Role and Regulation of the Metalloproteinase ADAM8 in Liver Inflammation and Hepatocellular Carcinoma

Von der Fakultät für Mathematik, Informatik und Naturwissenschaften der RWTH Aachen University zur Erlangung des akademischen Grades einer Doktorin der Naturwissenschaften genehmigte Dissertation

vorgelegt von

Tanzeela Awan M. Phil Pharmacology aus Layyah, Pakistan

Berichter:

Herr Universitätsprofessor Dr. rer. nat. Andreas Ludwig Frau Universitätsprofessorin Dr. phil. nat. Gabriele Pradel Herr Universitätsprofessor Dr. rer. nat. Martin Zenke

Tag der mündlichen Prüfung: 11.01.2021

Diese Dissertation ist auf den Internetseiten der Universitätsbibliothek online verfügbar.

Table of Contents Table of Contents 1 Introduction ...... 1

1.1 The Liver ...... 1 1.1.1 Cells of the liver ...... 1 1.1.2 Liver inflammation ...... 3 1.1.3 Liver carcinoma ...... 6 1.1.4 Integrin and focal adhesion kinase signalling ...... 7 1.2 Metalloproteinases ...... 9 1.2.1 ADAM proteases: structure and functions of different domains ...... 10 1.3 ADAM8 ...... 12 1.3.1 Expression and activation of ADAM8 ...... 12 1.3.2 Pro-inflammatory role of ADAM8 ...... 13 1.3.3 Anti-inflammatory role of ADAM8 ...... 15 1.3.4 ADAM8 in cancers ...... 16 2 Aim of the study ...... 20

2.1 Role of ADAM8 in liver inflammation ...... 20 2.2 Role of ADAM8 in malignancy of HCC ...... 21 3 Materials and Methods ...... 22

3.1 Materials ...... 22 3.1.1. Chemicals, enzymes and recombinant proteins ...... 22 3.1.2 Consumables ...... 23 3.1.3 Kits ...... 24 3.1.4 Microorganisms ...... 24 3.1.5 Plasmids ...... 24 3.1.6 Antibodies ...... 25 3.1.7 Buffers and solutions ...... 26 3.1.8 Oligonucleotides ...... 28 3.1.9 shRNA sequence ...... 29 3.1.10 Cell lines ...... 30 3.2 Methods ...... 31

Table of Contents 3.2.1 Cell culture methods ...... 31 3.2.2 Protein biochemistry methods ...... 34 3.2.3 Molecular biology methods ...... 37 3.2.4 Functional Assays ...... 42 3.2.5 Animal experiments ...... 43 3.3 Statistical analysis ...... 45 4 Results ...... 46

4.1 ADAM8 mediates non-alcoholic fatty liver disease ...... 46 4.1.1 ADAM8 in NAFLD tissues ...... 46 4.1.2 Expression of ADAM8 in hepatic cell lines ...... 48 4.1.3 Regulation of ADAM8 expression in liver cell lines under NAFLD conditions ...... 50 4.1.4 Influence of ADAM8 knockdown on liver inflammation by regulating expression and release of cytokines in liver cells ...... 55 4.2 Role of ADAM8 in LPS-induced liver injury ...... 72 4.2.1 Regulation of ADAM8 in different liver injury models ...... 72 4.2.2 ADAM8 and cytokines are regulated by LPS treatment in liver cells in- vitro ...... 73 4.2.3 ADAM8 knockout does not protect against LPS induced liver inflammation in-vivo ...... 79 4.3 Role of ADAM8 in HCC metastasis ...... 86 4.3.1 ADAM8 is overexpressed in HCC tissues and hepatoma cell lines ... 87 4.3.2 ADAM8 expression is positively associated with PCNA expression and hepatoma cell proliferation and clonogenicity ...... 88 4.3.3 ADAM8 expression negatively correlates with caspase 3/7 activity in hepatoma cell lines ...... 94 4.3.4 ADAM8 expression positively links with cellular migration and invasion of hepatoma cells ...... 96 4.3.5 ADAM8 controls cell proliferation, migration, and angiogenic properties of endothelial cells ...... 100 4.3.6 ADAM8 expression is linked to increased β1 integrin expression and focal adhesion kinase activation ...... 103 4.3.7 ADAM8 is associated with activation of MAPK, Src kinase and Rho A 106 ii

Table of Contents 5 Discussion ...... 110

5.1 ADAM8 is upregulated during experimental in vitro and in vivo models of NAFLD/NASH and contributes to the release of pro-inflammatory cytokines and fibrotic processes by liver cells in vitro ...... 111 5.2 The up-regulation of ADAM8 by LPS is linked to increased inflammatory mediator production by liver cells but is not critical for LPS-induced liver inflammation in-vivo...... 117 5.3 ADAM8 critically controls the proliferation and migration in hepatoma cells by regulating the malignant signalling events ...... 122 5.3.1 ADAM8 regulates cell proliferation, cell migration, cell invasion and apoptosis with HCC metastasis and angiogenesis ...... 123 5.3.2 ADAM8 is associated with β1 integrin, FAK, Src kinase and Rho A activation in hepatoma cells ...... 126 5.4 Conclusion ...... 129 5.5 Outlook ...... 131 6 Summary ...... 133

7 Literature ...... 138

8 Appendix ...... 158

8.1 List of figures ...... 158 8.2 List of tables ...... 161 8.3 Abbreviations ...... 162 8.4 Vector maps ...... 166 8.5 Mice genotyping ...... 170 9 Publications ...... 171

10 Curriculum Vitae ...... 172

11 Declaration ...... 173

12 Acknowledgment ...... 174

iii

Introduction

1 Introduction

1.1 The Liver

The liver is the body’s largest internal organ, weighing approximately 1500 g and accounting about 2.5 % of the adult body’s weight. It is located at the right upper quadrant of the abdomen and protected by the thoracic cage and diaphragm. The liver is supplied with blood by two major blood vessels: the hepatic artery from the heart and the hepatic portal vein from the gastrointestinal tract. The hepatic artery delivers 25% of the liver’s total blood supply while the hepatic portal vein supplies the remaining 75% of blood to the liver which contains nutrients drained from the gastrointestinal tract. The hepatic vein carries out all the blood back to the heart.

The anatomical location and dual supply of blood to the liver make it suitable to execute more than 500 functions in the body. These functions include detoxification of metabolites and toxins, synthesis of proteins, digestion of fats, storage of certain vitamins, metabolism of carbohydrates and proteins, decomposition of red blood cells and production and storage of hormones. It is essential in maintaining the body’s normal homeostasis, thus its failure may lead to the death of the organism (Cauli et al., 2008).

1.1.1 Cells of the liver

The liver is composed of two classes of cell types: The parenchymal cells that include hepatocytes and cholangiocytes, and the non-parenchymal cells that include Kupffer cells (KCs), hepatic stellate cells (HSCs), hepatic dendritic cells (DCs) and hepatic sinusoidal endothelial cells (SECs) (Figure 1). These liver cells are arranged in small structures known as lobules that are the basic functional units of the liver. The lobule primarily consists of the plates of hepatocytes and sinusoids. The hepatocytes form single cell thick plates to expose each cell to the blood for the extraction of nutrients and toxins. The hepatocytes make up 60 % of total liver cells and 80 % of total liver mass. Most of the liver’s synthetic and metabolic functions are carried out by hepatocytes (Mitra & Metcalf, 2012). Therefore, hepatocytes are usually large and rich in organelles such as endoplasmic reticulum, Golgi apparatuses, mitochondria, lysosomes, and peroxisomes (Ozougwu, 2017).

Introduction The tissue space between hepatocytes and sinusoids is known as the space of Disse. The liver sinusoidal endothelial cells (SECs) line the walls of the hepatic sinusoid. These cells are fenestrated and perform the function of filtration (Poisson et al., 2016). The SECs have the endocytic property and can engulf smaller particles like viruses but do not possess the phagocytic function (Breiner et al., 2001). These cells secrete various cytokines in response to the antigens to modulate the immune reaction (Kmiec, 2001; Shetty et al., 2018) and also regulate the hepatic immune tolerance, to avoid T-cell- mediated immune responses against hepatocytes (Limmer & Knolle, 2001).

Figure 1: Liver lobule structure and types of cells

A: The functional unit of the liver is lobule, composed of a central vein (CV), portal vein, biliary duct and hepatic artery. Plates of hepatocytes are separated by sinusoids. B: Hepatocytes secrete bile acid into bile canaliculi that lead to the bile duct. The Kupffer cells are present in the sinusoid, while hepatic stellate cells are located in the space of Disse. The figure is taken from Zaefarian et al (Zaefarian et al., 2019).

The Kupffer cells (KCs) are the liver’s resident macrophages present within the sinusoid (Knook et al., 1977) and are the major phagocytic cells (Smedsrad et al., 1985). These cells are constantly being activated upon signals from the gut-derived particles, and execute their function in the maintenance of inflammation and wound healing by releasing a vast range of inflammatory mediators (Ozougwu, 2017). Therefore, the KCs have an important role in the resolution of inflammation and fibrosis (Heymann & Tacke, 2016).

Hepatic stellate cells (HSCs) are the major fat-storing cells that mainly store vitamin A. They are present in the space of Disse and may protrude into the sinusoids (Knook & Seffelaar, 1982) (Figure 1). Generally, they are non-proliferative quiescent

Introduction cells that regulate the turnover of extracellular matrix (ECM) and sinusoid contractility. However, the inflammatory conditions, such as the release of transforming growth factor-beta (TGFβ), activate the HSCs and may convert them to myofibroblast-like cells which then start proliferation and produce large amounts of alpha-smooth muscle actin (αSMA) and ECM components like collagen I, fibronectin and proteoglycans (Ozougwu, 2017). These events lead to inflammatory and fibrotic responses (Tsuchida & Friedman, 2017).

1.1.2 Liver inflammation

The liver is the main site for the metabolism of lipids, proteins and carbohydrates and is constantly exposed to the gut-derived metabolites such as lipopolysaccharides (LPS) and toxins, able to trigger an immune response in the liver resulting in acute inflammation response (Heymann & Tacke, 2016). Inflammation is actually the organism’s response to invading bacteria, viruses, toxins and other pathogens. Other factors that may cause liver inflammation are hepatic viral infections (hepatitis A, B, C, D or E viral infections), metabolic disorders, obesity, chronic alcohol consumption and autoimmune disorders. However, the liver has also a tolerance potential to self- and foreign antigens and mediate anti-inflammatory effects by its specialized resident cells (Tiegs & Lohse, 2010). The disadvantage of these tolerance mechanisms is that they also allow viruses and parasites to chronically persist in the liver (Knolle & Thimme, 2014; Koyama & Brenner, 2017).

LPS is the main component present in the wall of gram-negative bacteria. It binds to LPS binding proteins (LBP) and the cluster of differentiation 14 (CD14) and initiates an inflammatory response by triggering the production of inflammatory cytokines via activation of Toll-like receptor 4 (TLR4) signalling pathway (Schumann, 2011). LPS is generally sensed by TLR4 which is expressed on multiple cell types in the liver and activation of TLR4 signalling may lead to the systemic inflammatory syndrome (Jirillo et al., 2002). Although initiation of an acute inflammatory response is beneficial for inducing clearance of bacteria, but persistent and abundant amounts of LPS in circulation may lead to the severe inflammation causing organ damage (Fang et al., 2018). The liver is likely among the first organs responding to LPS by releasing pro- inflammatory cytokines. LPS administration in mice triggers mononuclear cells infiltrating into the liver to produce hepatotoxic agents which results in severe liver

Introduction inflammation (Hamesch et al., 2015). The combined effect of LPS with other liver pathologies also worsens the outcome of liver damage leading to chronic liver inflammation. Involvement of LPS has been described in obesity (Turnbaugh et al., 2006, 2009), metabolic syndrome (Murphy et al., 2013), diabetes (Qin et al., 2012; Vrieze et al., 2012), cardiovascular diseases and non-alcoholic fatty liver disease (NAFLD) (Schnabl & Brenner, 2014).

Fatty liver is the most common form of chronic liver disease. It starts with the accumulation of fatty acids in the hepatocytes known as hepatic steatosis, which is one of the major consequences of the metabolic stress. Generally, NAFLD is a spectrum of chronic liver disease characterized by excessive cytoplasmic retention of triglyceride. This condition ranges from simple liver steatosis (the non-progressive form of liver disease; NAFLD) to steatohepatitis (the progressive form of liver disease; NASH) which further can be developed into liver fibrosis and cirrhosis and/or hepatocellular carcinoma (HCC) (Marchesini et al., 2016).

NAFLD causes ballooning of hepatocytes that may lead to apoptosis (Feldstein et al., 2003). Liver expression of death receptors has been found to increase in patients with NAFLD. These damaged hepatocytes release alarmins such as damage-associated molecular patterns (DAMPs), the high-mobility group protein B1 (HMGB1) and interleukin 33 (IL-33) (Marvie et al., 2010; Sass et al., 2005). These alarmins activate the immune cells in the liver (Feldstein et al., 2003). Furthermore, activation of the nuclear factor kappa B (NF-κB) pathway in injured hepatocytes induces the release of several pro-inflammatory cytokines and chemokines such as tumour necrosis factor- alpha (TNFα), IL-6, and CC-chemokine ligand 2 (CCL2) (Ramachandran & Jaeschke, 2016; Zhou et al., 2014). Crosstalk between the hepatocytes and the immune cells is also mediated by inflammasomes such as nucleotide-binding oligomerization domain with leucine-rich repeats (NOD-LRR) and pyrin domain-containing protein (NLRP3), which intervenes with cleavage and activation of pro-IL-1β and pro-IL-18. Hepatocytes can transfer their danger signals by activating inflammasomes in immune cells as described in murine models of alcoholic steatohepatitis (ASH) and non-alcoholic steatohepatitis (NASH) (Ganz et al., 2015; Szabo & Petrasek, 2015).

Therefore, both, endogenous mediators generated from injured liver cells and exogenous mediators generated from gut microbiota activate inflammatory pathways

Introduction in the liver (Tripathi et al., 2018). Apart from the tolerance capacity of the liver; the exaggerated inflammatory reaction may give rise to the noxious effect in the liver, thus causing organ damage (Kheder et al., 2016).

Figure 2: Inflammatory pathways in liver

Liver resident macrophages (Kupffer cells) are the first immune cells that respond towards the invading pathogens or liver injury. Upon activation, the Kupffer cells release pro-inflammatory cytokines TNFα, IL-6, certain chemokines, and TGFβ that initiate the acute phase response and inflammation. These cytokines activate the hepatic sinusoidal endothelial cells (not shown here) and upregulate the expression of endothelial adhesion molecules which help to recruit the immune cells (like neutrophils and monocytes) to the liver. Neutrophils are the initial cells reaching the injured site and change their phenotype, become activated, and release cytotoxic antimicrobial molecules such as reactive oxygen species (ROS). On the other hand, the injured hepatocytes release alarmins (DAMPs) which results in the activation of the Kupffer cells to release cytokines and TGFβ. TGFβ activates the hepatic stellate cells releasing the ECM components resulting in the fibrinogenesis while other cytokines may either induce apoptosis in the hepatocytes or may activate the STAT3 pathway which results in the survival and abnormal proliferation of the hepatocytes leading to the development of HCC.

Severe liver injury causes the hepatocyte senescence which promote immune cell reactions, mainly activation and proliferation of macrophages. These activated macrophages can phagocytise the senescent hepatocytes which are prone to undergo carcinogenicity, while the moderate chronic liver injury may result in hepatocyte carcinogenicity without letting hepatocyte to enter in senescence phase. Therefore, the

Introduction extent of liver injury may determine the fate of hepatocytes (Wang et al., 2018) (Figure 2).

1.1.3 Liver carcinoma

Liver cancer is ranked fifth among the most frequently occurring cancers worldwide and is second leading cause of cancer-related deaths (Bray et al., 2018; Yang et al., 2019). Hepatocellular carcinoma (HCC) is the major histological type of primary liver cancer accounting for 70-85 % of all primary liver cancers (Choo et al., 2016). Other types of primary liver cancers include cholangiocarcinoma, liver angiosarcoma, and hepatoblastoma. HCC occurs more often in males than in females and is more common both in developing and underdeveloped countries; especially in central Africa and some parts of Asia (Rawla et al., 2018). The most important risk factors for the development of HCC include chronic liver disease and cirrhosis which are the consequence of viral hepatitis, excessive alcohol intake, and NASH.

Invasion of tumour cells to the distance organ is known as metastasis. Intrahepatic metastasis is the general feature of liver carcinoma and is more common in HCC compared to the extrahepatic metastasis which is relatively low in incidence but has a worse prognostic outcome (Farges & Dokmak, 2010). The most common sites for extrahepatic metastasis during HCC are lungs, lymph nodes, bones and the adrenal glands (Katyal et al., 2000). HCC is considered highly lethal with poor prognosis because it is commonly diagnosed at late stages, although there is a considerable development in the surgical techniques and medical care (Thorgeirsson et al., 2016).

HCC predominantly arises in the cirrhotic liver where repeated inflammation occurs along with fibrogenesis (Block et al., 2003). Inflammation and fibrogenesis predispose the liver to dysplasia and subsequently malignant transformation (Block et al., 2003). An inflammatory microenvironment plays a prominent part in starting the advancement towards HCC (Block et al., 2003; Lu et al., 2006). Certain genetic and epigenetic abnormalities also take part in the pathogenesis of HCC by altering many signalling pathways that drive the disease toward the change in the biological and clinical behaviour (Bertino et al., 2014).

Introduction 1.1.4 Integrin and focal adhesion kinase signalling

Growth factors and adhesion molecules help tumour cells to invade and proliferate at some distant organ; a process known as metastasis. The adhesion molecules facilitate tumour cell interaction with integrins. Integrins are a family of heterodimeric receptors that are responsible for cell-cell and cell-ECM interaction during the processes of adhesion, migration and proliferation (Desgrosellier & Cheresh, 2010; Humphries et al., 2019).

Integrins are usually present in an inactive state and become activated either by outside-in signalling or inside-out signalling. The crosstalk between integrin such as β1 integrin with ECM components is an example of outside-in signalling which causes the conformational changes, and activates focal adhesion kinase (FAK) (Shi & Boettiger, 2003). FAK is a non-receptor protein which upon activation starts transmitting downstream signals to mitogen-activated protein kinase (MAPK)/extracellular-signal kinase regulated kinase (ERK), Src kinase and Rho-family of small guanosine triphosphatase (Rho GTPase) signalling influencing actin contraction and polarization (Playford & Schaller, 2004). These signals are critical for the regulation of cell survival and migration of tumours (Pan et al., 2004; Wu et al., 2012). FAK permits the cells to proliferate in an adhesion-independent manner. This makes FAK important in the cancer study because in cancers the cell proliferates and migrates to the whole body regardless of the adhesion (Gabarra-Niecko et al., 2003).

FAK activates not only the downstream signalling but also its substrate integrin that mediates the attachment of the cell to the ECM; an example of inside-out signalling. FAK is also auto-phosphorylated at tyrosine 397 which creates a binding site for the Src homology 2 (SH2) domain of Src and is critical for cell proliferation, invasion and angiogenesis (Heim et al., 2018). The Src kinase further activates other phosphorylation sites of FAK (Tyr 576/577 and Tyr 925) leading to potential activation of FAK to perform the cellular processes such as adhesion, migration, proliferation and survival (Santos et al., 2012; Sulzmaier et al., 2014) (Figure 3). The binding of Src to the FAK results in inhibition of cellular tumour antigen p53, permitting the cells to detour the apoptosis pathway (Golubovskaya & Cance, 2010).

Introduction

Figure 3: Integrin and FAK mediated signalling pathways in cancer

Inactive integrin heterodimer exists in a bend conformation which inhibits the binding of ligands to the recognition site. Upon activation, the integrin heterodimer changes its conformation and allows the ligand binding leading to the activation of various cellular functions through activation of several downstream signalling pathways. Binding of integrin to the ECM results in the activation of FAK and subsequently Src kinase. Other activating factors of FAK include cytokine receptor (CR), growth factor receptors (GFR), and G protein-coupled receptors (GPCR) that relay extracellular signals to FAK. Activation of FAK leads to survival signalling, growth, angiogenesis, migration, and invasion. GRB2, growth-factor-receptor-bound-2; PI3K, phosphatidylinositol 3-kinase; RAP1, Ras-related protein 1; ROCK, Rho-associated protein kinase. Solid arrows indicate activation of pathways, dotted arrows indicate the ultimate cellular response and the red lines indicate the negative regulation.

FAK is overexpressed and deregulated in various cancers. The involvement of FAK in the main events of carcinogenesis makes it a therapeutic target for cancer treatment. Src binding to the FAK also leads to the movement of cells by actin polymerization which involves activation of the Ras family (Rac, Rho) (Parsons, 2003).

