 282 NM_000732 CD3D antigen, delta polypeptide (TiT3 complex) 283 NM_000733 CD3E antigen, epsilon polypeptide (TiT3 complex) 284 NM_000073 CD3G antigen, gamma polypeptide (TiT3 complex) 285 NM_000734 CD3Z antigen, zeta polypeptide (TiT3 complex) 286 M12807 CD4 antigen (p55) 287 M59040 CD44 antigen (homing function and Indian blood group system) 288 NM_001777 CD47 antigen (Rh-related antigen, integrin-associated signal transducer) 289 NM_001778 CD48 antigen (B-cell membrane protein) 290 X04391 CD5 antigen (p56-62) 291 M37033 CD53 antigen 292 NM_001779 CD58 antigen, (lymphocyte function-associated antigen 3) 293 M34671 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30, EL32 and G344) 294 NM_006725 CD6 antigen 295 NM_001781 CD69 antigen (p60, early T-cell activation antigen) 296 NM_006137 CD7 antigen (p41) 297 NM_001782 CD72 antigen 298 K01144 CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) 299 NM_001783 CD79A antigen (immunoglobulin-associated alpha) 300 M89957 CD79B antigen (immunoglobulin-associated beta) 301 NM_001768 CD8 antigen, alpha polypeptide (p32) 302 NM_004931 CD8 antigen, beta polypeptide 1 (p37) 303 NM_005191 CD80 antigen (CD28 antigen ligand 1, B7-1 antigen) 304 NM_004356 CD81 antigen (target of antiproliferative antibody 1) 305 NM_004233 CD83 antigen (activated B lymphocytes, immunoglobulin superfamily) 306 L25259 CD86 antigen (CD28 antigen ligand 2, B7-2 antigen) 307 M38690 CD9 antigen (p24) 308 NM_001784 CD97 antigen 309 NM_001803 CDW52 antigen (CAMPATH-1 antigen) 310 AF002246 cell adhesion molecule with homology to L1CAM (close homolog of L1) 311 NM_016056 CGI-119 protein 312 NM_016072 CGI-141 protein 313 NM_020410 CGI-152 protein 314 NM_015959 CGI-31 protein 315 NM_015996 CGI-40 protein 316 NM_015999 CGI-45 protein 317 NM_005283 chemokine (C motif) XC receptor 1 318 D10925 chemokine (C-C motif) receptor 1 319 U03882 chemokine (C-C motif) receptor 2 320 NM_001837 chemokine (C-C motif) receptor 3 321 NM_005508 chemokine (C-C motif) receptor 4 322 NM_000579 chemokine (C-C motif) receptor 5 323 NM_004367 chemokine (C-C motif) receptor 6 324 NM_001838 chemokine (C-C motif) receptor 7 325 NM_005201 chemokine (C-C motif) receptor 8 326 NM_006641 chemokine (C-C motif) receptor 9 327 NM_016557 chemokine (C-C motif) receptor-like 1 328 NM_003965 chemokine (C-C motif) receptor-like 2 329 NM_001337 chemokine (C-X3-C) receptor 1 330 NM_022059 chemokine (C-X-C motif) ligand 16 331 D10924 chemokine (C-X-C motif), receptor 4 (fusin) 332 NM_001296 chemokine binding protein 2 333 NM_016326 chemokine-like factor 1 334 AY174118 Chemokine-like factor super family member 1 335 AF479260 Chemokine-like factor super family member 2 336 AF479813 Chemokine-like factor super family member 3 337 AF521889 Chemokine-like factor super family member 4 338 AF527413 Chemokine-like factor super family member 5 339 AF479261 Chemokine-like factor super family member 6 340 AF479263 Chemokine-like factor super family member 7 341 AF474370 Chemokine-like factor super family member 8 342 NM_004072 chemokine-like receptor 1 343 NM_000083 chloride channel 1, skeletal muscle (Thomsen disease, autosomal dominant) 344 NM_004366 chloride channel 2 345 NM_001830 chloride channel 4 346 X91906 chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) 347 NM_001286 chloride channel 6 348 Z67743 chloride channel 7 349 NM_004070 chloride channel Ka 350 NM_000085 chloride channel Kb 351 NM_000730 cholecystokinin A receptor 352 NM_000731 cholecystokinin B receptor 353 NM_000738 cholinergic receptor, muscarinic 1

354 NM_000739 cholinergic receptor, muscarinic 2 355 NM_000740 cholinergic receptor, muscarinic 3 356 NM_000741 cholinergic receptor, muscarinic 4 357 NM_012125 cholinergic receptor, muscarinic 5 358 NM_000079 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) 359 NM_020402 cholinergic receptor, nicotinic, alpha polypeptide 10 360 NM_000742 cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal) 361 NM_000743 cholinergic receptor, nicotinic, alpha polypeptide 3 362 NM_000744 cholinergic receptor, nicotinic, alpha polypeptide 4 363 NM_000745 cholinergic receptor, nicotinic, alpha polypeptide 5 364 U62435 cholinergic receptor, nicotinic, alpha polypeptide 6 365 NM_000746 cholinergic receptor, nicotinic, alpha polypeptide 7 366 NM_017581 cholinergic receptor, nicotinic, alpha polypeptide 9 367 NM_000747 cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) 368 X53179 cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal) 369 NM_000749 cholinergic receptor, nicotinic, beta polypeptide 3 370 U62439 cholinergic receptor, nicotinic, beta polypeptide 4 371 NM_000751 cholinergic receptor, nicotinic, delta polypeptide 372 NM_000080 cholinergic receptor, nicotinic, epsilon polypeptide 373 NM_005199 cholinergic receptor, nicotinic, gamma polypeptide 374 NM_021948 chondroitin sulfate proteoglycan BEHAB/brevican 375 NM_007015 chondromodulin I precursor 376 NM_004843 class I cytokine receptor 377 NM_021101 claudin 1 378 NM_006984 claudin 10 379 NM_012129 claudin 12 380 NM_012130 claudin 14 381 NM_014343 claudin 15 382 NM_006580 claudin 16 383 NM_012131 claudin 17 384 NM_016369 claudin 18 385 NM_020384 claudin 2 386 NM_001306 claudin 3 387 NM_001305 claudin 4 388 NM_003277 claudin 5 (transmembrane protein deleted in velocardiofacial syndrome) 389 NM_021195 claudin 6 390 NM_012132 claudin 8 391 NM_020982 claudin 9 392 AK096063 Claudin-19 393 AL139101 Claudin-20 394 AK098064 Claudin-22 395 BC016047 Claudin-23 396 AJ011497 Claudin-7 397 NM_001294 cleft lip and palate associated transmembrane protein 1 398 NM_006343 c-mer proto-oncogene tyrosine kinase 399 NM_006678 CMRF35 leukocyte immunoglobulin-like receptor 400 NM_001992 coagulation factor II (thrombin) receptor 401 NM_005242 coagulation factor II (thrombin) receptor-like 1 402 NM_004101 coagulation factor II (thrombin) receptor-like 2 403 NM_003950 coagulation factor II (thrombin) receptor-like 3 404 NM_001993 coagulation factor III (thromboplastin, tissue factor) 405 NM_000494 collagen, type XVII, alpha 1 406 X03663 colony stimulating factor 1 receptor, formerly McDonough feline sarcoma viral (v-fms) oncogene homolog 407 NM_006140 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) 408 NM_000395 colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) 409 NM_000760 colony stimulating factor 3 receptor (granulocyte) 410 Y00816 complement component (3b/4b) receptor 1, including Knops blood group system 411 NM_001877 complement component (3d/Epstein Barr virus) receptor 2 412 NM_012072 complement component 1, q subcomponent, receptor 1 413 NM_004054 complement component 3a receptor 1 414 M62505 complement component 5 receptor 1 (C5a ligand) 415 NM_000587 complement component 7 416 NM_000562 complement component 8, alpha polypeptide 417 NM_000066 complement component 8, beta polypeptide 418 NM_001737 complement component 9 419 NM_030772 connexin 59 420 NM_020660 connexin-36 421 AF014643 connexin46.6 422 X68274 contactin 2 (axonal) 423 NM_014361 contactin 5 424 NM_014461 contactin 6 425 NM_003632 contactin associated protein 1 426 NM_014141 contactin associated protein-like 2

427 NM_006587 corin 428 NM_005776 cornichon-like 429 NM_004382 corticotropin releasing hormone receptor 1 430 NM_001883 corticotropin releasing hormone receptor 2 431 NM_001338 coxsackie virus and adenovirus receptor 432 AAE34907 criptin growth factor 433 AF312769 Cryptic 434 NM_022663 CTAGE-1 protein 435 NM_022570 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12 436 NM_005127 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced) 437 NM_013252 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5 438 NM_016184 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 6 439 NM_014358 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 9 440 AY573061 C-type lectin domain family 14 member 441 AY365135 C-type lectin superfamily member 10 442 AK096429 C-type lectin superfamily member 13 443 AF325459 C-type lectin superfamily member 7 444 AY297446 C-type lectin superfamily member 8 445 NM_000087 cyclic nucleotide gated channel alpha 1 446 S76067 cyclic nucleotide gated channel alpha 2 447 NM_001298 cyclic nucleotide gated channel alpha 3 448 NM_019098 cyclic nucleotide gated channel beta 3 449 NM_020377 cysteinyl leukotriene CysLT2 receptor; cDNA: PSEC0146 from clone PLACE1006979 450 NM_006639 cysteinyl leukotriene receptor 1 451 M28668 cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7) 452 NM_000397 cytochrome b-245, beta polypeptide (chronic granulomatous disease) 453 U06715 cytochrome b-561 454 NM_022148 cytokine receptor-like factor 2 455 AF414120 Cytotoxic T-lymphocyte protein 4 [Precursor] 456 NM_032936 DC32 457 NM_030788 DC-specific transmembrane protein 458 M30142 decay accelerating factor for complement (CD55, Cromer blood group system) 459 D15057 defender against cell death 1 460 NM_000793 deiodinase, iodothyronine, type II 461 X76132 deleted in colorectal carcinoma 462 NM_005618 delta-like 1 463 U15979 delta-like 1 homolog 464 NM_016941 delta-like 3 465 NM_019074 delta-like 4 466 NM_014058 DESC1 protein 467 NM_003647 diacylglycerol kinase, epsilon (64kD) 468 NM_005137 DiGeorge syndrome critical region gene 2 469 NM_001936 dipeptidylpeptidase VI 470 M60278 diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor) 471 X74979 discoidin domain receptor family, member 1 472 NM_006182 discoidin domain receptor family, member 2 473 AK095973 Discoidin, CUB and LCCL domain containing protein 1 [Precursor] 474 AF387547 Discoidin, CUB and LCCL domain containing protein 2 [Precursor] 475 NM_017626 DnaJ (Hsp40) homolog, subfamily B, member 12 476 NM_021071 Dombrock blood group 477 NM_000794 dopamine receptor D1 478 M29066 dopamine receptor D2 479 NM_000796 dopamine receptor D3 480 NM_000797 dopamine receptor D4 481 NM_000798 dopamine receptor D5 482 AF023449 Down syndrome cell adhesion molecule 483 NM_016430 Down syndrome critical region gene 5 484 U01839 Duffy blood group 485 NM_030779 Eag-related gene member 2 486 M55267 ecotropic viral integration site 2A 487 AF060999 Ectodysplasin A 488 NM_021783 ectodysplasin A2 isoform receptor 489 NM_001776 ectonucleoside triphosphate diphosphohydrolase 1 490 AF144748 Ectonucleoside triphosphate diphosphohydrolase 2 491 NM_001248 ectonucleoside triphosphate diphosphohydrolase 3 492 NM_006209 ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin) 493 AF005632 Ectonucleotide pyrophosphatase/phosphodiesterase 3 494 NM_001974 egf-like module containing, mucin-like, hormone receptor-like sequence 1 495 NM_013447 egf-like module containing, mucin-like, hormone receptor-like sequence 2 496 NM_032571 EGF-like module-containing mucin-like receptor EMR3 497 NM_022159 EGF-TM7-latrophilin-related protein 498 NM_000118 endoglin (Osler-Rendu-Weber syndrome 1) 499 NM_016242 endomucin-2

