DOCSLIB.ORG

Supporting Information Materials and Methods

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Information Materials and Methods SUPPORTING INFORMATION MATERIALS AND METHODS CardioGRKO mice. The mouse GR (NR3C1) locus was modified by standard gene targeting procedures. In brief, the targeting vector contained loxP sites inserted upstream of exon 3 and downstream of exon 4 and included a neo selection cassette flanked by Frt sites. C57BL/6 embryonic stem cells with homologous recombination were identified by a PCR-based screen and confirmed by Southern blot and PCR analyses. Positive clones were transfected with Flp recombinase and neo deletion was confirmed by PCR. Mice harboring the modified GR allele were derived by blastocyst (albino B6) injection. For all mice, genotypes were determined by PCR using DNA isolated from tail biopsies. To evaluate the tissue specificity of Cre-mediated recombination, DNA was isolated from various tissues of cardioGRKO mice and subjected to PCR. Primers for the floxed GR allele were forward primer 5’- GGATTATAGGCATGCACAATTACGGC-3’ and reverse primer 5’- CTTCTCATTCCATGTCAGCATGTTCAC-3’. Primers for the null GR allele were the forward primer above and reverse primer 5’-CCCATCCAATGTTGTTGGCAGAG-3’. Adrenalectomized mice were maintained on laboratory chow and 0.9% NaCl ad libitum. All experiments were approved and performed according to the guidelines of the animal care and use committees at the University of North Carolina at Chapel Hill and at NIEHS/NIH. Data presented are from studies done on age-matched littermates and, unless indicated, were performed on male mice. Real-time PCR. Total RNA was isolated from the whole hearts of control and cardioGRKO mice using Qiagen RNeasy mini Kit (GmbH, Germany) according to manufacturer's instructions. All primer sets for PCR were purchased from Applied Biosystems (Foster City, CA). PCR was performed with Taqman® probe-based detection system and quantified by the ABI Prism 7900HT Sequence Detection System 1 (Applied Biosystems, Foster City, CA). The abundance of each gene was normalized to the housekeeping gene peptidylprolyl isomerase B (cyclophilin B) that is not regulated by glucocorticoids. Immunoblotting. Hearts from control and cardioGRKO mice were lysed in RIPA buffer (25 mM Tris- HCl, pH 7.5, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, and 0.1% SDS) supplemented with complete mini protease inhibitor cocktail (Roche, Indianapolis, IN). Protein concentrations were determined and equal amounts of lysates were separated on 4-12% bis-tris gels (Invitrogen, Carlsbad, CA) and transferred to nitrocellulose membranes. Membranes were blocked with 5% milk in 1x TBST (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, and 0.1 % Tween-20) for 1 hour at RT and incubated with primary antibodies overnight at 4ºC. Membranes were then washed with 1x TBST and incubated with appropriate secondary antibodies for 1 hour at RT. After additional washes with 1xTBST, membranes were developed by enhanced chemiluminescence (GE Healthcare, Piscataway, NJ). The RyR2 antibody was purchased from Abcam (Cambridge, MA) and the GAPDH antibody was purchased from Cell Signaling (Danvers, MA). The MR antibody was generously provided by Dr. Celso E. Gomez-Sanchez (1). Generation of the anti-GR antibodies 57 and 59 has been described previously (2). Histological analysis. Hearts from control and cardioGRKO mice were perfused with PBS and fixed with freshly prepared 4% paraformaldehyde. Samples were embedded in paraffin, cut in 5 μm sections, and stained with hematoxylin-eosin (HE) or Masson’s Trichrome as previously described (3). For immunohistochemistry, samples were deparaffinized, rehydrated, and endogenous peroxide blocked with 3% hydrogen peroxide. Citrate buffer (Biocare Medical, CA) was used for antigen retrieval. After blocking, samples were incubated overnight with anti-GR antibody 59 followed by a donkey anti-rabbit secondary antibody (Jackson Immunoresearch Laboratories, West Grove, PA) (2). Labeling was done with Vector RTU (Vector Laboratories, Burlingame, CA). Slides were developed with diamino- benzidine and counterstained with hematoxylin. 