In HCC, the overexpression of FAK was found to be involved in portal venous invasion and intrahepatic metastasis (Chen et al., 2010; Gnani et al., 2017; Itoh et al., 2004). TGFβ signalling and activation of hepatic stellate cells (HSCs) also involve the activation of FAK, hence taking part in fibrosis formation (Chen et al., 2020). A recent study has revealed that various key signalling pathways such as NF-κB signalling, Notch signalling, Hippo signalling and MAPK support the cancer stem cell-like phenotype in the liver and play a critical role in the metastasis and recurrence of the liver cancer (Tsui et al., 2020). 8

Introduction Inflammatory and fibrotic processes as well as cancer development and metastasis critically depend on the interaction of various mediator molecules and their receptors. This includes the action of cytokines, chemokines, growth factors, adhesion molecules and receptors which can be either released or expressed on the surface of liver cells. These molecular activities and interactions are tightly regulated by various mechanisms. One regulatory mechanism is the involvement of members of a disintegrin and metalloproteinase (ADAM) family. These proteinases are not only critically implicated in cancer cell migration and invasion (Conrad et al., 2019; Mygind et al., 2018; Romagnoli et al., 2014; Schlomann et al., 2015) but also known to process and activate the mediators involved in the inflammatory processes. Hence ADAMs have been studied to understand the mechanism of action of disease as well as to act as the therapeutic target to control the inflammatory and carcinogenic diseases.

1.2 Metalloproteinases

Metalloproteinases are divided into approximately 30 families based on their structure (Rawlings & Barrett, 1995). Among them is a group of metalloproteinases known as zincins, members of which share a relatively common sequence HEXXH in the catalytic domain. The zincins are further divided into three superfamilies; the gluzincins, the aspzincins and the metzincins (Stocker et al., 1995). The metzincins are mostly multidomain proteins that possess a globular catalytic domain with a zinc- binding consensus motif (Bode et al., 1993). There are several families in the metzincins including astacins, pappalysins, serralysins, matrix metalloproteinases (MMPs) and adamalysins (Murphy, 2008).

The family of the adamalysins is further divided into a disintegrin and metalloproteinase (ADAM), ADAM with thrombospondin motifs (ADAMTS) and the snake venom metalloproteinases (SVMPs) (Edwards et al., 2009). The proteins of the ADAM family are membrane-bound while SVMPs are soluble proteins. ADAM family members are unique among other metalloproteinases because they possess an active catalytic domain (metalloproteinase domain) and an active adhesion domain (the disintegrin domain). The members of the ADAMTS family lack the transmembrane domain of ADAMs and function as secreted proteins (Van Goor, 2008) (Figure 4). The thrombospondin domain helps them to bind with ECM proteins (Kuno et al., 1997).

Introduction

Figure 4: The structure of ADAMs and other metalloproteinases.

The general structure of the ADAM, SVMP, ADAMTS and MMP are shown here. SVMP lacks the transmembrane domain while ADAMTS has an additional TS-like structure between disintegrin and cysteine-rich domains. The MMP in this figure belongs to the gelatinase class, other MMPs subclasses lack the fibronectin-like and hemopexin-like motifs. The figure is taken from Seals and Courtneidge (Seals & Courtneidge, 2003).

There are more than 40 known members of ADAM family in various species (Duffy et al., 2009); out of them 23 members are described in humans (Giebeler & Zigrino, 2016; Seals & Courtneidge, 2003). However, only 17 of the 29 known mammalian ADAMs function as active proteinase: most probably because many members have lost their critical catalytic residues during evolution (White, 2003).

1.2.1 ADAM proteases: structure and functions of different domains

ADAMs have been implicated in the physiology and pathophysiology of organisms. ADAM proteases predominantly work as shedding enzymes with a vast variety of substrates. ADAM proteases are generally expressed as type I transmembrane proteins on the cell surface, consisting of a multi-domain structure including an N-terminal pro- domain, a catalytic domain, a disintegrin domain, a cysteine-rich domain, an epidermal growth factor-like (EGF) domain followed by a single-span transmembrane region and a cytoplasmic tail. Most ADAMs are synthesized as an inactive pro-enzyme in which the pro-domain is released during the process of maturation.

The pro-domain of ADAM proteinase facilitates the correct protein folding during biosynthesis by holding the zinc ion and the proteinase domain in a latent state (Van Goor, 2008). In some metalloproteinases such as ADAM2, 7, 11, 18, 22, 23, 29 and 32; the pro-domain is not removed and it remains bound with the metalloproteinase domain.

Introduction These ADAMs are not catalytically active and it is thought that these ADAMs may play a role in cell regulation or adhesion (Buckley et al., 2005; Wewer et al., 2006). The pro- domain is either released by pro-protein convertase “Furin” (e.g ADAM10 or 17) or by the process of autocatalysis (e.g ADAM8). After removal of the pro-domain the metalloproteinase domain mediates the catalytic activity of the protease

The disintegrin domain is most important for adhesive interactions with other molecules such as integrin (White, 2003). The disintegrin domain of ADAMs has a close relationship with SVMP which also interacts with the integrin receptors present on platelets resulting in inhibition of platelet aggregation and haemorrhage (Lu et al., 2005; Seals & Courtneidge, 2003). The classical integrin-binding motif of SVMP known as RGD (Arg-Lys-Asp) is missing in the disintegrin domain of all ADAM proteases except for ADAM15 (Nath et al., 1999). Most of the ADAM proteases bind to integrin through a conserved motif present in their disintegrin domain, except ADAM10 and 17 (Eto et al., 2002; Reiss et al., 2006).

A study on the crystal structure has demonstrated that the disintegrin and cysteine- rich domains form a C-shaped structure, suggesting that the disintegrin-loop is packed by the cysteine-rich domain and is inaccessible for the protein binding (Takeda et al., 2006). The cysteine-rich domain possesses the hypervariable region, which is thought to be responsible for the specificity of the protein interactions. The interaction of the disintegrin domain with other proteins such as integrin is independent of their enzymatic activity (Lu et al., 2006). The cysteine-rich domain has been described as important for substrate recognition which is mediated by its interaction with heparin sulfate proteoglycan (e.g syndecan) and with ECM components (e.g fibronectin) (Cousin et al., 2000; Flannery et al., 2002; Gaultier et al., 2002; Iba et al., 2000; Serrano et al., 2005; Smith et al., 2002).

The cytoplasmic tail of ADAMs differs in length and sequence. This domain is involved in the inside-out and outside-in regulation of enzymatic activity of ADAMs. Various ADAMs which are known to be involved in cell migration contains Src homology 3 (SH3)-domain which is the binding site for many signalling proteins (Duffy et al., 2009). The cytoplasmic tail also contains potential phosphorylation sites for serine, threonine, or tyrosine kinase (Seals & Courtneidge, 2003). These phosphorylation sites are important in maintaining not only the catalytic activity and

Introduction the intracellular trafficking of ADAMs but also act as an adaptor in the assembly of protein complexes (Soond et al., 2005).

1.3 ADAM8

ADAM8 was first described in macrophages with cloned forms known as MS2 or CD156a (Yoshida et al., 1990; Yoshiyama et al., 1997), and subsequently identified in other immune cells; granulocytes (Gomez-Gaviro et al., 2007), and B cells (Richens et al., 2007). It is expressed in almost all tissues of the body during the developmental stage as well as in adulthood. Under physiological conditions, ADAM8 is expressed at low levels in normal tissues, however, a few cell types such as osteoclasts (Choi et al., 2001), neuronal cells (Schlomann et al., 2000) and lung epithelial (King et al., 2004) cells express ADAM8 to a comparatively higher extent. The expression of ADAM8 is highly inducible under inflammatory conditions where it is involved in the manifestation of inflammatory disorders either through proteolytic function or by interacting with integrin via its disintegrin domain. ADAM8 is also considerably overexpressed in a vast variety of cancers. More recently, ADAM8 is considered as the marker for diagnosing some cancers (Conrad et al., 2019; Ishikawa et al., 2004; Miyauchi et al., 2018).

1.3.1 Expression and activation of ADAM8

A study by Le et al. (2018) demonstrated that ADAM8 plays an important role in the early development of the human placenta in a β1 integrin-dependent manner where it is localized to the trophoblasts and promotes trophoblast adhesion and migration through extracellular matrix (ECM) (Le et al., 2018). Although ADAM8 expression has been observed in the early and late embryonal stages (gonadal ridge, thymus, bone, and in developing blood and lymphatic vessels), a complete knockout of ADAM8 in mice has not revealed the development of any abnormality. Therefore, it is known to be non- essential for the normal development and homeostasis of an organism (Bartsch et al., 2010; Kelly et al., 2005).

Like other ADAMs, ADAM8 is also synthesized as an inactive pro-form that needs removal of the pro-domain for the activation (Hall et al., 2009; Schlomann et al., 2002). Removal of the pro-domain of ADAM8 takes place in an auto-catalytic manner in trans- Golgi networks (Figure 4), where the autocatalysis targets the pro-domain and

Introduction metalloproteinase domain of ADAM8 leaving the proteolytically active mature form and the remnant forms respectively (Hall et al., 2009; Schlomann et al., 2002). Beside membrane-bound ADAM8, the released metalloproteinase form which is known as soluble ADAM8 (sADAM8), also possesses proteolytic activity (Schlomann et al., 2002) (Figure 4). Post transnationally; ADAM8 is glycosylated at N-terminal which is important for the processing, stability, activity and localization of the proteinase (Srinivasan et al., 2014). Interestingly, ADAM8 is not inhibited by any of the tissue inhibitors metalloproteinases (TIMP) which are the endogenous proteins regulating the metalloproteinases (Amour et al., 2002; Schlomann et al., 2002).

Figure 5: Activation and processing of ADAM8

ADAM8 is multimerised in two forms at the cell surface for its cellular activity. The pro-domain of ADAM8 is removed auto-catalytically in the trans-Golgi network and mature ADAM8 is transported to the cell membrane where it is processed further i.e converted to the remnant form and soluble form of ADAM8. These two forms (active and remnant) stay on the cell membrane. The active form performs the catalytic activity i.e substrate cleavage and both forms can interact with integrins with disintegrin domain. Figure modified from Conrad et al (Conrad et al., 2019).

1.3.2 Pro-inflammatory role of ADAM8

Experimental evidence has shown that ADAM8 is involved in several inflammatory diseases where its expression is controlled by the production of cytokines (Koller et al., 2009; Zarbock & Rossaint, 2011). ADAM8 plays a critical role in the manifestation of

Introduction asthma as its expression has been shown to be strongly upregulated not only in asthma patients (Foley et al., 2007) but also in murine lungs in response to ovalbumin (OVA: an allergic stimulator) (King et al., 2004). ADAM8-deficiency in mice with OVA- induced asthma attenuates the capacity of immune cells to invade through the lung tissue, broncho-alveolar fluid or ECM; hence reducing the severity of asthma symptoms (Naus et al., 2010; Paulissen et al., 2011; Wildeboer et al., 2006). Moreover, in a murine model of acute lung inflammation, ADAM8 serves as a pro-inflammatory mediator by cleaving adhesion molecules which have a predominant effect on leucocyte migration (Dreymueller et al., 2017).

ADAM8 has also been described as an important modulator of neurological inflammatory disorders and neurodegeneration, although normally less expressed in cells of the central nervous system (CNS) (Mahoney et al., 2009; Schlomann et al., 2000). There are several CNS-related specific substrates of ADAM8 e.g amyloid precursor protein (APP) and a neuronal cell adhesion molecule known as a close homologue of L1 (CHL1) (Naus et al., 2004, 2006). ADAM8 manifests the neuronal inflammation also by other non-CNS specific substrates such as tumour necrosis factor alpha (TNFα) and endothelial cell adhesion molecules. ADAM8 deficient mice showed reduced inflammation and neurodegeneration (Schluesener, 1998).

ADAM8 up-regulation might play a regulatory role in maintaining a balance between osteoclasts and osteoblasts in bone-related pathological conditions (Choi et al., 2001). It contributes to the bone destruction (Ainola et al., 2009) and prosthetic osteolysis and aseptic loosening of total hip replacement by promoting the production of giant cells and osteoclasts (Mandelin et al., 2003). An integrin α9β1, present on osteoclasts, is found to be an essential interaction partner of ADAM8 in supporting the osteoclast formation (Rao et al., 2006). Furthermore, overexpression of ADAM8 in osteoclasts in transgenic mice contributes to the severe bone destruction. Therefore, it is likely to consider ADAM8 as a therapeutic target in bone degeneration under inflammatory conditions (Ishizuka et al., 2011).

In chronic periodontitis, which is also considered as a bone destructive disease, it was demonstrated that the levels of ADAM8 in the gingival cervicular fluid are reduced after non-surgical periodontal therapy, and are correlated with decreased clinical outcome of the associated parameters (Nimcharoen et al., 2019).

Introduction ADAM8 also contributes to cardiac disorders, a positive correlation has been found between ADAM8 overexpression and the development of atherosclerotic lesions and myocardial infarction (Raitoharju et al., 2011). A recent study showed that the increased expression of ADAM8 is associated with vascular diseases in mice and humans. ADAM8 expression is found to be higher in atherosclerotic regions of mice fed on a western-type diet with a concomitant release of TNFα and vascular cell adhesion molecule 1 (VCAM-1) (Schick et al., 2019). Contrary to this, Theodorou et al. (2017) has shown that ADAM8 deficiency does not affect the development of atherosclerosis in mice, although the expression of ADAM8 has been found higher in a human and murine model of atherosclerotic lesions (Theodorou et al., 2017).

ADAM8 may also promote liver injury by inhibiting the proliferation of the hepatocytes, angiogenesis and affecting the metabolic functions of the liver during acute liver injury induced by carbon tetrachloride (CCl4) (Li et al., 2014).

1.3.3 Anti-inflammatory role of ADAM8

Besides the pro-inflammatory role of ADAM8, an anti-inflammatory or protective role of ADAM8 has also been reported in some disorders. For example, in neurodegenerative disease, ADAM8 sheds tumour necrosis factor α receptor 1(TNF- R1) in response to an increased amount of TNFα and hence, protects the neurons from TNFα-mediated apoptosis (Bartsch et al., 2010). ADAM8 seems to control the process of angiogenesis since it is extensively co-localized with the endothelial marker platelet endothelial cell adhesion molecule (PECAM) and its expression is induced significantly after spinal cord injury in the mice (Mahoney et al., 2009). A study on zebrafish has shown that ADAM8 is necessary for the first erythroid cell to enter the blood circulation by cleaving the P-selectin glycoprotein ligand 1 (PSGL-1), therefore regulating blood circulation (Iida et al., 2010).

ADAM8 was also shown to possess protective effects against OVA-induced airway inflammation, contrary to the above-mentioned role of ADAM8 in OVA- induced airway inflammation. Higher leukocyte counts and increased production of some cytokines (e.g IL-4, TNFα) in the lungs of ADAM8 deficient mice pointed towards the fact that ADAM8 also possesses anti-inflammatory properties (Knolle et al., 2013). Experiments on an OVA-induced airway inflammation model of transgenic mice expressing more soluble ADAM8 also showed protection against inflammation 15

Introduction by decreasing the leucocyte infiltration due to the increased shedding of VCAM-1 (Matsuno et al., 2006). ADAM8 expression levels were found reduced in chronic obstructive pulmonary disease (COPD). Analysis of cigarette smoke-induced COPD in ADAM8 deficient mice revealed that ADAM8 can protect against emphysema by increasing macrophage death (Polverino et al., 2018).

1.3.4 ADAM8 in cancers

In recent years, studies on various kinds of the cancer showed the active participation of ADAM8 in cancer pathology and the upregulated expression of ADAM8 is associated with increased malignancy and poor prognosis (Valkovskaya et al., 2007; Wildeboer et al., 2006). ADAM8 is found to be upregulated in lung cancer (Ishikawa et al., 2004), prostate cancer (Fritzsche et al., 2006), triple-negative breast carcinoma (Romagnoli et al., 2014), pancreatic duct adenocarcinoma (Valkovskaya et al., 2007), pancreatic cancer (Schlomann et al., 2015), kidney cell carcinomas (Roemer et al., 2004), leukemia (Miyauchi et al., 2018), brain tumours (Wildeboer et al., 2006), head and neck squamous cell carcinoma (Zielinski et al., 2012), gastric cancer (He et al., 2016) and liver carcinoma (Zhang et al., 2013). ADAM8 is correlated with higher invasion, migration, circulating tumour cells and angiogenesis in the above-mentioned cancer types, and its higher expression in these cancers is also related to poor survival rate.

ADAM8 is now considered as the potential diagnostic marker for several carcinomas. In lung cancer, it is proposed as a marker for not only the early stage diagnosis of cancer (Ishikawa et al., 2004) but also a marker for the metastasis. A spliced form of ADAM8 was found to be involved in bone metastasis of lung cancer (Hernández et al., 2010). ADAM8 overexpression in the lung cancer cell lines renders them more resistant to cisplatin-induced toxicity (Zhang et al., 2013). Miyauchi et al., (2018) described that ADAM8 is the marker of residual chronic myeloid leukemia cells (CML) which survived after the treatment of leukemia with tyrosine kinase inhibitor (TKI), and these residual cells would be the cause of relapse of the disease (Miyauchi et al., 2018).

Metastasis and carcinogenicity depend on the uncontrolled proliferation of tumour cells, invasion through ECM and angiogenesis (Hanahan & Weinberg, 2011). ADAM8 is involved in cleaving various ECM components involved in the migration and 16

Introduction invasion of the cancer cells such as fibronectin (Zack et al., 2009) and periostin (Johansson et al., 2017). It is involved in the invasiveness of tumours through proteolytic ECM degradation via binding with β1 integrin (Conrad et al., 2018; Romagnoli et al., 2014; Schlomann et al., 2015). Soluble ADAM8 also plays an important role in the degradation of ECM components as it can reach the distant substrate (Johansson et al., 2017; Schlomann et al., 2015). Some studies have revealed that the metastatic and invasive activity of ADAM8 in cancers involves the activation of the MAPK signalling pathway (Conrad et al., 2018; Schlomann et al., 2015).

Development of the new blood vessels in the tumour requires some molecules which are the proteolytic targets of ADAM8 such as angiopoietin-1 receptor, vascular endothelial growth factor receptor 1 (VEGFR-1), VEGFR-2, ephrin type-B receptor 4 (EphB4), vascular endothelial-cadherin (VE-cadherin), E-selectin and PECAM (Romagnoli et al., 2014; Guaiquil et al., 2010). ADAM8 is also involved in the cleavage of numerous other molecules like PSGL-1 (Domínguez-Luis et al., 2011), L-selectin (Gomez-Gaviro et al., 2007), VCAM-1 (Matsuno et al., 2006), amyloid precursor protein (APP) (Naus et al., 2006) and ligands of cluster of differentiation 23 (CD23) (Fourie et al., 2003). The cleavage of these adhesion molecules enables the tumour cells to reach distant sites. Major substrates of ADAM8 are described in the table 1.

Table 1: Shedding substrates of ADAM8 which are involved in development of diseases

Type of Substrates Perspective role in References substrate disease Autocatalytic ADAM8 Proteolytic (Schlomann et al., pro-domain activity 2002) Soluble (Hall et al., 2009) ADAM8 (Schlomann et al., 2015)

ECM Collagen Invasion, (Schlomann et al., molecules Fibronectin migration and 2015) metastasis Periostin (Zack et al., 2009) (Johansson et al., 2017)

Receptors CD23, Immunomodul (Fourie et al., 2003) ation

Introduction

TNFR-I cell motility (Bartsch et al., 2010) IL-1R-II angiogenesis (Amour et al., 2002) VEGFR-1 metastasis (Guaiquil et al., VEGFR-2 2010) Angiopoieti (Seo et al., 2017) n-1 receptor EphB-4

Ligands PSGL-1 Transmigration (Conrad et al., 2018) APP metastasis (Nishimura et al., MBP 2015) ADAM10 (Amour et al., 2002) (Scharfenberg et al., ADAM17 Immunomodul ation 2020)

Adhesion CHL-1 Cell (Naus et al., 2006) molecules VE- detachment (Guaiquil et al., cadherin and motility, 2010) extravasation, CD31 (Gomez-Gaviro et transmigration E-selectin al., 2007)

L-selectin VCAM-1 Cytokines/ TNFα Immunomodul (Amour et al., 2002) chemokines CXCL1 ation (Naus et al., 2006) cKit- Ligand Growth TGFα Proliferation, (Naus et al., 2006) factors migration

ADAM8 dependent β1 integrin signalling is associated with many tumours like pancreatic cancer (Schlomann et al., 2015), gastrointestinal cancers (Huang et al., 2015) and breast cancer (Conrad et al., 2018; Romagnoli et al., 2014) where this interaction leads to activation of FAK and ERK1/2 (Schlomann et al., 2015). In glioma cells, ADAM8 induces the migration and invasion activities mainly via its proteolytic ability.

Introduction A mutation in the catalytic domain of ADAM8 can suppresses its catalytic capability. (Wildeboer et al., 2006). Investigation on the functional role of ADAM8 in the lung cancer reveals the fact that there are two ADAM8 isoforms present in the lung cancer cells, that enhance the invasive activity of the tumour cells (Hernández et al., 2010).

