Robust Distal Tip Cell Pathfinding in the Face of Temperature Stress Is

GENETICS | INVESTIGATION

Robust Distal Tip Cell Pathﬁnding in the Face of Temperature Stress Is Ensured by Two Conserved microRNAS in Caenorhabditis elegans

Samantha L. Burke,* Molly Hammell,† and Victor Ambros*,1 *Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, Massachusetts 01605, and †Watson School of Biological Sciences, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724

ABSTRACT Biological robustness, the ability of an organism to maintain a steady-state output as genetic or environmental inputs change, is critical for proper development. MicroRNAs have been implicated in biological robustness mechanisms through their post- transcriptional regulation of genes and gene networks. Previous research has illustrated examples of microRNAs promoting robustness as part of feedback loops and genetic switches and by buffering noisy gene expression resulting from environmental and/or internal changes. Here we show that the evolutionarily conserved microRNAs mir-34 and mir-83 (homolog of mammalian mir-29) contribute to the robust migration pattern of the distal tip cells in Caenorhabditis elegans by specifically protecting against stress from temperature changes. Furthermore, our results indicate that mir-34 and mir-83 may modulate the integrin signaling involved in distal tip cell migration by potentially targeting the GTPase cdc-42 and the beta-integrin pat-3. Our findings suggest a role for mir-34 and mir- 83 in integrin-controlled cell migrations that may be conserved through higher organisms. They also provide yet another example of microRNA-based developmental robustness in response to a specific environmental stress, rapid temperature fluctuations.

KEYWORDS mir-34; mir-83; mir-29; distal tip cell migrations; robustness

HE ability of a living system to maintain a steady-state as stage-speciﬁc diapause (Baugh and Sternberg 2006; Fu- Toutput in the face of environmental and physiological kuyama et al. 2006; Ruaud and Bessereau 2006; Schindler stresses is referred to as biological robustness (Kitano 2004). et al. 2014) and proceeding to the dauer larvae stage, an Organisms must be able to compensate for adverse changes alternative third larval stage that allows C. elegans to in gene expression caused by environmental stresses and lengthen their lifespan and survive food deprivation or heat internal gene expression noise if development is to proceed stress (Cassada and Russell 1975; Liu et al. 1995). unchanged. The nematode Caenorhabditis elegans is a useful MicroRNAs (miRNAs) are single-stranded RNAs of 22 model for studying such robustness. C. elegans development nucleotides that negatively regulate the translation of their has been mapped to a cell-by-cell level, such that we know target messenger RNAs (mRNAs) by binding to their 39 un- exactly when cell divisions occur and what the fate of each translated region (39 UTR) as part of a protein–RNA com- cell is (Sulston 1976; Sulston and Horvitz 1977; Kimble and plex called the miRNA-induced silencing complex (miRISC). Hirsh 1979; Sulston et al. 1983). There is also extensive Target recognition is determined by the miRNA’s seed se- research on the worm’s responses to stress, including quence, nucleotides two through seven (reviewed in Ambros stress-induced alternative larval developmental choices such 2004; Bartel 2004). miRNAs with the same seed sequence can presumably regulate the same target mRNAs and are grouped together within a miRNA family (reviewed in Bartel Copyright © 2015 by the Genetics Society of America doi: 10.1534/genetics.115.179184 2009). In addition to being regulated by multiple members Manuscript received March 12, 2015; accepted for publication June 10, 2015; of a miRNA family, an mRNA can be cotargeted by multiple published Early Online June 15, 2015. distinct miRNAs families, if it contains the corresponding Available freely online through the author-supported open access option. Supporting information is available online at www.genetics.org/lookup/suppl/ distinct seed-complementary sites. Such interfamily and doi:10.1534/genetics.115.179184/-/DC1. intrafamily cotargeting is considered one reason why 1Corresponding author: Program in Molecular Medicine, Biotech Two, Suite 306, 373 Plantation St., University of Massachusetts Medical School, Worcester, MA 01605. most single miRNA gene deletion mutants in C. elegans do E-mail: [email protected] not display apparent phenotypes; although one negative

Genetics, Vol. 200, 1201–1218 August 2015 1201 regulator is deleted, the target mRNAs in question remain mir-83(n4638); mir-34(gk437) mutants have a decreased under the regulation of additional, functionally redundant lifespan and decreased fecundity, suggesting that the loss miRNAs (Miska et al. 2007; Alvarez-Saavedra and Horvitz of these two miRNAs has repercussions for the biological 2010). Findings reported by the Abbott lab exemplified this fitness of the animals. phenomenon (Brenner et al. 2010). They screened for developmental phenotypes resulting from miRNA deletions in Materials and Methods genetically sensitized backgrounds, in which the miRNA- specific argonaute protein alg-1 was no longer functional. C. elegans strains In the alg-1 mutant background, overall miRNA production The C. elegans Bristol N2 strain was used as wild type in the is partially compromised, such that the additional deletion study (Brenner 1974). Additional strains are listed in Table of an otherwise redundant single miRNA can result in target S2. Both the n4638 and gk437 alleles were backcrossed to deregulation and visible phenotypes. N2 four times upon receipt. The VT2595 strain was used as In their study, the Abbott lab members identified six the mir-83(n4638); mir-34(gk437) double mutant except miRNAs involved in gonad morphogenesis (Brenner et al. when VT3289 is explicitly discussed in Figure 2C. 2010), a normally robust developmental process that is dependent on the migration of two distal tip cells (DTCs) C. elegans maintenance (reviewed in Wong and Schwarzbauer 2012). One of these Strains were maintained using standard procedures on miRNAs included mir-83, a miRNA that is highly conserved nematode growth media (NGM) plates seeded with Escher- in animals, including mammals (known as mir-29, Support- ichia coli strain HB101 (Brenner 1974), unless explicitly ing Information, Figure S1) (Lagos-Quintana et al. 2001, stated as being raised on OP50. Strains were raised at 20° 2002; Lau 2001; Mourelatos et al. 2002; Dostie et al. unless otherwise stated when temperature was oscillated. 2003; Lim et al. 2003; Lim 2003; Michael et al. 2003; Suh et al. 2004; Poy et al. 2004; Landgraf et al. 2007; Lui et al. Sequence alignments, target prediction, and fi 2007). Mammalian mir-29 has been previously implicated in statistical signi cance regulating cellular proliferation, differentiation, apoptosis, MicroRNA sequences were supplied by miRBase (Lagos- and the extracellular matrix (reviewed in Boominathan Quintana et al. 2001; Lau 2001; Lagos-Quintana et al. 2010; Kriegel et al. 2012). To better understand how mir-83 2002; Mourelatos et al. 2002; Ambros et al. 2003; Aravin functions, we set out to determine its mRNA targets and et al. 2003; Dostie et al. 2003; Grad et al. 2003; Houbaviy miRNA coregulators in C. elegans. Using mirWIP (Hammell et al. 2003; Lim et al. 2003; Lim 2003; Michael et al. 2003; et al. 2008), we noticed an overlap between the predicted Sempere et al. 2003; Griffiths-Jones 2004; Poy et al. 2004; mRNA targets for mir-83 and mir-34, another miRNA that is Suh et al. 2004; Griffiths-Jones et al. 2006, 2008; Landgraf conserved between nematodes and mammals (Figure S1, Ta- et al. 2007; Lui et al. 2007; Kozomara and Griffiths-Jones ble S1) (Lau 2001; Ambros et al. 2003; Grad et al. 2003; 2011, 2014) and aligned by eye. Predicted targets were Houbaviy et al. 2003; Lim et al. 2003; Lim 2003; Landgraf identified using mirWIP (Hammell et al. 2008). Throughout et al. 2007). mir-34 has been shown to have tumor suppressor the manuscript, three significance asterisks (***) are used activity in mammalian systems. There, its transcription is ac- for a P-value of #0.005, two (**) for a P-value .0.005 and tivated by p53 and it functions to reinforce p53 negative reg- #0.01, and one (*) for a P-value .0.01 and #0.05. ulation (reviewed in He et al. 2007; Yamakuchi and Migration defective phenotype scoring Lowenstein 2009; Hermeking 2009; Rokavec et al. 2014). To further understand the roles of mir-83 and mir-34,we Hypochlorite treatment (Stiernagle 2006) was used to iso- tested for genetic redundancy by creating the double mutant late embryos. Where noted, synchronized populations were and looking at developmental phenotypes. We also identi- created by allowing embryos to hatch in M9 buffer for 24 fied potential targets of mir-34 and mir-83 by tests of ge- hr (Johnson et al. 1984). Embryos or starved L1’s were then netic suppression. mir-83(n4638); mir-34(gk437) double plated on HB101-seeded NGM plates and raised to adult- mutants display a defect in gonad morphogenesis. In addi- hood in the temperature scheme noted. Day one adults were tion, this defect reflects a loss of developmental robustness; paralyzed in 100 mM levamisole, mounted on 2% agarose the mir-83(n4638); mir-34(gk437) phenotype is signifi- pads, and scored using a Zeiss Axioskop differential inter- cantly enhanced in response to temperature changes but ference contrast (DIC) microscope and a 363 objective. A not by other environmental stresses that we tested. Based two-proportion z-test was used to determine significant dif- on our results, we conclude that mir-34 and mir-83 function ferences between counts except where triplicates are pre- together to help create or maintain robust function of the sented. In such cases mean values were compared using genetic network controlling gonad morphogenesis, such an unpaired t-test performed by PRISM. that the development of this important organ is protected Temperature oscillations from the temperature changes C. elegans may encounter, either the rapid oscillations tested here or subtler changes Temperature oscillations were performed using modified MJ experienced in the wild. Furthermore, we observed that Research Programable Thermocyclers. First, the Thermocyclers’

1202 S. L. Burke, M. Hammell, and V. Ambros lids were removed. Next, a 0.25-inch-thick aluminum plate Array maEx246 was generated from the pSLB054- and was attached to the heat block using silicone-based thermal pSLB056-containing injection mix, while array maEx247 conductive grease. Original lids were replaced by insulating was made from the pSLB071 and pSLB075 mix. The array covers constructed out of styrofoam. HB101-seeded NGM carrying strains, VT3118 (for maEx246) and VT3145 (for plates containing worms were placed inside the modified maEx247), were crossed to N2 males to cross out the mir- device, in contact with the aluminum plate. To assess the 83(n4638) and mir-34(gk437) deletions, generating strains thermal dynamics of the system, a thermometer was embed- VT3136 and VT3178, respectively. ded in an NGM plate and the temperature of the agar was RNAi monitored during programmed temperature cycles. We observed that the temperature of NGM plates did cycle in ac- RNA-mediated interference (RNAi) was performed by rais- cordance with the Thermocycler program, although not as ing animals on dsRNA-producing E. coli as described in quickly as the heat block itself; we observed an 15- to 30- Kamath et al. (2001). Synchronized L1’s were placed on sec delay as the NGM cools or heats. Stated temperature cdc-42 RNAi food, pat-3 RNAi food, or empty vector control cycles refer to the program run by the Thermocycler. food, and raised to young adulthood with the temperature scheme stated. Animals were scored as previously described. Electron microscopy Target reporter scoring N2 and mir-83(n4638) IV; mir-34(gk437) X embryos were isolated using hypochlorite treatment, hatched in M9 buffer Hypochlorite treatment was used to isolate embryos, which for 24 hr and plated as synchronized L1’sonHB101- were hatch in M9 to generate synchronized L1’s. Worms seeded NGM plates. Worms were raised with temperature were plated on HB101-seeded NGM plates and raised with oscillations: 20° for 16 hr (15° for 15 min, 25° for 15 min, temperature oscillations: 20° for 16 hr (15° for 15 min, 25° repeat three additional times), 20° until young adulthood. for 15 min, repeat three additional times), 20° until time of Worms were fixed and prepared for electron microscopy as scoring. L1 animals were scored starting 18 hr postplating, previously described (Irazoqui et al. 2010) except they were immediately following temperature oscillations. L3 animals cut below the pharynx rather than in half to preserve gonad were scored starting 43 hr postplating, shortly after the molt morphology. Electron microscopy work was performed by from L2 to L3. Adults were scored starting 67 hr postplating, the University of Massachusetts Medical School Electron Mi- after egg laying had commenced. croscopy Core Facility. Worms were suspended in 100 mM levamisole, mounted on 2% agarose pads, and scored using a Leica TCS SPE confocal Cloning and transgenics microscope. For cdc-42 reporters, DTCs were first identified in Constructs were created using Life Technologies Gateway the DIC setting by eye using the 363 objective. The confocal Cloning. Except where otherwise stated, gene fragments microscopy setting was subsequently used for imaging and were first amplified from N2 genomic DNA using the primers quantifying the mean value florescence of each channel for listed in Table S3. PCR was next used to add the proper att a DTC using the Leica LAS AF software. For pat-3 reporters, sequences such that fragments could be moved into the the 310 objective was used to observe whole animals. A 30- appropriate Gateway DONR vector, as described in the Gate- step z-series was taken per worm. The Leica AF software was way Protocol. For the mir-34 promoter, the 5-kb promoter used to quantify mean value fluorescence for each channel was digested from a separate plasmid and ligated to a mod- using the z-stack maximum projection. Datasets were compared ified 476p5Emcs (a gift from Nathan Lawson’s lab, modified using an unpaired t-test performed by PRISM. to remove unnecessary SalI cut sites) to add the necessary Brood size counts att sites. For mutated 39 UTRs, DNA fragments of the desired sequence were created de novo by GeneWiz. The constructed N2 and mir-83(n4638) IV; mir-34(gk437) X embryos were DONR vectors, along with two commercially available vec- isolated using hypochlorite treatment and left in M9 buffer tors, were then used for transgene construction as described for 24 hr to hatch. Arrested L1’s were then plated on in the Gateway Protocol (Table S4). The destination vectors HB101-seeded NGM plates and either raised at 20° contin- were developed for the Mos1-mediated single-copy insertion uously or with temperature oscillations from hour 16 to technique (Frøkjaer-Jensen et al. 2008), which was used to hour 18 postplating [labeled “cycled”—20° for 16 hr (15° generate transgenic strains (Table S2). Multicopy arrays for 15 min, 25° for 15 min, repeat three additional times), were generated for cdc-42 and pat-3 GFP/mCherry report- 20° until death]. Worms were individually plated as L4’s, ers. mir-83(n4638) IV; mir-34(gk437) X males were first and the number of live offspring were counted from the start crossed to EG6701 to create a unc-119(ed3) III; mir- of egg laying until its end. Mean values were compared 83(n4638) IV; mir-34(gk437) X strain (VT3087). VT3087 using an unpaired t-test performed by PRISM. was subsequently injected with a mix of pBluescript SK+ Mating assays (30 ng/ml), pIF9 (15 ng/ml), pCFJ150 (30 ng/ml), pCFJ210 (30 ng/ml), and either pSLB054 (3 ng/ml) and pSLB056 N2 and mir-83(n4638) IV; mir-34(gk437) X embryos were (3 ng/ml) or pSLB071 (3 ng/ml) and pSLB075 (3 ng/ml). isolated using hypochlorite treatment and left in M9 buffer