2 Survival analysis. Control and cardioGRKO mice were monitored on a daily basis for morbidity or death until 12 months age. Severely morbid mice were euthanized according to approved animal protocol. Echocardiographic analysis. Trans-thoracic echocardiography was performed on conscious mice using a VisualSonics Vevo 770 ultrasound biomicroscopy system (VisualSonics, Inc., Toronto, Ontario, Canada) using a 30MHx 707B scan head as previously described (3-5). Two dimensional guided M- mode analysis of the left ventricle was performed in a genotype-blinded fashion in the parasternal long- axis at the level of the papillary muscle. The leading edges of the epicardium and endocardium were used to measure anterior wall thickness (IVSTD, IVSTS), posterior wall thickness (PWTD, PWTS), and left ventricular internal diameters (LVEDD, LVESD). LV volume in diastole (LV VolD) was calculated from the equation LV VolD = (7/2.4 + LVEDD) x LVEDD3 x 1000, and LV volume in systole (LV VolS) was calculated from the equation LV VolS = (7/2.4 + LVESD) x LVESD3 x 1000. Left ventricular systolic function was assessed by ejection fraction (EF), calculated from the equation EF % = (LV VolD-LV VolS)/LV VolD x 100, and fractional shortening (FS), calculated from the equation FS % = (LVEDD- LVESD)/LVEDD x 100. M-mode measurements represent 3 average consecutive cardiac cycles from each mouse. Microarray analysis. Gene expression analysis was performed on RNA from the hearts of 2 day (neonatal), 1 month, 2 month, and 3 month old control and cardioGRKO mice using the Agilent Whole Mouse Genome oligo arrays (014868) (Agilent Technologies, Santa Clara, CA) following the Agilent 1- color microarray-based gene expression analysis protocol as described previously (6, 7). Data was obtained using the Agilent Feature Extraction software (v9.5), using the 1-color defaults for all parameters. The Agilent Feature Extraction Software performed error modeling, adjusting for additive and multiplicative noise. To determine differentially expressed probes, an error-weighted ANOVA and Benjamini-Hochberg multiple test correction with a p value < 0.01 was performed using Rosetta Resolver System (version 7.0; Rosetta Biosoftware, Kirkland, WA). Significantly regulated genes were analyzed 3 by Ingenuity Pathway Analysis software (Ingenuity Systems) or by Gene Ontology using GATHER (8). For GATHER, inferred annotations and a Bayes factor cutoff of 6.0 were employed. Calcium measurements on isolated cardiomyocytes. Adult cardiomyocytes from control and cardioGRKO mice were isolated using a commercially available kit (Perfusion Adumyts Cardiomyocyte Isolation Kit, Cellutron, Baltimore, Maryland). Fluorescence measurements were performed on single cardiomyocytes loaded with the calcium sensitive indicator, fluo-4 (Molecular Probes, Kd = 345 nM). Briefly, isolated cardiomyocytes were allowed to attach to Elastin-coated wells in complete AW medium. Cells were then incubated in serum-free AW medium containing 6 µM fluo-4/AM at 37° C in the dark for 15 min. Before intracellular calcium measurements were made, cells were washed 3 times and incubated for 15-30 min at room temperature (25° C) in a HEPES-buffered Tyrode’s salt solution (135 mM NaCl; 4 mM KCl; 1.0 mM MgCl2; 20 mM HEPES; 1.0 mM CaCl2 and 10 mM glucose, with pH 7.4 adjusted by NaOH). Calcium measurements were performed on a Zeiss LSM 710 inverted confocal microscope equipped with a 20x 0.4 NA objective. Fluo-4 fluorescence was monitored by exciting the indicator at 488nm, and collecting the emission wavelength at 