Besides the metastasis promoting function, ADAM8 is also involved in the chemoresistance of non-small-cell lung cancer (Zhang et al., 2013) and tyrosine kinase inhibitor (TKI)-resistance of chronic myeloid leukemia (CML) cells (Miyauchi et al., 2018). The results from these studies indicate that the pharmacological inhibition of ADAM8 might have an additional therapeutic effect along with the conventional treatment of cancer to reduce treatment failures, relapse of disease and chemoresistance (Miyauchi et al., 2018; Zhang et al., 2013).

Aim of the study

2 Aim of the study

This study aimed to investigate the role and regulation of ADAM8 in liver inflammation and cancer. The study was divided into two parts: The role of ADAM8 in liver inflammation and the role of ADAM8 in the malignancy of HCC (Figure 6).

2.1 Role of ADAM8 in liver inflammation

The role of ADAM8 has been described in various inflammatory disorders including acute lung inflammation (Dreymueller et al., 2017; Knolle et al., 2013; Paulissen et al., 2011). During the progression of inflammation ADAM8 can function in either way; pro-inflammatory (Dreymueller et al., 2017; Paulissen et al., 2011) or anti-inflammatory (Knolle et al., 2013). Therefore, it is worthy to understand the contribution of ADAM8 also in liver inflammation. In particular, ADAM8 has not been yet studied in the context of liver inflammation resulting from NAFLD or in LPS- induced acute liver injury.

To investigate the role of ADAM8 in liver inflammation, two inflammatory models were used; non-alcoholic fatty liver disease (NAFLD) and LPS-induced liver injury. At a first step, the expression and regulation of ADAM8 were analysed ex-vivo, in liver tissues of animals from NAFLD (7 weeks and 14 weeks of high-fat diet (HFD) feeding), LPS-induced liver injury, bile duct ligation (BDL)-induced liver injury and after partial hepatectomy. The regulation of ADAM8 was then investigated in-vitro after LPS- treatment and under NAFLD conditions in murine and human liver cells including hepatocyte cell lines (Hepa1-6 & HepG2), endothelial cell lines (LSEC & EA.hy926) and liver stellate cell lines (GRX & LX-2). The results were also reproduced in freshly isolated murine hepatocytes. Afterwards, to analyse ADAM8 mediated induction of inflammation, lentiviral-based shRNA was used to knockdown the expression of ADAM8 in human cells while siRNA was used to silence ADAM8 in murine cells. The mRNA expression of TNFα and IL-6 and the release of TNFα, IL-6, IL-8/KC, CXCL16 and CX3CL1 was analysed in ADAM8 KD liver cells after respective treatments. Expression of fibrotic genes (alpha smooth muscle actin (αSMA) and collagen) was determined in ADAM8 KD stellate cells. Finally, an in-vivo murine model of LPS- induced liver injury was investigated with ADAM8 knockout (KO). After 6 h of intraperitoneal (i.p) injection of LPS, the liver tissues from control and ADAM8 KO

Aim of the study mice were analysed for the expression and regulation of ADAMs (ADAM8, 10 & 17) and cytokines (TNFα & IL-6), and also for immunohistopathology. Serum was analysed for liver enzymes and released cytokines to evaluate the extent of inflammation.

2.2 Role of ADAM8 in malignancy of HCC

Higher expression of ADAM8 has been reported in HCC (Zhang et al., 2013) in association with increased tumour invasion and metastasis (Li et al., 2015). However, the underlying mechanism and the relation between ADAM8 and various downstream signalling pathways have not been yet established in HCC.

To determine the role of ADAM8 in the metastasis of HCC, the tissues from a chemically induced-HCC murine model were analysed for the expression of ADAMs and cytokines. Functional analyses were performed on the hepatoma cell lines after ADAM8 silencing and ADAM8 overexpression in the hepatoma cell line (Hepa1-6 & HepG2). The subsequent effect of silencing and overexpression of ADAM8 on cell proliferation, cell migration, cell invasion and cell apoptosis was studied. Afterward, β1 integrin and FAK were analysed as the interaction partners of ADAM8. Further downstream signalling molecules like p38, Src kinase and Rho GTPase were investigated for their activation to establish a connection between ADAM8 and the mechanism behind the invasiveness of HCC.

Figure 6: Schematic presentations of the study objectives

Materials and Methods

3 Materials and Methods

3.1 Materials

3.1.1. Chemicals, enzymes and recombinant proteins

All the chemicals used in this research work were purchased from Merck (Darmstadt, Germany), Carl Roth (Karlsruhe, Germany) or Sigma-Aldrich (Steinheim, Germany), otherwise mentioned below.

Table 2: Special chemicals used in this work

Name Company

BM Blue POD Substrate soluble Roche (Prenzberg, Germany) BD Matrigel™ , BD Bioscience BD Bioscience (Heidelberg, Germany) BSA ApliChem (Darmstadt, Germany) BSA (ELISA) Tocris Biosciences (Bio-Techne GmbH, Wiesbaden-Nordenstadt Germany) Collagen-G Biochrome (Berlin, Germany) Complete Protease Inhibitor Roche (Prenzberg, Germany) DNA Molecular Weight Marker X Roche (Prenzberg, Germany) (0.07-12.2 kbp) DNA Molecular Weight Marker X Roche (Prenzberg, Germany) (0.1-1.5 kbp) ECL Plus / Advanced Western Amersham (Little Chalfont, UK) Blotting jetPEI® Poly Plus Transfections (Illkirch)/ VWR International GmbH Lipofectamine 3000 Thermo Fisher Scientific (Inc., Waltham, US) Lipofectamine™ RNAiMAX Thermo Fisher Scientific (Inc., Waltham, US) Midori Green Advance Biozym Scientific GmbH (Göttingen, Germany) Mitomycin Medac GmbH (Wedel, Germany) Nuclease Free Water Ambion, Thermo Fisher Scientific (Inc., Waltham, USA) Opti-MEM™ Gibco (Karlsruhe, Germany)

Materials and Methods

Orange DNA Loading Dye (6x) Thermo Fisher Scientific (Inc., Waltham, USA) Page Ruler Plus Prestained Protein Thermo Fisher Scientific (Inc., Waltham, Ladder USA) Polybrene Sigma Aldrich (Steinheim, Germany) Recombinant human IFNγ PeproTech GmbH (Hamburg, Germany) Recombinant human TNFα PeproTech GmbH (Hamburg, Germany) Recombinant human IL-1β PeproTech GmbH (Hamburg, Germany) Recombinant murine IFNγ PeproTech GmbH (Hamburg, Germany) Recombinant murine TNFα PeproTech GmbH (Hamburg, Germany) Recombinant murine IL-1β PeproTech GmbH (Hamburg, Germany) Linoleic acid-Oleic acid-Albumin Sigma Aldrich (Steinheim, Germany) 100x LPS Sigma Aldrich (Steinheim, Germany) Trypsin-EDTA Sigma Aldrich (Steinheim, Germany) Zeocin InvivoGen (San Diego, CA, USA) Caspase 3/7 Essen Bioscience Caspase substrate Sartorius (Gӧttingen, Germany 3.1.2 Consumables

All consumables used during cell culture (cell culture dishes, cell culture flasks, multi-well plates, pipette tips) were purchased from BD Biosciences (Heidelberg, Germany), Corning (Kaiserslautern, Germany) or Sarstedt (Nürnberg, Germany), if not mentioned below.

Table 3: Particular consumables used in this study

Name Company

Filter pipette tips Tip One (qPCR) Starlab (Merenschwand, Switzerland)

Nunc-Immuno™ Plate (ELISA) Nunc A/S (Roskilde, Denmark)

Omnican F, Single-use syringe 1 ml B. Braun Melsungen AG (Melsungen, Germany) PVDF Transfer Membrane Hybond-P GE-Healthcare (Buckinghamshire, UK) Real-time-qPCR-plates (96 wells) BIO Plastics (Landgraaf, Netherlands)

Materials and Methods

Safety catheter 22G B. Braun Melsungen AG (Melsungen, Germany) Bulldog clamp Aesculap (Tuttlingen, Germany)

3.1.3 Kits

The commercial kits used in this study were used according to the manufacturers’ instructions.

Table 4: Kits used in this study

Names Company

NucleoSpin® Plasmid Macherey-Nagel (Düren, Germany)

NucleoBond® Xtra Midi Macherey-Nagel (Düren, Germany)

RNeasy Mini Kit Qiagen (Hilden, Germany)

SYBR Premix Ex Taq II Takara/Clontech (Mountain View, USA)

PrimeScript™ First Strand cDNA Takara/Clontech (Mountain View, USA) Synthesis Kit Rho Activation Kit Enzo Life Science (Antwerp, Belgium)

ELISA Kits R&D Systems (Wiesbaden, Germany)

BCA Assay Kit Interchim (Montlucon, France)

3.1.4 Microorganisms

For propagation and cloning of plasmids, the E. coli strain DH5α was used (Genotype DH5α: supE44 ΔlacU 169(φ80lacZ ΔM15) hsd R17 recA1 end A1 gyr196 thi-1relA1).

3.1.5 Plasmids

The plasmids used in this study are listed below (Table 5). The vector maps are shown in the supplements.

Table 5: List of plasmids used

Plasmid Properties

pLVTHM Lentiviral shRNA expression plasmid encoding the reporter gene GFP

Materials and Methods

pMD2 Lentiviral envelop plasmid encoding VSV-G epitope

psPAX Lentiviral packaging plasmid encoding the HIV gag-pol gene and further auxiliary HIV proteins

pMOWs-Zeo-GFP Retroviral plasmid carrying zeocin resistance and expressing GFP

pMOWs-Zeo-A8 Retroviral plasmid over-expressing wild type human ADAM8 3.1.6 Antibodies

Antibodies used in this study are listed below.

Table 6: Antibodies used in this study

Name Isotype Application Company Monoclonal anti-human/mouse Rabbit WB Abcam Biotech Life ADAM8 (clone EPR14612) IgG sciences (Cambridge, UK) Polyclonal anti-human ADAM8 Rabbit WB Millipore (Darmstadt, Germany) Polyclonal anti-human/mouse Rabbit WB Millipore (Darmstadt, ADAM10 Germany) Polyclonal anti-human/mouse Rabbit WB Millipore (Darmstadt, ADAM17 Germany) Monoclonal anti-human/mouse Mouse WB Thermo Fisher GAPDH (clone GA1R) IgG1 Scientific (Inc., Waltham, USA) Monoclonal anti-human PCNA Mouse WB Santa Cruz (clone PC10) IgG Biotechnology (Dallas, TX, USA) Monoclonal anti-human β1 Mouse WB Santa Cruz integrin (clone 12G10) IgG Biotechnology (Dallas, TX, USA) Polyclonal anti-human FAK Rabbit WB Santa Cruz Biotechnology (Dallas, TX, USA) Polyclonal anti-human/mouse p- Goat WB Santa Cruz FAK (Tyr 576/577) Biotechnology (Dallas, TX, USA)

Materials and Methods

Polyclonal anti-human/mouse p- Rabbit WB Santa Cruz FAK (Tyr 925) Biotechnology (Dallas, TX, USA) Monoclonal anti-human/mouse Rabbit WB Santa Cruz p-FAK (Tyr 397) (clone 1419) IgG Biotechnology (Dallas, TX, USA) Polyclonal anti-human/mouse Rabbit WB Cell Signalling p38 (Danvers, NA, USA) Polyclonal anti-human/mouse p- Rabbit WB Cell Signalling p38 (Tyr 180/182) (Danvers, NA, USA) Polyclonal anti-human/mouse c- Rabbit WB Cell Signalling Src (Danvers, NA, USA) Polyclonal anti-human/mouse p- Rabbit WB Cell Signalling Src (Tyr 416) (Danvers, NA, USA) Polyclonal anti-goat IgG (HRP) Rabbit WB Jackson Immuno research laboratories Inc. Polyclonal anti-mouse IgG Goat WB Jackson Immuno (HRP) research laboratories Inc. Polyclonal anti-rabbit IgG (HRP) Goat WB Jackson Immuno research laboratories Inc. 3.1.7 Buffers and solutions

All the buffers and solutions used in this study are listed in Table 7.

Table 7: Buffers and their composition

Name Composition Basic rinsing buffer (for hepatocyte 9 g NaCl isolation) 0.42 g KCL 0.99 g Glucose 4.80 g HEPES 2.10 g NaHCO3 Add up to 1 L of ddH2O pH 7.4 Collagenase rinsing buffer (for 50 ml of basic rinsing buffer hepatocyte isolation) 2 mM CaCl2 30 mg Type-II collagenase Type 2-S trypsin inhibitor (Glycine max) ELISA blocking buffer 2 % Bovine serum albumin (BSA) 0.05 % Tween 20 PBS ELISA dilution buffer 0.1 % BSA 26

Materials and Methods 0.0 5% Tween 20 PBS ELISA wash buffer 0.05 % Tween PBS Lӓmmli buffer (5x) (reducing) 20 % Glycine 4.5 % SDS 125 mM Tris-HCl a spatula tip of Bromphenol blue pH 6.8 5 % Mercaptoethanol LB-Medium 10 g Bakto-trypton 5 g Yeast extract 10 g NaCl add 1 L ddH2O pH 7.0 Phosphate-buffered saline (PBS) 150 mM NaCl 120 mM KCl 10 nM Na2HPO4/KH2PO4 pH 7.4 Phosphate-buffered saline with tween 0.1 % Tween 20 (PBST) PBS Protein lysis buffer 1 mM Na3VO4 20 nM Tris 150 nM NaCl 4 mM EDTA 1 mM PMSF 1% Triton X-100 1x Complete inhibitor add up to 10 ml ddH2O Lӓmmli buffer (1x) Running buffer (SDS-PAGE) 25 mM Tris-HCl 200 mM Glycine 3.5 mM SDS pH 7.5 Separation gel buffer (SDS-PAGE) 90.85 g Tris/HCl 2 g SDS add up to 500 ml ddH2O pH 8.8 Stacking gel buffer (SDS-PAGE) 30.28 g Tris/HCl 2 g SDS add 500 ml ddH2O pH 6.8 Stripping buffer 0.1 % SDS 0.2 M Glycine in ddH2O pH 2.2 Tris-acetate EDTA buffer (TAE) 50x 57.1 ml Glacial acetic acid 242 g Tris

Materials and Methods 1 mM EDTA Add up to 1 L ddH2O pH 7.4 Tris-buffered saline (TBS) 8.75 g NaCl 3.152 g Tris-HCl 0.29 g EDTA add up to 1 L ddH2O pH 7.4 Tris-buffered saline with tween (TBST) 0.1 % Tween 20 TBS Wet-blot transfer buffer 5x (SDS- 90.15 g Glycine PAGE) 18.94 g Tris add up to 1 L ddH2O Wet-blot transfer buffer (1x) 200 ml 5x wet-blot transfer buffer 200 ml Methanol 600 ml ddH2O 3.1.8 Oligonucleotides

Oligonucleotides used for qPCR were purchased from Eurofins (Nürnberg, Germany) or Eurogentec (Kӧln, Germany) at the HPLC purification grade.

Table 8: List of qPCR oligonucleotides used in this study

Target Sequence 5ʹ→ 3ʹ Annealing gene temperature ºC hADAM10 Forward: GGATTGTGGCTCATTGGTGGGCA 61 Reverse: ACTCTCTCGGGGCCGCTGAC hADAM17 Forward: GAAGTGCCAGGAGGCGATTA 55 Reverse: CGGGCACTCACTGCTATTACC hADAM8 Forward: AAGCAGCCGTGCGTCATC 62 Reverse: AACCTGTCCTGACTATTCCAAATCTC hGAPDH Forward: CCAGCCCCAGCGTCAAAGGTG 66 Reverse: AGGGCCGATCATGGAGTCTT hPCNA Forward: GAAGCACCAAACCAGGAG 60 Reverse: CACAGGAAATTACAACAGCA mAdam10 Forward: AGCAACATCTGGGGACAAAC 57 Reverse: TGGCCAGATTCAACAAAACA mAdam17 Forward: AAACCAGAACAGACCCAACG 57 Reverse: AACGAATCGAACCCTGACTGGCA mAdam8 Forward: GCGAGTGCTGGAGGTTGTAA 64 Reverse: ACCCCCGTGATAAGTTGCAC mPcna Forward: CCCAGAACAGGAGTACAG 60 Reverse: GGCTCATTCATCTCTATGGT mRps29 Forward: CCTTTCTCCTCGTTGGGC 61 Reverse: GAGCAGACGCGGCAA mTnfα Forward: GAA CTG GCA GAA GAG GC 61 Reverse: CAT AGA ACT GAT GAG AGG GAG

Materials and Methods mIL-6 Forward: TGCAAGAGAVTTCCATCCAGTTGCC 59 Reverse: AAGCCTCCGACTTGTGAAGTGGT mαSma Forward: GTCCCAGACATCAGGGAGTAA 64 Reverse: TCGGATACTTCAGCGTCAGGA mCol1a1 Forward: CTG GCG GTT CAG GTC CAA T 63 Reverse: TTC CAG GCA ATC CAC GAG C mGapdh Forward: GGCAATTCAACGGCACAGT 63 Reverse: AGATGGTGATGGGCTTCCC 3.1.9 shRNA sequence

All shRNA sequences were designed following the scheme shown in Figure 7 as described before (Hess, 2012). These shRNA sequences were cloned into the pLVTHM plasmids. The 19 nucleotides long sense siRNA sequence and the reverse complementary antisense siRNA sequence were separated by the 7 nucleotides spanning loop. At the 5’-end of the sequence tandem was the transcription initiation site for the RNA PolIII, while the multiple thymidines at the 3’-end of the oligo encodes the stop signal for the polymerase. After the transcription of the siRNA sequence tandem, both, the sense and the antisense, siRNA sequence anneals and form, together with the loop region, the small hairpin RNA (shRNA) which is then further processed to siRNA. The forward oligo (upper sequence Figure 7) and reverse oligo (lower sequence Figure 7) are complementary. Both oligos were designed to form overlapping “sticky” ends at the 5’ and 3’ end. This enabled the directed ligation of the annealed oligos into the opened pLVTHM plasmid which had been digested with the corresponding restriction enzymes MluI and ClaI.

MluI 19nt sence siRNA Loop 19nt anti-sence siRNA stop ClaI 5ʹ-CGCGTCCCCNNNNNNNNNNNNNNNNNNNTTCAAGAGANNNNNNNNNNNNNNNNNNNTTTTTGGAAAT-3ʹ 3ʹ-AGGGGNNNNNNNNNNNNNNNNNNNAAGTTCTCTNNNNNNNNNNNNNNNNNNNAAAAACCTTTAGC-5ʹ

Figure 7: General design of oligonucleotides containing the shRNA target sequences

The sequence above represents the forward strand and the sequence below the reverse stand of the oligonucleotide pair. The sense and the anti-sense siRNA are separated by the loop region. There are overhanging “sticky” ends at either end of the oligo-dimer. The annealed oligos were ligated into the opened pLVTHM plasmid which had been digested with the restriction enzymes MluI and ClaI. After http://lentiweb.com/cloning_strategies.php, design by Maciej Wiznerowicz.

Materials and Methods The oligos containing the shRNA against ADAM8 were first inserted into the pSuper plasmid and subsequently subcloned into the lentiviral pLVTHM vector using the restriction enzymes EcoRI and ClaI. Following is the list representing the shRNA target sequences integrated into the pLVTHM used for human ADAM8 knockdown.

Table 9: List of shRNA sequences used

Name Sequence (forward) Scramble CCG TCA CAT CAA TTG CCG shADAM8-903 GC ATG ACA ACG TAC AGC TC shADAM8-1831 AG AGA AGG TTT GCT GGA AA shADAM8-2645 GC TGC TGT TCT AAC CTC AG

3.1.10 Cell lines

All cell lines used in this study are listed in Table 12. The culture medium for murine primary hepatocytes was supplemented with 2 mM glutamine, 10 % fetal calf serum (FCS) and penicillin 100 U/ml and streptomycin 100 U/ml (pen/strep). The culture medium for other cell lines was supplemented with 10 % FCS and pen/strep solution. All cells were cultured under standard conditions.

Table 10: List of cells used in this study

Name Description Culture medium

EA.hy926 Immortalized human umbilical cord DMEM endothelial cells

GRX Immortalized murine hepatic stellate cells DMEM

HEK293 Human embryonic epithelial kidney cells DMEM

Hepa1-6 Murine epithelial hepatoma cells DMEM

HepG2 Humane hepatocellular carcinoma cells DMEM

LSEC Immortalized murine liver sinusoidal DMEM endothelial cells

LX-2 Immortalized human hepatic stellate cells DMEM

PMH Freshly isolated primary murine William's E medium hepatocytes

Materials and Methods 3.2 Methods

The following methods and experimental procedures were used to carry out the present research.

3.2.1 Cell culture methods

Isolation and culture of primary hepatocytes:

Hepatocyte isolation from mice was carried out in collaboration with Prof. Dr. Frank Tacke and performed by Sibille Sauer-Lehnen (laboratory assistant at the Institute of molecular patho-biochemistry, experimental gene therapy and clinical chemistry, University Hospital, RWTH Aachen) as the protocol was described before (Severgnini et al., 2012). For the isolation of primary hepatocytes, wild type and ADAM8 knockout (KO) C57BL/6J mice were used. Mice were 8-10 weeks old and housed in a pathogen- free environment under ethical conditions and animal experiments protocol approved by the German legal authorities (LANUV NRW).