mir-34 and mir-83 in DTC Migrations 1203 for 24 hr to hatch. Arrested L1’s were then plated on 1981; Hedgecock et al. 1987). Both DTCs are born near HB101-seeded NGM plates and either raised at 20° contin- the midbody during the first larval stage and begin to mi- uously or with temperature oscillations from hour 16 to grate along the ventral body wall muscles toward the head hour 18 postplating [labeled “cycled”—20° for 16 hr (15° and tail during the second larval stage, referred to as phase for 15 min, 25° for 15 min, repeat three additional times), 1 of migration (Hirsh et al. 1976; Kimble and Hirsh 1979; 20° until death]. Once they reached adulthood, hermaphro- Kimble and White 1981). During phase 2, DTCs first turn dites were transferred daily away from progeny until the dorsally to migrate from the ventral to the dorsal body wall ability to lay eggs was exhausted (day four of adulthood). muscle, crossing the hypodermis in the process (Hedgecock Each hermaphrodite was then moved to an individual plate, et al. 1987). A second turn is required to continue migration to which four 1-day-old adult N2 males were added. Ani- along the dorsal body wall muscles and return to the mid- mals were allowed to mate for 3 days, at which point the body (phase 3), creating two U-shaped gonad arms (Figure males were removed. The total number of offspring that 1A) (Hirsh et al. 1976; Kimble and Hirsh 1979; Hedgecock hatched were counted for each hermaphrodite from the start et al. 1987). The final shape of the gonad arms can be used of the assay until its death. to deduce the path taken by each DTC. In a fraction of mir- 83(n4638); mir-34(gk437) mutants (26% at 20°, quantified Lifespan assays in Figure 2), anterior and posterior gonad arms appear dis- Survival assays were performed similarly to previously placed at various positions, improperly crossing the dorsal/ described (Kenyon et al. 1993). N2 and mir-83(n4638) IV; ventral axis (Figure 1B). These misplaced gonad arms sug- mir-34(gk437) X embryos were isolated using hypochlorite gest DTCs wandered from the proper path during phase 1 treatment and left in M9 buffer for 24 hr to hatch. Arrested and/or phase 3 of migration and often migrated too far and L1’s were then plated on HB101-seeded NGM plates and past the developing vulva. The penetrance of this overexten- either raised at 20° continuously or with temperature oscil- sion phenotype was highly variable and overextension was lations from hour 16 to hour 18 postplating [labeled observed to occur either with or without wandering during “cycled”—20° for 16 hr (15° for 15 min, 25° for 15 min, phase 1 and/or phase 3. Unlike some classes of C. elegans repeat three additional times), 20° until death]. To track migration mutants, DTCs in mir-83(n4638); mir-34(gk437) survival, 100 worms per replicate and three replicated per mutants execute both their first (dorsal) and second (ante- condition were moved to a new HB101-seeded NGM plate rior/posterior) turns at the proper positions in the animals as L4’s. Worms were transferred to a new plate daily during and at the proper times in development. The migration de- the course of the assay to avoid overcrowding from the off- fect of these mutants therefore reflects a defect in the precise spring. Worms were scored as alive or dead based on re- pathfinding of the DTCs as they migrate longitudinally along action to a gentle nose prod using a standard worm pick. the ventral or dorsal muscle. To score this phenotype we Animals were tracked until their death. Any worms that died categorized gonad arms as either migration defective or nor- as a consequence of crawling up the side of the plate were mal. Gonad arms were categorized as migration defective if removed from the assay. Replicates were used to calculate their abnormal shape indicated that the DTC had improperly percent survival and the standard deviation for each day. crossed the dorsal/ventral axis during its migration, or that Mean values for individual days were compared using the DTC migrated completely past the vulva before stopping. a two sample t-test for means. Previously published findings indicated a low level of migra- Additional stresses tion defects in the N2 strain (Peters et al. 2013). These included such phenotypes as DTCs stopping slightly short of Animals was raised on NGM plates containing 0.03% the vulva and a slight ventralward “dip” of the DTCs when sodium arsenite to induce oxidative stress (Sahu et al. migration ceases. We observed such phenotypes as well, but 2013). Incubation in 1% SDS for 30 min was used to isolate due to their occurrence in N2 we classified such cases as dauer animals from starved plates (Stiernagle 2006). Ani- within normal variation and did not score them as migration mals were raised on Pseudomonas auruginosa PA14 plates as defects. It is also important to note that in the previously previously described (Powell and Ausubel 2008). mentioned study (Peters et al. 2013), strains were raised at 23° rather than 20°. Results DTC wandering results in displaced gonad arms, which is reflected in a reorganization of the internal organs. Improper distal tip cell migration paths in mir-83(n4638); To visualize this reorganization in mir-83(n4638); mir- mir-34(gk437) mutants 34(gk437) mutants, we performed electron microscopy on The shape of the C. elegans adult hermaphrodite gonad is cross-sections of adult worms. We first collected 20 mir- determined by the migration of two DTCs, somatic gonadal 83(n4638); mir-34(gk437) worms whose anterior arm dis- cells at the tip of each gonad arm that drag the proliferative played a migration defect. These mutants and age-matched portion of the gonad with them as they migrate during the N2’s were fixed and processed for electron microscopy. As second through fourth larval stages of hermaphrodite de- previously described, in N2 worms the intestine spans the velopment (Kimble and Hirsh 1979; Kimble and White dorsal/ventral axis (Figure 1C) (Hall and Altun 2008). The

1204 S. L. Burke, M. Hammell, and V. Ambros Figure 1 mir-83(n4638); mir-34(gk437) mutants have gonad migration defects. (A) The C. elegans gonad consists of two U-shaped gonad arms. The shape of each arm is created by the migration path of the DTC. The two DTCs are initially located ventrally near the midbody. Each DTC migrates away from the midbody before turning dorsally, migrating to the dorsal body wall muscle, and then migrating back toward the midbody. The path of each DTC can be inferred by the location of the respective gonad arm. Body wall muscle in red, germline in gray, DTCs in black, uterus designated with “U.” (B) mir-83(n4638); mir-34(gk437) mutants have a gonad migration defect. The improper location of the mature gonad arms implies that DTCs did not migrate along the normal path. In the arm pictured (bottom), the DTC (black arrow) migrated too far, passing the vulva (white asterisk), and is displaced ventrally, as compared to N2 (top). Penetrance quantified in Figure 2. (C) Improper DTC migration causes a rearrangement of internal organs, due to space constraints. In N2 worms, the intestine is positioned laterally with respect to the dorsal/ventral axis (indicated by a white, dashed line), and the proximal and distal segments of the gonad are positioned ventrally and dorsally, respectively, on the other side from the intestine. In the mir-83(n4638); mir-34(gk437) worm shown here, the displaced gonad caused a displacement of the intestine. Black arrowheads point to the adult lat- eral alae, which are positioned on the left and right sides of the animal. oocyte-containing proximal gonad is located ventrally while we reasoned that the functions of these miRNAs in DTC the distal gonad is dorsal (Hall and Altun 2008). For a DTC migration could be relatively unimportant under standard to wander from the appropriate migration path, it must dis- laboratory conditions, but perhaps more critical under place the intestine. In addition, the somatic gonad itself will stressful conditions. Therefore, we tested for enhancement be displaced as it trails behind the migrating DTC. This of the DTC migration phenotype in worms exposed to vari- rearrangement of internal organs, with the intestine, distal ous stresses. We observed no change in the penetrance of gonad arm, and proximal gonad arm all displaced, was vis- the phenotype when mutants were exposed continuously ible in both of the two mir-83(n4638); mir-34(gk437) throughout development to high temperature (25°) or low mutants sectioned and visualized (Figure 1C). temperature (15°) or to a diet of pathogenic P. aeruginosa, oxidative stress (0.03% arsenic), or starvation during early The penetrance of the migration defect is significantly larval stages to induce dauer formation (Table S5). How- enhanced by oscillating temperature ever, an enhanced phenotype was observed when worms We first sought to quantify the penetrance of the migration developed under a changing temperature regimen (Figure defect in mir-83(n4638); mir-34(gk437) worms raised in 2B), a phenomenon previously observed for mir-7 Drosoph- standard laboratory conditions, namely on E. coli-seeded ila mutants in the context of Drosophila eye development (Li NGM plates kept at 20° (Brenner 1974). As expected, the et al. 2009). Semisynchronized populations of developing DTCs migrate properly in N2 worms in the majority of larvae were exposed to a regimen of temperature changes worms (2 6 2% migration defective, performed in triplicate, every 15 min—first from 15° to 25°, and then back to 15°, Figure 2A). Both mir-34(gk437) and mir-83(n4638) single and so on. The DTC migrations of N2 worms were unaf- mutant populations display migration defects at a low fre- fected by temperature oscillations (0 6 0%). All three mu- quency, 10.67 6 1.15% and 8 6 0%, respectively. The phe- tant strains [mir-34(gk437) and mir-83(n4638) single notype’s penetrance is significantly enhanced to 26 6 7.21% mutants and the mir-83(n4638); mir-34(gk437) double mu- in the mir-83(n4638); mir-34(gk437) double mutant (P # tant] showed an enhanced penetrance of the DTC migration 0.05, unpaired t-test), suggesting that the two miRNAs con- defective phenotype under oscillating temperature com- tribute partially redundant functions in the context of DTC pared to constant temperature (20°); from 10.67 6 1.15% migration. to 28 6 5.29% for mir-34(gk437), from 8 6 0% to 16.67 6 Due to the low penetrance of the phenotype in mir- 4.16% for mir-83(n4638), and from 26 6 7.21% to 62.67 6 83(n4638); mir-34(gk437) double mutants (Figure 2A), 4.16% for mir-83(n4638); mir-34(gk437). A similar pattern

mir-34 and mir-83 in DTC Migrations 1205 Figure 2 The gonad migration defect is significantly enhanced in mir-83(n4638); mir-34(gk437) double mutants. Gonad arm morphology in young adult hermaphrodites was used to score for defects in DTC migrations during larval development at (A) 20° or (B) under an oscillating temperature regimen (15° for 15 min, 25° for 15 min, repeated from plating eggs until young adulthood). (C) Integrated transgenes expressing either mir-34, maIs387 or mir-83, maIs391, under their natural promoters rescue single mutants. Both VT3289 and VT3294 maIs387; maIs391; mir-83(n4638); mir-34(gk437) were produced by crossing VT3106 maIs387; mir- 34(gk437) to VT3110 maIs391; mir-83 (n4638), shown in D. As expected, the newly isolated mir-83(n4638); mir-34 (gk437) double mutant, VT3289, displays the migration defect while the double mutant carrying both rescue transgenes, VT3294, appears normal. Significance asterisks compare to N2. Penetrance in VT2595 is not significantly different from penetrance in VT3289. Animals were cycled as described in B. ***P-value # 0.005, *0.01 , P # 0.05, not significant (n.s.) if P . 0.05.

was observed for animals grown on OP50 rather than transgenes (VT3294) (Figure 2C). We observed that VT3289 HB101 E. coli, suggesting that the migration defect and its exhibited a 56% penetrance of migration defective, which is not enhancement by oscillating temperature are independent of statistically different from 62% migration defective exhibited by food source (Figure S2). We also examined a second mir-34 the original mir-83(n4638); mir-34(gk437) double mutant, null allele, n4276, and obtained similar results as those for VT2595 (Figure 2C, two-proportion z-test, P . 0.05). If the gk437 (Figure S3). migration defect had been due to background mutations rather To conﬁrm that the DTC migration defects of mir-34 and than the mir-34 and mir-83 deletions we would not expect the mir-83 mutants are a consequence of the loss of the mir-34 newlyisolateddoubletohavethedefect.Asexpected,the and mir-83 genes, we generated single-copy integrated res- double mutant carrying both rescue constructs, maIs387; cuing transgenes in their respective single mutant (Table maIs391; mir-83(n4638); mir-34(gk437), appears mostly nor- S2). Both the mir-34 transgene, maIs387, and the mir-83 mal (4% migration defective). transgene, maIs391, rescue the migration defects of their The above results suggest that DTC migrations may be respective single mutant (Figure 2C). Although this ﬁnding inherently sensitive to unstable temperature, and that the supports the conclusion that the migration defects can be activity of mir-34 and mir-83 helps protect the genetic net- explicitly attributed to the mir-34 and mir-83 loss of func- work controlling this migration from environmental temper- tion, a caveat remained that the migration defect was due to ature changes. Although the penetrance of the phenotype background mutations, outside the mir-34 or mir-83 loci, was increased in mir-83(n4638); mir-34(gk437) mutants that had been present in the single mutants and were worms experiencing oscillating temperatures (from 26% segregated away during construction of the transgene- at constant 20° to 62.67% in oscillating temperatures), containing strains. In this scenario, the hypothetical back- the migration defect is still not fully penetrant in mir- ground mutations would have been maintained during the 83(n4638); mir-34(gk437) mutants, even with tempera- construction of the mir-83(n4638); mir-34(gk437) double ture oscillations. It was previously shown that for alg-1 mutant, strain VT2595. To address this caveat, we crossed dominant-negative alleles ma192 and ma202, respectively the maIs387; mir-34(gk437) and maIs391; mir-83(n4638) 71% and 73% of worms, have DTC migration defects, strongly strains together to generate a new doubly mutant mir- suggesting that other miRNAs are involved in the regula- 83(n4638); mir-34(gk437) strain (VT3289) lacking both tion of DTC migrations (Zinovyeva et al. 2014). Therefore transgenes and a sibling doubly mutant strain carrying both the additional miRNAs implicatedingonadmigrationby