500 NM_003775 endothelial differentiation, G-protein-coupled receptor 6 501 NM_001401 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 502 AF011466 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4 503 NM_012152 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7 504 NM_001400 endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 505 NM_005226 endothelial differentiation, sphingolipid G-protein-coupled receptor, 3 506 NM_004230 endothelial differentiation, sphingolipid G-protein-coupled receptor, 5 507 NM_030760 endothelial differentiation, sphingolipid G-protein-coupled receptor, 8 508 NM_001397 endothelin converting enzyme 1 509 NM_014693 endothelin converting enzyme 2 510 NM_004826 endothelin converting enzyme-like 1 511 L06622 endothelin receptor type A 512 L06623 endothelin receptor type B 513 NM_004767 endothelin type b receptor-like protein 2 514 M18391 EphA1 515 M59371 EphA2 516 NM_005233 EphA3 517 NM_004438 EphA4 518 X95425 EphA5 519 NM_004440 EphA7 520 NM_020526 EphA8 521 L40636 EphB1 522 L41939 EphB2 523 NM_004443 EphB3 524 NM_004444 EphB4 525 NM_004445 EphB6 526 M57730 ephrin-A1 527 AJ007292 Ephrin-A2 528 NM_004952 ephrin-A3 529 NM_005227 ephrin-A4 530 U26403 ephrin-A5 531 U09304 ephrin-B1 532 L38734 ephrin-B2 533 U57001 Ephrin-B3 534 NM_001963 epidermal growth factor (beta-urogastrone) 535 X00588 epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog) 536 NM_001980 epimorphin 537 NM_001432 epiregulin 538 NM_005764 epithelial protein up-regulated in carcinoma, membrane associated protein 17 539 NM_005797 epithelial V-like antigen 1 540 NM_004951 Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor) 541 NM_021819 ERGL protein; ERGIC-53-like protein 542 NM_016158 erythrocyte transmembrane protein 543 M60459 erythropoietin receptor 544 NM_022034 estrogen regulated gene 1 545 NM_005245 FAT tumor suppressor homolog 1 546 AB011535 FAT tumor suppressor homolog 2 547 NM_002000 Fc fragment of IgA, receptor for 548 NM_002001 Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide 549 NM_004106 Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide 550 NM_002002 Fc fragment of IgE, low affinity II, receptor for (CD23A) 551 M63830 Fc fragment of IgG, high affinity Ia, receptor for (CD64) 552 NM_004001 Fc fragment of IgG, low affinity IIb, receptor for (CD32) 553 M24854 Fc fragment of IgG, low affinity IIIa, receptor for (CD16) 554 NM_004107 Fc fragment of IgG, receptor, transporter, alpha 555 NM_004460 fibroblast activation protein, alpha 556 X66945 fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) 557 NM_000141 fibroblast growth factor receptor 2 558 M58051 fibroblast growth factor receptor 3 (achondroplasia, thanatophoric dwarfism) 559 L03840 fibroblast growth factor receptor 4 560 NM_013280 fibronectin leucine rich transmembrane protein 1 561 NM_013231 fibronectin leucine rich transmembrane protein 2 562 NM_013281 fibronectin leucine rich transmembrane protein 3 563 NM_014053 FLVCR protein 564 X51602 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) 565 U02687 fms-related tyrosine kinase 3 566 U04806 fms-related tyrosine kinase 3 ligand 567 NM_002020 fms-related tyrosine kinase 4 568 M99487 folate hydrolase (prostate-specific membrane antigen) 1 569 NM_000802 folate receptor 1 (adult) 570 J02876 folate receptor 2 (fetal) 571 M95489 follicle stimulating hormone receptor 572 NM_002029 formyl peptide receptor 1

573 NM_001462 formyl peptide receptor-like 1 574 NM_002030 formyl peptide receptor-like 2 575 NM_003505 frizzled homolog 1 576 NM_007197 frizzled homolog 10 577 L37882 frizzled homolog 2 578 NM_017412 frizzled homolog 3 579 NM_012193 frizzled homolog 4 580 NM_003468 frizzled homolog 5 581 NM_003506 frizzled homolog 6 582 NM_003507 frizzled homolog 7 583 NM_031866 frizzled homolog 8 584 NM_003508 frizzled homolog 9 585 NM_005031 FXYD domain containing ion transport regulator 1 (phospholemman) 586 AF241236 FXYD domain-containing ion transport regulator 2 587 NM_005971 FXYD domain-containing ion transport regulator 3 588 AI829935 FXYD domain-containing ion transport regulator 4 589 NM_014164 FXYD domain-containing ion transport regulator 5 590 BT006717 FXYD domain-containing ion transport regulator 6 591 BC018619 FXYD domain-containing ion transport regulator 7 592 AL353804 FXYD domain-containing ion transport regulator 8 593 NM_024513 FYVE and coiled-coil domain containing 1 594 NM_006564 G protein-coupled receptor STRL33 595 NM_007369 G protein-coupled receptor RE2 596 NM_005279 G protein-coupled receptor 1 597 NM_005287 G protein-coupled receptor 10 598 NM_014879 G protein-coupled receptor 105 599 NM_005288 G protein-coupled receptor 12 600 NM_013345 G protein-coupled receptor 132 601 NM_018949 G protein-coupled receptor 14 602 NM_005290 G protein-coupled receptor 15 603 NM_005291 G protein-coupled receptor 17 604 L42324 G protein-coupled receptor 18 605 NM_006143 G protein-coupled receptor 19 606 U13667 G protein-coupled receptor 2 607 NM_005293 G protein-coupled receptor 20 608 NM_005294 G protein-coupled receptor 21 609 NM_005295 G protein-coupled receptor 22 610 NM_005296 G protein-coupled receptor 23 611 NM_005297 G protein-coupled receptor 24 612 NM_005298 G protein-coupled receptor 25 613 NM_018971 G protein-coupled receptor 27 614 NM_005281 G protein-coupled receptor 3 615 NM_005299 G protein-coupled receptor 31 616 NM_001506 G protein-coupled receptor 32 617 NM_005300 G protein-coupled receptor 34 618 NM_005301 G protein-coupled receptor 35 619 NM_005302 G protein-coupled receptor 37 (endothelin receptor type B-like) 620 NM_001507 G protein-coupled receptor 38 621 AF034633 G protein-coupled receptor 39 622 NM_005282 G protein-coupled receptor 4 623 NM_005303 G protein-coupled receptor 40 624 NM_005304 G protein-coupled receptor 41 625 NM_005306 G protein-coupled receptor 43 626 NM_004778 G protein-coupled receptor 44 627 NM_007227 G protein-coupled receptor 45 628 NM_018490 G protein-coupled receptor 48 629 NM_003667 G protein-coupled receptor 49 630 NM_004224 G protein-coupled receptor 50 631 NM_005458 G protein-coupled receptor 51 632 NM_005684 G protein-coupled receptor 52 633 NM_005683 G protein-coupled receptor 55 634 NM_005682 G protein-coupled receptor 56 635 NM_014627 G protein-coupled receptor 57 636 NM_014626 G protein-coupled receptor 58 637 NM_005284 G protein-coupled receptor 6 638 NM_030784 G protein-coupled receptor 63 639 NM_005756 G protein-coupled receptor 64 640 NM_003608 G protein-coupled receptor 65 641 NM_006056 G protein-coupled receptor 66 642 NM_003485 G protein-coupled receptor 68 643 NM_005285 G protein-coupled receptor 7 644 NM_016540 G protein-coupled receptor 72 645 NM_004885 G protein-coupled receptor 74

646 NM_006794 G protein-coupled receptor 75 647 NM_018485 G protein-coupled receptor 77 648 NM_005286 G protein-coupled receptor 8 649 NM_032554 G protein-coupled receptor 81 650 NM_020370 G protein-coupled receptor 84 651 NM_018970 G protein-coupled receptor 85 652 NM_023914 G protein-coupled receptor 86 653 NM_023915 G protein-coupled receptor 87 654 NM_022049 G protein-coupled receptor 88 655 NM_001504 G protein-coupled receptor 9 656 NM_033050 G protein-coupled receptor 91 657 NM_020400 G protein-coupled receptor 92 658 M64749 G protein-coupled receptor RDC1 homolog 659 NM_016568 G protein-coupled receptor SALPR; somatostatin and angiotensin-like peptide receptor 660 NM_032503 G protein-coupled receptor slt 661 NM_016235 G protein-coupled receptor, family C, group 1, member B 662 NM_018653 G protein-coupled receptor, family C, group 5, member C 663 NM_018654 G protein-coupled receptor, family C, group 5, member D 664 L34339 galanin receptor 1 665 NM_003857 galanin receptor 2 666 NM_003614 galanin receptor 3 667 NM_000806 gamma-aminobutyric acid (GABA) A receptor, alpha 1 668 NM_000807 gamma-aminobutyric acid (GABA) A receptor, alpha 2 669 NM_000808 gamma-aminobutyric acid (GABA) A receptor, alpha 3 670 NM_000809 gamma-aminobutyric acid (GABA) A receptor, alpha 4 671 NM_000810 gamma-aminobutyric acid (GABA) A receptor, alpha 5 672 NM_000811 gamma-aminobutyric acid (GABA) A receptor, alpha 6 673 NM_000813 gamma-aminobutyric acid (GABA) A receptor, beta 2 674 NM_000814 gamma-aminobutyric acid (GABA) A receptor, beta 3 675 NM_000815 gamma-aminobutyric acid (GABA) A receptor, delta 676 U66661 gamma-aminobutyric acid (GABA) A receptor, epsilon 677 X15376 gamma-aminobutyric acid (GABA) A receptor, gamma 2 678 S82769 gamma-aminobutyric acid (GABA) A receptor, gamma 3 679 U95367 gamma-aminobutyric acid (GABA) A receptor, pi 680 NM_001471 gamma-aminobutyric acid (GABA) B receptor, 1 681 NM_002042 gamma-aminobutyric acid (GABA) receptor, rho 1 682 NM_002043 gamma-aminobutyric acid (GABA) receptor, rho 2 683 NM_018558 gamma-aminobutyric acid (GABA) receptor, theta 684 NM_005265 gamma-glutamyltransferase 1 685 NM_004121 gamma-glutamyltransferase-like activity 1 686 BC034709 Gap junction beta-4 protein (Connexin 30.3) 687 AF503615 Gap junction epsilon-1 protein (Connexin 31.3) 688 NM_000165 gap junction protein, alpha 1, 43kD (connexin 43) 689 AF075290 gap junction protein, alpha 3, 46kD (connexin 46) 690 NM_002060 gap junction protein, alpha 4, 37kD (connexin 37) 691 NM_005266 gap junction protein, alpha 5, 40kD (connexin 40) 692 NM_005497 gap junction protein, alpha 7, 45kD (connexin 45) 693 NM_005267 gap junction protein, alpha 8, 50kD (connexin 50) 694 NM_000166 gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked) 695 NM_004004 gap junction protein, beta 2, 26kD (connexin 26) 696 AJ004856 gap junction protein, beta 3, 31kD (connexin 31) 697 AF099731 gap junction protein, beta 5 (connexin 31.1) 698 NM_006783 gap junction protein, beta 6 (connexin 30) 699 NM_000164 gastric inhibitory polypeptide receptor 700 NM_005314 gastrin-releasing peptide receptor 701 NM_001495 GDNF family receptor alpha 2 702 NM_001496 GDNF family receptor alpha 3 703 NM_022139 GDNF family receptor alpha 4 704 NM_003943 genethonin 1 705 NM_000160 glucagon receptor 706 NM_002062 glucagon-like peptide 1 receptor 707 NM_004246 glucagon-like peptide 2 receptor 708 NM_000828 glutamate receptor, ionotrophic, AMPA 3 709 NM_000829 glutamate receptor, ionotrophic, AMPA 4 710 NM_000827 glutamate receptor, ionotropic, AMPA 1 711 L20814 glutamate receptor, ionotropic, AMPA 2 712 NM_001510 glutamate receptor, ionotropic, delta 2 713 NM_000830 glutamate receptor, ionotropic, kainate 1 714 U16126 glutamate receptor, ionotropic, kainate 2 715 NM_000831 glutamate receptor, ionotropic, kainate 3 716 NM_014619 glutamate receptor, ionotropic, kainate 4 717 NM_000832 glutamate receptor, ionotropic, N-methyl D-aspartate 1 718 NM_000833 glutamate receptor, ionotropic, N-methyl D-aspartate 2A