The mice were anesthetised using Xylazine (7 mg/kg body weight) and Ketamine (105 mg/kg body weight). The liver was cannulated using a safety catheter in the inferior vena cava while the hepatic portal vein was transected immediately. 5 µl of heparin-natrium-5000 (diluted 1:10 with sterile 0.9% NaCl up to the volume of 50 µl) was injected in the inferior vena cava and the thoracic part of the inferior vena cava was clamped off using a Bulldog clamp. The liver was perfused using a two-step perfusion protocol. The basic rinsing buffer was added with 1 mM of EDTA (anticoagulant) and filtered using 0.2 µm filter and purged with carbogen (5 volume parts of CO2 and 95 %

O2) for 15 minutes under sterile conditions and heated to 37º C. In the first step of perfusion, the liver was perfused with 20 ml of the anticoagulant rinsing buffer at a constant flow rate of 7.5 ml/minute.

In the second step of perfusion, the collagenase rinsing buffer was perfused in the liver at a flow rate of 7.5 ml/minute. The buffer was sterile-filtered and purged with carbogen as described above and heated to 37º C before perfusion. After perfusion, the liver was removed and put into a petri dish on ice containing washing buffer (DMEM supplemented with 4.5 g/l glucose, 25 mM HEPES, 1 % pen/strep, 4 mM glutamine and 10 % FBS). The liver was gently dissected and the gall bladder was removed. The liver capsule was ruptured and the hepatocytes were removed by shaking. The cell

Materials and Methods suspension was filtered through 100 µm pores containing nylon gaze and volume was adjusted to 50 ml using 4º C cold washing buffer.

To remove non-parenchymal cells, the cell suspension was centrifuged for 4 minutes at 4º C and 18 x g. The supernatant containing non-parenchymal cells was aspirated and the hepatocytes were resuspended in 20 ml of washing buffer by gentle shaking. Then the cells were counted by hemocytometer by trypan blue staining. Hepatocytes were incubated in 6-well plates that were pre-coated with collagen G, at a density of 0.5 million viable cells/ml with a viability of 70 %, in William's E medium supplemented with 2 mM glutamine, 1 % pen/step and 10 % FBS. After 4-6 hours the medium was exchanged to remove the dead unattached cells.

Propagation of cell lines:

All cell lines were cultured in T75 cell culture flasks at 37º C and 5 % CO2 in a humidified incubator under standard conditions. The cell culture medium, high glucose Dulbecco's modified eagle medium (DMEM), was supplemented with 10 % FCS and 1 % penicillin/streptomycin. The cells were kept at a cell density of about 2 - 10 x 105 cells per ml. The cells were sub-cultured when they reach 70 – 80 % confluence. Trypsin/EDTA was used to detach the cells from the plate and then they were resuspended in the cell culture medium and then counted (as described below) and seeded the cells at the desire concentration in the new cell culture flask.

Cell counting:

10 µl of the cell suspension was mixed with 10 µl of 0.4 % trypan blue solution. 10 µl of this suspension was added to the hemocytometer and the cells were counted under a normal light microscope. The cells that appear blue under the microscope were excluded as these were dead cells that incorporate trypan blue solution due to the damaged cell membrane.

Freezing and thawing of cells:

The cell lines were cryopreserved for a longer period in liquid nitrogen (~ -200º C) as described (Hess, 2012). At 70-80 % confluence, the cells were detached from the plate as described above, centrifuged and resuspended in the 10 ml of pre-cooled cryo- medium (75 % standard medium, 15 % FCS, 10 % DMSO). 1 ml cell suspension was

Materials and Methods added into the pre-labeled screw-top cryo-vials each and stored them at -20º C for 2 h and at -80º C for 48 h, before storing them in liquid nitrogen.

For the thawing of the cells, the cryo-vials were directly warmed at 37º C in a water bath. To remove DMSO, the cells were resuspended in fresh medium and centrifuged at 300 x g for 5 minutes. Afterward, the medium was removed and cells were resuspended and added in the flask containing pre-warmed cell culture medium and kept in an incubator under standard conditions. siRNA transfection:

The cells were seeded at a density of 2 x 105 cells per well in a 6-well plate. A transfection mixture of 500 µl opti-MEM reduced serum medium, 5 µl Lipofectamin™ RNAiMAX and 20 nM small interfering RNA (siRNA) against the target gene or non- specific (negative) control siRNA was prepared and incubated at room temperature for 20-30 minutes before adding it onto the cells. The medium was exchanged after 18-24 h and cells were further used in experiments. The successful knockdown was confirmed by western blot and qPCR after 96 h of the transfection.

Production of lentiviral particles:

The production of lentiviral particles was carried out as previously described (Hess, 2012). The human embryonic kidney cell line (HEK293) was used as a producer cell line for the production of shRNA based lentiviral particles. HEK293 cells were cultured at a density of 2.5 x 104 cells/cm2 in a cell culture dish which was pre-coated with collagen G (40 µg/ml of PBS for 15 minutes at 37º C). After 48 h, the transfection solution was prepared by mixing 5 µg of pLVTHM, 3.25 µg of psPAX2 and 1.75 µg pMD2 and 250 µl of 150 mM NaCl solution. This mixture was incubated for 15-30 min at room temperature and then added into the cells containing freshly exchanged medium. Subsequently, the medium was changed after 24 h. After 72 h of the transfection, the supernatant from the cells was collected and centrifuged at 500 x g for 5 minutes at room temperature. Subsequently, the supernatant was sterile filtered using a 0.2 µm syringe filter to avoid the chance of contamination. Lentiviral particles could be concentrated via ultracentrifugation for the long term storage of the viral particles. Therefore 10-30 ml of the supernatant was centrifuged at the speed of 50,000 x g for 2 h at room temperature in an ultracentrifuge. Finally, the supernatant was discarded and

Materials and Methods the pellet containing the viral particles was dissolved in 50 µl PBS and stored at -80º C after making aliquots.

Transduction:

The cells were harvested at a density of 1.25 x 105 cells per 6 well in a 6-well plate. 5 µl of the concentrated lentivirus encoding shRNA against the target gene or irrelevant shRNA (control) was added to each well. To increase the transduction efficiency, polybrene was added at a concentration of 4 µg/ml. The medium was exchanged after 18-24 h. The cellular expression of GFP encoded by the lentivirus can be analysed after 72 h of the transduction by the fluorescent microscope to determine the transduction efficiency. The successful knockdown of the target gene was confirmed by western blot and qPCR after 72 h of transduction.

Transfection of cells with overexpression plasmid:

HepG2 cells were transfected with ADAM8 overexpression plasmid (pMOWs-zeocin- ADAM8). The cells were seeded at a density of 2 x 106 cells per well in a 10 cm petri dish. A transfection mixture of 750 µl Opti-MEM reduced serum medium, 15 µl Lipofectamin™ 3000 reagent, 6 µl P3000™ reagent and 8 µg DNA construct was prepared and incubated at room temperature for 20-30 minutes before adding it onto the cells. pMOWs-zeocin-GFP was used as a control plasmid. This control plasmid leads to the expression of GFP instead of ADAM8. The medium was exchanged after 18-24 h and cells were further used in experiments. The successful transfection was confirmed by Western blot and qPCR for ADAM8 after 48-72 h of the transfection or by detection of GFP via fluorescence microscopy, respectively.

3.2.2 Protein biochemistry methods

SDS-PAGE:

The procedure was performed as described earlier (Babendreyer, 2018). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) is used to separate the proteins according to their molecular weight. The proteins were separated on a self- made 10 or 12.5 % (1.5 mm gel) SDS-PAGE gels using the Mini PROTEAN gel electrophoresis chamber (BIO-RAD, Hercules, USA).

Materials and Methods To isolate proteins, the lysis buffer was added to the cultured cells at 1 x 106 cells/ml for 10 minutes. Afterward, the cells were scratched and the cell homogenate was collected in Eppendorf tubes which were subsequently centrifuged at 16,000 x g at 4ºC for 5 minutes. The supernatants were either analysed by SDS-PAGE or stored at - 80º C. Supernatants were incubated at 95º C for 5 minutes to denature the proteins before running on the gels. 5 µl of PageRuler™ Prestained Protein Ladder was used to determine the size of the proteins. The electrophoresis was performed in SDS running buffer at 120 V for 90-120 minutes at room temperature.

Table 11: Composition of separating and separating gels

Components Separating gel 10% Stacking gel 5% Rothiphorese® Gel 30 (37, 5:1) 3.3 ml 0.85 ml 1.5 M Tris buffer pH 8.8 (separating gel 2.5 ml - buffer) 0.5 M Tris buffer pH 6.8 (stacking gel - 1.25 ml buffer) 10% SDS 100 µl 50 µl

MilliQ H2O 3.97 ml 2.8 ml 10% Ammonium per sulfate (APS) 100 µl 50 µl TEMED 10 µl 5 µl

Western blotting:

The proteins were electrophoretically transferred to polyvinylidene difluoride (PVDF) membranes by wet blot method (Mini Trans-Blot, BIO RAD, Hercules, USA) at constant 90 V for 120 minutes as described (Babendreyer, 2018). Subsequently, the membranes were blocked with the blocking buffer 5 % milk in TBST (except for the phosphorylated protein) to avoid non-specific binding of the antibody. The antibody against the target protein was diluted in 2 % milk in TBST (except for the phosphorylated proteins) at the above-mentioned concentration (Table 11) in the respective blocking buffer and incubated overnight at 4º C. Subsequently, the membranes were washed 3-4 times with TBST for 5-10 minutes each and incubated with the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody (concentration and dilution buffers are given in the table) for 60-90 minutes at room temperature. The membranes were washed again 3-4 times with TBST and the HRP

Materials and Methods substrate solution was added to the membranes. The HRP signals were analysed using the LAS-3000 Imager (Fujifilm, Tokyo, Japan) and quantified using the ImageJ software (NIH, Madison, Wisconsin, USA).

Phosphorylation analysis of proteins:

Cells were cultured in a 6 well plate at a density of ~ per well in a serum-free medium for 24 h and lysed in phosphor-lysis buffer on ice for 10-15 minutes. The cell homogenate was centrifuged at 16,000 x g for 5 minutes at 4º C to exclude the pellet of cell debris. The supernatant was supplemented with 1 fold SDS and incubated at 95º C for 5 minutes. An appropriate amount of cell lysate was subjected to the SDS-PAGE followed by Western blotting using the antibodies against the phosphorylated and non- phosphorylated form of the specified proteins.

Rho GTPase activation assay:

Cells were cultured in a 6 well plate at a density of 2-5 x 105 cells per well in a serum- free medium for 24 h and the cell lysate (300-500 µg total protein) was prepared. The lysate was analysed for the active and the total Rho content by using a commercial kit (Enzo Life Sciences, Plymouth, USA) according to the manufacturer’s instructions. As a positive control, the cell lysates were treated with guanosine triphosphate (GTPγS) that led to the activation of Rho GTPase.

ELISA:

The enzyme-linked immunosorbent assay (ELISA) uses target-specific antibodies to detect and quantify the soluble proteins present in the media or the serum. In the present study, ELISAs were used to analyse the presence and amounts of various human and murine soluble proteins released into the cell culture supernatants: namely TNFα, IL- 6, IL-8 or KC, chemokine CX3C motif ligand 1 (CX3CL1/fractalkine) and chemokine CXC motif ligand 16 (CXCL16). The serum was also analysed for murine soluble TNFα and IL-6 proteins. The ELISA was performed according to the manufacturer’s recommendations. In short, the 96 well nunc plate was coated with capture antibody diluted in PBS and incubated overnight at room temperature. The next day, the plate was blocked with the blocking buffer to avoid the non-specific binding of the proteins for 1 h at room temperature. After washing the wells with ELISA wash buffer 3 times, samples and a serial dilution of the recombinant protein diluted in ELISA buffer were

Materials and Methods added to the plate and incubated for 2 h at room temperature. The wells were again washed 3 times and the diluted detection antibody against the bound proteins was added to the plate for another 2 h. Subsequently, after repeating the washing step 3 times, 0.1 U/ml of streptavidin-conjugated horseradish peroxidase was added for 20 minutes following again the washing steps. To initiate the chromogenic reaction, the BM Blue POD substrate was added and incubated for 20 minutes. Finally, the reaction was stopped by the addition of 4 % sulfuric acid and the absorption was analysed with the FLUOstar Optima microplate reader (BMG Labtech, Ortenberg, Germany).

3.2.3 Molecular biology methods

Construction of ADAM8 overexpression vector:

To generate the ADAM8 overexpression vector, ADAM8 DNA was amplified and cloned into the pMOWs-Zeocin vector by using the following molecular biology methods.

PCR:

To amplify the ADAM8 DNA sequence, polymerase chain reaction (PCR) was performed. The PCR was performed twice, where the product of the first PCR is used as a template for the second PCR to amplify the specified target DNA sequence. The reaction mixture for the first PCR was prepared as described below.

Ingredient Amount CloneAmp HiFi PCR Premix (2x) 10 µl DNA template 50-100 ng Primer (10 µM) each 0.4 µl

ddH2O Add to make 20 µl The mixture containing tubes were placed in a PCR cycler (Biometra Analytik GmbH, Göttingen, Germany) and the program was run for approximately 35 cycles where each cycle consisted of three steps: the denaturation step took place at 95º C for 30 seconds, the annealing step took place at 65º C for 30 seconds and the elongation step took place at 72º C at the rate of 1 kb per minute. After final elongation, the reaction cooled down to 4º C.

Materials and Methods For the second PCR, the reaction mixture was prepared as follows:

Ingredient Amount CloneAmp HiFi PCR Premix (2x) 10 µl Template (product of first PCR) 50-100 ng

Primer (10 µM) each 0.4 µl

ddH2O Add to make 20 µl The PCR was run according to the above-mentioned program. The final product of the PCR was analysed by DNA gel electrophoresis.

DNA gel electrophoresis:

Agarose gel electrophoresis is used to separate DNA fragments according to their size. The DNA samples are loaded onto the gel which is placed in an electric field. The DNA fragments are moved from the cathode towards the anode due to their negative charge. 1 % agarose was used in Tris-acetate-EDTA (TAE) buffer to make gels. Before solidifying the gels, 0.5 µl of Midori green (advanced DNA stain) was added to detect nucleic acid in the gel. After adding the loading buffer to the samples, they were loaded onto the gel. 5 µl of 1 kb DNA ladder was used to detect the size of the samples. The samples were run for 30-45 minutes at 90 V. Afterwards, the gel was visualized under ultraviolet (UV) light in the Gel Doc™ XR+ Gel Documentation System (Bio-Rad Laboratories GmbH, Munich, Germany).

Gibson assembly:

Gibson assembly is used to join DNA fragments with identical ends with the length of at least 15 nucleotides. In this experiment, ADAM8 DNA constructs were cloned into pMOWs-zeocin vector. 50-100 ng of DNA was mixed with 5 µl of HiFi DNA assembly master mix and 25-50 ng of the digested vector was added in this mixture. Nuclease free water was added to the solution to make the volume up to 10 µl. The mixture was incubated at 50ºC for 10-15 minutes and afterward directly used for bacterial transformation.

Bacterial transformation and mini-preparation of plasmid DNA:

Chemically competent E. coli DH5α was thawed on ice and DNA plasmids were added to the bacterial cells. This mixture was incubated on ice for 30 minutes and heat-

Materials and Methods shocked at 42ºC for 30 seconds followed by 2-5 minutes incubation on ice. The mixture was directly added into 250 µl of pre-warmed (room temperature) lysogeny broth (LB) medium and incubated for 1 h at 37º C and 180 rpm. The mix was then added to the LB-agar plates containing penicillin and incubated at 37º C for 24 h. 15 ml of LB- ampicillin medium were inoculated with positively transformed bacteria and incubated at 37º C and 300 rpm overnight. Later, the plasmid purification was performed by QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations.

Colony PCR:

After transformation, the bacterial colonies were analysed by PCR to determine the presence of DNA plasmid in them. Bacterial colonies were picked up with the help of a pipette tip and this tip was put in the PCR reaction mixture containing tube. This colony served as the template in the reaction mixture for PCR. Other ingredients of the reaction mixture are described below:

Ingredient Amount Quick Load® Taq 2x Master Mix 10 µl Primer (10 µM) each 0.8 µl dd H2O Add to 20 µl The PCR program was run as described earlier (see PCR) except for the initial denaturation step. The denaturation step for the first cycle took a little longer (~ 8 minutes) to break the bacterial cell wall and expose the plasmid to the primers and polymerase.

RNA isolation and cDNA preparation:

Complementary deoxyribonucleic acid (cDNA) was used for the qPCR analysis to determine the quantity of the target RNA in the cells or tissues. To isolate ribonucleic acid (RNA) from the cells, the cells were seeded at the density of 2-5 x 105 per well in a 6 well plate and to extract RNA from tissues, 30-60 µg of tissue was used. The cells were washed with PBS and lysed in 350 µl of RLT buffer which was supplied with an RNeasy mini kit. For tissues, β-mercaptoethanol was added to the RLT buffer to eliminate ribonuclease which may digest RNA during its extraction procedure. The samples were homogenized using QIA Shredder columns and the further procedure was

Materials and Methods performed according to the manufacturer’s recommendations. After the extraction, the concentration of mRNA was determined with the NanoDrop (Peqlab, Erlangen, Germany). 500 ng of RNA from cells and 1000 ng of RNA from each tissue samples were reverse transcribed into cDNA by using the PrimeScript™ First Strand cDNA Synthesis Kit according to manufacturer’s instructions. RNA and cDNA samples were stored at -80º C.

Establishment of the qPCR primers:

The optimal annealing temperature was determined by gradient PCR for the newly designed primers before using them for qPCR analysis. The procedure was followed as described before (Babendreyer, 2018). The cDNA from all the samples was pooled to serve as the template. The PCR master mix was prepared using 10 µl of template cDNA, 5.5 µl of each primer (forward and reverse), and 50 µl of SYBR Premix Ex Taq II and 29 µl of nuclease-free water. 10µl, from a total of 100 µl master mix was distributed in 10 tubes and placed in the PCR cycler (Biometra Analytik, Göttingen, Germany). The gradient temperature was set for the specified positions in the cycler: 1 (55.0º C), 2 (55.3º C), 3 (56.0º C), 4 (57.0º C), 5 (58.2º C), 6 (59.4º C), 7 (60.6º C), 8 (61.8º C), 9 (63.0º C), 10 (64.0º C), 11 (64.7º C) and 12 (65.0º C).

The tubes were placed at positions 1, 3-10 and 12 and the PCR was run for 25 cycles with an initial denaturation temperature of 95º C for 5 min followed by 10 s denaturation at 95º C, 10 s annealing at 55-65º C (position wise) and 15 s elongation at 72º C for each cycle. Finally, the cycler cooled down at 4º C after the completion of the reaction.

Afterward, gel electrophoresis was performed. The samples were mixed with Orange loading dye (6x) and ran on a 2 % agarose gel containing Midori Green (as described above in gel electrophoresis). The samples were processed at 120 V for 120 minutes and the gel was observed under Gel Doc. Based on signal strength of the PCR product size and number of primer dimers, the optimal temperature was selected and further controlled by an established PCR. This PCR is similar to the gradient PCR, but instead of the temperature gradient, the determined annealing temperature was selected. The pooled cDNA was diluted 1:10 and 1:100. These diluted cDNA, the undiluted cDNA and nuclease-free water which serve as a negative control, were analysed together. Later the PCR product was visualized by Gel Doc and the primers were 40

Materials and Methods considered good for qPCR experiments, if desired PCR product was formed with the diluted cDNAs and no or very fewer primer dimers were formed with little or no cDNA. qPCR:

Quantitative PCR (qPCR) was used to quantify the mRNA levels of the gene of interest in cells or tissues as described (Babendreyer, 2018). The mRNA amount of gene of interest was normalised to the mRNA level of housekeeping genes. In this study glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference gene for human cell lines and ribosomal protein S29 (Rps29) gene was used as the reference gene for murine cell lines and murine primary hepatocytes. The expression analysed for murine tissue data was normalised to the average of the set of two housekeeping genes; Gapdh and Rps29. These reference genes were validated for tissue expression analysis by using the geNorm algorithm as described (Vandesompele et al., 2002). The qPCR reaction mixture was prepared as described below:

Ingredient Amount SYBR premix Ex Taq II 5 µl Nuclease-free water 2.9 µl Forward primer 0.55 µl Reverse primer 0.55 µl Template cDNA 1 µl Total 10 µl All qPCR reactions were run on a LightCycler® 480 System (Roche, Basel, Switzerland). The protocol used is as under:

Temperature Time 95º C 5 min Melting

95º C 10 s curve Primer specific (55-66º C) 10 s

72º C 15 s 45x 95º C 5 min

65º C 1 min 65-97º C (0.11º C/s) ~ 5 min

4º C ͚

Materials and Methods The efficiency of the qPCR was determined by standard curves. The standard curves were determined by making a serial dilution of a defined cDNA standard for each data set. Relation quantification was performed with the E-Method as described (Tellmann, 2006) using LightCycler® 480 software 1.5 (Roche, Basel, Switzerland).