1206 S. L. Burke, M. Hammell, and V. Ambros the Abbott lab (Brenner et al. 2010) were examined to porter, Plag-2::GFP (Siegfried and Kimble 2002), we found see if being raised in changing temperatures enhanced that the DTCs are born 16 to 16.5 hr after the reintroduc- any of the single mutants as it did for mir-34(gk437) tion of food (unpublished results) in both N2 and mir- and mir-83(n4638) mutants. We found that only the 83(n4638); mir-34(gk437) worms. This agrees with previous mir-259(n4106) migration defect appears to be enhanced by reports for the timing of DTC birth in N2’s (Sulston and oscillating temperatures (Figure 3A), although the enhancement Horvitz 1977; Kimble and Hirsh 1979). By examining the is not significant (P = 0.086, two-proportion z-test). Addi- effects of 2-hr time windows during which the temperature tionally, the migration defects exhibited by mir-259(n4106) oscillated between 15° and 25° every 15 min, we found that mutants are similar to those of mir-34(gk437) and mir- the temperature-sensitive period for DTCs overlapped with 83(n4638) single and double mutants; DTCs improperly the approximate time of their births. When the 2-hr oscillat- cross the dorsal/ventral axis during phase 1 and phase 3 ing temperature regimen occurred before 14 hr of develop- of migration and migrate past the vulva. However, the ment (Figure 4A) or after 20 hr of development (Figure 4C), mir-259 deletion does not enhance the penetrance of these mir-83(n4638); mir-34(gk437) mutants displayed the mi- defects in a triple mutant mir-83(n4638); mir-259(n4106); gration phenotype at a penetrance similar to that seen in mir-34(gk437) compared to the mir-83(n4638); mir-34(gk437) the nonenhanced 20° condition (see Figure 2A). However, double mutant (Figure 3B, P $ 0.05, two-proportion z-test). when temperature oscillations occurred from hour 16 to This suggests that, although mir-259 regulates targets in- hour 18 of development (Figure 4B) we observed an en- volved in DTC migration in a manner that is sensitive to hanced penetrance of the phenotype similar in magnitude temperature changes and could be involved in the same or to that of animals that had experienced temperature oscil- asimilarprocessasmir-34 and mir-83, mir-259 appears to lations throughout larval development (see Figure 2B). This not regulate the same targets as mir-34 and mir-83.Ifthe implies that the enhancement observed with temperature three miRNAs were acting in parallel on the same set of oscillations throughout development likely resulted from mRNA targets, we would expect an elevated penetrance changing temperature in the interval between hour 16 to of the phenotype upon removal of mir-259 from the dou- hour 18. Indeed, animals that experienced temperature ble mutant as the target mRNAs in question would be oscillations throughout most of larval development but ex- further derepressed. One caveat regarding this conclu- cluding the 2-hr period from hour 16 to hour 18 did not sion could be that the lack of enhancement seen in the exhibit phenotypic enhancement (Figure S4). mir-83(n4638); mir-259(n4106); mir-34(gk437) triple Our results indicate that cycling between 15° and 25° compared to the mir-83(n4638); mir-34(gk437) double captures the full enhancement of the migration phenotype (Figure 3B) might reflect common targets that were fully under the conditions we have tested. Increasing the upper derepressed in the mir-83(n4638); mir-34(gk437) dou- temperature to 37°, thereby heat shocking the worms in 15- ble, such that the loss of an additional regulator had no min increments, did not further enhance the penetrance of effect. In this regard, we note that the migration defect the phenotype (Figure S5). We also found that the pheno- penetrance in both the mir-259(n4106); mir-34(gk437) typic enhancement occurred whether the first temperature and the mir-83(n4638); mir-259(n4106) double mutants change was a decrease (Figure 4) or an increase (Figure S6) are weaker than that of the mir-83(n4638); mir-34(gk437) in temperature and was largely independent of the magni- mutant (Figure 3C, P # 0.005, two-proportion z-test). This tude of the temperature change; 10-degree or 5-degree suggests that the relevant mRNA target sets for mir-34 and changes in temperature resulted in similar phenotype en- mir-83 may overlap more with each other than with mir-259. hancement (Figure S7). We observed that a single oscilla- For these reasons, we chose to focus on the functionally inter- tion cycle during the hour-16 to hour-18 period was acting miRNAs mir-34 and mir-83 for the remainder of this insufficient to enhance the phenotype (Figure S8), suggest- study. ing that multiple cycles are necessary to elicit the stress that compromises the integrity of gonad morphogenesis in the The temperature sensitivity of DTC migration is absence of mir-34 and mir-83. restricted to a 2-hr period during the L1 stage Tissue specificity of mir-34 and mir-83 We next sought to determine if the entire DTC migration process was temperature sensitive in mir-83(n4638); mir- To determine the anatomical site of action of mir-34 and 34(gk437) mutants, or if there was a more restricted de- mir-83 in regulating the integrity of DTC migrations we velopmental period during which DTCs are sensitive to generated constructs expressing each of these miRNAs changing temperature in these mutants. Synchronized popu- driven by its natural promoter or by promoters from genes lations of N2 and mutant worms were produced by hatching expressed in the hypodermis (dpy-7), DTCs (lag-2, also eggs in the absence of food. L1 larvae arrest in such condi- expressed in some vulval cells), gonadal sheath cells (lim- tions and will not proceed developing until the reintroduction 7), or muscle (myo-3, also expressed in muscle-like sheath of food (Johnson et al. 1984; Baugh 2013). Once food is cells 3–5) (Johnstone et al. 1992; Henderson et al. 1994; reintroduced, it takes the larvae 24 hr at 20° to reach the Hall et al. 1999; Dupuy et al. 2007; Fox et al. 2007; Ono first molt into the L2 larval stage. Using the DTC-specificre- et al. 2007). These constructs were built in Mos1-mediated

mir-34 and mir-83 in DTC Migrations 1207 Figure 3 Other miRNAs implicated in gonad migration function in separate pathways. (A) Previously implicated miRNA mutants were tested for enhancement of gonad migration defects by temperature oscillations. Worms were either maintained at a steady 20° throughout development or were subjected to oscillating temperature (15° for 15 min, 25° for 15 min) throughout development (“cycled”). (B) The mir-259(n4106) mutation wascrossedintothemir-83(n4638); mir- 34(gk437) strain to assess potential genetic interactions. Worms were subjected to an oscillating temperature regimen (15° for 15 min, 25° for 15 min, repeated until young adulthood). The difference in migration defective (mig) phenotype penetrance between mir-83(n4638); mir-34(gk437) and mir-83(n4638); mir-259(n4106); mir-34 (gk437) is not significant. ***P-value # 0.005. (C) Phenotype penetrance for the mir-259(n4106) mutation in combination with either the mir-34(gk437) mutation or the mir-83(n4638) mutation was compared to that in the mir-83(n4638); mir-34(gk437) double mutant. Worms were raised at 20° or cycled during the temperature-sensitive period discussed in Figure 4 [20° for 16 hr (15° for 15 min, 25° for 15 min, repeated three additional times), 20° until young adulthood]. ***P-value # 0.005. single-copy insertion (MosSCI) destination vectors and fidelity of the DTC migration process, and that the migration were used to generate integrated transgenic lines (Frøkjaer- defect reflects abnormal pathfinding by the DTCs during Jensen et al. 2008) (Table S2). larval development. An alternative hypothesis, that the dis- As expected, both mir-34 or mir-83 expressed under their placed gonad arms observed in mutant adults resulted from cognate natural promoters rescued the DTC migration de- the shifting of internal organs after otherwise proper migra- fect of the respective single mutants (Table 1 and Table 2, tions, was tested by examining whether the animals’ move- P # 0.005, two-proportion z-test). mir-34(gk437) and mir- ment impacted their gonad morphology. We observed that 83(n4638) phenotypes were also rescued to varying degrees the migration-defective phenotype was not affected in ge- by tissue-specific heterologous promoters. mir-34 expressed netically paralyzed worms compared to fully active worms, in the DTCs (driven by the lag-2 promoter; Plag-2::mir-34) arguing against a contribution of movement-derived struc- partially rescued the mir-34(gk437) defect, from 28.3 to tural damage as a cause of the migration defect (Figure S9). 11.7% (Table 1, P # 0.05, two-proportion z-test). The lack To identify potential targets of mir-34 and mir-83 in the of full rescue could be due to a difference in expression regulation of DTC migration, we tested for suppression of levels and/or a requirement for mir-34 in more than one the phenotype in mir-83(n4638); mir-34(gk437) mutants by tissue. mir-83 expressed in either the DTCs (Plag-2::mir- RNAi knockdown of genes predicted by mirWIP (Hammell 83) or muscle (Pmyo-3::mir-83), significantly rescued the et al. 2008) to be targets of both mir-34 and mir-83 (Table migration defect (from 30% in the mutant to 5% in each S1), prioritizing genes known to be involved in cell migra- rescue line, Table 2, P # 0.005, two-proportion z-test). Po- tions, larval development, or miRNA function. cdc-42 and tential explanations for this result, where mir-83 appears to pat-3, both expressed in the DTCs and body wall muscle function in either the DTCs or the muscle, are discussed in and known to be involved in their migration (Lee et al. the Discussion section. 2001; Cram et al. 2006; Lucanic and Cheng 2008), are predicted targets of mir-34 and mir-83 and were subsequently Mir-34 and mir-83 regulate two key proteins involved in examined. DTC migrations cdc-42 is a GTPase shown to be downstream of integrin Our findings that DTC-specific expression of mir-34 or mir- signaling. Upon activation by integrin, cdc-42 acts to bring 83 can rescue the gonad migration defect of mir-34(gk437) about the actin cytoskeleton rearrangements associated with or mir-83(n4638) mutants suggests that mir-34 and mir-83 cell migration (Van Aelst and D’Souza-Schorey 1997; Price may regulate a gene or genes whose activity impacts the et al. 1998; Ren et al. 1999). Previously it has been shown

1208 S. L. Burke, M. Hammell, and V. Ambros Figure 4 Temperature oscillations within a limited 2-hr window cause the migration defective phenotype enhancement in mir-83(n4638); mir-34 (gk437) mutants. The temperature was oscillated every 15 min for a total of 2 hr (15° for 15 min, 25° for 15 min, repeated four times). (A) Temperature oscillations occurred prior to the birth of the DTCs (12 to 14 hr after plating starved L1’s on HB101-seeded NGM plates). (B) Temperature oscillations occurred over an interval (16 to 18 hr after plating starved L1’s on HB101) corresponding to the time of DTC birth. (C) Temperature oscillations occurred after the birth of the DTCs (20 to 22 hr after plating starved L1’s on HB101). ***P- value # 0.005, **0.005 , P # 0.01, signiﬁcance asterisks compare N2 to mir-83(n4638); mir-34(gk437) mutants.

that when a constitutively active allele of cdc-42 (unable to phenotypes similar to that observed in the balanced hetero- hydrolyze GTP to GDP) is expressed in the DTCs, those DTCs zygote. This result supports the idea that the reduction of display pathfinding defects (Peters et al. 2013). If cdc-42 is cdc-42 is responsible for the suppression seen in mir- a direct target of mir-34 and mir-83, we would expect its 83(n4638); mir-34(gk437) rather than being the result of expression to be elevated in animals mutant for these two the inclusion of the balancer chromosome mIn1. miRNAs. Therefore, we hypothesized that by lowering the C. elegans has one b-integrin gene, pat-3 (Williams and level of cdc-42 in mir-83(n4638); mir-34(gk437) mutants Waterston 1994; Gettner et al. 1995). Integrin signaling is we could suppress the gonad migration defect. This is in fact the major regulatory network involved in phase 1 and phase the case. The cdc-42 null allele gk388 deletes a portion 3 of DTC migration (Baum and Garriga 1997; Lee et al. of cdc-42’s59 UTR, the first exon, and a portion of the first 2001; Cram et al. 2006). Using the pat-3 null allele st564 intron (Kimata et al. 2012). mir-83(n4638); mir-34(gk437) (Williams and Waterston 1994), we created a strain homo- mutants heterozygous for the cdc-42(gk388) allele were sig- zygous for deletions of both mir-34 and mir-83 and carrying nificantly rescued, from 53% of the population displaying only one functional copy of pat-3. In this case, partial loss of the gonad migration-defective phenotype to 23% (Figure pat-3 reduced the migration defect from 52 to 25% (Figure 5A, P # 0.005, two-proportion z-test). Mutants containing 5C, P # 0.005, two-proportion z-test), supporting the con- one copy of gk388 and wild-type copies of both mir-34 and clusion that pat-3 overexpression contributes to the migra- mir-83 also are migration defective (wandering in phase 1 tion defect in mir-83(n4638); mir-34(gk437) mutants. Note and/or phase 3) at a low penetrance (10% of the popula- that 18% of worms with one functional copy of pat-3 are tion). This is expected as cdc-42 is a critical regulator of the migration defective (we observed wandering during phase 1 integrin signaling network (Van Aelst and D’Souza-Schorey and phase 3 and overextension, but no defects in phase 2 1997; Price et al. 1998; Ren et al. 1999). We confirmed this turns), indicating that the fidelity of DTC migration may suppression using RNAi-induced knockdown of cdc-42 (Fig- depend critically on pat-3 dosage. RNAi against pat-3 also ure 5B); cdc-42(RNAi) in a mir-83(n4638); mir-34(gk437) significantly suppressed the migration defect in a mir- mutant significantly suppressed the penetrance of the migra- 83(n4638); mir-34(gk437) mutant from 65 to 40% (Figure tion defect from 70 to 37% (P # 0.005, two-proportion 5D, P # 0.01, two-proportion z-test), confirming that the z-test). N2 worms on cdc-42 RNAi food exhibit wandering reduction of pat-3 is responsible for the suppression.

mir-34 and mir-83 in DTC Migrations 1209 Table 1 Tissue-speciﬁc mir-34 rescue Table 2 Tissue-speciﬁc mir-83 rescue

Strain Migration defective (%) (N = 60) Strain Migration defective (%) (N = 60) N2 0 N2 0 mir-34(gk437) 28.3 mir-83(n4638) 30 Pmir-34::mir-34; mir-34(gk437) 0*** Pmir-83::mir-83; mir-83(n4638) 1.7*** Pdpy-7::mir-34; mir-34(gk437) 20 Pdpy-7::mir-83; mir-83(n4638) 25 Plag-2::mir-34; mir-34(gk437) 11.7* Plag-2::mir-83; mir-83(n4638) 5*** Plim-7::mir-34; mir-34(gk437) 31.7 Plim-7::mir-83; mir-83(n4638) 41.7 Pmyo-3::mir-34; mir-34(gk437) 26.7 Pmyo-3::mir-83; mir-83(n4638) 5*** Synchronized L1’s were raised with oscillating temperatures: 20° for 16 hr (15° for Synchronized L1’s were raised with oscillating temperatures: 20° for 16 hr (15° for 15 min, 25° for 15 min, repeated three additional times), 20° until young adult- 15 min, 25° for 15 min, repeated three additional times), 20° until young adulthood. ***P-value # 0.005, *0.01 , P # 0.05, signiﬁcance asterisks compare rescue hood. ***P-value # 0.005, signiﬁcance asterisks compare rescue strains to mir-83 strains to mir-34(gk437) mutants. (n4638) mutants.