719 U90278 glutamate receptor, ionotropic, N-methyl D-aspartate 2B 720 NM_000836 glutamate receptor, ionotropic, N-methyl D-aspartate 2D 721 U31215 glutamate receptor, metabotropic 1 722 NM_000839 glutamate receptor, metabotropic 2 723 NM_000840 glutamate receptor, metabotropic 3 724 NM_000841 glutamate receptor, metabotropic 4 725 NM_000842 glutamate receptor, metabotropic 5 726 NM_000843 glutamate receptor, metabotropic 6 727 NM_000844 glutamate receptor, metabotropic 7 728 NM_000845 glutamate receptor, metabotropic 8 729 NM_001977 glutamyl aminopeptidase (aminopeptidase A) 730 NM_000171 glycine receptor, alpha 1 (startle disease/hyperekplexia, stiff man syndrome) 731 NM_002063 glycine receptor, alpha 2 732 NM_006529 glycine receptor, alpha 3 733 U33267 glycine receptor, beta 734 NM_002099 glycophorin A (includes MN blood group) 735 NM_002100 glycophorin B (includes Ss blood group) 736 NM_002101 glycophorin C (Gerbich blood group) 737 NM_002102 glycophorin E 738 NM_002510 glycoprotein (transmembrane) nmb 739 NM_001502 glycoprotein 2 (zymogen granule membrane) 740 NM_005512 glycoprotein A repetitions predominant 741 NM_005814 glycoprotein A33 (transmembrane) 742 NM_000173 glycoprotein Ib (platelet), alpha polypeptide 743 NM_000407 glycoprotein Ib (platelet), beta polypeptide 744 NM_000174 glycoprotein IX (platelet) 745 U45956 glycoprotein M6A 746 U45955 glycoprotein M6B 747 NM_004488 glycoprotein V (platelet) 748 NM_004868 glycoprotein, synaptic 2 749 NM_002081 glypican 1 750 BC027972 glypican 2 751 NM_004484 glypican 3 752 NM_001448 glypican 4 753 NM_004466 glypican 5 754 NM_005708 glypican 6 755 NM_018434 goliath protein 756 NM_000406 gonadotropin-releasing hormone receptor 757 NM_002066 GPI anchored molecule like protein 758 L13698 growth arrest-specific 1 759 NM_000163 growth hormone receptor 760 NM_000823 growth hormone releasing hormone receptor 761 NM_004122 growth hormone secretagogue receptor 762 NM_004963 guanylate cyclase 2C (heat stable enterotoxin receptor) 763 M92432 guanylate cyclase 2D, membrane (retina-specific) 764 L37378 guanylate cyclase 2F, retinal 765 NM_000410 hemochromatosis 766 NM_014799 hephaestin 767 NM_002151 hepsin (transmembrane protease, serine 1) 768 NM_021624 histamine H4 receptor 769 NM_000861 histamine receptor H1 770 NM_007232 histamine receptor H3 771 U07161 HLA class I histocompatibility antigen, A-1 alpha chain 772 M26429 HLA class I histocompatibility antigen, Cw-1 alpha chain 773 M27487 HLA class II histocompatibility antigen, DP alpha chain 774 K00409 HLA class II histocompatibility antigen, SB beta chain [Fragment] 775 NM_006979 HLA class II region expressed gene KE4 776 NM_021160 HLA-B associated transcript 5 777 NM_002127 HLA-G histocompatibility antigen, class I, G 778 NM_018057 homolog of rat orphan transporter v7-3 779 NM_016097 HSPC039 protein 780 NM_020199 HTGN29 protein 781 NM_001523 hyaluronan synthase 1 782 NM_005328 hyaluronan synthase 2 783 U86409 hyaluronan synthase 3 784 U09577 hyaluronoglucosaminidase 2 785 NM_002153 hydroxysteroid (17-beta) dehydrogenase 2 786 NM_016371 hydroxysteroid (17-beta) dehydrogenase 7 787 AF064876 hyperpolarization activated cyclic nucleotide-gated potassium channel 1 788 AJ012582 hyperpolarization activated cyclic nucleotide-gated potassium channel 2 789 NM_005477 hyperpolarization activated cyclic nucleotide-gated potassium channel 4 790 NM_001525 hypocretin (orexin) receptor 1 791 NM_001526 hypocretin (orexin) receptor 2

792 NM_019028 hypothetical protein similar to ankyrin repeat-containing priotein AKR1 793 NM_013332 hypoxia-inducible protein 2 794 NM_012092 inducible T-cell co-stimulator 795 M10051 insulin receptor 796 J05046 insulin receptor-related receptor 797 X04434 insulin-like growth factor 1 receptor 798 NM_002219 integral membrane protein 1 799 NM_004867 integral membrane protein 2A 800 NM_021999 integral membrane protein 2B 801 NM_030926 integral membrane protein 3 802 X68742 integrin, alpha 1 803 NM_003637 integrin, alpha 10 804 NM_012211 integrin, alpha 11 805 X17033 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 806 NM_000419 integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B) 807 NM_002204 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) 808 L12002 integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) 809 X06256 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) 810 X53586 integrin, alpha 6 811 NM_002206 integrin, alpha 7 812 D25303 integrin, alpha 9 813 L25851 integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) 814 NM_002209 integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide) 815 J04145 integrin, alpha M (complement component receptor 3, alpha; also known as CD11b) 816 NM_002210 integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) 817 NM_000887 integrin, alpha X (antigen CD11C (p150), alpha polypeptide) 818 X07979 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 819 NM_000211 integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1) 820 J02703 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 821 NM_000213 integrin, beta 4 822 J05633 integrin, beta 5 823 M35198 integrin, beta 6 824 M62880 integrin, beta 7 825 M73780 integrin, beta 8 826 NM_017625 intelectin 827 NM_000201 intercellular adhesion molecule 1 (CD54), human rhinovirus receptor 828 NM_002162 intercellular adhesion molecule 3 829 NM_001544 intercellular adhesion molecule 4, Landsteiner-Wiener blood group 830 NM_003259 intercellular adhesion molecule 5, telencephalin 831 J03171 interferon (alpha, beta and omega) receptor 1 832 X77722 interferon (alpha, beta and omega) receptor 2 833 J03143 interferon gamma receptor 1 834 U05875 interferon gamma receptor 2 (interferon gamma transducer 1) 835 J04164 interferon induced transmembrane protein 1 (9-27) 836 NM_021034 interferon induced transmembrane protein 3 (1-8U) 837 NM_005532 interferon, alpha-inducible protein 27 838 AF029213 interleukin 1 receptor accessory protein 839 NM_014271 interleukin 1 receptor accessory protein-like 1 840 NM_017416 interleukin 1 receptor accessory protein-like 2 841 NM_000877 interleukin 1 receptor, type I 842 X59770 interleukin 1 receptor, type II 843 NM_003856 interleukin 1 receptor-like 1 844 NM_003854 interleukin 1 receptor-like 2 845 NM_000628 interleukin 10 receptor, beta 846 NM_004512 interleukin 11 receptor, alpha 847 NM_001559 interleukin 12 receptor, beta 2 848 NM_001560 interleukin 13 receptor, alpha 1 849 U70981 interleukin 13 receptor, alpha 2 850 NM_014339 interleukin 17 receptor 851 NM_018725 interleukin 17B receptor 852 NM_003855 interleukin 18 receptor 1 853 NM_003853 interleukin 18 receptor accessory protein 854 NM_000417 interleukin 2 receptor, alpha 855 M26062 interleukin 2 receptor, beta 856 D11086 interleukin 2 receptor, gamma (severe combined immunodeficiency) 857 NM_014432 interleukin 20 receptor, alpha 858 NM_021798 interleukin 21 receptor 859 M74782 interleukin 3 receptor, alpha (low affinity) 860 NM_000418 interleukin 4 receptor 861 X61177 interleukin 5 receptor, alpha 862 M20566 interleukin 6 receptor 863 NM_002184 interleukin 6 signal transducer (gp130, oncostatin M receptor) 864 M29696 interleukin 7 receptor