3.2.4 Functional Assays

Wound closure assay (scratch/migration assay):

The wound closure assay was performed as described previously (Pasqualon et al., 2015). In brief, 3-4.5 x 104 cells were seeded near confluence in 96-well plates, pre- coated with collagen G (40 µg/ml) and allowed to settle down and adhere overnight. At confluence, the cells were treated with mitomycin (10 µg/ml) (Medac, Germany) for two h before induction of the scratch to block the proliferation of cells. Subsequently, the cells were washed and a defined scratch (642-767 µm) was performed in all wells simultaneously by using the certified automated 96-wound-maker™ (Essen Biosciences, Hertfordshire, UK). The cells were again washed to remove the detached cells and 100 µl standard medium were added in each well. The closure of the scratched area was observed and analysed using the IncuCyte ZOOM system. For live-cell analysis of scratch-induced wound closure, the images were taken every 2 hours for a period of 24 h. The reduction in the width of the wound was analysed by the IncuCyte ZOOM microscope software 2014A. Data were expressed as a percentage of wound closure after 24 h.

Invasion assay:

The invasion assay was performed following the same procedure as described for wound closure assay (Pasqualon et al., 2015). After the induction of scratch, the medium was removed and 40 µl of basement membrane extract BD Matrigel™ (BD, Bioscience, Franklin lakes, USA) was added directly on to the cells. The invasion of cells into the scratch area through the matrigel was observed by taking images of each well every 2 h for a period of 24 h using the automated IncuCyte ZOOM microscope (Essen Biosciences, Hertfordshire, UK). The reduction in the width of the wound was analysed by the IncuCyte ZOOM microscope software 2014A. Data were expressed as a percentage of wound closure after 24 h.

Materials and Methods Proliferation assay:

Cell proliferation was also monitored using the automated IncuCyte ZOOM microscope (Essen Biosciences, Hertfordshire, UK). The procedure was performed as described previously (Pasqualon et al., 2015). For live-cell analysis, 1 x 104 cells were seeded per well in a 96-well plate, and images were taken every 2 h for the period of 48 h. The analysis of confluence was achieved with the IncuCyte ZOOM microscope software 2014A. Results were expressed as fold increase in confluence after 24 h and 48 h in comparison to 0 h (the starting time point of live cell analysis).

Tube formation assay:

The angiogenic capability of endothelial cells was determined by the tube formation on basement membrane extract (BD Matrigel™, BD Bioscience, Franklin Lakes, USA) as described (Arnaoutova & Kleinman, 2010). 40 µl of BD Matrigel™ was added in the wells of a 96-well plate on ice. After the Matrigel was gelled for 30 minutes at 37º C, endothelial cells at the density of 2 x 104 were added on the matrigel layer. The tube formation was monitored using the IncuCyte ZOOM system (Essen Bioscience, Ann Arbor, USA) by taking images of each well every 30 minutes for 24 h. Images were analysed with the free Angiogenesis Analyser by Gilles Carpentier plug-in for ImageJ. Data were expressed as total segment length after 12 h.

Clonogenic assay:

To evaluate the colony-forming capability of the cells, the colony formation assay was performed as described (Franken et al., 2006). Briefly, the cells were seeded at a density of 1000 cells/well in 6-wells plates. The medium was changed every 2 days. After 15 to 20 days, colonies were fixed with formaldehyde or methanol and stained with 0.1 % crystal violet. The plates were photographed and the number of colonies (consisting of minimum 40-50 cells) per well was counted.

3.2.5 Animal experiments

ADAM8 KO Mice:

ADAM8 knockout mice (Adam8-/- or KO) were provided by Jörg Bartsch (Phillips University of Marburg) (C57BL/6 background). Littermates for ADAM8 knockout mice were of wild type (WT) genotype. Genotypes were determined using standardized

Materials and Methods genotyping methods for each strain (used primers, protocols, and examples for mice are included in the supplements).

All animal experiments were approved by the local authority Landesamt für Natur, Umwelt und Verbraucherschutz (LANUV NRW, 84-02.04.2011.A219, 84- 02.04.2013.A474 and 84-02.04.2011.A335). Animals were housed in the pathogen-free environment in the animal facility of the Medical Faculty of RWTH Aachen University. Animals were transferred to the individual cages for experiments (LPS and control treatment) in the Institute of Pharmacology and Toxicology of RWTH Aachen University.

LPS-induced liver injury:

The LPS-induced liver injury model was used to analyse the effect of knockout of ADAM8 in LPS-induced liver inflammation. The procedure has been previously described by Hamesch et al, (Hamesch et al., 2015). 8-10 week old mice were weighed and injected with LPS (15 µg/100 ml) or 0.9% NaCl as control. After 6 h the mice were euthanized using 500 mg/kg Ketamine and 50 mg/kg Xylazine. The mice were fixed in the supine position and the abdominal cavity was cut open to expose the aorta. 1 ml syringe was used to collect the blood from the aorta and collected in heparin containing tubes. The blood was centrifuged at 3000 x g for 10 minutes to separate serum. The serum was then collected, made aliquot, and stored at -80º C for analysing liver enzymes and cytokine release. The liver was separated from the organs and the gallbladder was removed carefully. Afterward, one of the liver lobes was cut and fixed in paraformaldehyde. After 24-48 h the fixative liver tissues were dehydrated, embedded in paraffin, and cut into 3 µm slices for Hematoxylin-eosin (H & E) staining, performed by the standard protocols by the immunohistochemistry core facility of the IZKF at University Hospital, RWTH Aachen. Images were taken with a Zeiss microscope (AxioLab.A1, Carl Zeiss Micro-Imaging GmbH, Germany). One lobe of the liver was cut and embedded in Tissue-Tek® O.C.T™ Compound (Science Services GmbH, München, Germany) and immediately stored at -80º C for Ki67 staining or Tunnel staining for observation of spontaneous proliferation and apoptosis in the liver tissues. The remaining liver tissue was stored immediately at -80º C for analysis of protein and mRNA.

Materials and Methods 3.3 Statistical analysis

Statistical analysis was performed as described (Babendreyer, 2018). If not mentioned otherwise all data are shown as mean + standard deviation (SD) calculated from at least three independent experiments. Data were analysed by general mixed model analysis (PROC GLIMMIX, SAS 9.4, SAS Institute Inc., Cary, USA) and is derived from either lognormal or negative binomial (count data) distributions. Residual plots and the Shapiro-Wilk test were used as diagnostics. In the case of heteroscedasticity (according to the covtest statement), the degrees of freedom were adjusted by the Kenward-Roger approximation. The necessary data were normalised to the appropriate controls and analysed with PRISM 6.0 (GraphPad Software, La Jolla, USA). The one-sample t-test was used for comparison of normalised data to the respective controls. Differences between the parameters were tested with Student’s t-test or in case of heteroscedasticity with the Mann Whitney U test. Multiple comparisons were corrected by false discovery rate (FDR). A p-value < 0.05 was considered significant.

Results 4 Results

4.1 ADAM8 mediates non-alcoholic fatty liver disease

4.1.1 ADAM8 in NAFLD tissues

The role of ADAM8 in non-alcoholic fatty liver disease has not yet been studied. In a first approach to address this question liver tissue from mice with experimentally induced NAFLD was used and studied for ADAM8 mRNA expression. These mice had been fed with a high-fat diet (HFD) for 7 and 14 weeks and were known to develop the phenotype similar to NAFLD especially after 14 weeks of HFD. The liver tissues of the mice were kindly provided by Dr. Hacer Sahin (Department of Gastroenterology, Medical clinic III, University Hospital, RWTH Aachen). The mRNA expression level of ADAM8 was then analysed by quantitative PCR.

These samples were also analysed for the expression of ADAM10 and 17 along with ADAM8 and the expression of cytokines e.g TNFα and IL-6. The analysis showed that the mRNA expression of ADAM8 was increased in the livers at 14 weeks of HFD compared to the livers of control mice (Figure 8A). Interestingly, the expression of ADAM10 and 17 was found to be significantly decreased at 14 weeks of HFD (Figure 8B-C).

The mRNA expression of TNFα and IL-6 were found to be upregulated which confirms an inflammatory reaction in the livers of mice fed on HFD even after 7 weeks (Figure 9A-B).

Results

Figure 8: High-fat diet induces the expression of ADAMs

A-C: qPCR analysis of relative mRNA expression levels of Adam8 (A), Adam10 (B) and Adam17 (C) in the livers of mice who were fed on a high-fat diet (HFD) for 7 weeks (7w) and 14 weeks (14w) and compared to that of control mice (Ctrl) who were fed on a normal diet. The mRNA expression of Adams was normalised to the average of three housekeeping genes, 18S, β actin and Rps29. Data are shown as mean ± SD. * p< 0.05, ** p<0.01, *** p<0.001 (n=6/group)

Figure 9: High-fat diet induces the expression of pro-inflammatory mediators; TNFα and IL-6

A-B: qPCR analysis of relative mRNA expression of Tnfα (A) and Il-6 (B) in the livers of mice who were fed on a high-fat diet (HFD) for 7 weeks and 14 weeks and compared to that of control mice group (Ctrl) who were fed on normal diet. The mRNA expression was normalised to the average of three housekeeping genes; 18S, β actin and Rps29. Data are shown as mean ± SD. * p< 0.05, ** p<0.01, *** p<0.001 (n=6/group)

Results Thus, among the investigated ADAMs, only expression of ADAM8 was found to be elevated with the increase in expression of inflammatory mediators in the in-vivo model of NAFLD. This finding made ADAM8 an interesting molecule to study its role in the manifestation of liver inflammation.

4.1.2 Expression of ADAM8 in hepatic cell lines

ADAM8 is usually expressed at low levels in tissue cells but at higher levels in immune cells. As the expression of ADAM8 is cell-type dependent, we first analysed the general expression pattern of ADAM8 in different cell types present in the liver.

The messenger RNA expression profile of ADAM8 was determined by quantitative real-time polymerase chain reaction (qPCR) and the protein expression was analysed by western blotting using an antibody against ADAM8. These analyses gave an overview of the relative expression level of ADAM8 in hepatic cell lines from murine and human origin.

Expression of ADAM8 in murine hepatic cell lines:

The murine hepatic cell lines Hepa1-6 (murine hepatoma cells, representing murine hepatocytes), LSEC (immortalized murine liver sinusoidal endothelial cell line) and GRX (immortalized murine hepatic stellate cell line) were used in this study.

Figure 10 shows the quantitative analyses of gene and protein expression of ADAM8 in the mentioned cell lines. The relative mRNA expression (Figure 10A) and the relative protein expression (Figure 10B) of these cells showed that each cell line has a distinct ADAM8 expression. The hepatocytes (Hepa1-6) and LSEC have comparatively high ADAM8 expression while the stellate cells have the lowest level among these cell lines.

Results

Figure 10: mRNA and protein expression of ADAM8 in murine liver cell lines

A: Expression of Adam8 mRNA in three murine liver cell lines; Hepa1-6 (murine hepatoma cells), LSEC (liver sinusoidal endothelial cells) and GRX (liver stellate cells), was measured by qPCR. mRNA expression of Adam8 was normalised to the expression of Rps29. B: Protein expression of ADAM8 in murine liver cell lines. Western blot data are shown as the summary of the densitometric analysis of ADAM8 (left panel) and the representative blot images (right panel). GAPDH was detected in parallel to confirm the equal loading of samples. Data are shown as mean + SD and are representative of 3-4 independent experiments.

Expression of ADAM8 in human hepatic cell lines:

The human hepatic cell lines HepG2 (the human hepatocarcinoma line representing hepatocytes), EA.hy926 (the human umbilical vein endothelial cell line established by fusing primary human umbilical vein cells with a thioguanine-resistant clone of A549 cells) and LX-2 (immortalized human hepatic stellate cells) were used in the present study to represent different cell types present in the human liver.

Figure 11 shows the relative expression levels of ADAM8 mRNA and protein in the above described human cell lines. All cells display a distinct expression of ADAM8 which also differs at gene and protein levels. Among these cells, LX-2 cells expressed the highest level of ADAM8 mRNA, while EA.hy926 and HepG2 cells showed the average expression of ADAM8 mRNA compared to expression in LX-2. On the posttranscriptional level, however, all cell types showed almost identical expression values of the ADAM8 protein.

Results

Figure 11: mRNA and protein expression of ADAM8 in human liver cell lines

A: qPCR analysis of relative mRNA expression of ADAM8 in three human liver cell lines; HepG2, EA.hy926 and LX-2 which was normalised to the expression of GAPDH. B: Western blot analysis of protein expression of ADAM8 in human liver cell lines. The data are shown as the summary of densitometric analysis (left panel) and as the representative blots (right panel). GAPDH was detected in parallel to confirm the equal loading of samples. Data are shown as mean + SD and are representative of 3-4 independent experiments.

Thus, ADAM8 is expressed at a relatively high level in hepatic cells. Although ADAM8 has different expression levels in these cells, these cell lines are good models to study the role of ADAM8 in liver pathology.

4.1.3 Regulation of ADAM8 expression in liver cell lines under NAFLD conditions

To study whether the expression levels of ADAM8 can be regulated under NAFLD in-vitro conditions, hepatocytes (HepG2 and Hepa1-6) were treated with fatty acids (a mixture of oleic acid and linoleic acid) and interleukin 1β (IL-1β) alone or in combination to mimic the fatty liver condition. After 24 h of stimulation, the cells were analysed for the expression of ADAM8. The experiments showed that stimulation with fatty acids-only also induced the expression of ADAM8 at gene level as well as at protein level in hepatocytes. Moreover, the induction became more pronounced when fatty acids were used in combination with IL-1β (Figure 12A-D).

Results

Figure 12: ADAM8 expression is elevated after fatty acid and IL-1β stimulation in hepatoma cell lines

A-B: qPCR analysis of mRNA expression of ADAM8 in Hepa1-6 (A) and HepG2 (B) cells after 24 h stimulation with fatty acid (FA) and IL-1β alone or in combination compared to the control unstimulated (US) group of cells. mRNA expression of ADAM8 was normalised to the expression of Rps29 for Hepa1- 6 cells and to the expression of GAPDH for HepG2 cells. C-D: Western blot analysis of ADAM8 protein expression after 24 h stimulation with FA and IL-1β. The data are shown as densitometric quantification and representative blots for Hepa1-6 cells (C) and HepG2 cells (D). The protein expression was normalised to GAPDH for equal loading. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

Regulation of ADAM8 expression in endothelial cells under inflammatory conditions:

During NAFLD the hepatocytes are damaged and release danger signals (DAMPs) to recruit the immune cells. The immune cells need to cross the endothelial barrier to reach the injured site. Endothelial cells are activated by the cytokines produced by immune cells and in response, they over-express the adhesion molecules and facilitate the transmigration of the cells (Poisson et al., 2016; Shetty et al., 2018). 51

Results Therefore, endothelial cell lines murine LSECs and human EA.hy926 were analysed for the regulation in the expression of ADAM8 under inflammatory conditions. These cells were stimulated with either tumour necrosis factor-alpha (TNFα) or interferon-gamma (INFγ) or with both. After 24 h the cell lysates were investigated for ADAM8 mRNA and protein expression. ADAM8 mRNA expression was significantly induced by either cytokine but the most prominent effect was seen when the cells were treated with both cytokines in combination (Figure 13A-B). The protein expression of ADAM8 was also increased in the same way in both cell lines (Figure 13C-D).

Figure 13: ADAM8 expression is elevated after TNFα and INFγ stimulation in endothelial cell lines

A-B: qPCR analysis of mRNA expression of ADAM8 in LSEC (A) and EA.hy926 (B) cells after stimulation with TNFα and INFγ alone or in combination for 24 h compared to the control group which was unstimulated cells (US). mRNA expression of ADAM8 was normalised to the expression of Rps29 for murine cells and the expression of GAPDH for human cells. C-D: Western blot analysis of protein expression after stimulation with TNFα and INFγ for 24 h. The data are shown as densitometric quantification and representative blots for LSEC cells (C) and EA.hy926 cells (D). The protein

Results expression was normalised to GAPDH for equal loading. Data are shown as mean + SD and are representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

Regulation of ADAM8 expression in activated stellate cells:

Hepatic stellate cells are usually present in an inactive form and become activated when they come into contact with inflammatory factors such as transforming growth factor- beta (TGFβ). After activation, they participate in the process of inflammation and especially in the onset of fibrosis. Stellate cells are considered as the main fibrogenic cells (Tsuchida & Friedman, 2017). In the present study, hepatic stellate cell lines (GRX and LX-2) were incubated with TGFβ for 24 h and examined for the induction of ADAM8 expression. The data indicated that ADAM8 is significantly upregulated in both stellate cell lines on mRNA and protein level (Figure 14A-D).

Figure 14: ADAM8 expression is increased after TGFβ stimulation in hepatic stellate cell lines

A-B: qPCR analysis of mRNA expression of ADAM8 in GRX (A) and LX-2 (B) cells after stimulation with TGFβ compared to the control group which was unstimulated cells (US). mRNA expression of

Results ADAM8 was normalised to the expression of Rps29 for murine cells and the expression of GAPDH for human cells. C-D: Western blot analysis of protein expression of ADAM8 after stimulation with TGFβ. The data are shown as densitometric quantification and representative blots for GRX cells (C) and LX-2 cells (D). The protein expression was normalised to GAPDH for equal loading. Data are shown as mean + SD and are representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

ADAM8 expression in primary hepatocytes:

As a more physiological model primary murine hepatocytes (PMH) were also used to confirm the up-regulation of ADAM8 expression observed for the hepatocyte cell lines under NAFLD conditions. PMH were freshly isolated from mice livers via well- established methods (Severgnini et al., 2012). The PMH lose their tissue-specific functions when cultured for a long period, therefore these cells were cultured for a maximum of 72 h during the present study. After isolation, PMH were seeded in the 6- well plates which were pre-coated with collagen. These hepatocytes were stimulated with fatty acid and IL-1β, and the expression of ADAM8 was investigated. The analysis showed that ADAM8 was expressed at very low levels in un-treated PMH while its gene and protein expression was significantly upregulated upon the combined effect of fatty acid and IL-1β (Figure 15A-B) indicating the similar effects observed for the hepatocyte cell lines.

Figure 15: ADAM8 expression is upregulated after fatty acids and IL-1β stimulation in primary hepatocytes

A: qPCR analysis of mRNA expression of ADAM8 in primary murine hepatocytes (PMH) after stimulation with fatty acid (FA) and IL-1β alone or in combination compared to the control group which was unstimulated cells (US). The expression was normalised the mRNA expression of Rps29. B:

Results Western blot analysis of protein expression of ADAM8 in primary murine hepatocytes (PHM) after stimulation with fatty acid (FA) and IL-1β compared to the control group of cells. The data are shown as densitometric quantification and representative blots for primary hepatocytes. The protein expression was normalised to GAPDH for equal loading. Data are shown as mean + SD and are representative of 3- 4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

4.1.4 Influence of ADAM8 knockdown on liver inflammation by regulating expression and release of cytokines in liver cells

Knockdown of ADAM8:

The up-regulation of ADAM8 in an in-vivo and in-vitro model of NAFLD raised the question of whether ADAM8 probably modulates the process of inflammation during NAFLD. Therefore to investigate the functional role of ADAM8, it was silenced using either siRNA or lentiviral shRNA. The transduction efficiency with pLVTHM lentiviruses expressing shRNA against ADAM8 was analysed by fluorescence microscopy, as these lentiviruses were also encoded for GFP (green fluorescent protein). The silencing of ADAM8 was further confirmed at gene and protein levels via qPCR and Western blot analysis respectively.

For murine cells, three shRNA lentiviral-based constructs were used to knock down the expression of ADAM8. Unfortunatley, none of these constructs worked efficiently (Figure 16A-B).

Figure 16: Knockdown of ADAM8 in Hepa1-6 using pLVTHM lentivirus system

A-B: mRNA (A) and protein expression (B) of ADAM8 in Hepa1-6 cells analysed 72 h after application of pLVTHM lentiviruses containing shRNA against murine ADAM8 (A8_1 and A8_2). The expression was shown for non-treated WT cells and for the cells treated with non-targeting shRNA which also served as a control group (Ctrl). mRNA expression of ADAM8 was normalised to the expression of RPS29. For protein analysis GAPDH was analysed for equal loading and data are shown as representative blot images. Data are shown as mean + SD and representative of 3-4 independent experiments.

Results

The cells were not effectively transduced by the viral vector as it did not penetrate most cells. The constructs were GFP labelled and only a few cells were producing the green GFP signal which might indicate that the the lentiviral vectors may not be the best vectors to transduce these cells. Therefore siRNA constructs were used to transfect the cells. Three different stealth siRNA constructs were obtained from a commercial supplier (Thermofisher) and analysed for silencing of ADAM8. The knockdown was confirmed at the transcriptional level for two constructs after 48-72 h. Moreover, ADAM8 protein levels were also reduced by these two constructs but after almost 96 h of transfection which may be due to the high stability of ADAM8 protein (Figure 17A- B).