The suppression in mir-83(n4638); mir-34(gk437) mu- these reporter experiments could not confirm direct regula- tant phenotype by genetic reduction of either cdc-42 or tion of both cdc-42 and pat-3 by mir-34 or mir-83, there pat-3 activity supports the supposition that cdc-42 and pat-3 were numerous technical issues that limited the sensitivity function downstream of these miRNAs in the regulation of and fidelity of the reporter assays (see Discussion). It is DTC migration. The fact that both cdc-42 and pat-3 are pre- possible that cdc-42 and pat-3 could be acting in parallel dicted to contain sites for both mir-34 and mir-83 in their 39 pathways that indirectly oppose the activities of mir-34 UTR sequences strongly suggests direct targeting by these and mir-83, such that the observed suppression is the result miRNAs. In an attempt to gather additional data in support of decreasing the activity of an opposing pathway. However, of direct regulation, we constructed a set of nuclear local- based on the computational prediction of cotargeting by ized mCherry and GFP reporters using the promoters and 39 mir-34 and mir-83, combined with the fact that both cdc- UTR sequences of each target (see Methods). mCherry was 42 and pat-3 are known to be required for proper pathfind- paired with the wild-type target 39 UTR while GFP was fused ing, we propose that these predicted mir-34 and mir-83 to a 39 UTR where the predicted mir-34 and mir-83 binding common targets function downstream of the two miRNAs sites were mutated. Specifically, the 39 UTR bases predicted to in conferring robustness to DTC migration in the face of be part of the mRNA–miRNA seed base pairing were mutated temperature changes. to the complementary base, A to T, C to G, G to C, and U to A, mir-83(n4638); mir-34(gk437) mutants display reduced such that mir-34 and mir-83 loaded miRISCs would no longer cross-progeny fecundity to be able to bind the mutated 39 UTRs. For each wild-type 39 UTR reporter, the corresponding GFP construct with a mu- In addition to guiding the morphology of the adult gonad, tated 39 UTR served as an internal control, as it should not be DTCs are also required to signal to the germline and subjected to regulation by either miRNA. The mCherry con- regulate the production of germ cells (reviewed in Hubbard struct, however, should be regulated by both miRNAs and and Greenstein 2000). We therefore tested whether the de- therefore, should be expressed differently in their presence letion of mir-34 and mir-83 affected the function of the or absence. We generated multicopy arrays (single-copy hermaphrodite germline by quantifying offspring. We scored transgenes were unsuccessful, see Discussion) containing both the total number of viable progeny, animals that hatched constructs in mir-83(n4638); mir-34(gk437) mutants and from laid eggs. We did not observe a noticeable difference crossed these arrays into N2 worms for comparison to the in the number of dead eggs laid by mir-83(n4638); mir- mutant background. GFP and mCherry fluorescence was sub- 34(gk437) mutants vs. N2 worms; therefore, we did not sequently quantified within DTCs or for the whole animal. include them in our quantification. When raised at 20° or We did not observe a difference in the ratio of mCherry to with temperature oscillations occurring during the previ- GFP fluorescence expressed in DTCs for the cdc-42 reporters, ously described 2-hr temperature-sensitive period (referred in any of the stages observed (Figure S10A, P $ 0.05, un- to as cycled), there was no statistical difference in the num- paired t-test). ber of viable self-progeny produced by mir-83(n4638); mir- As for the pat-3 reporters, the results were indicative but 34(gk437) mutants compared to wild type (Figure 6A, P $ not definitive. Expression of the pat-3 reporters was not de- 0.05, unpaired t-test). tectable in DTCs in larval stages. In adults, pat-3 reporter The self-fertility of a C. elegans hermaphrodite is limited expression was very dim and bleached rapidly, necessitating by the number of sperm that it produces. Once self-sperm are scoring whole animals. In whole adult animals, there was exhausted, the hermaphrodite’s total reproductive capacity is a slight increase in the ratio of mCherry to GFP fluorescence defined by the number of additional oocytes it can produce for the pat-3 reporters when mir-34 and mir-83 were de- that are competent to produce viable cross-progeny upon mat- leted (Figure S10B, P # 0.05, unpaired t-test), suggesting ing to males (Brenner 1974). To investigate cross-progeny that the two miRNAs do directly regulate pat-3. Although production, N2 and mir-83(n4638); mir-34(gk437) mutants

1210 S. L. Burke, M. Hammell, and V. Ambros Figure 5 The mir-83(n4638); mir-34 (gk437) migration defect is suppressed in cdc-42 and pat-3 heterozygotes. The penetrance of the migration defective phenotype is signiﬁcantly reduced in mir-83(n4638); mir-34(gk437) mutants when (A) carrying one copy of cdc-42, (B) raised on cdc-42 RNAi food as compared to empty vector control, (C) carrying one copy of pat-3, or (D) raised on pat-3 RNAi food as compared to empty vector control. Arrested L1’s were plated on HB101-seeded NGM plates to restart development. Once plated, temperature was held at 20° for 16 hr, then cycled as follows: 15° for 15 min, 25° for 15 min, four times, then held at 20° until young adulthood. ***P-value # 0.005, **0.005 , P # 0.01, *0.01 , P # 0.05, P . 0.05 not signiﬁcant (n.s.).

were firsteitherraisedat20° or cycled. After day 4 of adult- have a gonad migration defect, and a higher number of hood, animals had exhausted their own supply of sperm and viable progeny for the 40% of the population expected to could no longer produce fertilized embryos (Byerly et al. lack any defect. However, the reduced fecundity of mir- 1976). At this point, young adult N2 males were mated to 83(n4638); mir-34(gk437) hermaphrodites was unaffected aged animals to assess their fertility (Figure 6B). Temperature by temperature regimen and the population distribution of oscillations did not affect the number of cross-progeny pro- fecundity for mir-83(n4638); mir-34(gk437) worms was not duced by wild-type hermaphrodites crossed to wild-type males consistent with a 60/40% split. Thus it appears that the (247.25 6 77.52 vs. 236.5 6 103.44 at 20°, P $ 0.05, un- fecundity defect in mir-83(n4638); mir-34(gk437) mutants paired t-test). Additionally, there was no significant difference is likely independent of the gonad migration defect. It is between the number of cross-progeny produced by mir- possible that mir-34 and mir-83 may regulate targets other 83(n4638); mir-34(gk437) wormsraisedineitherconstant than cdc-42 and pat-3 within the DTCs that affect their abil- temperature or with temperature oscillations when mated to ity to signal to the germline for the regulation of oocyte wild-type males (141.85 6 84.01 at 20° vs. 118.65 6 51.99 production. Alternatively, there may be subtle changes in cycled, P $ 0.05, unpaired t-test). There were, however, sig- the mating behavior of mir-83(n4638); mir-34(gk437) her- nificant differences between strains in total cross-progeny pro- maphrodites that could be detected with closer study. duced. Specifically, the number of cross-progeny produced by mir-83(n4638); mir-34(gk437) mutants have mir-83(n4638); mir-34(gk437) mutants when mated to wild- a decreased lifespan type males was significantly less than the number of cross- progeny produced by wild-type hermaphrodites mated to A rearrangement of internal organs (as seen in Figure 1C) wild-type males regardless of the temperature regime during might be expected to have negative consequences for the development (P # 0.005, unpaired t-test). overall fitness and viability of the affected worm. Moreover, If the fecundity defect in mir-83(n4638); mir-34(gk437) it has been shown that an animal’s fecundity can correlate hermaphrodites was a direct consequence of the gonad mi- with its longevity (Hsin and Kenyon 1999; Berman and gration defect, we would expect to see a greater number of Kenyon 2006; Kenyon 2010). To explore this possibility, cross-progeny produced by mir-83(n4638); mir-34(gk437) we measured the lifespan of N2 and mir-83(n4638); mutants when raised at 20° compared to temperature mir-34(gk437) mutants raised at either 20° continu- cycled, as temperature cycling dramatically decreases the ously (Figure 7A) or with temperature oscillations dur- percentage of animals with normal gonad morphology. ing the time-sensitive period (Figure 7B). Although Moreover, we would expect to see two populations of ani- mir-83(n4638); mir-34(gk437) worms raised at 20° mals within the cycled conditioned, a lower number of via- appeared to have a slightly shortened lifespan compared ble progeny for the 60% of the population expected to to N2, the difference was only marginally statistically

mir-34 and mir-83 in DTC Migrations 1211 related to the DTC migration phenotype. A relation between the two would explain the slight, less significant difference in lifespan at 20°, when only 20% of the mir-83(n4638); mir-34(gk437) population is migration defective, vs. the significant difference in lifespan when animals undergo temperature changes, as now 60% of the population is migration defective. This hypothesis has yet to be explored as we have not scored individual worms for both the migration phenotype and lifespan due to the fact that scoring for the migration phenotype involves paralyzing the worms and is potentially detrimental to their lifespan. It is possible that the more pronounced difference in lifespan between mir-83(n4638); mir-34(gk437) and N2 worms when raised with temperature oscillations does not reflect a direct re- lationship between lifespan and gonadal migration but instead could reflect a general decrease in the fitness of mir-83(n4638); mir-34 (gk437) worms when experiencing temperature changes.

Discussion There is an obvious benefit for building biological robustness into genetic networks; the fitness of an organism critically depends on the fidelity of developmental processes and reproductive capacity in the face of environmental changes. Previous research across numerous model organisms has described evolutionarily conserved responses to stresses such as food deprivation, heat shock, and various forms of toxicity (reviewed in Lant and Storey 2010). miRNAs are thought to contribute to ensuring the fidelity of gene expression programs in the face of both external stresses and internal transcriptional noise (Li et al. 2009) (reviewed Figure 6 mir-83(n4638); mir-34(gk437) mutants produce normal sized self-broods and reduced cross-broods. (A) The total number of living off- in Hornstein and Shomron 2006; Ebert and Sharp 2012; spring was counted to determine brood size for N2 and mir-83(n4638); Posadas and Carthew 2014). Previous studies have shown mir-34(gk437) worms raised at 20° throughout development or subjected how miRNAs can participate in regulatory loops to precisely to temperature cycles (15° for 15 min, 25° for 15 min, repeated four regulate gene expression levels (reviewed in Tsang et al. ’ times) from 16 to 18 hr of development after plating starved L1 son 2007; Ebert and Sharp 2012) or establish genetic switches. HB101. There is no statistically significant difference between any of the groups. (B) Individual 4-day-old adult hermaphrodites that had miRNAs have also been shown to repress leaky transcrip- exhausted their self-progeny were crossed to four 1-day-old N2 males tion, thereby dampening noise within genetic networks and number of cross-brood progeny was counted. The average cross- (reviewed in Hornstein and Shomron 2006; Posadas and brood size was reduced for mir-83(n4638); mir-34(gk437) hermaphro- Carthew 2014). ° dites whether they were raised at 20 or subjected to temperature cycles The precise spatiotemporal program of DTC migration is (15° for 15 min, 25° for 15 min, repeated four times) from 16 to 18 hr of development. Averages were compared using an unpaired t-test, per- controlled by a complex genetic network including genes formed by PRISM. ***P-value # 0.005. Each group was compared to pat-3 and cdc-42 (Cram et al. 2006), which encode, respec- the three others. The absence of significance asterisks denotes a lack of tively, b-integrin and a GTPase downstream of integrin statistical significance. signaling. Genetic networks need to be robust so as to compensate for adverse changes in gene expression that can significant (Figure 7A, ***P # 0.005, **0.005 , P # 0.01, result from stress (reviewed in Lant and Storey 2010; Zhou *0.01 , P # 0.05, unpaired t-test). However, for animals et al. 2011). Cells can compensate for stress-induced posi- subjected to oscillating temperatures during the temperature- tive fluctuations in mRNA levels through the post-transcrip- sensitive period (from 16 to 18 hr postplating) the dif- tional repressive action of miRNAs (Figure 8A). Likewise, ference between N2 and mir-83(n4638); mir-34(gk437) negative fluctuations in mRNA levels can be compensated mutant worms was more pronounced and statistically signif- for by activating transcription and/or translation, including icant from day 7 to day 21 (with the exception of days 9 and releasing inhibition imparted by miRNAs. Thus miRNAs 17, Figure 7B, ***P # 0.005, **0.005 , P # 0.01, *0.01 , can contribute to the robustness of a genetic network by P # 0.05, unpaired t-test). The difference in lifespans may be fine tuning the expression levels of networked genes and

1212 S. L. Burke, M. Hammell, and V. Ambros Figure 7 mir-83(n4638); mir-34(gk437) mutants have a decreased lifespan compared to wild type. Wild-type (N2) and mir-83(n4638); mir-34(gk437) embryos were harvested by hypochlorite treatment and synchronized L1 larvae were obtained by hatching overnight in M9. Larvae were plated on HB101-seeded NGM plates and raised (A) continuously at 20° or (B) subjected to temperature cycles (15° for 15 min, 25° for 15 min, repeated four times) from 16 to 18 hr of development after plating starved L1’s on HB101. For each longevity assay shown in panels A and B, 100 animals per replicate, three replicates per condition, were plated as L4’s (day 0) and tracked until their death. Alive or dead was determined by prodding worms on their nose and looking for a re- action. Daily averages were compared using a two sample t-test for means. ***P-value # 0.005, **0.005 , P # 0.01, *0.01 , P # 0.05.

buffering their expression from environmentally driven ad- a low level of activity of the myo-3 promoter in the DTCs. verse perturbations. Alternatively, it is possible that mir-83 may perform func- For DTCs, phase 1 and phase 3 of their migration is tions within both the DTCs and muscle, and that function in regulated by cell-intrinsic integrin signaling (Baum and Gar- either cell type can rescue DTC migration. A third possibility riga 1997; Lee et al. 2001; Cram et al. 2006; Meighan and is that mir-83 may function only in the DTCs, but that the Schwarzbauer 2007). We propose that both mir-34 and mir- mir-83 miRNA can be supplied either cell intrinsically or cell 83 help protect the robustness of this genetic network by extrinsically from muscle-expressed mir-83. Intriguingly, an- regulating cdc-42 and pat-3 (Figure 8B), particularly when other known component of the DTC migration gene net- the network is stressed by temperature changes. Our finding work, the metalloprotease mig-17, is secreted by body wall that DTC expression of mir-34 and mir-83 can rescue the muscle cells and localizes to the gonadal basement mem- migration defect of their respective mutants supports the brane (Nishiwaki et al. 2000). It is also possible that mir-83 hypothesis that the two miRNAs regulate cdc-42 and pat-3 synthesized in the muscle could be transported to the DTCs within the DTCs. Although these rescue data strongly sug- to function, explaining why mir-83 expression in either of gest that mir-34 and mir-83 function within the DTCs, we these two tissues can result in similar levels of rescue. were not able to confirm expression of these miRNAs in For technical reasons, our fluorescent reporter transgene DTCs. Transgenes with either the mir-34 or mir-83 promoter approach did not permit us to confirm 39 UTR-dependent driving GFP did not produce detectable expression of GFP in regulation of cdc-42 or pat-3 by mir-34 or mir-83. Both genes the DTCs (although expression in body wall muscle cells are widely expressed; cdc-42 is most highly expressed in the was detected for mir-34 driven GFP). It is possible that the intestine and muscles, while pat-3 expression is particularly endogenous mir-34 and mir-83 genes are expressed in the high in muscles (unpublished results and Plenefisch et al. DTCs, but these transgenic constructs may express GFP at 2000). Since the two DTCs make up such a small fraction of levels below limits of detection. the worm, protein expression changes within the DTCs are Interestingly, we also observed rescue of the migration not easily analyzed by Western blotting as expression defect in mir-83(n4638) mutants by expression of mir-83 in throughout the entire worm will mask any small cell-specific muscle cells using the myo-3 promoter. This could reflect changes. We used fluorescent reporters due to the difficulty

mir-34 and mir-83 in DTC Migrations 1213 Figure 8 A model proposing robustness functions for mir-34 and mir-83 through dampening noisy cdc-42 and pat-3 expression in the face of temperature changes. (A) Environmental stresses, such as changing temperatures, may lead to fluctuations in the expression levels of various transcripts, which could challenge cellular pro- teomic homeostasis. Repression of protein production by miRNAs can provide a means of stabilizing protein output from fluctuating target transcripts. (B) In the case of mir- 34 and mir-83, the fidelity of DTC migration is proposed to be maintained in part by inhibiting noisy cdc-42 and pat-3 expression incited by unstable environmental temperature.