865 M68932 interleukin 8 receptor, alpha 866 NM_001557 interleukin 8 receptor, beta 867 NM_002186 interleukin 9 receptor 868 NM_000214 jagged 1 (Alagille syndrome) 869 AF003521 jagged 2 870 NM_007213 JM4 protein 871 NM_006694 jumping translocation breakpoint 872 NM_016946 junctional adhesion molecule 1 873 NM_021219 junctional adhesion molecule 2 874 NM_031470 junctional adhesion molecule 3 875 NM_002231 kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocyte antigen) 876 NM_021083 Kell blood group precursor (McLeod phenotype) 877 NM_015236 KIAA0768 protein 878 NM_014926 KIAA0848 protein 879 NM_014908 KIAA1094 protein 880 NM_020665 kidney-specific membrane protein 881 NM_013289 killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 882 NM_006737 killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 883 NM_014514 killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1 884 NM_014218 killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1 885 NM_014219 killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2 886 NM_014511 killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 887 NM_002255 killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 888 NM_014512 killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 1 889 NM_012312 killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 890 NM_012313 killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 3 891 NM_012314 killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 892 NM_014513 killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5 893 NM_002259 killer cell lectin-like receptor subfamily C, member 1 894 NM_002260 killer cell lectin-like receptor subfamily C, member 2 895 NM_002261 killer cell lectin-like receptor subfamily C, member 3 896 NM_013431 killer cell lectin-like receptor subfamily C, member 4 897 NM_002262 killer cell lectin-like receptor subfamily D, member 1 898 NM_016523 killer cell lectin-like receptor subfamily F, member 1 899 NM_018240 kin of IRRE like 900 L04947 kinase insert domain receptor (a type III receptor tyrosine kinase) 901 M59964 KIT ligand 902 NM_032045 kringle-containing transmembrane protein; kringle-coding gene marking the eye and the nose 903 M74387 L1 cell adhesion molecule (hydrocephalus, stenosis of aqueduct of Sylvius 1) 904 NM_002299 lactase 905 NM_031211 LAT1-3TM protein 906 NM_012302 latrophilin 907 NM_014921 lectomedin-2 908 L04193 lens intrinsic membrane protein 2 (19kD) 909 U43168 leptin receptor 910 NM_015344 leptin receptor overlapping transcript-like 1 911 NM_018103 leucine-rich repeat-containing 5 912 NM_021634 leucine-rich repeat-containing G protein-coupled receptor 7 913 AF190501 Leucine-rich repeat-containing G-protein coupled receptor 6 914 NM_005575 leucyl/cystinyl aminopeptidase 915 NM_002310 leukemia inhibitory factor receptor 916 NM_006863 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1 917 NM_006866 leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 918 NM_006669 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 919 NM_005874 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 920 NM_006864 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 921 NM_006847 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 922 NM_006840 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 923 X60702 leukocyte tyrosine kinase 924 NM_000752 leukotriene b4 receptor (chemokine receptor-like 1) 925 NM_000897 leukotriene C4 synthase 926 NM_012306 lifeguard 927 NM_002338 limbic system-associated membrane protein 928 AF036905 linker for activation of T cells 929 M35533 lipopolysaccharide binding protein 930 NM_000237 lipoprotein lipase 931 NM_012319 LIV-1 protein, estrogen regulated 932 NM_000527 low density lipoprotein receptor (familial hypercholesterolemia) 933 NM_002333 low density lipoprotein receptor-related protein 3 934 AB011540 low density lipoprotein receptor-related protein 4 935 NM_002335 low density lipoprotein receptor-related protein 5 936 NM_004631 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor 937 X13916 low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor)

938 NM_018557 low density lipoprotein-related protein 1B (deleted in tumors) 939 U04441 low density lipoprotein-related protein 2 940 AY358399 Low-density lipoprotein receptor-related protein 10 941 AK027641 Low-density lipoprotein receptor-related protein 11 942 AF074264 Low-density lipoprotein receptor-related protein 6 943 NM_007011 lung alpha/beta hydrolase 2 944 NM_000233 luteinizing hormone/choriogonadotropin receptor 945 NM_005581 Lutheran blood group (Auberger b antigen included) 946 NM_003695 lymphocyte antigen 6 complex, locus D 947 NM_002346 lymphocyte antigen 6 complex, locus E 948 NM_002347 lymphocyte antigen 6 complex, locus H 949 D83597 lymphocyte antigen 64 homolog, radioprotective 105kD 950 NM_002349 lymphocyte antigen 75 951 L42621 lymphocyte antigen 9 952 NM_004829 lymphocyte antigen 94 homolog, activating NK-receptor; NK-p46, 953 NM_004828 lymphocyte antigen 95 (activating NK-receptor; NK-p44) 954 NM_002286 lymphocyte-activation gene 3 955 L11015 lymphotoxin beta (TNF superfamily, member 3) 956 NM_002342 lymphotoxin beta receptor (TNFR superfamily, member 3) 957 NM_020133 lysophosphatidic acid acyltransferase-delta 958 D14696 lysosomal-associated protein transmembrane 4 alpha 959 NM_006344 macrophage lectin 2 (calcium dependent) 960 NM_006770 macrophage receptor with collagenous structure 961 NM_002445 macrophage scavenger receptor 1 962 X70040 macrophage stimulating 1 receptor (c-met-related tyrosine kinase) 963 NM_002116 major histocompatibility complex, class I, A 964 NM_005514 major histocompatibility complex, class I, B 965 M11886 major histocompatibility complex, class I, C 966 NM_005516 major histocompatibility complex, class I, E 967 NM_002119 major histocompatibility complex, class II, DO alpha 968 NM_002120 major histocompatibility complex, class II, DO beta 969 K01171 major histocompatibility complex, class II, DR alpha 970 NM_002124 major histocompatibility complex, class II, DR beta 1 971 NM_012064 major intrinsic protein of lens fiber 972 M15800 mal, T-cell differentiation protein 973 NM_004668 maltase-glucoamylase (alpha-glucosidase) 974 NM_002438 mannose receptor, C type 1 975 NM_004870 mannose-P-dolichol utilization defect 1 976 NM_022077 mannosidase, beta A, lysosomal-like 977 M13150 MAS1 oncogene 978 S78653 mas-related G protein-coupled MRG 979 AY255572 Mas-related G-protein coupled receptor member E [Fragment] 980 BC016964 Mas-related G-protein coupled receptor member F 981 AY255583 Mas-related G-protein coupled receptor member G [Fragment] 982 NM_004995 matrix metalloproteinase 14 (membrane-inserted) 983 Z48482 matrix metalloproteinase 15 (membrane-inserted) 984 D50477 matrix metalloproteinase 16 (membrane-inserted) 985 X89576 matrix metalloproteinase 17 (membrane-inserted) 986 NM_006690 matrix metalloproteinase 24 (membrane-inserted) 987 NM_022468 matrix metalloproteinase 25 988 NM_015166 megalencephalic leukoencephalopathy with subcortical cysts 1 989 NM_005511 melan-A 990 NM_002386 melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) 991 NM_000529 melanocortin 2 receptor (adrenocorticotropic hormone) 992 NM_019888 melanocortin 3 receptor 993 NM_005912 melanocortin 4 receptor 994 NM_005913 melanocortin 5 receptor 995 M28882 melanoma cell adhesion molecule 996 U14108 melatonin receptor 1A 997 NM_005959 melatonin receptor 1B 998 NM_005898 membrane component, chromosome 11, surface marker 1 999 NM_000902 membrane metallo-endopeptidase (neutral endopeptidase, enkephalinase, CALLA, CD10) 1000 AF313620 Membrane progestin receptor alpha 1001 AY424283 Membrane progestin receptor gamma 1002 NM_015884 membrane-bound transcription factor protease, site 2 1003 NM_000139 membrane-spanning 4-domains, subfamily A, member 1 1004 X12530 membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide) 1005 NM_016650 membrane-spanning 4-domains, subfamily A, member 4 1006 NM_023945 membrane-spanning 4-domains, subfamily A, member 5 1007 NM_022349 membrane-spanning 4-domains, subfamily A, member 6A 1008 NM_021201 membrane-spanning 4-domains, subfamily A, member 7 1009 NM_031457 membrane-spanning 4-domains, subfamily A, member 8B 1010 NM_005588 meprin A, alpha (PABA peptide hydrolase)

1011 NM_005925 meprin A, beta 1012 J02958 met proto-oncogene (hepatocyte growth factor receptor) 1013 NM_005927 microfibrillar-associated protein 3 1014 NM_032046 mosaic serine protease 1015 NM_002456 mucin 1, transmembrane 1016 NM_017648 mucin 13, epithelial transmembrane 1017 AF258676 Mucin and cadherin-like protein 1018 NM_018298 mucolipin-3 1019 NM_007164 mucosal vascular addressin cell adhesion molecule 1 1020 NM_005592 muscle, skeletal, receptor tyrosine kinase 1021 M29273 myelin associated glycoprotein 1022 U64564 myelin oligodendrocyte glycoprotein 1023 NM_000530 myelin protein zero (Charcot-Marie-Tooth neuropathy 1B) 1024 L08246 myeloid cell leukemia sequence 1 (BCL2-related) 1025 NM_005373 myeloproliferative leukemia virus oncogene 1026 NM_005468 N-acetylated alpha-linked acidic dipeptidase-like; ILEAL DIPEPTIDYLPEPTIDASE 1027 NM_007052 NADPH oxidase 1 1028 NM_022143 NAG14 protein 1029 NM_000906 natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) 1030 NM_000907 natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B) 1031 NM_000908 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 1032 NM_005601 natural killer cell group 7 sequence 1033 NM_016382 natural killer cell receptor 2B4 1034 NM_007053 natural killer cell receptor, immunoglobulin superfamily member 1035 NM_013436 NCK-associated protein 1 1036 NM_002499 neogenin homolog 1 1037 NM_004646 nephrosis 1, congenital, Finnish type (nephrin) 1038 NM_014625 nephrosis 2, idiopathic, steroid-resistant (podocin) 1039 NM_002507 nerve growth factor receptor (TNFR superfamily, member 16) 1040 NM_014917 netrin G1f 1041 AB058760 Netrin G2 1042 AK131380 Netrin receptor UNC5A 1043 AB096256 Netrin receptor UNC5B 1044 AB055056 Netrin receptor UNC5D 1045 X16841 neural cell adhesion molecule 1 1046 NM_004540 neural cell adhesion molecule 2 1047 NM_015392 neural proliferation, differentiation and control, 1 1048 NM_004883 neuregulin 2 1049 NM_004801 Neurexin 1-alpha 1050 AF064842 Neurexin 1-beta 1051 NM_015080 Neurexin 2-alpha 1052 AC044790 Neurexin 2-beta 1053 NM_004796 Neurexin 3-alpha 1054 AF123462 Neurexin 3-beta 1055 NM_014932 neuroligin 1 1056 NM_018977 neuroligin 3 1057 M73482 neuromedin B receptor 1058 NM_020167 neuromedin U receptor 2 1059 NM_005010 neuronal cell adhesion molecule 1060 NM_014293 neuronal pentraxin receptor 1061 NM_014379 neuronal potassium channel alpha subunit 1062 NM_022146 neuropeptide FF 1; RFamide-related peptide receptor 1063 M88461 neuropeptide Y receptor Y1 1064 NM_000910 neuropeptide Y receptor Y2 1065 NM_006174 neuropeptide Y receptor Y5 1066 NM_006173 neuropeptide Y receptor Y6 (psuedogene) 1067 NM_003873 neuropilin 1 1068 NM_003872 neuropilin 2 1069 NM_002531 neurotensin receptor 1 (high affinity) 1070 NM_012344 neurotensin receptor 2 1071 NM_016522 neurotrimin 1072 U12140 neurotrophic tyrosine kinase, receptor, type 2 1073 U05012 neurotrophic tyrosine kinase, receptor, type 3 1074 AY247409 NFAT activation molecule 1 1075 U72661 ninjurin 1 1076 NM_016533 ninjurin 2 1077 NM_000435 Notch homolog 3 1078 NM_014037 NTT5 protein 1079 NM_002538 occludin 1080 NM_000273 ocular albinism 1 (Nettleship-Falls) 1081 NM_031945 oculospanin 1082 NM_014565 olfactory receptor, family 1, subfamily A, member 1 1083 NM_012352 olfactory receptor, family 1, subfamily A, member 2