500-630 nm. Data were collected in either line scan or frame mode, with a temporal resolution that ranged from 0.1 to 0.5 sec, respectively. Changes in intracellular calcium are represented as the change in fluo-4 fluorescence emission intensity (fluorescence intensity units). Cardiomyocytes displaying spontaneous intracellular calcium changes in the form of local calcium transients were selected for study. Intracellular calcium changes were monitored at the single cell level with data collected from a region of interest (ROI) representing an individual cell. Typically, 1 to 4 ROIs were monitored per experiment. The effects of caffeine stimulation on the intracellular calcium signal were monitored by the dilution of a caffeine solution into the medium bathing the cells. Final concentrations of caffeine bathing cells were either 0.25 mM, 0.5 mM, or 10 mM. Electrocardiographic analysis. Electrocardiographs were recorded in conscious mice non-invasively using the ECGenie system (Mouse Specifics) as described previously (9-11). 4 REFERENCES 1. Gomez-Sanchez CE, et al. (2006) Development of a panel of monoclonal antibodies against the mineralocorticoid receptor. Endocrinology 147(3):1343-1348. 2. Cidlowski JA, Bellingham DL, Powell-Oliver FE, Lubahn DB, & Sar M (1990) Novel antipeptide antibodies to the human glucocorticoid receptor: recognition of multiple receptor forms in vitro and distinct localization of cytoplasmic and nuclear receptors. Mol Endocrinol 4(10):1427-1437. 3. Willis MS, et al. (2007) Muscle ring finger 1, but not muscle ring finger 2, regulates cardiac hypertrophy in vivo. Circ Res 100(4):456-459. 4. Li HH, et al. (2011) The ubiquitin ligase MuRF1 protects against cardiac ischemia/reperfusion injury by its proteasome-dependent degradation of phospho-c-Jun. Am J Pathol 178(3):1043- 1058. 5. Li HH, et al. (2007) Atrogin-1 inhibits Akt-dependent cardiac hypertrophy in mice via ubiquitin- dependent coactivation of Forkhead proteins. J Clin Invest
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • The Activation of the Glucagon-Like Peptide-1 (GLP-1) Receptor by Peptide and Non-Peptide Ligands
    The Activation of the Glucagon-Like Peptide-1 (GLP-1) Receptor by Peptide and Non-Peptide Ligands Clare Louise Wishart Submitted in accordance with the requirements for the degree of Doctor of Philosophy of Science University of Leeds School of Biomedical Sciences Faculty of Biological Sciences September 2013 I Intellectual Property and Publication Statements The candidate confirms that the work submitted is her own and that appropriate credit has been given where reference has been made to the work of others. This copy has been supplied on the understanding that it is copyright material and that no quotation from the thesis may be published without proper acknowledgement. The right of Clare Louise Wishart to be identified as Author of this work has been asserted by her in accordance with the Copyright, Designs and Patents Act 1988. © 2013 The University of Leeds and Clare Louise Wishart. II Acknowledgments Firstly I would like to offer my sincerest thanks and gratitude to my supervisor, Dr. Dan Donnelly, who has been nothing but encouraging and engaging from day one. I have thoroughly enjoyed every moment of working alongside him and learning from his guidance and wisdom. My thanks go to my academic assessor Professor Paul Milner whom I have known for several years, and during my time at the University of Leeds he has offered me invaluable advice and inspiration. Additionally I would like to thank my academic project advisor Dr. Michael Harrison for his friendship, help and advice. I would like to thank Dr. Rosalind Mann and Dr. Elsayed Nasr for welcoming me into the lab as a new PhD student and sharing their experimental techniques with me, these techniques have helped me no end in my time as a research student.