Figure 17: Knockdown of ADAM8 in Hepa1-6 using short interfering RNA (siRNA)

Hepa1-6 cells were transfected with three different sequences of stealth siRNA targeting against murine ADAM8 (A8_1, A8_2 and A8_3). The expression was also analysed for non-treated wild type (WT) cells and for the cells treated with negative control stealth siRNA which also served as a control group (Ctrl). A: qPCR analysis of mRNA expression of ADAM8 72 h after transfection with siRNA. mRNA expression of ADAM8 was normalised to the expression of Rps29. B: Western blot analysis of protein expression of ADAM8 in Hepa1-6 cells 96 h after the application of siRNA. The data are shown as densitometric quantification and representative blots. The protein expression was normalised to GAPDH for equal loading. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

After successful downregulation of ADAM8 in hepatocytes murine sinusoidal endothelial cells and stellate cells were also transfected with siRNA to knockdown the

Results expression of ADAM8 as shown in the figure (Figure 18A-D). The knockdown was confirmed via mRNA and protein analyses.

Figure 18: Knockdown of ADAM8 in LSEC and GRX cell lines by using siRNA

LSEC and GRX cells were transfected with two working sequences of stealth siRNA targeting against murine ADAM8 (A8_1 and A8_2). The expression was also analysed for non-treated wild type (WT) cells and for the cells treated with negative control stealth siRNA which also served as a control group (Ctrl). A-B: qPCR analysis of mRNA expression of ADAM8 in LSEC (A) and GRX (B) cells 72 h after transfection. mRNA expression was normalised to the expression of Rps29. C-D: Western blot analysis of protein expression of LSEC (C) and GRX (D) after 96 h of transfection with siRNA. The data are shown as densitometric quantification and representative blots for both types of cells. The protein expression was normalised to GAPDH for equal loading. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

For the human cells, lentiviruses expressing shRNA against human ADAM8 were used to transduce the cells for ADAM8 knockdown. HepG2 cells were transduced first to evaluate the transduction efficiency of the shRNA sequences. Two sequences were used to transduce HepG2 cells and both of them worked successfully for ADAM8 silencing which was confirmed by qPCR and western blot analysis (Figure 19A-B).

Results

Figure 19: Knockdown of ADAM8 in HepG2 cells using pLVTHM lentivirus

HepG2 cells were transduced with pLVTHM lentiviruses of encoding two different sequences of shRNA against human ADAM8 (A8_1 and A8_2). The expression was shown for non-treated wild type (WT) cells as well as for the cells treated with non-targeted shRNA which also served as a control group (Ctrl). A: qPCR analysis of mRNA expression of ADAM8 after 72 h of transduction. mRNA expression of ADAM8 was normalised to the expression of GAPDH. B: Western blot analysis of protein expression of ADAM8 in HepG2 cells after 72 h of transduction. The data are shown as densitometric quantification of signals and representative blots. The protein expression was normalised to GAPDH for equal loading. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

A similar effect of these constructs was seen for the other two human cell lines (EA.hy926 & LX-2) (Figure 20A-D) and both constructs were used to knock down ADAM8.

Results

Figure 20: Knockdown of ADAM8 in EA.hy926 and LX-2 cells using pLVTHM lentivirus

EA.hy926 and LX-2 cells were transduced with pLVTHM lentiviruses of encoding two different sequences of shRNA against human ADAM8 (A8_1 and A8_2). The expression was analysed for non- treated wild type (WT) cells as well as for the cells treated with non-targeted shRNA which also served as a control group (Ctrl). A-B: qPCR analysis of mRNA expression of ADAM8 in EA.hy926 (A) and LX-2 cells (B) 72 h after transduction. mRNA expression of ADAM8 was normalised to the expression of RPS29. C-D: Western blot analysis of protein expression of ADAM8 in EA.hy926 (C) and LX-2 (D) cells after 72 h of transduction. The data are shown as densitometric quantification of signals and representative blots for these cells. The protein expression was normalised to GAPDH for equal loading. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

Effect of ADAM8 knockdown on the production of pro-inflammatory cytokines: mRNA expression of pro-inflammatory cytokines TNFα and IL-6 was measured in stimulated hepatocytes with and without ADAM8 knockdown. Hepa1-6 cells showed increased mRNA expression of TNFα along with the induction of ADAM8 by fatty acid and IL-1β. This response was decreased with the knockdown of ADAM8. The downregulation of TNFα could be seen with both ADAM8 knockdown sequences (Figure 21A). The expression of TNFα in HepG2 cells was increased in stimulated 59

Results control cells compared to unstimulated control cells, whereas in ADAM8 knockdown cells there was a slight but not significant decrease in expression when comparing stimulated and unstimulated cells. (Figure 21B).

The mRNA expression of IL-6 was also increased in Hepa1-6 and HepG2 cells under stimulated conditions which was suppressed by ADAM8 KD in Hepa1-6 cells and HepG2 cells (Figure 21C-D).

Figure 21: Regulation of mRNA expression of TNFα and IL-6 after ADAM8 KD in hepatoma cell lines

Hepa1-6 and HepG2 cells with and without ADAM8 knockdown (Ctrl, A8_1 and A8_2) were stimulated with fatty acid (FA)+IL-1β or left un-stimulated (US). A-B: Subsequently the hepatocyte cell lines; Hepa1-6 (A) and HepG2 (B) were analysed for the mRNA expression of TNFα. C-D: The cell lines were analysed for the mRNA expression of IL-6. The mRNA expression was normalised to Rps29 (for murine cells) or GAPDH (for human cells). Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001. Differences between the control (Ctrl) and ADAM8 KD (A8_1 or A8_2) groups are indicated by hashes # p< 0.05, ## p<0.01, ### p<0.001.

Results Effect of ADAM8 knockdown on the release of cytokines and chemokines:

The previous experiments in the present study indicated that ADAM8 can influence the gene induction of pro-inflammatory mediators. The subsequent protein synthesis and the release of mediators could be regulated by two different mechanisms. On the hand the gene induction could be influenced in response to cell stimulation. On the other hand some inflammatory mediators (such as TNFα, CX3CL1 and CXCL16) are expressed as transmembrane molecules and are shed from the cell surface via the activity of proteases. ADAM8 has been implicated in the shedding of TNFα and CX3CL1 (Naus et al., 2006). Therefore, pro-inflammatory mediator release from stimulated liver cells was studied concerning ADAM8.

The influence of ADAM8 knockdown (KD) on the release of cytokines (such as TNFα, IL-6 and IL-8) and chemokines (CXCL16 and CX3CL1) by hepatoma cell lines was investigated by measuring the amounts of released cytokines with enzymr linked immunosorbent assay (ELISA) in an in-vitro setting of NAFLD. After 24 h of stimulation with fatty acids and IL-1β the supernatants from hepatoma cell lines (Hepa1-6 & HepG2) were collected and analysed. The amount of released TNFα was significantly upregulated as a result of the combined stimulatory effect of fatty acid and IL-1β. The knockdown of ADAM8 reduced the amount of TNFα in the supernatants although the two tested ADAM8 sequences have differential effects (Figure 22A-B).

Release of IL-6 and IL-8 (in HepG2) or KC (in Hepa1-6), which is the murine correlate of IL-8, were found elevated upon fatty acids and IL-1β stimulation. This response was significantly reduced after silencing of ADAM8 in both cell types (Figure 22C-F). Whereas the release of CXCL16 remained unchanged after the treatment with fatty acid or after ADAM8 KD in both cell lines (Figure 22G-H). CX3CL1 was also analysed in supernatants and found elevated after fatty acid and IL-1β treatment to the cells. ADAM8 KD seemed to reduce the release of CX3CL1 in hepatoma cells but the differences were not statistically significant (Figure 22I-J).

Results

Figure 22: Regulation of cytokines and chemokines release by ADAM8 in hepatoma cell lines

Soluble protein concentrations of cytokines and chemokines were determined by ELISA in the supernatants from Hepa1-6 cells and HepG2 cells. Control and ADAM8 KD cells were left untreated or treated with FA and IL-1β. A-B: Protein concentration of TNFα in the supernatants from Hepa1-6 (A) and HepG2 (B) cells. C-D: Protein concentration of IL-6 in the supernatants from Hepa1-6 (C) and HepG2 (D) cells. E-F: Protein concentration of KC in the supernatants from Hepa1-6 (E) and IL-8 in supernatants from HepG2 (F) cells. G-H: Protein concentration of CXCL16 in the supernatants from Hepa1-6 (G) and HepG2 (H) cells. I-J: Protein concentration of CX3CL1 (fractalkine) in the supernatants from Hepa1-6 (I) and HepG2 (J) cells. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001 Differences between the control (Ctrl) and ADAM8 KD (A8_1 or A8_2) are indicated by hashes # p< 0.05. ## p<0.01, ### p<0.001.

The effect of ADAM8 KD on the release of IL-6, IL-8, CXCL16 and CX3CL1 was measured for murine LSEC and human EA.hy926 cell after induction with TNFα and INFγ. Release of IL-6 and IL-8 or KC was increased in stimulated endothelial cells (Figure 23A-D). ADAM8 KD reduced the amount of released IL-6 in both cell types. The elevated amount of KC was also downregulated after ADAM8 silencing in LSEC but there was no effect of ADAM8 KD on the release of IL-8 from EA.hy926 cells. CXCL16 was increased in EA.hy926 cells with no effect of ADAM8 silencing while it remained the same in LSEC either after stimulation or ADAM8 KD (Figure 23E-F). Release of CX3CL1 was increased in both cell types after the treatment with TNFα and INFγ, and ADAM8 silencing reduced the released CX3CL1 (Figure 23G-H)

Results

Figure 23: Regulation of cytokines and chemokines release by ADAM8 in endothelial cell lines

Soluble protein concentrations of cytokines and chemokines were determined by ELISA in the supernatants from LSEC and EA.hy926 cells. Control and ADAM8 KD cells were left untreated or treated with TNFα+INFγ. A-B: Protein concentration of IL-6 in the supernatants from LSEC (A) and

Results EA.hy926 (B) cells. C-D: Protein concentration of KC in the supernatants from LSEC (C) and IL-8 in the supernatants from EA.hy926 (D) cells. E-F: Protein concentration of CXCL16 in the supernatants from LSEC (E) and EA.hy926 (F) cells. G-H: Protein concentration of CX3CL1 in the supernatants from LSEC (G) and EA.hy926 (H) cells. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001 Differences between the control (Ctrl) and ADAM8 KD (A8_1 or A8_2) are indicated by hashes. # p< 0.05. ## p<0.01, ### p<0.001

The hepatic stellate cells (GRX and LX-2) were also analysed for the release of these cytokines after the silencing of ADAM8. The release of TNFα was induced in response to stimulation with TGFβ in both stellate cell types and this response was alleviated after ADAM8 knockdown in both cell types (Figure 24A-B). Similar observations were made for IL-6 release which was increased after induction with TGFβ and decreased after ADAM8 KD compared to the control group (Figure 24C-D). Next, KC was analysed in GRX cells, which was also increased significantly in the supernatants from the TGFβ treated cells. However, in this case, ADAM8 KD could not show any specific effect on KC release (Figure 24E). In contrast to KC, simulation with TGFβ did not provoke the release of IL-8 and ADAM8 KD did not affect its expression (Figure 24F). The release of CXCL16 remained unaffected either by stimulation or after ADAM8 KD in both cell types (Figure 24G-H). CX3CL1 release was upregulated after treatment with TGFβ but ADAM8 silencing caused no pronounced differences (Figure 24I-J).

Results

Figure 24: Regulation of cytokines and chemokines release by ADAM8 in stellate cell lines

Soluble protein concentrations of cytokines and chemokines were determined by ELISA in the supernatants from GRX and LX-2 cells. Control and ADAM8 KD cells were left untreated or treated with TGFβ. A-B: Protein concentration of TNFα in the supernatants from GRX (A) and LX-2 (B) cells. C-D: Protein concentration of TNFα in the supernatants from GRX (C) and LX-2 (D) cells. E-F: Protein concentration of KC in the supernatants from GRX (E) and IL-8 in the supernatants from LX-2 (F) cells. G-H: Protein concentration of CXCL16 in the supernatants from GRX (G) and LX-2 (H) cells. I-J: Protein concentration of CX3CL1 in the supernatants from GRX (I) and LX-2 (J) cells. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001 Differences between the control (Ctrl) and ADAM8 KD (A8_1 or A8_2) are indicated by hashes. # p< 0.05. ## p<0.01, ### p<0.001

ADAM8 KD reduced the expression of pro-fibrotic markers in activated stellate cells:

Stellate cells are the main fibrogenic cells and take part in liver fibrosis by expressing enhanced components of ECM proteins. ADAM8 deficient mice resisted the development of severe fibrosis in a model of acute lung inflammation which was shown by reduced leucocyte recruitment and less collagen deposition (Dreymueller et al., 2017). Therefore, to unravel the relationship between fibrotic markers and expression of ADAM8, stellate cells were investigated for the expression alpha-smooth muscle actin (αSMA) and alpha-1 type-1 collagen (Col1a1). The mRNA analysis of GRX cells revealed that the expression of both components considerably increased when cells were treated with TGFβ. ADAM8 silencing downregulated the mRNA expression of αSma but the mRNA expression of Col1a1 was unaltered after ADAM8 knockdown (Figure 25). These data suggested that ADAM8 may also take part in fibrogenic processes through the induction of αSMA in stellate cells.

Results

Figure 25: Regulation of pro-fibrotic molecules by ADAM8 in stellate cell lines

A-B: qPCR analysis of mRNA expression of αSma (A) and Col1a1 (B) in GRX cells after Adam8 knockdown in GRX cells with or without treating with TGFβ for 24 h. The mRNA expression was normalised to Rps29 mRNA expression. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001 The differences among the control (Ctrl) and Adam8 KD (A8_1 or A8_2) are indicated by hashes. # p< 0.05. ## p<0.01, ### p<0.001

Regulation of cytokines and chemokines in primary murine hepatocytes:

The release of these cytokines and chemokines was also investigated for the primary hepatocytes, after treatment with fatty acids and IL-1β. TNFα, IL-6, IL-8 and CX3CL1 were found upregulated after fatty acids and IL-1β stimulation (Figure 26A- D). The expression of CXCL16 was not affected (Figure 26E). The effect of ADAM8 knockdown could not be investigated for these cytokines and chemokines in primary hepatocytes due to the limitations of cell culture duration and the low efficiency of these cells toward transfection.

Results

Figure 26: Regulation of cytokines and chemokines release from murine primary hepatocytes after stimulating with fatty acid and IL-1β

Protein concentration in the supernatants from primary murine hepatocytes was analysed by ELISA. The cells were either unstimulated (US) or stimulated with fatty acid (FA) and/or IL-1β for 24 h. A-E: Protein concentration of TNFα (A), IL-6 (B), KC (C), CX3CL1 (D) and CXCL16 in the supernatants from primary murine hepatocytes. The cells were either unstimulated or stimulated with FA and IL-1β. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

Results Conditioned medium from endothelial cell lines enhanced ADAM8 expression in hepatoma cell lines:

Liver sinusoidal endothelial cells are the most abundant non-parenchymal cells present in the liver which not only line the sinusoids but are also very important in mediating the immune response during acute and chronic liver injury (Shetty et al., 2018). The previous experiments in the present study showed that ADAM8 expression is upregulated under inflammatory environment in almost all types of liver cells. Endothelial cells were also found correlated to the shedding of certain pro- inflammatory cytokines and chemokines in this study. Therefore, we analysed the effect of conditioned medium from stimulated and unstimulated endothelial cells on hepatocytes. Endothelial cells were either left untreated or treated with TNFα and INFγ for 24 h and then this endothelial cell conditioned medium was used to incubated hepatocytes for further 24 h. The results indicated that the expression of ADAM8 was increased significantly in Hepa1-6 cells and HepG2 cells when treated with conditioned medium from stimulated endothelial cells compared to the treatment of conditioned medium from untreated endothelial cells (Figure 27A-D). This increase in expression of ADAM8 occurred at gene as well as at protein level.

Results

Figure 27: Conditioned medium from endothelial cell lines induces the expression of ADAM8 in hepatoma cell lines

Hepatoma cells were stimulated with the conditioned medium (CM) from the endothelial cells for the period of 24 h and then the hepatocytes were analysed for gene and protein expression of ADAM8. A- B: qPCR analysis of mRNA expression of ADAM8 in Hepa1-6 (A) and HepG2 (B) cells after stimulation with CM from LSEC and EA.hy926 cells respectively. The mRNA expression was normalised to Rps29 for Hepa1-6 cells and to GAPDH for HepG2 cells. C-D: Western blot analysis of protein expression of ADAM8 in Hepa1-6 (C) and HepG2 (D) after stimulation with CM from LSEC and EA.hy926 cells respectively. GAPDH was analysed to control the equal loading of proteins. Data are presented as densitometric quantification of signals and representative blots. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

Altogether these data support the pathogenic role of ADAM8 in mediating non- alcoholic fatty liver disease and release of TNFα and IL-6 in all investigated liver cell types. According to present data, ADAM8 regulates IL-8 only in HepG2 cells, KC in Hepa1-6 and LSEC, and CX3CL1 only in murine and human endothelial cells (LSEC & EA.hy926) which indicated the cell type specificity of ADAM8.

Results 4.2 Role of ADAM8 in LPS-induced liver injury

Lipopolysaccharide (LPS) is a main endotoxin from gram-negative bacteria and it induces the inflammatory response in several organs including the lungs, kidneys and liver. The liver is constantly exposed to the bacterial toxins from the gut and detoxifies the intestinal system . Under certain liver inflammatory conditions such as non- alcoholic fatty liver disease, bacterial growth increases resulting in the release of a high amount of LPS (Kheder et al., 2016). From previous results presented in this study, it is noticed that ADAM8 is regulated in liver cells in-vitro. Therefore, in this part of the present study, the effect of LPS-induction on ADAM8 is analysed in-vitro and in-vivo on liver cells and liver tissues respectively.

4.2.1 Regulation of ADAM8 in different liver injury models

As initial inquiry mice liver tissues from different liver injury models were analysed for their expression of ADAM8 and pro-inflammatory cytokines TNFα and IL-6 to measure the extent of inflammation in each model compared to the control group. The liver samples were obtained from the laboratory of Dr. David Scholten (Department of Gastroenterology, Medical clinic III, University Hospital RWTH Aachen). The liver injury models included LPS-induced liver injury, bile duct ligation (BDL) model and partial hepatectomy (PH) model.

The mRNA was isolated from all liver tissues and investigated by qPCR for the expression of ADAM8, ADAM10, ADAM17, TNFα and IL-6. The results showed that the mRNA expression of ADAM8 is elevated in all models of liver injury tissues compared to the control livers. However, the highest increase in the level of ADAM8 is observed in the LPS-induced liver injury model and the lowest increase is observed for PH-model. A similar trend was observed for the mRNA expression of TNFα and IL-6. In contrast to the up-regulation of ADAM8, the expression of ADAM10 and ADAM17 was not upregulated under these conditions when compared to control (Figure 28). These observations suggested that ADAM8 can effectively be upregulated in vivo by LPS and this up-regulation correlates with the gene induction of other inflammatory mediators such as TNFα and IL-6.

Results

Figure 28: Regulation of ADAM proteases and cytokines in different liver injury murine models

A-E: mRNA was isolated from liver tissues of LPS+GalN, bile duct ligation (BDL), partial hepatectomy (PH) liver injury models and control mice. The mRNA expression of ADAM proteases; ADAM8 (A), ADAM10 (B) and ADAM17 (C) and cytokines; TNFα (D) and IL-6 (E) in these livers as compared to the expression of liver tissues from control mice (WT_Ctrl). The mRNA expression was normalised to the average of two housekeeping genes; Rps29 and Gapdh. Data are shown as mean ± SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001 (n=6/group)

4.2.2 ADAM8 and cytokines are regulated by LPS treatment in liver cells in- vitro

The above observations prompted the study of whether ADAM8 could play a role in LPS-induced liver pathogenesis. Therefore, first in-vitro observations were made in human and murine liver cell lines for the regulation of ADAM8 under LPS stimulation. mRNA and protein analysis was performed after 24 h treatment with LPS before and after ADAM8 knockdown. From the previous experiments of the present study, it was clear that untreated wild type cells and control cells (treated with negative control siRNA in the case of murine cells or with an empty lentiviral vector in human cell lines) showed not much difference in ADAM8 expression. Therefore, only control cells were used for further experiments. From two established ADAM8 knockdown sequences only one was used, as both sequences showed similar expression levels of proteins and genes analysed.

Results The mRNA expression showed a substantial increase in the level of ADAM8 after LPS-treatment in murine and human hepatocyte cell lines Hepa1-6 and HepG2 respectively. In ADAM8 knockdown cells no induction of gene expression through LPS-treatment was possible (Figure 29). Protein expression analysis by western blot also indicated the clear increase in ADAM8 only in the control group and a decreased expression in ADAM8 knockdown cells.