1084 NM_002548 olfactory receptor, family 1, subfamily D, member 2 1085 NM_014566 olfactory receptor, family 1, subfamily D, member 5 1086 NM_003554 olfactory receptor, family 1, subfamily E, member 2 1087 NM_012360 olfactory receptor, family 1, subfamily F, member 1 1088 NM_003555 olfactory receptor, family 1, subfamily G, member 1 1089 NM_013941 olfactory receptor, family 10, subfamily C, member 1 1090 NM_013940 olfactory receptor, family 10, subfamily H, member 1 1091 NM_013939 olfactory receptor, family 10, subfamily H, member 2 1092 NM_013938 olfactory receptor, family 10, subfamily H, member 3 1093 NM_012351 olfactory receptor, family 10, subfamily J, member 1 1094 NM_013937 olfactory receptor, family 11, subfamily A, member 1 1095 NM_013936 olfactory receptor, family 12, subfamily D, member 2 1096 NM_030959 olfactory receptor, family 12, subfamily D, member 3 1097 NM_033057 olfactory receptor, family 2, subfamily B, member 2 1098 NM_012368 olfactory receptor, family 2, subfamily C, member 1 1099 NM_012369 olfactory receptor, family 2, subfamily F, member 1 1100 NM_007160 olfactory receptor, family 2, subfamily H, member 3 1101 NM_030905 olfactory receptor, family 2, subfamily J, member 2 1102 NM_019897 olfactory receptor, family 2, subfamily S, member 2 1103 NM_030903 olfactory receptor, family 2, subfamily W, member 1 1104 NM_002550 olfactory receptor, family 3, subfamily A, member 1 1105 NM_002551 olfactory receptor, family 3, subfamily A, member 2 1106 NM_012373 olfactory receptor, family 3, subfamily A, member 3 1107 NM_006637 olfactory receptor, family 5, subfamily I, member 1 1108 NM_030876 olfactory receptor, family 5, subfamily V, member 1 1109 NM_033180 olfactory receptor, family 51, subfamily B, member 2 1110 NM_033179 olfactory receptor, family 51, subfamily B, member 4 1111 NM_030774 olfactory receptor, family 51, subfamily E, member 2 1112 NM_012375 olfactory receptor, family 52, subfamily A, member 1 1113 NM_003696 olfactory receptor, family 6, subfamily A, member 1 1114 NM_017506 olfactory receptor, family 7, subfamily C, member 1 1115 NM_012377 olfactory receptor, family 7, subfamily C, member 2 1116 NM_002544 oligodendrocyte myelin glycoprotein 1117 X77130 opiate receptor-like 1 1118 L34774 opioid binding protein/cell adhesion molecule-like 1119 NM_000911 opioid receptor, delta 1 1120 NM_000912 opioid receptor, kappa 1 1121 L25119 opioid receptor, mu 1 1122 NM_020061 opsin 1 (cone pigments), long-wave-sensitive (color blindness, protan) 1123 NM_000513 opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) 1124 NM_001708 opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan) 1125 NM_033282 opsin 4 (melanopsin) 1126 NM_030958 organic anion transporter polypeptide-related protein 4 1127 NM_020372 organic cation transporter 1128 AF533891 Osteopetrosis associated transmembrane protein 1 1129 NM_004802 otoferlin 1130 NM_015945 ovarian cancer overexpressed 1 1131 NM_002543 oxidised low density lipoprotein (lectin-like) receptor 1 1132 NM_000916 oxytocin receptor 1133 NM_005972 pancreatic polypeptide receptor 1 1134 NM_005705 pan-hematopoietic expression 1135 NM_000316 parathyroid hormone receptor 1 1136 NM_005048 parathyroid hormone receptor 2 1137 U43148 patched homolog 1138 NM_003738 patched homolog 2 1139 NM_000919 peptidylglycine alpha-amidating monooxygenase 1140 D11428 peripheral myelin protein 22 1141 U82970 phosphate regulating gene with homologies to endopeptidases on the X chromosome 1142 NM_003711 phosphatidic acid phosphatase type 2A 1143 NM_003712 phosphatidic acid phosphatase type 2C 1144 NM_004204 phosphatidylinositol glycan, class Q 1145 NM_014754 phosphatidylserine synthase 1 1146 NM_030783 phosphatidylserine synthase 2 1147 NM_002667 phospholamban 1148 NM_021105 phospholipid scramblase 1 1149 NM_020359 phospholipid scramblase 2 1150 NM_020360 phospholipid scramblase 3 1151 NM_020353 phospholipid scramblase 4 1152 NM_007024 PL6 protein 1153 M83246 plasminogen activator, urokinase receptor 1154 NM_015993 plasmolipin 1155 NM_013308 platelet activating receptor homolog 1156 NM_000442 platelet/endothelial cell adhesion molecule (CD31 antigen)

1157 D10202 platelet-activating factor receptor 1158 M21574 platelet-derived growth factor receptor, alpha polypeptide 1159 M21616 platelet-derived growth factor receptor, beta polypeptide 1160 NM_002673 plexin B1 1161 NM_005397 podocalyxin-like 1162 NM_006505 poliovirus receptor 1163 AF060231 poliovirus receptor-related 1 (herpesvirus entry mediator C; nectin) 1164 NM_002856 poliovirus receptor-related 2 (herpesvirus entry mediator B) 1165 NM_006071 polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like 1166 U24497 polycystic kidney disease 1 (autosomal dominant) 1167 NM_000297 polycystic kidney disease 2 (autosomal dominant) 1168 S62403 Polymeric-immunoglobulin receptor 1169 NM_022135 popeye protein 2 1170 NM_033272 potassium channel subunit HERG-3 1171 NM_002245 potassium channel, subfamily K, member 1 (TWIK-1) 1172 NM_021161 potassium channel, subfamily K, member 10 (TREK-2) 1173 NM_022055 potassium channel, subfamily K, member 12 1174 NM_022054 potassium channel, subfamily K, member 13 1175 NM_022358 potassium channel, subfamily K, member 15 (TASK-5) 1176 NM_031460 potassium channel, subfamily K, member 17 (TASK-4) 1177 AF004711 potassium channel, subfamily K, member 2 (TREK-1) 1178 NM_002246 potassium channel, subfamily K, member 3 (TASK-1) 1179 NM_003740 potassium channel, subfamily K, member 5 (TASK-2) 1180 NM_004823 potassium channel, subfamily K, member 6 (TWIK-2) 1181 NM_005714 potassium channel, subfamily K, member 7 1182 NM_016601 potassium channel, subfamily K, member 9 (TASK-3) 1183 U69883 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 1184 NM_021614 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 1185 NM_002249 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 1186 NM_002250 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 1187 NM_002244 potassium inwardly-rectifying channel, subfamily J, inhibitor 1 1188 U12541 potassium inwardly-rectifying channel, subfamily J, member 1 1189 NM_002241 potassium inwardly-rectifying channel, subfamily J, member 10 1190 D50582 potassium inwardly-rectifying channel, subfamily J, member 11 1191 L36069 potassium inwardly-rectifying channel, subfamily J, member 12 1192 AJ006128 potassium inwardly-rectifying channel, subfamily J, member 13 1193 NM_013348 potassium inwardly-rectifying channel, subfamily J, member 14 1194 NM_002243 potassium inwardly-rectifying channel, subfamily J, member 15 1195 NM_018658 potassium inwardly-rectifying channel, subfamily J, member 16 1196 NM_000891 potassium inwardly-rectifying channel, subfamily J, member 2 1197 U39196 potassium inwardly-rectifying channel, subfamily J, member 3 1198 NM_004981 potassium inwardly-rectifying channel, subfamily J, member 4 1199 NM_000890 potassium inwardly-rectifying channel, subfamily J, member 5 1200 U24660 potassium inwardly-rectifying channel, subfamily J, member 6 1201 D50312 potassium inwardly-rectifying channel, subfamily J, member 8 1202 U52152 potassium inwardly-rectifying channel, subfamily J, member 9 1203 NM_016611 potassium inwardly-rectifying channel, subfamily K, member 4 1204 NM_014407 potassium large conductance calcium-activated channel, subfamily M beta member 3 1205 NM_002247 potassium large conductance calcium-activated channel, subfamily M, alpha member 1 1206 U25138 potassium large conductance calcium-activated channel, subfamily M, beta member 1 1207 NM_005832 potassium large conductance calcium-activated channel, subfamily M, beta member 2 1208 NM_014505 potassium large conductance calcium-activated channel, subfamily M, beta member 4 1209 NM_002251 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1 1210 NM_002252 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 1211 NM_000219 potassium voltage-gated channel, Isk-related family, member 1 1212 NM_012282 potassium voltage-gated channel, Isk-related family, member 1-like 1213 NM_005136 potassium voltage-gated channel, Isk-related family, member 2 1214 NM_005472 potassium voltage-gated channel, Isk-related family, member 3 1215 NM_000218 potassium voltage-gated channel, KQT-like subfamily, member 1 1216 Y15065 potassium voltage-gated channel, KQT-like subfamily, member 2 1217 NM_004519 potassium voltage-gated channel, KQT-like subfamily, member 3 1218 NM_004700 potassium voltage-gated channel, KQT-like subfamily, member 4 1219 NM_019842 potassium voltage-gated channel, KQT-like subfamily, member 5 1220 NM_004975 potassium voltage-gated channel, Shab-related subfamily, member 1 1221 NM_004770 potassium voltage-gated channel, Shab-related subfamily, member 2 1222 L02750 potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia) 1223 NM_005549 potassium voltage-gated channel, shaker-related subfamily, member 10 1224 L02752 potassium voltage-gated channel, shaker-related subfamily, member 2 1225 NM_002232 potassium voltage-gated channel, shaker-related subfamily, member 3 1226 NM_002233 potassium voltage-gated channel, shaker-related subfamily, member 4 1227 NM_002234 potassium voltage-gated channel, shaker-related subfamily, member 5 1228 NM_002235 potassium voltage-gated channel, shaker-related subfamily, member 6 1229 NM_031886 potassium voltage-gated channel, shaker-related subfamily, member 7