of seeing cell-specific changes. We first attempted to gener- lating fertility that is entirely unrelated to their role in ate single copy insertions of the four reporters. For both the regulating DTC migrations. We do not yet know the pathway pat-3 GFP reporter and the cdc-42 mCherry reporter, we or pathways through which mir-34 and mir-83 affect fertility were not able to generate single copy integrated transgenes or whether the fertility phenotypes represent functions within that expressed at detectable levels. Therefore we were the germline, DTCs, or both. forced to use multicopy arrays, which most certainly reflect We identified a 2-hr temperature-sensitive period, during an overexpression of mRNA. We suspect that the absence of which temperature oscillations can induce the enhanced measurable response of these reporters to mir-34 and mir-83 DTC migration phenotype of mir-83(n4638); mir-34(gk437) activity in our experiments likely reflects an overexpression hermaphrodites. This temperature-sensitive period overlaps of the reporters, in excess to the endogenous miRNA levels. with the birth of the DTCs during the L1 larval stage and is It is also possible that mir-34 and mir-83 may regulate their well before the DTCs begin their migration (Sulston 1976; targets in a fashion too dynamic to visualize using fluores- Sulston and Horvitz 1977; Kimble and Hirsh 1979; Sulston cent reporters. et al. 1983). We have not determined what aspect of DTC Here we showed that mir-34 and mir-83 both contribute specification and/or differentiation may be inherently sensi- to keeping DTC migrations robust and protecting the fidelity tive to temperature changes such that in the absence of mir- of DTC migratory behavior from changes in temperature. In 34 and mir-83, DTCs display a stronger defect in pathfinding addition to organizing the morphogenic processes that fidelity than when under constant temperature. It is intrigu- shape the mature gonad, DTCs are also responsible for reg- ing that this defect is enhanced by fluctuating temperature ulating meiosis in the germline (Hubbard and Greenstein specifically during the L1 stage, suggesting that DTCs are 2000). Therefore DTCs have a direct impact on C. elegans particularly sensitive to the stress of unstable temperature reproductive capacity, and there is a direct benefit for the prior to the execution of their migratory program. It is worm to protect these cells from external stresses. Interest- known that the rate of development is closely tied to the ingly, although mir-83(n4638); mir-34(gk437) mutants pro- environmental temperature in C. elegans. Temperature sen- duced the normal number of self-progeny in our experiments, sitivity during the L1 stage may reflect a requirement to they nevertheless exhibited reduced numbers of cross-progeny buffer noise within the integrin genetic network early in when mated to wild-type males. Thus, the overall maximum development. A lack of proper initial buffering may sensitize reproductive capacity of mir-83(n4638); mir-34(gk437) her- DTCs such that their subsequent migration is no longer ro- maphrodites is compromised. Our results suggest that this bust. Alternatively, early temperature fluctuations may lead maximum fecundity defect is not a direct consequence of to changes in gene expression that are subsequently buff- the gonad migration defect, as the penetrance of the fecundity ered by mir-34 and mir-83 as the DTCs actively migrate defect is higher than that of the migration defect and is not during later larval stages. enhanced by temperature oscillations. Additionally the fecun- In mammals, both mir-34 and mir-29 (the mammalian dity defect may reflect a role for mir-34 and mir-83 in regu- mir-83 homolog) have been implicated in cancer, and

1214 S. L. Burke, M. Hammell, and V. Ambros mir-29 has also been implicated in regulating fibrosis and microscopy data. The Electron Microscopy Core Facility is cell–cell interactions (reviewed in Boominathan 2010; Krie- supported by award no. S10RR027897 from the National gel et al. 2012). Mammalian mir-34 homologs are transcrip- Center For Research Resources. Some strains were provided tionally activated by p53 and mediate post-transcriptional by the Caenorhabditis Genetics Center, which is funded by regulatory processes downstream of p53 (reviewed in He the National Institutes of Health (NIH) Office of Research et al. 2007; Hermeking 2009; Boominathan 2010). mir- Infrastructure Programs (P40 OD010440). The authors are 34a overexpression has been shown to reduce lung cancer solely responsible for the content of this paper and it does tumor cell proliferation and tumor volume (Xue et al. 2014). not necessarily represent the official views of the National Human cells contain four paralogs of mir-29/mir-83: Center for Research Resources of the NIH. This research was namely, mir-29a, mir-29b-1, mir-29b-2,andmir-29c supported by NIH R01GM34028 and by a grant from the (reviewed in Kriegel et al. 2012). Expression of the mir-29 Ellison Medical Foundation. miRNAs are regulated by both c-Myc and NF-kB and have Author contributions: S.L.B. performed the experiments and been shown to regulate genes involved in apoptosis, cell analyzed the data. S.L.B., M.H., and V.A. designed experi- proliferation, differentiation, and extracellular matrix com- ments; S.L.B. and V.A. wrote the paper. ponents (reviewed in Kriegel et al. 2012). The mir-29 miR- NAs have been shown to be downregulated in a variety of cancers, including cervical, colon, liver, leukemia, lung, and Literature Cited melanoma (Calin et al. 2005; Yanaihara et al. 2006; Cum- mins et al. 2006; Pekarsky et al. 2006; Garzon et al. 2008, Alvarez-Saavedra, E., and H. R. Horvitz, 2010 Many families of C. 2009; Xiong et al. 2010; Li et al. 2011; Nguyen et al. 2011). elegans microRNAs are not essential for development or viabil- – They have also been shown to be up-regulated in certain ity. Curr. Biol. 20: 367 373. Ambros, V., 2004 The functions of animal microRNAs. Nature breast cancers. Human CDC42 was shown to be a direct 431: 350–355. target of the mir-29 miRNAs in work from the Kim lab (Park Ambros, V., R. C. Lee, A. Lavanway, P. T. Williams, and D. Jewell, et al. 2008). Additionally, they showed that the suppression 2003 MicroRNAs and other tiny endogenous RNAs in C. ele- of CDC42 by mir-29 led to p53 up-regulation and increased gans. Curr. Biol. 13: 807–818. apoptosis. Taken together with the work in mammals show- Aravin, A. A., M. Lagos-Quintana, A. Yalcin, M. Zavolan, D. Marks ing that mir-34 reinforces p53 negative regulation, this sug- et al., 2003 The small RNA profile during Drosophila mela- gests that the coregulation of a genetic network by mir-34 nogaster development. Dev. Cell 5: 337–350. and mir-83/mir-29 is evolutionarily ancient and conserved. Bartel, D. P., 2004 MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281–297. Furthermore, TargetScan (Lewis et al. 2005; Grimson et al. Bartel, D. P., 2009 MicroRNAs: target recognition and regulatory 2007; Friedman et al. 2009; Garcia et al. 2011) predicts functions. Cell 136: 215–233. conserved targeting of human ITGB1 (integrin beta-1), Baugh, L. R., 2013 To grow or not to grow: nutritional control of ITGA11 (integrin alpha-11), and ITGA6 (integrin alpha-6) development during Caenorhabditis elegans L1 arrest. Genetics by the mir-29 family and conserved targeting for human 194: 539–555. ITGB8 (integrin beta-8) and ITGA10 (integrin alpha-10) Baugh, L. R., and P. W. Sternberg, 2006 DAF-16/FOXO regulates by the mir-34 family. transcription of cki-1/Cip/Kip and repression of lin-4 during C. elegans L1 arrest. Curr. Biol. 16: 780–785. Here we show a link between mir-34, mir-83/mir-29, and Baum, P. D., and G. Garriga, 1997 Neuronal migrations and axon integrin-controlled cell migration. Integrin and extracellular fasciculation are disrupted in ina-1 integrin mutants. Neuron matrix misregulation is a key factor in epithelial to mesen- 19: 51–62. chymal transition (EMT) (reviewed in Seguin et al. 2015). Berman,J.R.,andC.Kenyon,2006 Germ-cell loss extends C. elegans The implication of mir-34 and mir-83/mir-29 in various can- life span through regulation of DAF-16 by kri-1 and lipophilic- cers may reflect a conserved involvement in metastasis hormone signaling. Cell 124: 1055–1068. through altered EMT that has yet to be explored. The wan- Boominathan, L., 2010 The guardians of the genome (p53, TA- dering DTC defect in C. elegans mir-34 and mir-83/mir-29 p73, and TA-p63) are regulators of tumor suppressor miRNAs network. Cancer Metastasis Rev. 29: 613–639. mutants, which we have shown results from misregulation Brenner, J. L., K. L. Jasiewicz, A. F. Fahley, B. J. Kemp, and A. L. fl – of pat-3 and cdc-42,mayreect a homologous miRNA Abbott, 2010 Loss of individual microRNAs causes mutant integrin axis in tumor formation, proliferation, and metas- phenotypes in sensitized genetic backgrounds in C. elegans. tasis in higher animals, including humans. Curr. Biol. 20: 1321–1325. Brenner, S., 1974 The genetics of Caenorhabditis elegans. Genetics 77: 71–94. Acknowledgments Byerly, L., R. C. Cassada, and R. L. Russell, 1976 The life cycle of the nematode Caenorhabditis elegans. I. Wild-type growth and We thank the members of the Ambros lab for helpful reproduction. Dev. Biol. 51: 23–33. discussion, the labs of Nathan Lawson and Oliver Hobert Calin, G. A., M. Ferracin, A. Cimmino, G. Di Leva, M. Shimizu et al., for plasmids, and the lab of Amy Walker for use of their 2005 A MicroRNA signature associated with prognosis and confocal microscope. We also thank the Electron Microscopy progression in chronic lymphocytic leukemia. N. Engl. J. Med. Core Facility at the University of Massachusetts for electron 353: 1793–1801.