Figure 29: ADAM8 expression is elevated after LPS stimulation in hepatoma cell lines

Control (Ctrl) and ADAM8 KD (A8_1) hepatoma cells were either left untreated (US) or treated with 1µg LPS for 24 h and subsequently analysed for mRNA and protein expression of ADAM8. A-B: qPCR analysis of mRNA expression of ADAM8 in Hepa1-6 (A) and HepG2 (B). The mRNA expression of ADAM8 was normalised to the mRNA expression of Rps29 (for Hepa1-6) and GAPDH (for HepG2). C-D: Western blot analysis of protein expression of ADAM8 in Hepa1-6 (C) and HepG2 (D) cells. The data are shown as densitometric quantification and representative blots for respective cells. The protein expression was normalised to GAPDH for equal loading. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001 Next, the effect of LPS stimulation was analysed on endothelial cells, and these endothelial cell lines; LSEC and EA.hy926, responded strongly toward LPS stimulation and ADAM8 mRNA and protein expression were highly upregulated in the control

Results groups of both cell lines (Figure 30). In ADAM8 KD cells, the induction of ADAM8 expression was not possible with LPS treatment (Figure 30).

Figure 30: LPS strongly induces the expression of ADAM8 in endothelial cell lines

Control (Ctrl) and ADAM8 KD (A8_1) endothelial cell lines were either left untreated (US) or treated with 1µg LPS for 24 h and subsequently analysed for mRNA and protein expression of ADAM8. A-B: qPCR analysis of mRNA expression of ADAM8 in LSEC (A) and EA.hy926 (B) cells. The mRNA expression of ADAM8 was normalised to the mRNA expression of Rps29 (for LSEC) and GAPDH (for EA.hy926). C-D: Western blot analysis of protein expression of ADAM8 in LSEC (C) and EA.hy926 (D) cells. The data are shown as densitometric quantification and representative blots for respective cells. The protein expression was normalised to GAPDH for equal loading. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

Next, freshly isolated primary hepatocytes from the livers of wild type and ADAM8 knockout (KO) mice were treated with LPS and analysed after 24 h for the mRNA and protein expression of ADAM8. ADAM8 was upregulated in hepatocytes from wild type mice at the mRNA level as well as at the protein level but was not

Results detectable in ADAM8 KO hepatocytes whether it was stimulated or untreated which also confirms the KO of ADAM8 (Figure 31).

Figure 31: LPS induces the expression of ADAM8 in primary murine hepatocytes

A-B: Primary murine hepatocytes were isolated from wild type (WT) and ADAM8 KO (A8_KO) mice and cultured under standard conditions. The cells were treated with LPS for 24 h and analysed for the mRNA expression (A) and protein expression (B) of ADAM8. mRNA expression of ADAM8 was normalised to the mRNA expression of Rps29 and for protein analysis, GAPDH was used for equal loading. The data are shown as densitometric quantification and representative blots for respective cells. Data are shown as mean + SD and representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

Next, the mRNA expression of pro-inflammatory TNFα and IL-6 was investigated in all cell lines and primary hepatocytes. The expression of TNFα in the hepatocyte cell lines Hepa1-6 and HepG2 was increased in the control group and also in the ADAM8 KD group after LPS treatment. In ADAM8 KD cells the LPS-induced expression of TNFα seemed to be less compared to that in the control group. However, the difference was not significant. Primary hepatocytes showed an increased expression of TNFα after LPS treatment in wild type groups of cells and this induced expression was decreased in the ADAM8 KO group of cells. Interestingly, the mRNA expression of TNFα in untreated ADAM8 KO cells was also decreased compared to untreated wild type cells. In endothelial cells (EA.hy926 and LSEC), LPS induced the mRNA expression of

Results TNFα in control cells. In ADAM8 KD cells, the LPS induced expression was reduced which was only significant for EA.hy926 cells but not for LSEC (Figure 32).

Figure 32: Effect of ADAM8 silencing on the mRNA expression of TNFα after LPS treatment

A-E: TNFα mRNA expression of Hepa1-6 (A), HepG2 (B), primary hepatocytes (C), LSEC (D) and EA.hy926 (E) after LPS treatment for 24 h was analysed in control and ADAM8 silenced cells by qPCR. The mRNA expression of TNFα was normalised to the mRNA expression of Rps29 (for murine cells) and GAPDH (for human cells). Data are shown as mean + SD and are representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001 Differences between control (Ctrl) and ADAM8 KD (A8_1) or ADAM8 KO (KO) are indicated by hashes # p< 0.05. ## p<0.01, ### p<0.001.

The mRNA expression analysis of IL-6 in hepatocyte cell lines, primary hepatocytes and endothelial cells showed an increase in expression after LPS treatment in the control group of cells (Figure 33). ADAM8 knockdown seems to have a small effect on LPS induced IL-6 increase in the tested cell lines but this effect did not reach significance. These results indicate that ADAM8 knockdown partially reduced hepatocytic and endothelial up-regulation of TNF mRNA expression upon LPS stimulation and had only a minor effect on IL-6 mRNA expression.

Results

Figure 33: Effect of ADAM8 silencing on the mRNA expression of IL-6 after LPS treatment

A-E: IL-6 mRNA expression of Hepa1-6 (A), HepG2 (B), primary hepatocytes (C), LSEC (D) and EA.hy926 (E) after LPS treatment for 24 h were analysed in control and ADAM8 silenced cells by qPCR. The mRNA expression of IL-6 was normalised to the mRNA expression of Rps29 (for murine cells) and GAPDH (for human cells). Data are shown as mean + SD and are representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001 Differences between control (Ctrl) and ADAM8 KD (A8_1) or ADAM8 KO (KO) are indicated by hashes # p< 0.05. ## p<0.01, ### p<0.001.

The release of TNFα and IL-6 through these cells was also measured in the supernatants by ELISA. The released amount of both cytokines increased substantially in the control group of hepatocyte cell lines, primary hepatocytes and endothelial cell lines after LPS stimulation for 24 h. In ADAM8 KD hepatocytes and endothelial cell lines, the amount of released TNFα and IL-6 declined in LPS treated cells compared to LPS treated control cells (Figure 34). Primary hepatocytes also showed an increased amount of these cytokines which was again decreased in ADAM8 KO hepatocytes after LPS treatment (Figure 34C&F).

Results

Figure 34: ADAM8 silencing reduced the induced release of cytokines in hepatoma cell lines and primary hepatocytes

A-C: TNFα protein concentration in supernatants of Hepa1-6 (A), HepG2 (B) and primary hepatocytes (C) after LPS treatment for 24 h was analysed in control and ADAM8 silenced cells by ELISA. D-F: IL- 6 protein concentration in supernatants of Hepa1-6 (D), HepG2 (E) and primary hepatocytes (F) after LPS treatment for 24 h was analysed in control and ADAM8 silenced cells by ELISA. Data are shown as mean + SD and are representative of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001 Differences between control (Ctrl) and ADAM8 KD (A8_1) or ADAM8 KO (KO) are indicated by hashes # p< 0.05. ## p<0.01, ### p<0.001.

4.2.3 ADAM8 knockout does not protect against LPS induced liver inflammation in-vivo

These results suggested that ADAM8 expression and function is associated with LPS- induced liver pathology. To confirm this further in-vivo experiments were performed. Mice with a total KO of ADAM8 were studied for LPS-induced liver inflammation.

Intraperitoneal injection of LPS is an established experimental model of LPS- induced liver inflammation in rodents (Hamesch et al., 2015). LPS binds to LPS- binding proteins and connects to Toll-like receptor 4. This receptor complex activates the NF-κB pathway which leads to the production of several cytokines causing the initiation of an acute inflammatory response (Hamesch et al., 2015). The recommended dose of LPS is 1 – 20 mg/kg body weight. To calculate a suitable dosage of LPS in

Results accordance to produce an acute inflammatory response, a pilot experiment was performed on wtC57BL/6 mice. These mice received an i.p injection of LPS with 20 mg/kg body weight , whereas control mice were injected with an equal volume of 0.9% NaCl. The animals were observed for a 6 h period during which they were normal in their feeding, drinking and social behaviour, and without signs of pain.

Regulation of mRNA expression of ADAMs and cytokines after LPS-treatment:

The mRNA analysis of liver tissue from these LPS-treated mice showed a significant increase in TNFα and IL-6 expression in response to LPS-treatment which demonstrates the presence of an acute inflammatory reaction in the liver (data not shown). For the next experiments, this LPS dose was used because it has successfully produced the inflammatory response in the liver.

Next, the wild type and ADAM8 KO mice were treated by intraperitoneal injection of either LPS or NaCl. The survival rate of animals was 100% and the size of the liver was not affected by any treatment. At first, mRNA analyses were made by qPCR for TNFα, IL-6 (Figure 35) and ADAM8 (also additionally for ADAM10 and 17) (Figure 36). The data showed that mRNA expression of TNFα was upregulated after LPS- treatment in WT mice. Also, the mRNA expression of TNFα was upregulated similarly in ADAM8 KO mice after LPS injection suggesting that ADAM8 KO does not affect the TNF expression level (Figure 35). Interestingly, the expression of TNFα was very low in 0.9% NaCl treated ADAM8 KO mice compared to NaCl treated WT mice. For the induction of IL-6, less clear results were obtained. It could be that the induction was reduced in ADAM8 KO mice compared to the wild type control, however, statistical significance was not reached. As expected, the expression of ADAM8 was induced in wild type controls but completely absent in ADAM8 KO mice.

Results

Figure 35: Expression of TNFα and IL-6 in livers of ADAM8 KO mice after LPS administration

A-B: The animals (control and ADAM8 KO) were given i.p injection of LPS or 0.9% NaCl and sacrificed after 6 h. The liver tissues from control and ADAM8 KO mice were analysed for mRNA expression of Tnfα (A) and Il-6 (B). The mRNA expression of liver tissues was normalised to the mRNA expression of Gapdh. Data are shown as mean ± SD. The number of animals used were: Ctrl-NaCl (n=4), Ctrl-LPS (n=5), A8_KO-NaCl (n=3) and A8_KO-LPS (n=4). The statistical differences between the LPS treated groups and their respective controls are shown by asterisks. * p< 0.05, ** p<0.01, *** p<0.001

ADAM10 and ADAM17 mRNA were also analysed to eliminate the possibility of involvement of these ADAMs in the liver inflammatory response. The expression of ADAM10 and 17 in liver tissue was not altered after LPS injection in both mice genotypes (Figure 36).

Figure 36: Expression of ADAM8, 10 and 17 in livers of mice after LPS administration

A-C: The animals (control and ADAM8 KO) were given i.p injection of LPS or 0.9% NaCl and sacrificed after 6 h. The liver tissues from control and ADAM8 KO mice were analysed for mRNA expression of Adam8 (A), Adam10 (B) and Adam17 (C). The mRNA expression of liver tissues was normalised to the mRNA expression of Gapdh. Data are shown as mean ± SD. The number of animals in each group was: Ctrl-NaCl (n=4), Ctrl-LPS (n=5), A8_KO-NaCl (n=3) and A8_KO-LPS (n=3). The statistical differences between the LPS treated groups and their respective controls are shown by asterisks. * p< 0.05, ** p<0.01, *** p<0.001

Results Serum levels of cytokines and liver enzymes are not effected by ADAM8 KO after LPS treatment: The serum was analysed for released TNFα and IL-6. The results indicated some induction of TNFα in wild type mice but not in ADAM8 KO mice. Neither the expected induction of TNFα in wild type mice nor the possible reduction in ADAM8 knockout mice could reach significance. For IL-6 induction no difference could be observed in both groups of mice either treated with LPS or not (Figure 37).

Figure 37: ADAM8 silencing does not affect the release of TNFα and IL-6 in mice serum after LPS administration

A-B: The animals (control and ADAM8 KO) were given i.p injection of LPS or 0.9% NaCl and sacrificed after 6 h. The serum from control and ADAM8 KO mice were analysed for a protein concentration of TNFα (A) and IL-6 (B) by ELISA. Data are shown as mean ± SD. The number of animals in each group was: Ctrl-NaCl (n=3), Ctrl-LPS (n=3), A8_KO-NaCl (n=3) and A8_KO-LPS (n=3).

The liver enzymes alanine transaminase (ALT) and aspartate transaminase (AST) were analysed in serum for any change after LPS injection . The analyses showed that ALT and AST were elevated in both the WT and ADAM8 KO groups of the animals after LPS injection. Due to the wide variation in results, no statistically significant differences in liver enzyme levels were observed in WT and ADAM8 KO mice. Nevertheless, it appeared that both enzyme activities are not increased in ADAM8 Knockout mice (Figure 38).

Results

Figure 38: Amount of liver enzymes in serum of control and ADAM8 KO mice after LPS administration

A-B: The animals (control and ADAM8 KO) were given i.p injection of LPS or 0.9% NaCl and sacrificed after 6 h. The serum from control and ADAM8 KO mice were analysed for liver enzymes alanine transaminase ALT (A) and aspartate transaminase AST (B). Data are shown as mean ± SD. The number of animals in each group was: Ctrl-NaCl (n=2), Ctrl-LPS (n=5), A8_KO-NaCl (n=3) and A8_KO-LPS (n=3).

Immunohistology of liver tissues after LPS treatment showed no signs of injury after LPS treatment:

The immunohistochemistry of liver tissues showed no differences in any group of animals whether treated with LPS or not. No obvious signs of liver injury appeared after haematoxylin and eosin staining (Figure 39A). Haematoxylin and eosin (H & E) staining is most commonly used to detect tissue injury but here, LPS treatment could not produce any damage to liver tissue either in the control group of animals or in the ADAM8 KO group.

In summary, it can be concluded that the absence of ADAM8 reduces the inflammatory response in isolated liver cells, but the in-vivo LPS model in the present study was not able to induce inflammation. For this reason, the role of ADAM8 in the inflammatory response could not be observed.

Results

Figure 39A: Hematoxylin and eosin staining of liver sections of control and ADAM8 KO mice after LPS administration

The animals (control and ADAM8 KO) were given i.p injection of LPS or 0.9% NaCl and sacrificed after 6 h. The liver tissues were fixed in paraformaldehyde (PFA) and embedded in paraffin. Afterward, the liver sections were cut and staining was performed with commercially available H & E staining kit. The representative images are shown from each group of animals. No change in colour is visible for treated and untreated ctrl and A8_KO groups. The scale bar indicates 100µm.

Regardless of the treatment, some dark stained nuclei were observed in the liver tissue of these mice. These dark stained nuclei appeared to be condensed chromosomal material preparing to divide (Figure 39B). It was speculated that these were proliferating cells and that the number of these proliferating bodies was increased in ADAM8 KO livers.

Results

Figure 39B: Hematoxylin and eosin staining of liver sections of control and ADAM8 KO mice after LPS administration

The animals (control and ADAM8 KO) were given i.p injection of LPS or 0.9% NaCl and sacrificed after 6 h. The liver tissues were fixed in paraformaldehyde and embedded in paraffin. Afterward, the liver sections were cut and staining was performed with a commercially available H & E staining kit. The representative images are shown from each group of animals. Arrows are pointing toward the darkly stained nuclei which appeared to be the condensed chromatin material. The scale bar indicates 100µm.

To further confirm that these were proliferating cells, the tissues were stained with Ki67 which is a proliferation marker. Similar observations were made, namely that ADAM8 KO liver tissue showed slightly more proliferating bodies compared to liver tissues of WT mice (Figure 40). In general, the ADAM8 KO mice are healthy and phenotypically similar to the healthy mice, but after the above made observations in the liver of ADAM8 KO mice, it can be speculated that ADAM8 might play some role in the physiology of the liver in healthy state too.

Results

Figure 40: Ki67-stainings of liver sections of NaCl control and ADAM8 KO mice

The animals (control and ADAM8 KO) were given an i.p injection of 0.9% NaCl and sacrificed after 6 h. The liver tissues were fixed Tissue-Tek® O.C.T.™ and afterward, the liver sections were made by cutting the tissue, and staining was performed with a commercially available Ki67-staining kit. The representative images are shown from each group of animals. Arrows are pointing toward the red-stained nuclei that are the proliferating cells. The scale bar indicates 100µm. The staining was performed by Daniela Lambertz (Technical assistant at the Department of Gastroenterology, Medical clinic III, University Hospital, RWTH Aachen).

4.3 Role of ADAM8 in HCC metastasis

Accumulating evidence indicates that ADAM8 is highly upregulated in several tumours including lung cancer, kidney cancer, colorectal cancer and pancreatic cancer, and is associated with the tumour invasiveness and poor prognosis. ADAM8 plays a dynamic role in tumorigenesis and cancer metastasis by enhancing cell migration capability (Conrad et al., 2018; Romagnoli et al., 2014; Uwe Schlomann et al., 2015). In the present study, the contribution of ADAM8 to tumour progression and metastasis of hepatocellular carcinoma (HCC) was investigated in murine (Hepa1-6) and human (HepG2) hepatoma cells by analysing various cell functions e.g cell proliferation, cell migration, cell invasion and apoptosis. The angiogenic capability of endothelial cells was also investigated in murine liver endothelial cells (LSEC) and human endothelial cells (EA.hy926) by analysing cell proliferation, cell migration and tube formation ability of these cells.

Results 4.3.1 ADAM8 is overexpressed in HCC tissues and hepatoma cell lines

In a previously published study by our collaboration partner Dr. Christian Liedtke (Clinic for Gastroenterology, Metabolic Disorders and Internal Intensive Medicine (Medical Clinic III) University Hospital RWTH Aachen), the gene array data have shown that ADAM8 is upregulated in murine pre-cancerous cells (approximately 14 fold increase) and malignant hepatoma cells (approximately 52 fold increase) when compared to the basal expression in primary murine hepatocytes of the same genetic background (Sonntag et al., 2018).

In the present study relative mRNA expression of ADAM8 was analysed by qPCR in the liver tissues from the mice who developed the chemical-induced HCC. These liver tissue samples were kindly provided by Prof. Dr. Christian Liedtke from the Clinic for Gastroenterology, Metabolic Disorders and Internal Intensive Medicine (Medical Clinic III), University Hospital RWTH Aachen, Germany. The analysis showed that the mean expression of ADAM8 was approximately 5.6 fold higher in HCC liver tissues when compared to the healthy liver tissues (Figure 41A). In contrast, ADAM10 and ADAM17 were only over-expressed by approximately 2 fold and 1.4 fold, respectively in the same HCC tissues (Figure 41B-C).

Figure 41: Expression of ADAM proteases in HCC tissue

A-C: qPCR analysis of mRNA expression of ADAM8 (A), ADAM10 (B) and ADAM17 (C) in murine hepatocellular carcinoma tissues and control liver tissues. The mRNA expression of ADAMs was normalised to the average of two housekeeping genes RPS29 and GAPDH. Data are presented as mean ± SD. * p< 0.05, ** p<0.01, *** p<0.001 (Control n=3 and HCC n=7)

In line with these findings, mRNA expression analysis of hepatoma cell line Hepa1-6 cells showed higher expression of ADAM8 compared to primary murine

Results hepatocytes. The protein expression analysis also confirmed that ADAM8 protein was expressed at higher levels in cell lysates of hepatoma cell lines Hepa1-6 and HepG2 cells when compared to the healthy primary murine hepatocytes (Figure 42).

Figure 42: Comparison of expression of ADAM8 in hepatoma cell lines and primary hepatocytes

A: qPCR analysis of the basal mRNA expression of ADAM8 in murine cells; hepatoma cells Hepa1-6 and primary murine hepatocytes (PMH). The mRNA expression was normalised to the expression of RPS29. B: Western blot analysis of protein expression of ADAM8 in untreated cells; primary murine hepatocytes (PMH) and hepatoma cell lines; Hepa1-6 & HepG2. The expression was normalised to GAPDH protein expression. The data are shown as a summary of densitometric analysis and representative blot images. The Data are shown as means + SD of quantitated data from 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

4.3.2 ADAM8 expression is positively associated with PCNA expression and hepatoma cell proliferation and clonogenicity

To explore the functional role of ADAM8 in control of HCC homeostasis, two different approaches were applied i.e gene knockdown and overexpression of ADAM8 in hepatoma cells. ADAM8 knockdown was performed as described before (Figure 17 & 19). To over-express ADAM8 in hepatoma cells, hADAM8 cDNA was cloned in the mammalian expression vector pMOWs which encodes resistance against the antibiotic Zeocin. The cells were transfected and selected with the antibiotic Zeocin. A vector coding for GFP instead of ADAM8 was used as control. The overexpression of hADAM8 was confirmed in HepG2 cells at the mRNA level and also at the protein level through analysing the cell lysate (Figure 43C&E). Human ADAM8 was also successfully over-expressed in murine Hepa1-6 cells, which was confirmed through the

Results mRNA analysis (Figure 43A). The mRNA examination with species-specific primers for ADAM8 confirmed that endogenous expression of murine ADAM8 in Hepa1-6 cells was not altered (Figure 43B). The overexpression of ADAM8 was also established by protein expression analysis in Hepa1-6 and HepG2 cells respectively (Figure 43D- E).