1230 NM_004979 potassium voltage-gated channel, Shal-related subfamily, member 1 1231 AJ010969 potassium voltage-gated channel, Shal-related subfamily, member 2 1232 NM_004980 potassium voltage-gated channel, Shal-related subfamily, member 3 1233 NM_004976 potassium voltage-gated channel, Shaw-related subfamily, member 1 1234 NM_004977 potassium voltage-gated channel, Shaw-related subfamily, member 3 1235 NM_004978 potassium voltage-gated channel, Shaw-related subfamily, member 4 1236 NM_002236 potassium voltage-gated channel, subfamily F, member 1 1237 NM_002237 potassium voltage-gated channel, subfamily G, member 1 1238 NM_012283 potassium voltage-gated channel, subfamily G, member 2 1239 NM_002238 potassium voltage-gated channel, subfamily H (eag-related), member 1 1240 NM_000238 potassium voltage-gated channel, subfamily H (eag-related), member 2 1241 NM_012285 potassium voltage-gated channel, subfamily H (eag-related), member 4 1242 NM_022152 PP1201 protein 1243 NM_000311 prion protein (p27-30) (Creutzfeld-Jakob disease, Gerstmann-Strausler-Scheinker syndrome, fatal familial insomnia) 1244 NM_012409 prion protein 2 (dublet) 1245 NM_014373 Probable G-protein coupled receptor 160 1246 NM_006320 progesterone receptor membrane component 2 1247 NM_005018 programmed cell death 1 1248 NM_025239 programmed death ligand 2 1249 NM_000949 prolactin receptor 1250 NM_000950 proline-rich Gla (G-carboxyglutamic acid) polypeptide 1 1251 NM_000951 proline-rich Gla (G-carboxyglutamic acid) polypeptide 2 1252 AF027208 prominin-like 1 1253 NM_000955 prostaglandin E receptor 1 (subtype EP1), 42kD 1254 NM_000956 prostaglandin E receptor 2 (subtype EP2), 53kD 1255 S69200 prostaglandin E receptor 3 (subtype EP3) 1256 L25124 prostaglandin E receptor 4 (subtype EP4) 1257 AF010316 prostaglandin E synthase 1258 NM_000959 prostaglandin F receptor (FP) 1259 NM_000960 prostaglandin I2 (prostacyclin) receptor (IP) 1260 NM_005672 prostate stem cell antigen 1261 NM_006799 protease, serine, 21 (testisin) 1262 NM_002772 protease, serine, 7 (enterokinase) 1263 NM_002773 protease, serine, 8 (prostasin) 1264 NM_006404 protein C receptor, endothelial (EPCR) 1265 NM_019848 Protein P3 1266 NM_002711 protein phosphatase 1, regulatory (inhibitor) subunit 3A 1267 NM_004648 protein tyrosine phosphatase, non-receptor type substrate 1 1268 NM_002836 protein tyrosine phosphatase, receptor type, A 1269 NM_002837 protein tyrosine phosphatase, receptor type, B 1270 Y00638 protein tyrosine phosphatase, receptor type, C 1271 NM_002839 protein tyrosine phosphatase, receptor type, D 1272 NM_006504 protein tyrosine phosphatase, receptor type, E 1273 Y00815 protein tyrosine phosphatase, receptor type, F 1274 L09247 protein tyrosine phosphatase, receptor type, G 1275 D15049 protein tyrosine phosphatase, receptor type, H 1276 NM_002843 protein tyrosine phosphatase, receptor type, J 1277 NM_002844 protein tyrosine phosphatase, receptor type, K 1278 NM_002845 protein tyrosine phosphatase, receptor type, M 1279 U66702 protein tyrosine phosphatase, receptor type, N polypeptide 2 1280 NM_002848 protein tyrosine phosphatase, receptor type, O 1281 NM_002849 protein tyrosine phosphatase, receptor type, R 1282 NM_002850 protein tyrosine phosphatase, receptor type, S 1283 AB006621 protein tyrosine phosphatase, receptor type, T 1284 NM_005704 protein tyrosine phosphatase, receptor type, U 1285 M93426 protein tyrosine phosphatase, receptor-type, Z polypeptide 1 1286 NM_002668 proteolipid protein 2 (colonic epithelium-enriched) 1287 M17085 proteolipid protein1 (Pelizaeus-Merzbacher disease, spastic paraplegia 2, uncomplicated) 1288 NM_002587 protocadherin 1 (cadherin-like 1) 1289 AB037821 Protocadherin 10 1290 AY029205 Protocadherin 15 1291 NM_014459 protocadherin 17 1292 NM_019035 protocadherin 18 1293 NM_022843 protocadherin 20 1294 NM_002590 protocadherin 8 1295 R38168 protocadherin 9 1296 NM_018900 protocadherin alpha 1 1297 NM_018901 protocadherin alpha 10 1298 NM_018902 protocadherin alpha 11 1299 NM_018903 protocadherin alpha 12 1300 NM_018904 protocadherin alpha 13 1301 NM_018905 protocadherin alpha 2 1302 NM_018906 protocadherin alpha 3

1303 NM_018907 protocadherin alpha 4 1304 NM_018908 protocadherin alpha 5 1305 NM_018909 protocadherin alpha 6 1306 NM_018910 protocadherin alpha 7 1307 NM_018911 protocadherin alpha 8 1308 NM_014005 protocadherin alpha 9 1309 NM_018898 protocadherin alpha subfamily C, 1 1310 NM_018899 protocadherin alpha subfamily C, 2 1311 NM_013340 protocadherin beta 1 1312 NM_018930 protocadherin beta 10 1313 NM_018932 protocadherin beta 12 1314 NM_018933 protocadherin beta 13 1315 NM_018934 protocadherin beta 14 1316 NM_018935 protocadherin beta 15 1317 NM_020957 protocadherin beta 16 1318 NM_018936 protocadherin beta 2 1319 NM_018937 protocadherin beta 3 1320 NM_018938 protocadherin beta 4 1321 NM_015669 protocadherin beta 5 1322 NM_018939 protocadherin beta 6 1323 NM_018940 protocadherin beta 7 1324 NM_019120 protocadherin beta 8 1325 NM_019119 protocadherin beta 9 1326 NM_018912 protocadherin gamma subfamily A, 1 1327 NM_018913 protocadherin gamma subfamily A, 10 1328 NM_018914 protocadherin gamma subfamily A, 11 1329 NM_003735 protocadherin gamma subfamily A, 12 1330 NM_018915 protocadherin gamma subfamily A, 2 1331 NM_018916 protocadherin gamma subfamily A, 3 1332 NM_018917 protocadherin gamma subfamily A, 4 1333 NM_018918 protocadherin gamma subfamily A, 5 1334 NM_018919 protocadherin gamma subfamily A, 6 1335 NM_018920 protocadherin gamma subfamily A, 7 1336 NM_014004 protocadherin gamma subfamily A, 8 1337 NM_018921 protocadherin gamma subfamily A, 9 1338 NM_018922 protocadherin gamma subfamily B, 1 1339 NM_018923 protocadherin gamma subfamily B, 2 1340 NM_018924 protocadherin gamma subfamily B, 3 1341 NM_018925 protocadherin gamma subfamily B, 5 1342 NM_018926 protocadherin gamma subfamily B, 6 1343 NM_018927 protocadherin gamma subfamily B, 7 1344 NM_002588 protocadherin gamma subfamily C, 3 1345 NM_018928 protocadherin gamma subfamily C, 4 1346 NM_018929 protocadherin gamma subfamily C, 5 1347 NM_017675 protocadherin LKC 1348 X12949 Proto-oncogene tyrosine-protein kinase receptor ret 1349 NM_016145 PTD008 protein 1350 NM_014051 PTD011 protein 1351 U33635 PTK7 protein tyrosine kinase 7 1352 AF000546 purinergic receptor (family A group 5) 1353 X83688 purinergic receptor P2X, ligand-gated ion channel, 1 1354 NM_012226 purinergic receptor P2X, ligand-gated ion channel, 2 1355 Y07683 purinergic receptor P2X, ligand-gated ion channel, 3 1356 NM_002560 purinergic receptor P2X, ligand-gated ion channel, 4 1357 NM_002561 purinergic receptor P2X, ligand-gated ion channel, 5 1358 NM_005446 purinergic receptor P2X, ligand-gated ion channel, 6 1359 NM_002562 purinergic receptor P2X, ligand-gated ion channel, 7 1360 NM_022788 Purinergic receptor P2Y, G protein-coupled, 12 1361 NM_002563 purinergic receptor P2Y, G-protein coupled, 1 1362 NM_002566 purinergic receptor P2Y, G-protein coupled, 11 1363 NM_002564 purinergic receptor P2Y, G-protein coupled, 2 1364 NM_018674 putative acid-sensing ion channel 1365 NM_022089 putative ATPase 1366 NM_020389 putative capacitative calcium channel 1367 D10923 putative chemokine receptor; GTP-binding protein 1368 NM_007223 putative G protein coupled receptor 1369 M76676 putative leukocyte platelet-activating factor receptor 1370 NM_003967 putative neurotransmitter receptor 1371 AF000545 Putative P2Y purinoceptor 10 1372 NM_032553 Putative P2Y purinoceptor FKSG79 1373 NM_003876 putative receptor protein 1374 NM_006858 putative T1/ST2 receptor binding protein 1375 NM_012342 putative transmembrane protein

1376 NM_002565 pyrimidinergic receptor P2Y, G-protein coupled, 4 1377 NM_004154 pyrimidinergic receptor P2Y, G-protein coupled, 6 1378 NM_005855 receptor (calcitonin) activity modifying protein 1 1379 NM_005854 receptor (calcitonin) activity modifying protein 2 1380 NM_005856 receptor (calcitonin) activity modifying protein 3 1381 NM_004560 receptor tyrosine kinase-like orphan receptor 2 1382 NM_018092 reserved 1383 NM_023004 reticulon 4 receptor 1384 NM_000322 retinal degeneration, slow (retinitis pigmentosa 7) 1385 NM_002921 retinal G protein coupled receptor 1386 NM_000327 retinal outer segment membrane protein 1 1387 NM_006583 retinal pigment epithelium-derived rhodopsin homolog 1388 NM_002888 retinoic acid receptor responder (tazarotene induced) 1 1389 NM_021111 reversion-inducing-cysteine-rich protein with kazal motifs 1390 AL136826 RGM domain family member A 1391 BC067736 RGM domain family member B 1392 AY372521 RGM domain family member C 1393 NM_016124 Rhesus blood group, D antigen 1394 NM_000324 Rhesus blood group-associated glycoprotein 1395 NM_000539 rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant) 1396 NM_003961 rhomboid, veinlet-like 1 1397 AF040990 Roundabout homolog 1 1398 AY509035 Roundabout homolog 3 1399 AF040991 roundabout, axon guidance receptor, homolog 2 1400 NM_000540 ryanodine receptor 1 (skeletal) 1401 NM_001035 ryanodine receptor 2 (cardiac) 1402 NM_001036 ryanodine receptor 3 1403 NM_002958 RYK receptor-like tyrosine kinase 1404 U01160 sarcoma amplified sequence 1405 AB052951 Scavenger receptor class F member 2 1406 NM_003004 secreted and transmembrane 1 1407 NM_002980 secretin receptor 1408 NM_004866 secretory carrier membrane protein 1 1409 NM_005697 secretory carrier membrane protein 2 1410 NM_005698 secretory carrier membrane protein 3 1411 NM_021115 seizure related 6 homolog (mouse)-like 1412 M30640 selectin E (endothelial adhesion molecule 1) 1413 NM_000655 selectin L (lymphocyte adhesion molecule 1) 1414 NM_003005 selectin P (granule membrane protein 140kD, antigen CD62) 1415 NM_003006 selectin P ligand 1416 NM_003612 sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A 1417 NM_006378 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D 1418 NM_004263 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F 1419 NM_020796 sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 1420 NM_020241 sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B 1421 NM_030913 sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C 1422 U78095 serine protease inhibitor, Kunitz type, 2 1423 NM_016372 seven transmembrane domain orphan receptor 1424 NM_006326 seven transmembrane domain protein 1425 NM_016551 seven transmembrane protein TM7SF3 1426 NM_019839 seven transmembrane receptor BLTR2; leukotriene B4 receptor BLT2 1427 NM_017514 SEX gene 1428 NM_004753 short-chain dehydrogenase/reductase 1 1429 AF310233 Sialic acid binding Ig-like lectin 10 1430 NM_003830 sialic acid binding Ig-like lectin 5 1431 NM_001245 sialic acid binding Ig-like lectin 6 1432 NM_014385 sialic acid binding Ig-like lectin 7 1433 NM_014442 sialic acid binding Ig-like lectin 8 1434 AF282256 Sialic acid binding Ig-like lectin-like 1 1435 NM_023068 sialoadhesin 1436 J04536 sialophorin (gpL115, leukosialin, CD43) 1437 NM_003037 signaling lymphocytic activation molecule 1438 NM_006065 signal-regulatory protein beta 1 1439 NM_018556 signal-regulatory protein beta 2 1440 NM_006928 silver homolog 1441 NM_012449 six transmembrane epithelial antigen of the prostate 1442 AJ306388 SLAM family member 6 1443 AF291815 SLAM family member 7 1444 AF146761 SLAM family member 8 1445 NM_020123 SM-11044 binding protein 1446 NM_002996 small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin) 1447 U84401 smoothened homolog 1448 NM_001038 sodium channel, nonvoltage-gated 1 alpha