    [Show full text]
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • Peking University-Juntendo University Joint Symposium on Cancer Research and Treatment ADAM28 (A Disintegrin and Metalloproteinase 28) in Cancer Cell Proliferation and Progression
    Whatʼs New from Juntendo University, Tokyo Juntendo Medical Journal 2017. 63(5), 322-325 Peking University - Juntendo University Joint Symposium on Cancer Research and Treatment ADAM28 (a Disintegrin and Metalloproteinase 28) in Cancer Cell Proliferation and Progression YASUNORI OKADA＊ ＊Department of Pathophysiology for Locomotive and Neoplastic Diseases, Juntendo University Graduate School of Medicine, Tokyo, Japan A disintegrinandmetalloproteinase 28 (ADAM28) is overexpressedpredominantlyby carcinoma cells in more than 70% of the non-small cell lung carcinomas, showing positive correlations with carcinoma cell proliferation and metastasis. ADAM28 cleaves insulin-like growth factor binding protein-3 (IGFBP-3) in the IGF-I/IGFBP-3 complex, leading to stimulation of cell proliferation by intact IGF-I released from the complex. ADAM28 also degrades von Willebrand factor (VWF), which induces apoptosis in human carcinoma cell lines with negligible ADAM28 expression, andthe VWF digestionby ADAM28-expressing carcinoma cells facilitates them to escape from VWF-induced apoptosis, resulting in promotion of metastasis. We have developed human antibodies against ADAM28 andshown that one of them significantly inhibits tumor growth andmetastasis using lung adenocarcinoma cells. Our data suggest that ADAM28 may be a new molecular target for therapy of the patients with ADAM28-expressing non-small cell lung carcinoma. Key words: a disintegrin and metalloproteinase 28 (ADAM28), cell proliferation, invasion, metastasis, human antibody inhibitor Introduction human cancers 2). However, development of the synthetic inhibitors of MMPs andtheir application Cancer cell proliferation andprogression are for treatment of the cancer patients failed 3). modulated by proteolytic cleavage of tissue micro- On the other hand, members of the ADAM (a environmental factors such as extracellular matrix disintegrin and metalloproteinase) gene family, (ECM), growth factors andcytokines, receptors another family belonging to the metzincin gene andcell adhesionmolecules.
    [Show full text]
  • Receptor Internalization Assays
    REF: P30214 RECEPTOR INTERNALIZATION ASSAYS - PITUITARY ADENYLATE CYCLASE-ACTIVATING POLYPEPTIDE TYPE I RECEPTOR - Product name: ADCYAP1R1-tGFP (PAC1-tGFP) / U2OS cell line -7 Ec50 PACAP-38: 1.06 x 10 M Z´: 0.73+/- 0.02 INNOVATIVE TECHNOLOGIES IN BIOLOGICAL SYSTEMS, S.L. Parque Tecnológico Bizkaia, Edifício 502, 1ª Planta | 48160 | Derio | Bizkaia Tel.: +34 944005355 | Fax: +34 946579925 VAT No. [email protected] | www.innoprot.com ESB95481909 Product Name: ADCYAP1R1-tGFP_U2OS Reference: P30214 Rep. Official Full Name: Pituitary adenylate cyclase- activating polypeptide type I receptor DNA Accession Number: Gene Bank AY366498 Host Cell: U2OS References: P30214: 2 vials of 3 x 106 proliferative cells P30214-DA: 1 vial of 2 x 106 division-arrested cells Storage: Liquid Nitrogen Assay Briefly description About ADCYAP1R1 Each vial of ADCYAP1R1 Internalization Assay Pituitary adenylate cyclase-activating Cell Line contains U2OS cells stably expressing polypeptide type I receptor, also known as human Pituitary adenylate cyclase-activating PAC1 is a protein that in humans is encoded by polypeptide type I receptor tagged in the N- the ADCYAP1R1 gene. ADCYAP1R1 is a terminus with tGFP protein. membrane-associated protein and shares significant homology with members of the Innoprot’s ADCYAP1R1-tGFP Internalization glucagon/secretin receptor family. This receptor Assay Cell Line has been designed to assay binds pituitary adenylate cyclase activating potential agonists/ antagonists against peptide (PACAP) mediating several biological ADCYAP1R1, modulating its activation and the activities and it is positively coupled to following redistribution process inside the cells. adenylate cyclase. This cell line will allow the image analysis of the stimuli induced by the compounds.