mir-34 and mir-83 in DTC Migrations 1215 Cassada, R. C., and R. L. Russell, 1975 The dauer larva, a post- He, X., L. He, and G. J. Hannon, 2007 The guardian’s little helper: embryonic developmental variant of the nematode Caenorhab- microRNAS in the p53 tumor suppressor network. Cancer Res. ditis elegans. Dev. Biol. 46: 326–342. 67: 11099–11101. Cram, E. J., H. Shang, and J. E. Schwarzbauer, 2006 A systematic Hedgecock, E. M., J. G. Culotti, D. H. Hall, and B. D. Stern, RNA interference screen reveals a cell migration gene network 1987 Genetics of cell and axon migrations in Caenorhabditis in C. elegans. J. Cell Sci. 119: 4811–4818. elegans. Development 100: 365–382. Cummins, J. M., Y. He, R. J. Leary, R. Pagliarini, L. A. Diaz et al., Henderson, S. T., D. Gao, E. J. Lambie, and J. Kimble, 1994 lag-2 2006 The colorectal microRNAome. Proc. Natl. Acad. Sci. USA may encode a signaling ligand for the GLP-1 and LIN-12 recep- 103: 3687–3692. tors of C. elegans. Development 120: 2913–2924. Dostie, J., Z. Mourelatos, M. Yang, A. Sharma, and G. Dreyfuss, Hermeking, H., 2009 The miR-34 family in cancer and apoptosis. 2003 Numerous microRNPs in neuronal cells containing novel Cell Death Differ. 17: 193–199. microRNAs. RNA 9: 180–186. Hirsh, D., D. Oppenheim, and M. Klass, 1976 Development of the Dupuy, D., N. Bertin, C. A. Hidalgo, K. Venkatesan, D. Tu et al., reproductive system of Caenorhabditis elegans. Dev. Biol. 49: 2007 Genome-scale analysis of in vivo spatiotemporal promoter 200–219. activity in Caenorhabditis elegans. Nat. Biotechnol. 25: 663–668. Hornstein, E., and N. Shomron, 2006 Canalization of develop- Ebert, M. S., and P. A. Sharp, 2012 Roles for microRNAs in con- ment by microRNAs. Nat. Genet. 38(Suppl): S20–S24. ferring robustness to biological processes. Cell 149: 515–524. Houbaviy, H. B., M. F. Murray, and P. A. Sharp, 2003 Embryonic Fox, R. M., J. D. Watson, S. E. Stetina Von, J. McDermott, T. M. stem cell-specific MicroRNAs. Dev. Cell 5: 351–358. Brodigan et al., 2007 The embryonic muscle transcriptome of Hsin, H., and C. Kenyon, 1999 Signals from the reproductive sys- Caenorhabditis elegans. Genome Biol. 8: R188. tem regulate the lifespan of C. elegans. Nature 399: 362–366. Friedman, R. C., K. K.-H. Farh, C. B. Burge, and D. P. Bartel, Hubbard, E. J., and D. Greenstein, 2000 The Caenorhabditis ele- 2009 Most mammalian mRNAs are conserved targets of mi- gans gonad: a test tube for cell and developmental biology. Dev. croRNAs. Genome Res. 19: 92–105. Dyn. 218: 2–22. Frøkjaer-Jensen, C., M. W. Davis, C. E. Hopkins, B. J. Newman, J. Irazoqui, J. E., E. R. Troemel, R. L. Feinbaum, L. G. Luhachack, B. M. Thummel et al., 2008 Single-copy insertion of transgenes in O. Cezairliyan et al., 2010 Distinct pathogenesis and host re- Caenorhabditis elegans. Nat. Genet. 40: 1375–1383. sponses during infection of C. elegans by P. aeruginosa and S. Fukuyama, M., A. E. Rougvie, and J. H. Rothman, 2006 C. elegans aureus. PLoS Pathog. 6: e1000982. DAF-18/PTEN mediates nutrient-dependent arrest of cell cycle Johnson, T. E., D. H. Mitchell, S. Kline, R. Kemal, and J. Foy, and growth in the germline. Curr. Biol. 16: 773–779. 1984 Arresting development arrests aging in the nematode Garcia, D. M., D. Baek, C. Shin, G. W. Bell, A. Grimson et al., Caenorhabditis elegans. Mech. Ageing Dev. 28: 23–40. 2011 Weak seed-pairing stability and high target-site abun- Johnstone, I. L., Y. Shafi, and J. D. Barry, 1992 Molecular analysis dance decrease the proficiency of lsy-6 and other microRNAs. of mutations in the Caenorhabditis elegans collagen gene dpy-7. Nat. Struct. Mol. Biol. 18: 1139–1146. EMBO J. 11: 3857–3863. Garzon, R., M. Garofalo, M. P. Martelli, R. Briesewitz, L. Wang Kamath, R. S., M. Martinez-Campos, P. Zipperlen, A. G. Fraser, and et al., 2008 Distinctive microRNA signature of acute myeloid J. Ahringer, 2001 Effectiveness of specific RNA-mediated in- leukemia bearing cytoplasmic mutated nucleophosmin. Proc. terference through ingested double-stranded RNA in Caeno- Natl. Acad. Sci. USA 105: 3945–3950. rhabditis elegans. Genome Biol. 2: RESEARCH0002. Garzon, R., C. E. A. Heaphy, V. Havelange, M. Fabbri, and S. Volinia Kenyon, C. J., 2010 The genetics of ageing. Nature 464: 504–512. et al., 2009 MicroRNA 29b functions in acute myeloid leuke- Kenyon, C., J. Chang, E. Gensch, A. Rudner, and R. Tabtiang, mia. Blood 114: 5331–5341. 1993 A C. elegans mutant that lives twice as long as wild type. Gettner,S.N.,C.Kenyon,andL.F.Reichardt, 1995 Characterization Nature 366: 461–464. of beta pat-3 heterodimers, a family of essential integrin receptors Kimata, T., Y. Tanizawa, Y. Can, S. Ikeda, A. Kuhara et al., in C. elegans. J. Cell Biol. 129: 1127–1141. 2012 Synaptic polarity depends on phosphatidylinositol sig- Grad, Y., J. Aach, G. D. Hayes, B. J. Reinhart, G. M. Church et al., naling regulated by myo-inositol monophosphatase in Caeno- 2003 Computational and experimental identification of C. el- rhabditis elegans. Genetics 191: 509–521. egans microRNAs. Mol. Cell 11: 1253–1263. Kimble, J., and D. Hirsh, 1979 The postembryonic cell lineages of Griffiths-Jones, S., 2004 The microRNA Registry. Nucleic Acids the hermaphrodite and male gonads in Caenorhabditis elegans. Res. 32: D109–D111. Dev. Biol. 70: 396–417. Griffiths-Jones, S., R. J. Grocock, S. van Dongen, A. Bateman, and Kimble, J. E., and J. G. White, 1981 On the control of germ cell A. J. Enright, 2006 miRBase: microRNA sequences, targets development in Caenorhabditis elegans. Dev. Biol. 81: 208–219. and gene nomenclature. Nucleic Acids Res. 34: D140–D144. Kitano, H., 2004 Biological robustness. Nat. Rev. Genet. 5: 826– Griffiths-Jones, S., H. K. Saini, S. van Dongen, and A. J. Enright, 837. 2008 miRBase: tools for microRNA genomics. Nucleic Acids Kozomara, A., and S. Griffiths-Jones, 2011 miRBase: integrating Res. 36: D154–D158. microRNA annotation and deep-sequencing data. Nucleic Acids Grimson, A., K. K.-H. Farh, W. K. Johnston, P. Garrett-Engele, L. P. Res. 39: D152–D157. Lim et al., 2007 MicroRNA targeting specificity in mammals: Kozomara, A., and S. Griffiths-Jones, 2014 miRBase: annotating determinants beyond seed pairing. Mol. Cell 27: 91–105. high confidence microRNAs using deep sequencing data. Nu- Hall, D. H., and Z. F. Altun, 2008 C. Elegans Atlas, Cold Spring cleic Acids Res. 42: D68–D73. Harbor Laboratory Press, Cold Spring Harbor, NY. Kriegel, A. J., Y. Liu, Y. Fang, X. Ding, and M. Liang, 2012 The Hall, D. H., V. P. Winfrey, G. Blaeuer, L. H. Hoffman, T. Furuta et al., miR-29 family: genomics, cell biology, and relevance to renal 1999 Ultrastructural features of the adult hermaphrodite go- and cardiovascular injury. Physiol. Genomics 44: 237–244. nad of Caenorhabditis elegans: relations between the germ line Lagos-Quintana, M., R. Rauhut, W. Lendeckel, and T. Tuschl, and soma. Dev. Biol. 212: 101–123. 2001 Identification of novel genes coding for small expressed Hammell, M., D. Long, L. Zhang, A. Lee, C. S. Carmack et al., RNAs. Science 294: 853–858. 2008 mirWIP: microRNA target prediction based on micro- Lagos-Quintana, M., R. Rauhut, A. Yalcin, J. Meyer, W. Lendeckel RNA-containing ribonucleoprotein-enriched transcripts. Nat. et al., 2002 Identification of tissue-specific microRNAs from Methods 5: 813–819. mouse. Curr. Biol. 12: 735–739.

1216 S. L. Burke, M. Hammell, and V. Ambros Landgraf, P., M. Rusu, R. Sheridan, A. Sewer, N. Iovino et al., Pekarsky, Y., U. Santanam, A. Cimmino, A. Palamarchuk, A. Efanov 2007 A mammalian microRNA expression atlas based on small et al., 2006 Tcl1 expression in chronic lymphocytic leukemia is RNA library sequencing. Cell 129: 1401–1414. regulated by miR-29 and miR-181. Cancer Res. 66: 11590– Lant, B., and K. B. Storey, 2010 An overview of stress response 11593. and hypometabolic strategies in Caenorhabditis elegans: con- Powell, J. R., and F. M. Ausubel, 2008 Models of Caenorhabditis served and contrasting signals with the mammalian system. elegans infection by bacterial and fungal pathogens. Methods Int. J. Biol. Sci. 6: 9–50. Mol. Biol. 415: 403–427. Lau, N. C., 2001 An abundant class of tiny RNAs with probable Plenefisch, J. D., X. Zhu, and E. M. Hedgecock, 2000 Fragile skel- regulatory roles in Caenorhabditis elegans. Science 294: 858– etal muscle attachments in dystrophic mutants of Caenorhabditis 862. elegans: isolation and characterization of the mua genes. Devel- Lee, M., E. J. Cram, B. Shen, and J. E. Schwarzbauer, 2001 Roles opment 127: 1197–1207. for pat-3 Integrins in Development and Function of Caenorhab- Posadas, D. M., and R. W. Carthew, 2014 MicroRNAs and their ditis elegans Muscles and Gonads. J. Biol. Chem. 276: 36404– roles in developmental canalization. Curr. Opin. Genet. Dev. 27: 36410. 1–6. Lewis, B. P., C. B. Burge, and D. P. Bartel, 2005 Conserved seed Powell, J. R., and F. M. Ausubel, 2008 Models of Caenorhabditis pairing, often flanked by adenosines, indicates that thousands of elegans Infection by Bacterial and Fungal Pathogens. Methods human genes are microRNA targets. Cell 120: 15–20. Mol. Biol. 415: 403–427. Li, X., J. J. Cassidy, C. A. Reinke, S. Fischboeck, and R. W. Carthew, Poy, M. N., L. Eliasson, J. Krutzfeldt, S. Kuwajima, X. Ma et al., 2009 A microRNA imparts robustness against environmental 2004 A pancreatic islet-specific microRNA regulates insulin fluctuation during development. Dev. Cell 137: 273–282. secretion. Nature 432: 226–230. Li, Y., F. Wang, J. Xu, F. Ye, Y. Shen et al., 2011 Progressive Price, L. S., J. Leng, M. A. Schwartz, and G. M. Bokoch, miRNA expression profiles in cervical carcinogenesis and iden- 1998 Activation of Rac and Cdc42 by integrins mediates cell tification of HPV-related target genes for miR-29. J. Pathol. 224: spreading. Mol. Biol. Cell 9: 1863–1871. 484–495. Ren, X. D., W. B. Kiosses, and M. A. Schwartz, 1999 Regulation of Lim, L. P., 2003 The microRNAs of Caenorhabditis elegans. Genes the small GTP-binding protein Rho by cell adhesion and the Dev. 17: 991–1008. cytoskeleton. EMBO J. 18: 578–585. Lim, L. P., M. E. Glasner, S. Yekta, C. B. Burge, and D. P. Bartel, Rokavec, M., H. Li, L. Jiang, and H. Hermeking, 2014 The p53/ 2003 Vertebrate microRNA genes. Science 299: 1540. miR-34 axis in development and disease. J. Mol. Cell Biol. 6: Liu, Z., S. Kirch, and V. Ambros, 1995 The Caenorhabditis elegans 214–230. heterochronic gene pathway controls stage-specific transcription Ruaud, A.-F., and J.-L. Bessereau, 2006 Activation of nicotinic of collagen genes. Development 121: 2471–2478. receptors uncouples a developmental timer from the molting Lucanic, M., and H.-J. Cheng, 2008 A RAC/CDC-42–independent timer in C. elegans. Development 133: 2211–2222. GIT/PIX/PAK signaling pathway mediates cell migration in C. Sahu, S. N., J. Lewis, I. Patel, S. Bozdag, J. H. Lee et al., elegans. PLoS Genet. 4: e1000269. 2013 Genomic Analysis of Stress Response against Arsenic in Lui,W.-O.,N.Pourmand,B.K.Patterson,andA.Fire,2007 Patterns Caenorhabditis elegans. PLoS ONE 8: e66431. of known and novel small RNAs in human cervical cancer. Cancer Schindler, A. J., L. R. Baugh, and D. R. Sherwood, Res. 67: 6031–6043. 2014 Identification of late larval stage developmental check- Meighan, C. M., and J. E. Schwarzbauer, 2007 Control of C. elegans points in Caenorhabditis elegans regulated by insulin/IGF and hermaphrodite gonad size and shape by vab-3/Pax6- steroid hormone signaling pathways. PLoS Genet. 10: mediated regulation of integrin receptors. Genes Dev. 21: e1004426. 1615–1620. Seguin, L., J. S. Desgrosellier, S. M. Weis, and D. A. Cheresh, Michael, M. Z., S. M. O’ Connor, N. G. van Holst Pellekaan, G. P. 2015 Integrins and cancer: regulators of cancer stemness, me- Young, and R. J. James, 2003 Reduced accumulation of spe- tastasis, and drug resistance. Trends Cell Biol. 25: 234–240. cific microRNAs in colorectal neoplasia. Mol. Cancer Res. 1: Sempere, L. F., N. S. Sokol, E. B. Dubrovsky, E. M. Berger, and V. 882–891. Ambros, 2003 Temporal regulation of microRNA expression in Miska, E. A., E. Alvarez-Saavedra, A. L. Abbott, N. C. Lau, A. B. Drosophila melanogaster mediated by hormonal signals and Hellman et al., 2007 Most Caenorhabditis elegans microRNAs broad-Complex gene activity. Dev. Biol. 259: 9–18. are individually not essential for development or viability. PLoS Siegfried, K. R., and J. Kimble, 2002 POP-1 controls axis forma- Genet. 3: e215–e216. tion during early gonadogenesis in C. elegans. Development Mourelatos, Z., J. Dostie, S. Paushkin, A. Sharma, B. Charroux 129: 443–453. et al., 2002 miRNPs: a novel class of ribonucleoproteins con- Stiernagle, T., 2006 Maintenance of C. elegans (February 11, taining numerous microRNAs. Genes Dev. 16: 720–728. 2006), WormBook, ed. The C. elegans Research Community, Nguyen, T., C. Kuo, M. B. Nicholl, M.-S. Sim, R. R. Turner et al., WormBook, doi/10.1895/wormbook. 1.101. 1.10.1895/worm- 2011 Downregulation of microRNA-29c is associated with hy- book permethylation of tumor-related genes and disease outcome in Suh, M.-R., Y. Lee, J. Y. Kim, S.-K. Kim, S.-H. Moon et al., cutaneous melanoma. Epigenetics 6: 388–394. 2004 Human embryonic stem cells express a unique set of Nishiwaki, K., N. Hisamoto, and K. Matsumoto, 2000 A metallo- microRNAs. Dev. Biol. 270: 488–498. protease disintegrin that controls cell migration in Caenorhabdi- Sulston, J. E., 1976 Post-embryonic development in the ventral tis elegans. Science 288: 2205–2208. cord of Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. B Ono, K., R. Yu, and S. Ono, 2007 Structural components of the Biol. Sci. 275: 287–297. nonstriated contractile apparatuses in the Caenorhabditis ele- Sulston, J. E., and H. R. Horvitz, 1977 Post-embryonic cell line- gans gonadal myoepithelial sheath and their essential roles for ages of the nematode, Caenorhabditis elegans. Dev. Biol. 56: ovulation. Dev. Dyn. 236: 1093–1105. 110–156. Park, S.-Y., J. H. Lee, M. Ha, J.-W. Nam, and V. N. Kim, 2008 miR- Sulston, J. E., E. Schierenberg, J. G. White, and J. N. Thomson, 29 miRNAs activate p53 by targeting p85a and CDC42. Nat. 1983 The embryonic cell lineage of the nematode Caenorhab- Struct. Mol. Biol. 16: 23–29. ditis elegans. Dev. Biol. 100: 64–119.

mir-34 and mir-83 in DTC Migrations 1217 Tsang, J., J. Zhu, and A. van Oudenaarden, 2007 MicroRNA-me- Xue, W., J. E. Dahlman, T. Tammela, O. F. Khan, S. Sood et al., diated feedback and feedforward loops are recurrent network 2014 Small RNA combination therapy for lung cancer. Proc. motifs in mammals. Mol. Cell 26: 753–767. Natl. Acad. Sci. USA 111: E3553–E3561. Van Aelst, L., and C. D’Souza-Schorey, 1997 Rho GTPases and Yamakuchi, M., and C. J. Lowenstein, 2009 MiR-34, SIRT1 and signaling networks. Genes Dev. 11: 2295–2322. p53: the feedback loop. Cell Cycle 8: 712–715. Williams, B. D., and R. H. Waterston, 1994 Genes critical for Yanaihara, N., N. Caplen, E. Bowman, M. Seike, K. Kumamoto muscle development and function in Caenorhabditis elegans et al., 2006 Unique microRNA molecular proﬁles in lung can- identiﬁed through lethal mutations. J. Cell Biol. 124: 475– cer diagnosis and prognosis. Cancer Cell 9: 189–198. 490. Zhou, K. I., Z. Pincus, and F. J. Slack, 2011 Longevity and stress in Wong, M.-C., and J. E. Schwarzbauer, 2012 Gonad morpho- Caenorhabditis elegans. Aging (Albany, N.Y. Online) 3: 733–753. genesis and distal tip cell migration in the Caenorhabditis Zinovyeva, A. Y., S. Bouasker, M. J. Simard, C. M. Hammell, and V. – elegans hermaphrodite. Wiley Interdiscip. Rev. Dev. Biol. 1: 519 Ambros, 2014 Mutations in conserved residues of the C. ele- 531. gans microRNA Argonaute ALG-1 identify separable functions in Xiong, Y., J.-H. Fang, J.-P. Yun, J. Yang, Y. Zhang et al., ALG-1 miRISC loading and target repression. PLoS Genet. 10: 2010 Effects of microRNA-29 on apoptosis, tumorigenicity, e1004286. and prognosis of hepatocellular carcinoma. Hepatology 51: 836–845. Communicating editor: D. I. Greenstein