1449 NM_002978 sodium channel, nonvoltage-gated 1, delta 1450 NM_001039 sodium channel, nonvoltage-gated 1, gamma 1451 NM_001037 sodium channel, voltage-gated, type I, beta polypeptide 1452 NM_021007 sodium channel, voltage-gated, type II, alpha 2 polypeptide 1453 NM_004588 sodium channel, voltage-gated, type II, beta polypeptide 1454 NM_002977 sodium channel, voltage-gated, type IX, alpha polypeptide 1455 M77235 sodium channel, voltage-gated, type V, alpha polypeptide (long (electrocardiographic) QT syndrome 3) 1456 NM_002976 sodium channel, voltage-gated, type VI, alpha polypeptide 1457 NM_006514 sodium channel, voltage-gated, type X, alpha polypeptide 1458 NM_014139 sodium channel, voltage-gated, type XII, alpha polypeptide 1459 NM_013356 solute carrier 16 (monocarboxylic acid transporters), member 8 1460 NM_004171 solute carrier family 1 (glial high affinity glutamate transporter), member 2 1461 NM_004172 solute carrier family 1 (glial high affinity glutamate transporter), member 3 1462 L14595 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1463 NM_005071 solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6 1464 U03506 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 1465 NM_005628 solute carrier family 1 (neutral amino acid transporter), member 5 1466 NM_003049 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 1467 NM_000452 solute carrier family 10 (sodium/bile acid cotransporter family), member 2 1468 L32185 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 1469 AB004857 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 1470 NM_014585 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3 1471 NM_005072 solute carrier family 12 (potassium/chloride transporters), member 4 1472 NM_005135 solute carrier family 12 (potassium/chloride transporters), member 6 1473 NM_006598 solute carrier family 12 (potassium/chloride transporters), member 7 1474 NM_000339 solute carrier family 12 (sodium/chloride transporters), member 3 1475 NM_000338 solute carrier family 12 (sodium/potassium/chloride transporters), member 1 1476 NM_001046 solute carrier family 12 (sodium/potassium/chloride transporters), member 2 1477 NM_020708 solute carrier family 12, (potassium-chloride transporter) member 5 1478 NM_012450 solute carrier family 13 (sodium/sulfate symporters), member 4 1479 NM_003984 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 1480 NM_022829 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 1481 NM_015865 solute carrier family 14 (urea transporter), member 1 (Kidd blood group) 1482 NM_007163 solute carrier family 14 (urea transporter), member 2 1483 S78203 solute carrier family 15 (H+/peptide transporter), member 2 1484 U13173 solute carrier family 15 (oligopeptide transporter), member 1 1485 L31801 solute carrier family 16 (monocarboxylic acid transporters), member 1 1486 NM_006517 solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter) 1487 NM_004207 solute carrier family 16 (monocarboxylic acid transporters), member 3 1488 NM_004696 solute carrier family 16 (monocarboxylic acid transporters), member 4 1489 NM_004695 solute carrier family 16 (monocarboxylic acid transporters), member 5 1490 NM_004694 solute carrier family 16 (monocarboxylic acid transporters), member 6 1491 NM_004731 solute carrier family 16 (monocarboxylic acid transporters), member 7 1492 NM_005074 solute carrier family 17 (sodium phosphate), member 1 1493 NM_005835 solute carrier family 17 (sodium phosphate), member 2 1494 NM_006632 solute carrier family 17 (sodium phosphate), member 3 1495 NM_003056 solute carrier family 19 (folate transporter), member 1 1496 K03195 solute carrier family 2 (facilitated glucose transporter), member 1 1497 NM_030777 solute carrier family 2 (facilitated glucose transporter), member 10 1498 NM_030807 solute carrier family 2 (facilitated glucose transporter), member 11 1499 J03810 solute carrier family 2 (facilitated glucose transporter), member 2 1500 M20681 solute carrier family 2 (facilitated glucose transporter), member 3 1501 NM_017585 solute carrier family 2 (facilitated glucose transporter), member 6 1502 NM_020041 solute carrier family 2 (facilitated glucose transporter), member 9 1503 NM_003039 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 1504 NM_014580 solute carrier family 2, (facilitated glucose transporter) member 8 1505 NM_013272 solute carrier family 21 (organic anion transporter), member 11 1506 NM_016354 solute carrier family 21 (organic anion transporter), member 12 1507 NM_017435 solute carrier family 21 (organic anion transporter), member 14 1508 NM_005075 solute carrier family 21 (organic anion transporter), member 3 1509 NM_006446 solute carrier family 21 (organic anion transporter), member 6 1510 NM_019844 solute carrier family 21 (organic anion transporter), member 8 1511 NM_007256 solute carrier family 21 (organic anion transporter), member 9 1512 NM_005630 solute carrier family 21 (prostaglandin transporter), member 2 1513 AJ001417 solute carrier family 22 (extraneuronal monoamine transporter), member 3 1514 AF057039 solute carrier family 22 (organic anion transporter), member 6 1515 NM_002555 solute carrier family 22 (organic cation transporter), member 1-like 1516 NM_003059 solute carrier family 22 (organic cation transporter), member 4 1517 NM_003060 solute carrier family 22 (organic cation transporter), member 5 1518 NM_005116 solute carrier family 23 (nucleobase transporters), member 1 1519 NM_005847 solute carrier family 23 (nucleobase transporters), member 2 1520 NM_004727 solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 1521 NM_020344 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2

1522 NM_020689 solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 1523 U14528 solute carrier family 26 (sulfate transporter), member 2 1524 NM_000111 solute carrier family 26, member 3 1525 NM_000441 solute carrier family 26, member 4 1526 NM_004213 solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 1527 NM_004212 solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 1528 NM_004955 solute carrier family 29 (nucleoside transporters), member 1 1529 NM_002394 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 1530 NM_000341 solute carrier family 3 (cystine, dibasic and neutral amino acid transporters), member 1 1531 NM_021194 solute carrier family 30 (zinc transporter), member 1 1532 NM_003459 solute carrier family 30 (zinc transporter), member 3 1533 NM_001859 solute carrier family 31 (copper transporters), member 1 1534 NM_001860 solute carrier family 31 (copper transporters), member 2 1535 NM_003052 solute carrier family 34 (sodium phosphate), member 1 1536 NM_005660 solute carrier family 35 (UDP-galactose transporter), member 2 1537 NM_018964 solute carrier family 37 (glycerol-3-phosphate transporter), member 1 1538 NM_006841 solute carrier family 38, member 3 1539 NM_014579 solute carrier family 39 (zinc transporter), member 2 1540 NM_000342 solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group) 1541 NM_003040 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) 1542 NM_005070 solute carrier family 4, anion exchanger, member 3 1543 NM_032034 solute carrier family 4, sodium bicarbonate transporter-like, member 11 1544 NM_021815 solute carrier family 5 (choline transporter), member 7 1545 NM_006933 solute carrier family 5 (inositol transporters), member 3 1546 NM_014227 solute carrier family 5 (low affinity glucose cotransporter), member 4 1547 NM_000453 solute carrier family 5 (sodium iodide symporter), member 5 1548 NM_000343 solute carrier family 5 (sodium/glucose cotransporter), member 1 1549 M95549 solute carrier family 5 (sodium/glucose cotransporter), member 2 1550 NM_021095 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 1551 NM_007231 solute carrier family 6 (neurotransmitter transporter), member 14 1552 NM_003044 solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 1553 NM_005629 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1554 M95167 solute carrier family 6 (neurotransmitter transporter, dopamine), member 3 1555 NM_003042 solute carrier family 6 (neurotransmitter transporter, GABA), member 1 1556 S75989 solute carrier family 6 (neurotransmitter transporter, GABA), member 11 1557 NM_016615 solute carrier family 6 (neurotransmitter transporter, GABA), member 13 1558 NM_004211 solute carrier family 6 (neurotransmitter transporter, glycine), member 5 1559 S70609 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 1560 S80071 solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 1561 NM_001043 solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 1562 X70697 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1563 Z18956 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1564 NM_003045 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1565 NM_003046 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1566 AJ000730 solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 1567 AF077866 solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 1568 NM_003983 solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 1569 NM_003982 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 1570 NM_012244 solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 1571 NM_014270 solute carrier family 7 (cationic amino acid transporter, y+ system), member 9 1572 NM_017965 solute carrier family 7, (cationic amino acid transporter, y+ system) member 10 1573 NM_014331 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 1574 NM_021097 solute carrier family 8 (sodium/calcium exchanger), member 1 1575 M81768 solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive) 1576 U28043 solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 1577 NM_004594 solute carrier family 9 (sodium/hydrogen exchanger), isoform 5 1578 NM_001049 somatostatin receptor 1 1579 M81830 somatostatin receptor 2 1580 NM_001051 somatostatin receptor 3 1581 NM_001052 somatostatin receptor 4 1582 NM_001053 somatostatin receptor 5 1583 NM_003105 sortilin-related receptor, L(DLR class) A repeats-containing 1584 S67798 sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) 1585 NM_003080 sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) 1586 NM_032038 spinster-like protein 1587 NM_015136 stabilin 1 1588 NM_017564 stabilin-2 1589 NM_003498 stannin 1590 NM_003156 stromal interaction molecule 1 1591 NM_001041 sucrase-isomaltase 1592 NM_018969 super conserved receptor expressed in brain 3 1593 NM_013437 suppression of tumorigenicity 1594 NM_021978 suppression of tumorigenicity 14 (colon carcinoma, matriptase, epithin)