    [Show full text]
  • An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Netwo
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2014 An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis Sriram Devanathan Washington University School of Medicine in St. Louis Timothy Whitehead Washington University School of Medicine in St. Louis George G. Schweitzer Washington University School of Medicine in St. Louis Nicole Fettig Washington University School of Medicine in St. Louis Attila Kovacs Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Devanathan, Sriram; Whitehead, Timothy; Schweitzer, George G.; Fettig, Nicole; Kovacs, Attila; Korach, Kenneth S.; Finck, Brian N.; and Shoghi, Kooresh I., ,"An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis." PLoS One.9,7. e101900. (2014). https://digitalcommons.wustl.edu/open_access_pubs/3326 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Sriram Devanathan, Timothy Whitehead, George G. Schweitzer, Nicole Fettig, Attila Kovacs, Kenneth S. Korach, Brian N. Finck, and Kooresh I. Shoghi This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/3326 An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Network Analysis Sriram Devanathan1, Timothy Whitehead1, George G. Schweitzer2, Nicole Fettig1, Attila Kovacs3, Kenneth S.
    [Show full text]
  • The Role and Mechanisms of Action of Micrornas in Cancer Drug Resistance Wengong Si1,2,3, Jiaying Shen4, Huilin Zheng1,5 and Weimin Fan1,6*
    Si et al. Clinical Epigenetics (2019) 11:25 https://doi.org/10.1186/s13148-018-0587-8 REVIEW Open Access The role and mechanisms of action of microRNAs in cancer drug resistance Wengong Si1,2,3, Jiaying Shen4, Huilin Zheng1,5 and Weimin Fan1,6* Abstract MicroRNAs (miRNAs) are small non-coding RNAs with a length of about 19–25 nt, which can regulate various target genes and are thus involved in the regulation of a variety of biological and pathological processes, including the formation and development of cancer. Drug resistance in cancer chemotherapy is one of the main obstacles to curing this malignant disease. Statistical data indicate that over 90% of the mortality of patients with cancer is related to drug resistance. Drug resistance of cancer chemotherapy can be caused by many mechanisms, such as decreased antitumor drug uptake, modified drug targets, altered cell cycle checkpoints, or increased DNA damage repair, among others. In recent years, many studies have shown that miRNAs are involved in the drug resistance of tumor cells by targeting drug-resistance-related genes or influencing genes related to cell proliferation, cell cycle, and apoptosis. A single miRNA often targets a number of genes, and its regulatory effect is tissue-specific. In this review, we emphasize the miRNAs that are involved in the regulation of drug resistance among different cancers and probe the mechanisms of the deregulated expression of miRNAs. The molecular targets of miRNAs and their underlying signaling pathways are also explored comprehensively. A holistic understanding of the functions of miRNAs in drug resistance will help us develop better strategies to regulate them efficiently and will finally pave the way toward better translation of miRNAs into clinics, developing them into a promising approach in cancer therapy.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • ADAM10 Site-Dependent Biology: Keeping Control of a Pervasive Protease
    International Journal of Molecular Sciences Review ADAM10 Site-Dependent Biology: Keeping Control of a Pervasive Protease Francesca Tosetti 1,* , Massimo Alessio 2, Alessandro Poggi 1,† and Maria Raffaella Zocchi 3,† 1 Molecular Oncology and Angiogenesis Unit, IRCCS Ospedale Policlinico S. Martino Largo R. Benzi 10, 16132 Genoa, Italy; [email protected] 2 Proteome Biochemistry, IRCCS San Raffaele Scientific Institute, 20132 Milan, Italy; [email protected] 3 Division of Immunology, Transplants and Infectious Diseases, IRCCS San Raffaele Scientific Institute, 20132 Milan, Italy; [email protected] * Correspondence: [email protected] † These authors contributed equally to this work as last author. Abstract: Enzymes, once considered static molecular machines acting in defined spatial patterns and sites of action, move to different intra- and extracellular locations, changing their function. This topological regulation revealed a close cross-talk between proteases and signaling events involving post-translational modifications, membrane tyrosine kinase receptors and G-protein coupled recep- tors, motor proteins shuttling cargos in intracellular vesicles, and small-molecule messengers. Here, we highlight recent advances in our knowledge of regulation and function of A Disintegrin And Metalloproteinase (ADAM) endopeptidases at specific subcellular sites, or in multimolecular com- plexes, with a special focus on ADAM10, and tumor necrosis factor-α convertase (TACE/ADAM17), since these two enzymes belong to the same family, share selected substrates and bioactivity. We will discuss some examples of ADAM10 activity modulated by changing partners and subcellular compartmentalization, with the underlying hypothesis that restraining protease activity by spatial Citation: Tosetti, F.; Alessio, M.; segregation is a complex and powerful regulatory tool.