1218 S. L. Burke, M. Hammell, and V. Ambros GENETICS

Supporting Information www.genetics.org/lookup/suppl/doi:10.1534/genetics.115.179184/-/DC1

Robust Distal Tip Cell Pathﬁnding in the Face of Temperature Stress Is Ensured by Two Conserved microRNAS in Caenorhabditis elegans

Samantha L. Burke, Molly Hammell, and Victor Ambros

Copyright © 2015 by the Genetics Society of America DOI: 10.1534/genetics.115.179184 A C. elegans mir-34 A G G C A G U G U G G U U A G C U G G U U G - - D. melanogaster mir-34 U G G C A G U G U G G U U A G C U G G U U G U G M. musculus mir-34a U G G C A G U G U - C U U A G C U G G U U G U - M. musculus mir-34b A G G C A G U G U A A U U A G C U G A U U G U - M. musculus mir-34c A G G C A G U G U A G U U A G C U G A U U G C - H. Sapiens mir-34a U G G C A G U G U - C U U A G C U G G U U G U - H. Sapiens mir-34c A G G C A G U G U A G U U A G C U G A U U G C - B C. elegans mir-83 U A G C A C C A U A U A A A U U C A G U A A - M. musculus mir-29a U A G C A C C A U C U G A A A U C G G U U A - M. musculus mir-29b U A G C A C C A U U U G A A A U C A G U G U U M. musculus mir-29c U A G C A C C A U U U G A A A U C G G U U A - H. Sapiens mir-29a U A G C A C C A U C U G A A A U C G G U U A - H. Sapiens mir-29b U A G C A C C A U U U G A A A U C A G U G U U H. Sapiens mir-29c U A G C A C C A U U U G A A A U C G G U U A -

Figure S1 mir-34 and mir-83 are highly conserved. FigureNucleotide S1. mir-34 alignments and mir-83 of (A) are mir-34 highly andconserved. (B) mir-83 sequences. mir-29 is the mammalian homolog of mir-83. NucleotideConserved alignments nucleotides of (A) are mir-34 shown and in red.(B) mir-83 sequences. mir-29 is the mammalian homolog of mir-83. Conserved nucleotides are shown in red.

S. L. Burke et al. 2 SI

S. L. Burke et al. 2 SI A *** * 100 Migration defective s 80 Normal arm

gonad 40

f 24 o

n=50 20 % 8 0 4 0

r-34(gk437)r-83(n4638)r-34(gk437) mi mi

r-83(n4638); mi mi B *** ** 100 Migration defective s 80 Normal arm

60 48

gonad 40 f o

22 n=50 20 % 12 0 0 N2

r-34(gk437)r-83(n4638)r-34(gk437) mi mi

r-83(n4638); mi mi

Figure S2S2. The gonadgonad migration migration defect defect is significantly is significantly enhanced enhanced in mir-83(n4638); in mir-83(n4638); mir-34(gk437) mir-34(gk437) double mutants double mutants raised raisedon OP50 on OP50E. coil E.. coil. (A) AnimalsAnimals raised raised at at20 20ºo or (B)or (B)in oscillating in oscillating temperatures temperatures (15o for (15º 15 minutes,for 15 minutes, 25o for 15 25º minutes, for 15 repeated minutes, from repeated from plating platingeggs until eggs young until young adulthood). adulthood). *** p-value*** p-value ≤ .005, ≤ .005, ** **.005 .005 < < p p ≤ ≤ .01,.01, * .01 << p p ≤ ≤ .05. .05.

S. L. Burke et al. 3 SI S. L. Burke et al. 3 SI A n.s. 100 Migration defective s 80 Normal arm

gonad 40 f o

17 n=60 20 % 8 0 0 N2

r-34(gk437) r-34(n4276) mi mi

B n.s. 100 Migration defective s 80 Normal arm

gonad 40 33 f o

n=60 20 18 % 2 0 N2

r-34(gk437) r-34(n4276) mi mi

FigureFigure S3 S3. Migration Migration defect defect seen seen in two in differenttwo different mir-34 mir-34 null alleles. null alleles. AnimalsAnimals raised raised at eitherat either (A) 20(A)o or20º (B) or in (B) oscillating in oscillating temperatures temperatures (15o for 15(15º minutes, for 15 25minutes,o for 15 minutes,25º for 15 repeated minutes, repeated from fromplating plating eggs eggs until until young young adulthood). adulthood). NotNot significant significant (n.s) (n.s) if p-value if p-value greater greater than than.05. .05.

S. L. Burke et al. 4 SI S. L. Burke et al. 4 SI o A 100 *** 25 C Migration defective s

m 80

r Normal o a

20 C d 60 a n

o n=60 g 40 Temperature o

f 15 C o

20 20 % 0 0 t = 0 12 hrs t = ~24 hrs N2 mir-83(n4638); Feeding First Molt mir-34(gk437)

B 100 *** 25 o C Migration defective s

m 80 r Normal a 20 o C d 60 58 a n

o n=60

g 40

Temperature f 15 o C o 20 % 0 0 t = 0 14 hrs 20 hrs t = ~24 hrs N2 mir-83(n4638); Feeding First Molt mir-34(gk437)

C 100 *** o Migration defective 25 C s

m 80 r Normal Repeat a 20 o C d 60 N2 mir-34; mir-83 until a

n adulthood

o n=60

g 40

f Temperature 15 o C o 20 15 % 0 0 t = 0 22 hrs t = ~24 hrs mir-83(n4638); N2 Feeding First Molt mir-34(gk437)

Figure S4 Additional temperature oscillation schemes. TemperatureFigure S4. Additional oscillated temperaturebetween 15o andoscillation 25o every schemes. 15 minutes for the time windows indicated. (A) For the first 12 hoursTemperature from the oscillated initial plating between of starved 15º L1sand on 25º HB101-seeded every 15 minutes NGM forplates. the (B)time From windows 14 to 20indicated. hours post-plating (A) For the L1s, first 12 hours a time period that overlaps with the 2 hour window described in Figure 3. (C) From 22 hours post plating L1s until wormsfrom the were initial scored plating as adults.of starved *** p-value L1s on ≤ HB101-seeded .005, significance NGM stars plates. compare (B) N2 From to mir-83(n4638); 14 to 20 hours mir-34(gk437) post-plating L1s, a time mutants.period that overlaps with the 2 hour window described in Figure 3. (C) From 22 hours post plating L1s until worms were soed as adults. *** p-value ≤ .005, signiiane stas opae to mir-83(n4638); mir-34(gk437) mutants.

S. L. BurkeS. et L. al. Burke et al. 5 SI 5 SI o 100 *** 37 C Migration defective s

m 80

r Normal o a 20 C

d 60 a 48 n

o n=60 Temperature g 40 o 15 C f o 20 % 0 0 t = 0 16 hrs 18 hrs t = ~24 hrs N2 mir-83(n4638); Feeding First Molt mir-34(gk437)

Figure S5 Oscillating temperatures between 15o and 37o does not further enhance the gonad migration defect in Figuremir-83(n4638); S5. Oscillating mir-34(gk437) temperatures mutants. between 15º and 37º does not further enhance the gonad migration defect in o o o mir-83(n4638);Starved L1s were mir-34(gk437) plated on HB101-seeded mutants. NGM plates, grown at 20 for 16 hours, then cycled between 15 and 37 every 15 minutes for a total of 2 hours. *** p-value ≤ .005, significance stars compare N2 to mir-83(n4638); Starvedmir-34(gk437) L1s weremutants. plated on HB101-seeded NGM plates, grown at 20º for 16 hours, then cycled between 15º and 37º evey 15 inutes o a total o hous. *** p-value ≤ .005, signiiane stas opae to mir-83(n4638); mir-34(gk437) mutants.

S. L. Burke et al. 6 SI

S. L. Burke et al. 6 SI A *** 100 Migration defective s

m 80 Normal o

r 25 C a

d 60 a o n n=60 20 C o

g 40

f 22 o Temperature 20 15 o C % 0 0 t = 0 12 hrs 14 hrs t = ~24 hrs N2 mir-83(n4638); Feeding First Molt mir-34(gk437)

B *** 100 Migration defective s

m Normal 80 o r 25 C a 58 d 60 a

n n=60 20 o C o

g 40

f o

20 Temperature 15 o C % 0 0 t = 0 16 hrs 18 hrs t = ~24 hrs N2 mir-83(n4638); Feeding First Molt mir-34(gk437) C *** 100 Migration defective s

m 80 Normal o r 25 C a

d 60 a o n n=60 20 C o

g 40

f 23 o

20 Temperature 15 o C % 2 0 t = 0 20 hrs 22 hrs t = ~24 hrs N2 mir-83(n4638); Feeding First Molt mir-34(gk437)

Figure S6. Enhancement of the gonad migration defect is independent of the direction of the initial temperature change. Figure S6 Enhancement of the gonad migration defect is independent of the direction of the initial temperature Temperaturechange. Temperature oscillation oscillation schemes schemes were were identical identical to thoseto those presented presented in in Figure Figure 3 except the the direction direction of ofthe the initial temperature changeinitial temperature was reversed. change Rather was reversed. than first Rather lowering than firstthe loweringtemperature the temperature to 15º, the to temperature 15o, the temperature was elevated was to 25º for 15 minutes.elevated to This 25o wasfor 15 followed minutes. byThis 15 was minutes followed at by15º 15 and minutes repeated at 15 othree and repeated additional three times. additional Oscillations times. occurred (A) 12-14, )Oscillations 1-1, ooccurred ) 0- (A) 12-14, hous (B) post 16-18, plating or (C) staved 20-22 1s.hours *** post p-value plating ≤ starved .005, signiianeL1s. *** p-value stas ≤ .005, opae to mir-83(n4638); mir-34(gk437)significance stars mutants. compare N2 to mir-83(n4638); mir-34(gk437) mutants.

S. L. Burke S.et L.al. Burke et al. 7 SI 7 SI

A *** 100 Migration defective s

m 80 Normal o

r 25 C a

d 60 a 20 o C n 45 n=60 o

g 40

f Temperature o o 15 C 20 % 0 0 t = 0 16 hrs 18 hrs t = ~24 hrs N2 mir-83(n4638); Feeding First Molt mir-34(gk437)

*** 100 Migration defective

B s

m 80 Normal o

r 25 C a

d 60

a 53 20 o C n n=60 o

g 40

f Temperature o o 20 15 C % 0 0 t = 0 16 hrs 18 hrs t = ~24 hrs N2 mir-83(n4638); Feeding First Molt mir-34(gk437)

Figure S7. The amount of enhancement of the gonad migration defect is independent of the magnitude of the temperature change. Figure S7 The amount of enhancement of the gonad migration defect is independent of the magnitude of the temperatureFive degree change. changes between (A) 15º and 20º and (B) 20º and 25º during the 2 hour window from 16-18 hours post Fiveplating degree staved changes 1s. between *** p-value (A) 15≤ o.005, and 20signiianeo and (B) 20 staso and 25opaeo during the to2 hourmir-83(n4638); window from mir-34(gk437) 16-18 hours post mutants. plating starved L1s. *** p-value ≤ .005, significance stars compare N2 to mir-83(n4638); mir-34(gk437) mutants.

S. L. Burke et al. 8 SI S. L. Burke et al. 8 SI A *** 100 Migration defective s

m 80 Normal r

a 25 o C

d 60 a

n 20 o C o

g 40

f Temperature o 15 o C 20 20 % 0 n=60 t = 0 16 hrs 18 hrs t = ~24 hrs 0 Feeding First Molt N2 mir-83(n4638); mir-34(gk437)

B *** 100 Migration defective s

m 80 r Normal

a 25 o C

d 60 a

n 20 o C o

g 40

f Temperature o 15 o C 18 20 % 0 n=60 t = 0 16 hrs 18 hrs t = ~24 hrs 0 Feeding First Molt N2 mir-83(n4638); mir-34(gk437) C

** 100 Migration defective

s Normal m 80 r o a 25 C

d 60 a o n 20 C o

g 40

Temperature o o 15 C 20 13 % 0 n=60 t = 0 16 hrs 18 hrs t = ~24 hrs 0 Feeding First Molt N2 mir-83(n4638); mir-34(gk437)

*** 100 Migration defective

s Normal m 80 r o

a 25 C

d 60 a o

n 20 C o

g 40

Temperature o o 23 15 C 20 % 0 n=60 t = 0 16 hrs 18 hrs t = ~24 hrs 0 Feeding First Molt N2 mir-83(n4638); mir-34(gk437)

Figure S8. A single temperature cycle is not sufficient to enhance the gonad migration defect in mir-83(n4638); mir-34(gk437) mutants. FigureThe 2 hour S8 Awindow single temperatureconsists of fourcycle rounds is not sufficientof 15 minutes to enhance at 15º the followed gonad migrationby 15 minutes defect at in 25º.mir-83(n4638); A single round of mir-34(gk437)temperature cycling mutants. is not enough to see an enhancement of the migration phenotype whether that occurs (A) 16 o o Thehous, 2 hour ) 1.5window hous, consists ) 1of fourhous, rounds o ) of 1.515 minutes hous atpost 15 plating followed staved by 15 minutes1s. *** atp-value 25 . A ≤single .005, round ** .005 of < p ≤ .01, temperature cycling is not enough to see an enhancement of the migration phenotype whether that occurs (A) 16 significance stars compare N2 to mir-83(n4638); mir-34(gk437) mutants. hours, (B) 16.5 hours, (C) 17 hours, or (D) 17.5 hours post plating starved L1s. *** p-value ≤ .005, ** .005 < p ≤ .01, significance stars compare N2 to mir-83(n4638); mir-34(gk437) mutants.