1595 NM_004711 synaptogyrin 1 1596 NM_004710 synaptogyrin 2 1597 NM_004209 synaptogyrin 3 1598 NM_012451 synaptogyrin 4 1599 X06389 synaptophysin 1600 NM_005639 synaptotagmin I 1601 NM_003180 synaptotagmin V 1602 D38522 Synaptotagmin-11 1603 AB102948 Synaptotagmin-14 1604 AB109022 Synaptotagmin-15 1605 NM_002997 syndecan 1 1606 J04621 syndecan 2 (heparan sulfate proteoglycan 1, cell surface-associated, fibroglycan) 1607 NM_014654 syndecan 3 (N-syndecan) 1608 NM_002999 syndecan 4 (amphiglycan, ryudocan) 1609 NM_014723 syntaphilin 1610 NM_004603 syntaxin 1A (brain) 1611 NM_003163 syntaxin 1B 1612 NM_004177 syntaxin 3A 1613 NM_004604 syntaxin 4A (placental) 1614 NM_004853 syntaxin 8 1615 NM_005816 T cell activation, increased late expression 1616 S62045 tachykinin receptor 1 1617 M57414 tachykinin receptor 2 1618 M89473 tachykinin receptor 3 1619 NM_000116 tafazzin (cardiomyopathy, dilated 3A (X-linked); endocardial fibroelastosis 2; Barth syndrome) 1620 AF494231 Taste receptor type 2 member 38 1621 AF494230 Taste receptor type 2 member 39 1622 AF494229 Taste receptor type 2 member 40 1623 AF494232 Taste receptor type 2 member 41 1624 AF494237 Taste receptor type 2 member 43 1625 AF494228 Taste receptor type 2 member 44 1626 AF494226 Taste receptor type 2 member 45 1627 AY114091 Taste receptor type 2 member 46 1628 AF494233 Taste receptor type 2 member 47 1629 AF494234 Taste receptor type 2 member 48 1630 AF494236 Taste receptor type 2 member 49 1631 AF494235 Taste receptor type 2 member 50 1632 AY724953 Taste receptor type 2 member 55 1633 AY114094 Taste receptor type 2 member 60 1634 NM_019599 taste receptor, type 2, member 1 1635 AF227136 taste receptor, type 2, member 10 1636 AF227137 taste receptor, type 2, member 13 1637 AF227138 taste receptor, type 2, member 14 1638 NM_016945 taste receptor, type 2, member 16 1639 NM_016943 taste receptor, type 2, member 3 1640 NM_016944 taste receptor, type 2, member 4 1641 NM_018980 taste receptor, type 2, member 5 1642 AF227133 taste receptor, type 2, member 7 1643 AF227134 taste receptor, type 2, member 8 1644 AF227135 taste receptor, type 2, member 9 1645 NM_006019 T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3 1646 NM_015686 TED protein 1647 L06139 TEK tyrosine kinase, endothelial (venous malformations, multiple cutaneous and mucosal) 1648 NM_022144 tenomodulin protein 1649 X14253 Teratocarcinoma-derived growth factor 1 precursor (Cripto-1 growth factor) (CRGF) 1650 M96956 Teratocarcinoma-derived growth factor 2(Cripto-3 growth factor) 1651 NM_001120 tetracycline transporter-like protein 1652 NM_006675 tetraspan transmembrane 4 super family 1653 NM_012466 tetraspanin TM4-B 1654 NM_000361 thrombomodulin 1655 NM_001061 thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V) 1656 NM_001060 thromboxane A2 receptor 1657 NM_006288 Thy-1 cell surface antigen 1658 NM_033051 thymic stromal co-transporter 1659 Y00406 Thyroid peroxidase 1660 NM_000369 thyroid stimulating hormone receptor 1661 NM_013381 thyrotropin-releasing hormone degrading ectoenzyme 1662 NM_003301 thyrotropin-releasing hormone receptor 1663 NM_032036 TLH29 protein precursor 1664 NM_018676 TMTSP for transmembrane molecule with thrombospondin module 1665 NM_030956 toll-like receptor 10 1666 NM_003264 toll-like receptor 2 1667 NM_003265 toll-like receptor 3

1668 NM_003266 toll-like receptor 4 1669 NM_016562 toll-like receptor 7 1670 NM_016610 toll-like receptor 8 1671 NM_017442 toll-like receptor 9 1672 NM_012288 TRAM-like protein 1673 X01060 transferrin receptor (p90, CD71) 1674 NM_003227 transferrin receptor 2 1675 K03222 transforming growth factor, alpha 1676 L11695 transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD) 1677 D50683 transforming growth factor, beta receptor II (70-80kD) 1678 L07594 transforming growth factor, beta receptor III (betaglycan, 300kD) 1679 NM_003304 transient receptor potential cation channel, subfamily C, member 1 1680 NM_003305 transient receptor potential cation channel, subfamily C, member 3 1681 NM_016179 transient receptor potential cation channel, subfamily C, member 4 1682 NM_012471 transient receptor potential cation channel, subfamily C, member 5 1683 NM_002420 transient receptor potential cation channel, subfamily M, member 1 1684 NM_003307 transient receptor potential cation channel, subfamily M, member 2 1685 NM_017636 transient receptor potential cation channel, subfamily M, member 4 1686 NM_014555 transient receptor potential cation channel, subfamily M, member 5 1687 NM_024080 transient receptor potential cation channel, subfamily M, member 8 1688 NM_018727 transient receptor potential cation channel, subfamily V, member 1 1689 NM_015930 transient receptor potential cation channel, subfamily V, member 2 1690 NM_021625 transient receptor potential cation channel, subfamily V, member 4 1691 NM_019841 transient receptor potential cation channel, subfamily V, member 5 1692 NM_012338 transmembrane 4 superfamily member (tetraspan NET-2) 1693 NM_012339 transmembrane 4 superfamily member (tetraspan NET-7) 1694 M90657 transmembrane 4 superfamily member 1 1695 NM_004615 transmembrane 4 superfamily member 2 1696 NM_004616 transmembrane 4 superfamily member 3 1697 NM_004617 transmembrane 4 superfamily member 4 1698 NM_003963 transmembrane 4 superfamily member 5 1699 NM_003271 transmembrane 4 superfamily member 7 1700 NM_023003 transmembrane 6 superfamily member 1 1701 NM_003272 transmembrane 7 superfamily member 1 (upregulated in kidney) 1702 NM_004800 transmembrane 9 superfamily member 2 1703 NM_024082 transmembrane gamma-carboxyglutamic acid protein 3 1704 NM_024081 transmembrane gamma-carboxyglutamic acid protein 4 1705 NM_005656 transmembrane protease, serine 2 1706 NM_016425 transmembrane protease, serine 4 1707 NM_030770 transmembrane protease, serine 5 (spinesin) 1708 NM_013390 transmembrane protein 2 1709 NM_031440 transmembrane protein 7 1710 NM_021259 transmembrane protein 8 (five membrane-spanning domains) 1711 NM_031925 transmembrane protein induced by tumor necrosis factor alpha 1712 NM_017599 transmembrane protein vezatin 1713 NM_003692 transmembrane protein with EGF-like and two follistatin-like domains 1 1714 NM_016192 transmembrane protein with EGF-like and two follistatin-like domains 2 1715 NM_007180 trehalase (brush-border membrane glycoprotein) 1716 NM_018643 triggering receptor expressed on myeloid cells 1 1717 NM_018965 triggering receptor expressed on myeloid cells 2 1718 X85960 TRK-fused gene 1719 NM_012467 tryptase gamma 1 1720 NM_018153 tumor endothelial marker 8 1721 NM_003810 tumor necrosis factor (ligand) superfamily, member 10 1722 AF019047 tumor necrosis factor (ligand) superfamily, member 11 1723 NM_003809 tumor necrosis factor (ligand) superfamily, member 12 1724 NM_006573 tumor necrosis factor (ligand) superfamily, member 13b 1725 NM_003807 tumor necrosis factor (ligand) superfamily, member 14 1726 NM_005118 tumor necrosis factor (ligand) superfamily, member 15 1727 NM_005092 tumor necrosis factor (ligand) superfamily, member 18 1728 NM_003326 tumor necrosis factor (ligand) superfamily, member 4 (tax-transcriptionally activated glycoprotein 1, 34kD) 1729 NM_000074 tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome) 1730 NM_000639 tumor necrosis factor (ligand) superfamily, member 6 1731 L08096 tumor necrosis factor (ligand) superfamily, member 7 1732 NM_001244 tumor necrosis factor (ligand) superfamily, member 8 1733 NM_003811 tumor necrosis factor (ligand) superfamily, member 9 1734 X01394 tumor necrosis factor (TNF superfamily, member 2) 1735 NM_003844 tumor necrosis factor receptor superfamily, member 10a 1736 AF016268 tumor necrosis factor receptor superfamily, member 10b 1737 AF016267 tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain 1738 AF029761 tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain 1739 NM_003839 tumor necrosis factor receptor superfamily, member 11a, activator of NFKB 1740 NM_003790 tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)

1741 NM_012452 tumor necrosis factor receptor superfamily, member 13B 1742 NM_003820 tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) 1743 NM_004195 tumor necrosis factor receptor superfamily, member 18 1744 NM_018647 tumor necrosis factor receptor superfamily, member 19 1745 M33294 tumor necrosis factor receptor superfamily, member 1A 1746 M32315 tumor necrosis factor receptor superfamily, member 1B 1747 NM_014452 tumor necrosis factor receptor superfamily, member 21 1748 NM_003327 tumor necrosis factor receptor superfamily, member 4 1749 X60592 tumor necrosis factor receptor superfamily, member 5 1750 M67454 tumor necrosis factor receptor superfamily, member 6 1751 M63928 tumor necrosis factor receptor superfamily, member 7 1752 M83554 tumor necrosis factor receptor superfamily, member 8 1753 NM_001561 tumor necrosis factor receptor superfamily, member 9 1754 NM_002354 tumor-associated calcium signal transducer 1 1755 NM_002353 tumor-associated calcium signal transducer 2 1756 NM_016639 type I transmembrane protein Fn14 1757 NM_012410 type I transmembrane receptor (seizure-related protein) 1758 NM_003332 TYRO protein tyrosine kinase binding protein 1759 D17517 TYRO3 protein tyrosine kinase 1760 NM_005424 tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1761 NM_025217 UL16 binding protein 2 1762 NM_024518 UL16 binding protein 3 1763 NM_003728 unc-5 homolog B (C. elegans) 1764 NM_007000 uroplakin 1A 1765 NM_006952 uroplakin 1B 1766 AB000450 vaccinia related kinase 2 1767 NM_003574 VAMP (vesicle-associated membrane protein)-associated protein A (33kD) 1768 NM_004738 VAMP (vesicle-associated membrane protein)-associated protein B and C 1769 NM_004666 vanin 1 1770 NM_004665 vanin 2 1771 NM_018399 vanin 3 1772 M30257 vascular cell adhesion molecule 1 1773 NM_004624 vasoactive intestinal peptide receptor 1 1774 NM_003382 vasoactive intestinal peptide receptor 2 1775 L07868 v-erb-a erythroblastic leukemia viral oncogene homolog 4 1776 M11730 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog 1777 M29366 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 1778 NM_003383 very low density lipoprotein receptor 1779 U64520 vesicle-associated membrane protein 3 (cellubrevin) 1780 NM_003761 vesicle-associated membrane protein 8 (endobrevin) 1781 AF440756 Vitelliform macular dystrophy 2-like protein 1 1782 AF440757 Vitelliform macular dystrophy 2-like protein 2 1783 AK096459 Vitelliform macular dystrophy 2-like protein 3 1784 AH006947 Vitelliform macular dystrophy protein 2 1785 X06182 v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 1786 NM_018400 voltage-gated sodium channel beta-3 subunit (scn3b gene) 1787 M34353 v-ros UR2 sarcoma virus oncogene homolog 1 1788 NM_018117 WD40 repeat domain 11 protein 1789 NM_020208 X transporter protein 3 1790 NM_003399 X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound 1791 AC004126 Zona pellucida glycoprotein 1 1792 NM_003460 zona pellucida glycoprotein 2 (sperm receptor) 1793 NM_007155 zona pellucida glycoprotein 3A (sperm receptor) 1794 NM_021186 zona pellucida glycoprotein 4 1795 AL355990 solute carrier family 6 (neurotransmitter transporter), member 17