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • An Investigation of ADAM-Like Decysin 1 in Macrophage-Mediated Inflammation and Crohn’S Disease
    An Investigation of ADAM-like Decysin 1 in Macrophage-mediated Inflammation and Crohn’s Disease By Nuala Roisin O’Shea A thesis submitted to UCL for the degree of Doctor of Philosophy Division of Medicine Declaration I, Nuala Roisin O’Shea, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Crohn’s disease (CD) is now recognised as a defective host response to bacteria in genetically susceptible individuals. The role of innate immunity and impaired bacterial clearance are widely accepted. In this thesis the role of ADAM-like, Decysin-1 (ADAMDEC1) in macrophage-mediated inflammation and gut mucosal immunity is explored. Using transcriptomic analysis of monocyte derived macrophages (MDM) ADAMDEC1 was identified as grossly under expressed in a subset of patients with CD. ADAMDEC1 was found to be highly selective to the intestine, peripheral blood monocyte-derived and lamina propria macrophages. It was shown to be an inflammatory response gene, upregulated in response to bacterial antigens and inflammation. ADAMDEC1 was expressed in prenatal and germ free mice, demonstrating exposure to a bacterial antigen is not a prerequisite for expression. Adamdec1 knock out mice were used to investigate the role of ADAMDEC1 in vivo. Adamdec1-/- mice displayed an increased susceptibility to dextran sodium sulphate (DSS), Citrobacter rodentium and Salmonella typhimurium induced colitis. In Adamdec1-/- mice, bacterial translocation and systemic infection were increased in bacterial models of colitis. These results suggest that individuals with grossly attenuated expression of ADAMDEC1 may be at an increased risk of developing intestinal inflammation as a consequence of an impaired ability to handle enteric bacterial pathogens.
    [Show full text]
  • NATURAL KILLER CELLS, HYPOXIA, and EPIGENETIC REGULATION of HEMOCHORIAL PLACENTATION by Damayanti Chakraborty Submitted to the G
    NATURAL KILLER CELLS, HYPOXIA, AND EPIGENETIC REGULATION OF HEMOCHORIAL PLACENTATION BY Damayanti Chakraborty Submitted to the graduate degree program in Pathology and Laboratory Medicine and the Graduate Faculty of the University of Kansas in partial fulfillment ofthe requirements for the degree of Doctor of Philosophy. ________________________________ Chair: Michael J. Soares, Ph.D. ________________________________ Jay Vivian, Ph.D. ________________________________ Patrick Fields, Ph.D. ________________________________ Soumen Paul, Ph.D. ________________________________ Michael Wolfe, Ph.D. ________________________________ Adam J. Krieg, Ph.D. Date Defended: 04/01/2013 The Dissertation Committee for Damayanti Chakraborty certifies that this is the approved version of the following dissertation: NATURAL KILLER CELLS, HYPOXIA, AND EPIGENETIC REGULATION OF HEMOCHORIAL PLACENTATION ________________________________ Chair: Michael J. Soares, Ph.D. Date approved: 04/01/2013 ii ABSTRACT During the establishment of pregnancy, uterine stromal cells differentiate into decidual cells and recruit natural killer (NK) cells. These NK cells are characterized by low cytotoxicity and distinct cytokine production. In rodent as well as in human pregnancy, the uterine NK cells peak in number around mid-gestation after which they decline. NK cells associate with uterine spiral arteries and are implicated in pregnancy associated vascular remodeling processes and potentially in modulating trophoblast invasion. Failure of trophoblast invasion and vascular remodeling has been shown to be associated with pathological conditions like preeclampsia syndrome, hypertension in mother and/or fetal growth restriction. We hypothesize that NK cells fundamentally contribute to the organization of the placentation site. In order to study the in vivo role of NK cells during pregnancy, gestation stage- specific NK cell depletion was performed in rats using anti asialo GM1 antibodies.
    [Show full text]