S. L. Burke et al. 9 SI

S. L. Burke et al. 9 SI *** *** n.s. 100 Migration defective s

m 80 Normal r a

60 d 60 52 a

n n = 50 o g

40 f o

% 20 0 0

mir-83(n4638); unc-54(e190); mir-34(gk437) mir-83(n4638); mir-34(gk437)

Figure S9S9. The gonadgonad migration migration defect defect in mir-83(n4638); in mir-83(n4638); mir-34(gk437) mir-34(gk437) mutants mutants is not movement is not movement dependent. dependent. The unc-54(e190)unc-54(e190) mutation mutation paralyzes paralyzes worms. worms. The penetrance The penetrance of the migration of the migration defect is defectnot signiﬁcantly is not significantly different different between mir-83(n4638); mir-34(gk437) mutants and unc-54(e190); mir-83(n4638); mir-34(gk437) mutants. Starved between mir-83(n4638); mir-34(gk437) mutants and unc-54(e190); mir-83(n4638); mir-34(gk437) mutants. Starved L1s were plated on HB101-seeded NGM plates, spent 16 hours at 20o, followed by four 15 minutes oscillations betweenL1s were 15 platedo and 25 ono. HB101-seeded*** p-value ≤ .005. NGM plates, spent 16 hours at 20º, followed by four 15 minutes oscillations between 15 and 5. *** p-value ≤ .005.

S. L. BurkeS. et L. al. Burke et al. 10 SI 10 SI A 1.5

1.0

0.5 mCherry/GFP n ≤ 9 Mean value fluorescence 0.0 s s s s s s 1 1 3 3 L L L L

3136 3118 3136 3118 T T T T V V V V VT3136 AdultVT3118 Adult

B * 1.0

0.8

0.6

0.4 mCherry/GFP 0.2 n=10 Mean value fluorescence 0.0 s s

VT3178 Adult VT3145 Adult

Figure S10. Quantification of cdc-42 and pat-3 fluorescent reporters. Synchronized L1s were plated on HB101-seeded NGM plates and cycled - 20º for 16 hours, [15º for 15 minutes, 25º for 15 minutes, repeated three additional times], 20º until time of scoring. The mean value fluorescence of mCherry was normalized to that of GFP. (A) Ratio of fluorescence within a DTC for worms with mir-34 and mir-83 versus the double miRNA mutant Figure(strain S10 VT3136 Quantification and VT3118 of respectively). cdc-42 and (B)pat-3 Ratio fluorescent of fluorescence reporters. for whole animals for worms with mir-34 and mir-83 versus Synchronized L1s were plated on HB101-seeded NGM plates and cycled - 20o for 16 hours, [15o for 15 minutes, 25o the doule i utant stain 1 and 15 espetively). * .01 < p ≤ .05. for 15 minutes, repeated three additional times], 20o until time of scoring. The mean value fluorescence of mCherry was normalized to that of GFP. (A) Ratio of fluorescence within a DTC for worms with mir-34 and mir-83 versus the double miRNA mutant (strain VT3136 and VT3118 respectively). (B) Ratio of fluorescence for whole animals for worms with mir-34 and mir-83 versus the double miRNA mutant (strain VT3178 and VT3145 respectively). * .01 < p ≤ .05. S. L. Burke et al. 11 SI

S. L. Burke et al. 11 SI Table S1 Predicted targets of both mir‐34 and mir‐83.

SEQUENCE GENE NAME SCREENED

B0348.6 ife‐3 C03E10.4 gly‐20 C04E6.7

C06G1.4 ain‐1 YES C14F5.5 sem‐5 YES C16A3.2 C16E9.4 inx‐1 C23H4.1 cab‐1 C26D10.5 eff‐1 C34H3.1 tag‐275

C38C6.2 atg‐2 YES C43H6.6 C48A7.1 egl‐19 C52B9.2 ets‐9 C56G2.1 akap‐1 D2023.2 pyc‐1

F09B9.2 unc‐115 YES F14D12.2 unc‐97 YES F21A3.3 F21F8.10 str‐135 F39C12.3 tsp‐14 F42H10.3 F46C8.5 ceh‐14 F46E10.9 dpy‐11

F49E11.1 mbk‐2

S. L. Burke et al. 12 SI SEQUENCE GENE NAME SCREENED

F53G12.1 rab‐11.1

H18N23.2

H19N07.2 math‐33 YES K08B12.5 tag‐59 YES K09E9.2 erv‐46

M04G12.4 somi‐1 YES M106.4 gmps‐1 R03G5.1 eft‐4 R07B1.9

R07G3.1 cdc‐42 YES R09B5.12 chil‐14 R153.1 pde‐4 T05A10.1 sma‐9 T12G3.1 sqst‐1

T14F9.4 peb‐1 YES T17H7.4 gei‐16 T19A6.1 T27B1.2 pat‐9 T28D9.7 del‐10 W01F3.1 mnr‐1 W03G9.1 snf‐1

W09G10.6 clec‐125

Y43H11AL.1 Y54E10A.9 vbh‐1

Y73B6BL.6 sqd‐1

S. L. Burke et al. 13 SI SEQUENCE GENE NAME SCREENED

ZC64.3 ceh‐18 YES ZK1058.2 pat‐3 YES ZK112.2 ncl‐1

ZK377.2 sax‐3 YES ZK994.3 pxn‐1

List of genes whose mRNA is predicted to be targeted by both mir‐34 and mir‐83 according to mirWIP. Included are both cdc‐42 and pat‐3. RNAi was used to knockdown a subset of candidate targets (designated by YES in the SCREENED column) to look for suppression of the migration defect in mir‐83(n4638); mir‐34(gk437) mutants.

S. L. Burke et al. 14 SI Table S2 C. elegans Strains

STRAIN NAME GENOTYPE

MT12955 mir‐1(n4102) I MT12969 mir‐259(n4106) V MT15501 mir‐83(n4638) IV MT16309 mir‐247 mir‐797(n4505) X RW3600 pat‐3(st564)/qC1 [dpy‐19(e1259) glp‐1(q339)] III VC898 cdc‐42(gk388)/mIn1 [mIS14 dpy‐10(e128)] II VT1555 mir‐59(n4604) IV VT2392 mir‐34(gk437) X VT2527 mir‐124(n4255) IV VT2595 mir‐83(n4638) IV; mir‐34(gk437) X VT2797 pat‐3(st564)/qC1 [dpy‐19(e1259) glp‐1(q339)] III; mir‐83(n4638) IV; mir‐34(gk437) X VT2812 unc‐54(e190) I; mir‐83(n4638) IV; mir‐34(gk437) X VT2885 cdc‐42(gk388)/mIn1 [mIS14 dpy‐10(e128)] II; mir‐83(n4638) IV; mir‐34(gk437) X VT2905 mir‐259(n4106) V; mir‐34(gk437) X VT2906 mir‐83(n4638) IV; mir‐259(n4106) V; mir‐34(gk437) X VT3032 mir‐83(n4638) IV; mir‐259(n4106) V VT3104 maIs385 [Plim‐7::mir‐34 cb unc‐119+] I; mir‐34(gk437) X VT3105 maIs386 [Pmyo‐3::mir‐34 cb unc‐119+] I; mir‐34(gk437) X VT3106 maIs387 [Pmir‐34::mir‐34 cb unc‐119+] I; mir‐34(gk437) X VT3107 maIs388 [Plim‐7::mir‐83 cb unc‐119+] II; mir‐83(n4638) IV VT3108 maIs389 [Pdpy‐7::mir‐83 cb unc‐119+] II; mir‐83(n4638) IV VT3109 maIs390 [Pmyo‐3::mir‐83 cb unc‐119+] II; mir‐83(n4638) IV VT3110 maIs391 [Pmir‐83::mir‐83 cb unc‐119+] II; mir‐83(n4638) IV VT3111 maIs392 [Plag‐2::mir‐83 cb unc‐119+] II; mir‐83(n4638) IV VT3118 unc‐119(ed3) III; mir‐83(n4638) IV; mir‐34(gk437) X; maEx246 VT3123 maIs396 [Pdpy‐7::mir‐34 cb unc‐119+] I; mir‐34(gk437) X VT3124 maIs397 [Plag‐2::mir‐34 cb unc‐119+] I; mir‐34(gk437) X VT3136 unc‐119(ed3) III; maEx246 VT3145 unc‐119(ed3) III; mir‐83(n4638) IV; mir‐34(gk437) X; maEx247 VT3178 unc‐119(ed3) III; maEx247 VT3289 mir‐83(n4638) IV; mir‐34(gk437) X VT3294 maIs387 I; maIs391 II; mir‐83(n4638) IV; mir‐34(gk437) X

S. L. Burke et al. 15 SI Table S3 Entry vectors and primers

VECTOR DESCRIPTION FORWARD PRIMER 5’→ 3’ REVERSE PRIMER 5’→ 3’ pSLB028 pat‐3 3‘UTR GATAAATAGTTTTTATCCTTATATTTTAAT CTCGGGGAACAACAACTGACTCTGT pSLB029 mir‐34 hairpin CTTAATACCACTACTGACTA AAGGTTTCTGATCTAAGATG pSLB032 Mutated cdc‐42 3‘UTR N/A N/A pSLB033 Mutated pat‐3 3‘UTR N/A N/A pSLB035 cdc‐42 promoter ATATCATATAAACTTGCGAAGGAAT TTCGCCTGAAAAAAAAAATGAATA pSLB036 cdc‐42 3‘UTR GAACGTCTTCCTTGTCTCCATGT TGTTCCTCTCCTCGTCAAACA pSLB037 lim‐7 promoter AGCAATGCTTCCGAAAACC GCCGTTGAACAGATATAGAAGTTTG pSLB038 dpy‐7 promoter AATCTCATTCCACGATTTCT TTATCTGGAACAAAATGTA pSLB040 mir‐83 hairpin TAAAAGCACCACTCGGAACC AATAGCTCTCGACGCGAAAT pSLB041 mir‐83 3’ sequence CTGTATTCAATTATTTGATTC TTTTCAAGCCAAAACAGAGC pSLB042 myo‐3 promoter TGTGTGTGATTGCTTTTTC TTCTAGATGGATCTAGT pSLB043 mir‐34 3’ sequence GAGTTTTTGAAAAGTTGAGG CACGGCCGCTACCTCCACCTTA pSLB062 mir‐83 promoter ACGAATTTCCCACCATTTTG AATTGAATAATTTGTACCTGCG pSLB069 pat‐3 promoter ACGGTATTTTTTCGGGAGA TTGATGCCGGGTAGGTT pSLB076 lag‐2 promoter ACTGGCGCTACTCCACCTT CTGAAAAAAGGCAAATTTGAAAAG pSLB080 mir‐34 promoter N/A N/A

List of primers used to amplify genomic regions and the resulting Gateway compatible entry vectors created for tissue specific rescue and target sensor constructs.

S. L. Burke et al. 16 SI Table S4 Expression constructs

VECTOR DESCRIPTION ENTRY VECTORS DESTINATION VECTORS pSLB054 Pcdc‐42::GFP‐H2B::Mutated cdc‐42 3‘UTR pCM1.35, pSLB033, pSLB035 pCFJ210 pSLB056 Pcdc‐42::mCherry‐H2B::cdc‐42 3‘UTR pCM1.151, pSLB035, pSLB036 pCFJ150 pSLB059 Plim‐7::mir‐83 hairpin::mir‐83 3‘UTR pSLB037, pSLB040, pSLB041 pCFJ150 pSLB063 Pdpy7::mir‐83 hairpin::mir‐83 3’ UTR pSLB038, pSLB040, pSLB041 pCFJ150 pSLB064 Pmyo‐3::mir‐83 hairpin::mir‐83 3’ UTR pSLB040, pSLB041, pSLB042 pCFJ150 pSLB065 Plim‐7::mir‐34 hairpin::mir‐34 3’ UTR pSLB029, pSLB037, pSLB043 pCFJ210 pSLB066 Pdpy‐7::mir‐34 hairpin::mir‐34 3’ UTR pSLB029, pSLB030, pSLB043 pCFJ210 pSLB067 Pmyo‐3::mir‐34 hairpin::mir‐34 3’ UTR pSLB029, pSLB042, pSLB043 pCFJ210 pSLB070 Pmir‐83::mir‐83 hairpin::mir‐83 3‘UTR pSLB040, pSLB041, pSLB062 pCFJ150 pSLB071 Ppat‐3::mCherry‐H2B::pat‐3 3‘UTR pCM1.151, pSLB028, pSLB069 pCFJ150 pSLB075 Ppat‐3::GFP‐H2B::Mutated pat‐3 3‘UTR pCM1.35, pSLB033, pSLB069 pCFJ210 pSLB077 Plag‐2::mir‐34 hairpin::mir‐34 3‘UTR pSLB029, pSLB043, pSLB076 pCFJ210 pSLB078 Plag‐2::mir‐83 hairpin::mir‐83 3‘UTR pSLB040, pSLB041, pSLB076 pCFJ150 pSLB081 Pmir‐34::mir‐34 hairpin::mir‐34 3‘UTR pSLB029, pSLB043, pSLB080 pCFJ210

The noted entry and destination vectors were used to construct the described transgenes for tissue specific rescue and target sensor experiments.

S. L. Burke et al. 17 SI Table S5 Additional stresses

STRESS STRAIN MIGRATION DEFECT PENETRANCE a15º N2 4.5 +/‐ 6.36% mir‐34(gk437) 21.5 +/‐ 12.02% mir‐83(n4638) 14.5 +/‐ 0.71% mir‐83(n4638); mir‐34(gk437) 21 +/‐ 5.66% b25º N2 5.3 +/‐ 3.18% mir‐34(gk437) 13.4 +/‐ 6.54% mir‐83(n4638) 11.6 +/‐ 0.53% mir‐83(n4638); mir‐34(gk437) 24 +/‐ 5.66% cArsenic N2 0% (n=30) mir‐83(n4638); mir‐34(gk437) 27% (n=30) dDauer N2 7% (n=60) mir‐34(gk437) 27% (n=60) mir‐83(n4638) 25% (n=60) mir‐83(n4638); mir‐34(gk437) 37% (n=60) eP. aeruginosa N2 3% (n=30) mir‐34(gk437) 13% (n=30) mir‐83(n4638) 13% (n=30) mir‐83(n4638); mir‐34(gk437) 17% (n=30)

aRaised from egg to young adulthood at 15º. Two replicates, n=60 and n=100. bRaised from egg to young adulthood at 25º. Two replicates, n=80 and n=100. cRaised from egg to young adulthood at 20º on NGM plates with 0.03% sodium arsenite. dDauers isolated from starved plates and moved to fresh plates. Left at 20º until young adulthood. eRaised from egg to young adulthood at 25º on P. aeruginosa seeded NGM plates.

Penetrance of the migration defect in the noted strains raised in other stress conditions.

S. L. Burke et al. 18 SI