***

Figure 43: hADAM8 over-expression in Hepa1-6 and HepG2 cells using pMOWs expression vector

Hepa1-6 and HepG2 cells were left untreated (WT), transfected with retroviral control (Ctrl) and hADAM8 overexpression vectors (ADAM8). A-C: After 15 d selection, the cells were analysed by qPCR using primers for human (A) and murine (B) ADAM8 for Hepa1-6 and primers for human ADAM8 in HepG2 cells (C). Results are shown as relative mRNA expression normalised to the respective reference genes. D-E: These cells were also analysed by Western blotting for ADAM8 overexpression in Hepa1- 6 (D) and in HepG2 cells (E) and representative Western blots with a summary of densitometric analysis were shown. Results are shown as means + SD of quantitated data from 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

Afterward, cells with ADAM8 knockdown and ADAM8 overexpression were further investigated for tumour related cell functions. These functional assays include cell proliferation, cell migration, cell invasion and apoptosis analysis. Proliferation assay was performed by microscopic live-cell analysis to explore the effect of ADAM8 alteration on the cells. To this end, ADAM8 knockdown showed that ADAM8 knockdown significantly reduced the proliferation rate which was confirmed in both 89

Results types of hepatoma cells (Figure 44). Vice versa, a prominent increase in the cell confluence upon ADAM8 overexpression was observed in both types of hepatoma cells (Figure 45).

Figure 44: ADAM8 knockdown reduces the proliferation in hepatoma cell lines

A-D: Hepa1-6 and HepG2 cells were seeded at 10,000 cells/well in a 96-well plate after respective ADAM8 KD and analysed for cell proliferation by real-time microscopy and automated confluence analysis over 24 h. The results are shown as representative images (left) and quantified as % confluence (right) for Hepa1-6 (A-B) and HepG2 cells (C-D). Results are shown as means + SD of quantitated data from 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001. Scale bars indicate 300 μm.

Results

Figure 45: ADAM8 overexpression induces the proliferation in hepatoma cell lines

A-D: Hepa1-6 and HepG2 cells were seeded at 10,000 cells/well in a 96-well plate after ADAM8 overexpression and analysed for cell proliferation by real-time microscopy and automated confluence analysis over 24 h. The results are shown as representative images (left) and quantified as % confluence (right) for Hepa1-6 (A-B) and HepG2 cells (C-D). Results are shown as means + SD of quantitated data from 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001. Scale bars indicate 300 μm.

Another approach to investigate the proliferation capacity of cells is the clonogenic assay where single cells are allowed to develop a colony over time. The results of the clonogenic assay or the colony formation assay revealed a significant decrease in the number of colonies as well as a decrease in cell density when ADAM8 expression was silenced in HepG2 cells (Figure 46A-B). Conversely, the number of colonies was significantly increased in both types of hepatoma cells when ADAM8 is over-expressed (Figure 46C-D). These results indicate that ADAM8 promotes the proliferation of hepatoma cells.

Results

Figure 46:ADAM8 expression is associated with cell growth in hepatoma cell lines

A-B: Hepa1-6 cells were seeded at a density of 1000 cells/well in a 6-well plate after knockdown of ADAM8 (A8_1 & A8_2) and treatment with negative control siRNA (Ctrl) and the individual cell was allowed to form a single colony. The colonies were photographed and counted after 15-20 days after seeding the cells. Only those colonies were counted which contain more than 50 cells. The results are shown as representative images (A) and quantified as the number of colonies per well (B). C-D: Colony formation was also observed for the Hepa1-6 and HepG2 cells after transfecting the cells with negative control (Ctrl) and ADAM8 overexpression (ADAM8) vectors. The results are shown as representative images (C) and quantified as the number of colonies per well (D). Results are shown as representative experiments and as means + SD of quantitated data from 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

The proliferation defects in hepatoma cells upon ADAM8 knockdown or overexpression may be caused by changes in proliferating cell nuclear antigen (PCNA), which facilitates and controls DNA replication and is a well-known marker of proliferation in cancer cells (Bologna-Molina et al., 2013; Yin et al., 2017; Zhao et al., 2012). At first, the PCNA mRNA expression was analysed by qPCR which showed no change in gene expression of PCNA by both types of hepatoma cells after ADAM8 knockdown, (Figure 47A-B). This result was in good agreement with the previous reports showing that PCNA is regulated by post-translational events (Mailand et al., 2013). The protein expression of PCNA was then analysed by western blot which indicated that the abundance of PCNA protein in both hepatoma cell lines was noticeably reduced in ADAM8 knockdown cells compared to the respective controls 92

Results (Figure 47C-D). Vice versa, with overexpression of ADAM8 a significant increase was visible in the protein expression of PCNA presented in Hepa1-6 and HepG2 cells (Figure 47E-F). The positive correlation of ADAM8 with the cell proliferation marker PCNA indicated that ADAM8 has a strong association with cell proliferation in HCC.

Results

Figure 47: ADAM8 expression is correlated with PCNA protein expression in hepatoma cell lines

The expression of PCNA was analysed in Hepa1-6 and HepG2 cells after ADAM8 KD and overexpression. A-B: qPCR analysis of mRNA expression of PCNA in Hepa1-6 (A) and HepG2 cells (B) which were; untreated cells (WT), cells treated with negative control (Ctrl) or cells with ADAM8 KD (A8_1 & A8_2). The mRNA expression was normalised to RPS29 (for Hepa1-6 cells) and GAPDH (for HepG2 cells). C-D: Western blot analysis of protein expression of PCNA was analysed by Western blot in Hepa1-6 cells (C) and HepG2 cells (D) which were; untreated cells (WT), cells treated with negative control (Ctrl) or cells with ADAM8 KD (A8_1 & A8_2). Protein data were normalised to GAPDH for equal loading. Representative blots are shown. E-F: Western blot analysis of protein expression of PCNA in Hepa1-6 cells (E) and HepG2 cells (F) after retroviral ADAM8 overexpression (ADAM8) and compared with respective controls (untreated cells WT and cells receiving the negative control Ctrl). Protein data were normalised to GAPDH for equal loading. Representative blots are shown. Data are shown as means + SD of quantitated data from 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

4.3.3 ADAM8 expression negatively correlates with caspase 3/7 activity in hepatoma cell lines

Alteration in cancer cell proliferation may be accompanied by the changes in cell apoptosis. In the present study, apoptosis was analysed by real-time quantification of cells for changes in caspase 3/7 activity using a specific substrate that becomes green- fluorescent upon cleavage. ADAM8 silenced Hepa1-6 cells led to a substantial elevation of caspase 3/7 positive cells (Figure 48A) indicating that these cells have an increased sensitivity to undergo apoptosis.

Results

Figure 48: ADAM8 expression is negatively correlated with caspase 3/7 mediated apoptosis of hepatoma cell lines

Apoptosis analysis of cultured hepatoma cell lines was studied by real-time microscopy using a fluorogenic caspase 3/7 reagent for 96 h. ADAM8 was silenced or overexpressed in the cells. A: Hepa1- 6 cells were left untreated (WT), treated with siRNA for knockdown of ADAM8 (A8_1) or received non- targeting control siRNA (Ctrl). Subsequently, the average number of caspase 3/7 positive cells per microscopic image was determined. B-C: Hepa1-6 (B) and HepG2 cells (C) were transfected with vector for overexpression of ADAM8 (ADAM8) or with a control vector (Ctrl) and then analysed for caspase 3/7 positive cells. Data are shown as mean + SD from 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

Furthermore, apoptosis was also measured for Hepa1-6 and HepG2 cells overexpressing ADAM8. ADAM8 overexpression in both types of cells exhibited a considerable reduction in caspase 3/7 positive cells compared to the respective controls (Figure 48B-C) demonstrating that there are fewer apoptotic cells.

In this study, the previously described in-vivo experiments for LPS-induced liver injury revealed that there were more proliferative bodies present in the liver tissues of the ADAM8 KO mice. Therefore, and under the light of the observed apoptosis in the in vitro experiment, it was thought that ADAM8 might influence the basal in-vivo apoptosis in the liver. For this purpose, Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was performed and the number of apoptotic cells was counted in WT and ADAM8 KO liver sections (Figure 49A). The results showed a slightly higher number of apoptotic cells in the ADAM8 KO liver sections but the difference was not significant (Figure 49B).

Results

Figure 49: ADAM8 KO does not show enhanced apoptosis in liver tissues

A: Liver tissues were obtained from the wildtype control (Ctrl) and ADAM8 KO (KO) mice after NaCl administration and fixed in Tissuetek®. After preparing the liver sections, TUNNEL staining was performed by using commercially available reagents. Representative microscopic images for Tunnel, Dapi, and merge staining are shown for Ctrl and ADAM KO livers here (A). White arrows indicate the Tunnel stained cells (apoptotic cells) and yellow arrows indicate the non-specific staining. B: Tunnel positive cells and total nuclei per image were counted manually and represented by a graph (B). The data are shown as mean ± SD. The number of animals used was: Ctrl (n=4) and ADAM8 KO (n=3). Scale bars indicate 100 μm. The staining was performed by Daniela Lambertz (Technical assistant at the Department of Gastroenterology, Metabolic Disorders and Internal Medicine, Medical clinic III, University Hospital RWTH Aachen). The analysis of the data was done by myself.

4.3.4 ADAM8 expression positively links with cellular migration and invasion of hepatoma cells

Cell migration and cell invasion through ECM are the hallmarks of the cancer metastasis and formation of secondary tumours. Therefore, the potential biological roles of ADAM8 for HCC progression and metastasis were explored by investigating hepatoma cell migration and invasion after ADAM8 knockdown and overexpression. A wound-healing assay was performed by microscopic live cell analysis. A defined

Results scratch was made through a confluent layer of cells and migration of cells into the scratch area was calculated as percent wound closure. Before induction of a scratch, the cells were treated with mitomycin for 2 h to prevent cell proliferation to ensure that the cells present in the scratch area were migrating and not the proliferating cells (Figure 50). ADAM8 knockdown cells showed reduced migration compared to the respective controls in both types of hepatoma cells; Hepa1-6 and HepG2 (Figure 50A-D). On the other hand, ADAM8 overexpression increased the migration rate of these cells (Figure 51A-D).

Figure 50: ADAM8 silencing reduces cell migration in hepatoma cell lines

The migration of hepatoma cells was investigated by real-time microscopy for a period of 20 h. A-D: Confluent layers of Hepa1-6 cells and HepG2 cells with knockdown of ADAM8 (A8_1 & A8_2 are two sequences of shRNA or siRNA respectively) and control cells (Ctrl) that received non-targeting sequences, were wounded by a defined scratch and wound closure was determined. Results are shown as representative images of cell layers directly after (top panel) or 20h after (bottom panel) application of the scratch and quantified as percent wound closure (C-D). Scale bars are indicating 300 μm. The data is represented as the mean + SD of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

Results

Figure 51: ADAM8 overexpression enhanced cell migration in hepatoma cell lines

The migration of hepatoma cells was investigated by real-time microscopy for a period of 20 h. A-D: Confluent layers of Hepa1-6 cells and HepG2 cells with overexpression of ADAM8 (ADAM8) and control cells (Ctrl) that received non-targeting sequences. Cells were wounded by a defined scratch and wound closure was determined. Results are shown as representative images of cell layers directly after (top panel) or 20h after (bottom panel) application of the scratch and quantified as percent wound closure (C-D). Scale bars are indicating 300 μm. The data is represented as mean + SD of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

To measure the invasion capacity of the cells, the scratch wound was covered with the matrigel which was used to mimic ECM. The number of cells that migrated through the matrigel was determined and data were calculated as the percentage of wound closure. The experiments revealed a significant reduction of invasion capacity in ADAM8 knockdown cells compared to the controls in both cell lines (Figure 52). Conversely, ADAM8 overexpression led to the increased invasion of the cells in both types of cell lines (Figure 53).

Results

Figure 52: ADAM8 silencing reduces cell invasion through ECM in hepatoma cells

The invasion of hepatoma cells was investigated by real-time microscopy for a period of 20 h. A-D: Confluent layers of Hepa1-6 cells (A) and HepG2 cells (B) with knockdown of ADAM8 (A8_1 &A8_2 are the two sequences of shRNA or siRNA used for ADAM8 KD) and control cells (Ctrl) that received non-targeting sequences cells were wounded by a defined scratch. Matrigel was poured onto the scratch and wound closure was determined over time. Results are shown as representative images of cell layers directly after (top panel) or 20h after (bottom panel) application of the scratch and quantified as percent wound closure (C-D). Scale bars are indicating 300 μm. The data is represented as mean + SD of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

Results

Figure 53: ADAM8 overexpression enhances cell invasion through ECM in hepatoma cells

The invasion of hepatoma cells was investigated by real-time microscopy for a period of 24 h. A-D: Confluent layers of Hepa1-6 cells (A) and HepG2 cells (B) with overexpression of ADAM8 (ADAM8) and control cells (Ctrl) that received non-targeting sequences cells were wounded by a defined scratch. Matrigel was poured onto the scratch and wound closure was determined. Results are shown as representative images of cell layers directly after (top panel) or 20h after (bottom panel) application of the scratch and quantified as percent wound closure (C-D). Scale bars are indicating 300 μm. The data is represented as mean + SD of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

4.3.5 ADAM8 controls cell proliferation, migration, and angiogenic properties of endothelial cells

The metastatic spread of tumour cells needs an adequate supply of oxygen and nutrients which is supplied by the development of new blood vessels into the metastatic tissue, as tumours cannot grow in the absence of blood supply (Nishida et al., 2006). The formation of tnew blood vessels is known as angiogenesis. Angiogenesis is equally important for cancer cell growth and metastasis. For angiogenesis, endothelial cell

100

Results proliferation and migration are important steps. In the present study, the proliferation, migration, and tube formation capability of endothelial cells were analysed in association with ADAM8 KD.

At first, the murine sinusoidal endothelial cells (LSEC) and modified human umbilical vein endothelial cells (EA.hy926) were analysed for cell proliferation after ADAM8 KD. Proliferation was analysed by microscopic live cell analysis which indicated reduced cell confluence in ADAM8 KD cells compared to the control cells after 24 h in both cell lines (Figure 54A-D).

Figure 54: ADAM8 knockdown reduces the proliferation in endothelial cells

A-D: LSEC and EA.hy926 cells were seeded at 10,000 cells per well in a 96-well plate after respective ADAM8 KD and analysed for cell proliferation by real-time microscopy and automated confluence analysis over 24 h. The results are shown as representative images (left) and quantified as % confluence (right) for LSEC (A-B) and EA.hy926 cells (C-D). Results are shown as means + SD of quantitated data from 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001. Scale bars indicate 300 μm.

Next cell migration was observed. Mitomycin was used to prevent cell proliferation-. The observations were the same as for the hepatoma cells; ADAM8 KD reduced the migration of cells into the wound area. The results were obtained from both

101

Results endothelial cell lines, LSEC and EA.hy926 and both sequences for ADAM8 silencing gave a similar reduction in cell migration in both cell lines (Figure 55).

Figure 55: ADAM8 silencing reduces cell migration in endothelial cell lines

The migration of hepatoma cells was investigated by real-time microscopy for a period of 20 h. A-D: Confluent layers of LSEC cells and EA.hy926 cells with knockdown of ADAM8 (A8_1 & A8_2 are two sequences of shRNA or siRNA) and control cells (Ctrl) that received non-targeting sequences cells were wounded by a defined scratch and wound closure was determined. Results are shown as representative images of cell layers directly after (top panel) or 20h after (bottom panel) application of the scratch and quantified as percent wound closure (C-D). Scale bars are indicating 300 μm. The data is represented as mean + SD of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

Angiogenesis can be measured by the tube formation assay, where endothelial cells are allowed to grow on matrigel and can observed for the formation of tubes or vessels. It was observed that the tubes formed by endothelial cells after ADAM8 knockdown were either non-continuous or less in numbers compared to the control cells (Figure 56). Observations were made in both types of cell lines. The results revealed the importance of ADAM8 in the process of angiogenesis.

102

Results

Figure: 56 ADAM8 knockdown reduces the tube formation capability of endothelial cell lines

A-D: Endothelial cells LSEC (A) and EA.hy926 (C) were seeded in 96-well plate pre-filled with gelled BD Matrigel™ after ADAM8 knockdown (A8_1 & A8_2 were two sequences used for ADAM8 KD for siRNA or shRNA). Tube formation was monitored by an automated IncuCyte Zoom microscope. Images were taken every 30 min for 24 h. Images were analysed by free Angiogenesis Analyser software for ImageJ. The images (A&C) and measurements (B&D) are shown for 12 h time point before the cells undergo apoptosis. Data were analysed as total segment length. Scale bars are indicating 300 μm. The data is represented as mean + SD of 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

4.3.6 ADAM8 expression is linked to increased β1 integrin expression and focal adhesion kinase activation

ADAM8 interacts with β1 integrin and this interaction leads to cell migration which is reported in various cancers (Romagnoli et al., 2014; Schlomann et al., 2015), osteoclast formation (Rao et al., 2006), and also in trophoblast migration (Le et al., 2018). Focal adhesion kinase is described as an interaction partner of β1 integrin activating various downstream and upstream mechanisms which lead to cell proliferation and cell migration (Figure 3). It was questioned whether ADAM8 would be associated with β1 integrin and/or FAK activation in hepatoma cells. To investigate the mechanistic relationship between ADAM8 and β1 integrin in hepatoma cells, the expression of β1 integrin and other downstream signalling events in the form of protein expression were therefore measured. The experiments revealed that the basal protein expression level of β1 integrin in Hepa1-6 and HepG2 cells was markedly reduced with ADAM8

103

Results knockdown (Figure 57A-B).On the other hand the protein expression increased with ADAM8 overexpression in both hepatoma cell lines, demonstrating a positive link between ADAM8 and β1 integrin (Figure 57C-D).

Next, the association of ADAM8 and focal adhesion kinase (FAK) was investigated since FAK is a major intracellular signalling mediator of integrins (Guan, 2010). Therefore it was speculated that FAK would also be an effector of ADAM8. FAK has many tyrosine activation sites; Y397, Y576/577 and Y925. All these tyrosine phosphorylation sites cause cell mobility and adhesion when activated (Calalb et al., 1995; Owen et al., 1999). To analyse the activation of FAK with ADAM8, the phosphorylation of the above-mentioned tyrosine sites were investigated. The results revealed that ADAM8 knockdown reduced the phosphorylation of FAK protein at Y397 and Y925 in both hepatoma cell lines (Figure 57A-B). On the other hand, ADAM8 overexpression significantly increased the phosphorylation of FAK at Y397 but no effect was observed on the phosphorylation of FAK at Y925. The observations were made in both hepatoma cell lines (Hepa1-6 and HepG2) and similar results were detected (Figure 57C-D). Taken together, these results illustrate that ADAM8 supports β1 integrin expression and that this corresponds to the different FAK activation pathways.

104

Results

105

Results

Figure 57: ADAM8 expression in hepatoma cells is positively associated with the expression of β1 integrin and activation of focal adhesion kinase

A-B: Hepa1-6 (A) and HepG2 (B) cells were left untreated (WT), treated for knockdown of ADAM8 (A8_1 & A8_2 two sequences of shRNA or siRNA) or received non-targeting control sequences (Ctrl). Subsequently, cells were studied for expression of β1 integrin, GAPDH, phosphorylated focal adhesion kinase at tyrosine 397 or tyrosine 925, total FAK and ADAM8 by western blotting. C-D: Hepa1-6 (C) and HepG2 cells (D) were left untreated (WT) or transfected with vector for overexpression of ADAM8 (ADAM8) or with control vector (Ctrl) and then analysed by Western blotting as described above. Western blots were analysed by densitometry. Integrin expression was expressed with that of GAPDH and expression of phosphorylated FAK forms with that of total FAK. Data are shown as representative Western blots and as mean + SD of quantified data from 3-4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001.

The protein expression analyses of β1 integrin and FAK in ADAM8 KD cells were performed by an internship student Minha Naveed who had been supervised within this Ph.D. thesis. The analyses of the data were performed by myself.

4.3.7 ADAM8 is associated with activation of MAPK, Src kinase and Rho A

After establishing the fact that ADAM8 has a positive correlation with the β1 integrin/FAK-associated signalling axis in hepatoma cells, it was questioned whether the activation of this axis also involves other kinases, such as mitogen- activated protein kinase (MAPK/p38) and Src kinase. The activation of the MAPK/p38 pathway was analysed by the phosphorylation of p38 ay Y180. Both hepatoma cell lines showed reduced basal activation of p38 after ADAM8 silencing compared to respective controls (Figure 58A-B). Noticeably, ADAM8 overexpression in hepatoma cells showed no prominent effect on the phosphorylation of p38 compared to the control cells (Figure 58C-D).

The Src kinase is phosphorylated at two sites, tyrosine 416 (activation site) and tyrosine 527 (auto-inhibition site). The activation of the Src kinase protein was measured by the phosphorylation of Src at Y416 which is the activating residue of Src. Decreased phosphorylation of Src kinase (Y416) was detected after ADAM8 silencing in the two hepatoma cell lines analysed in this study (Figure 58A-B). In turn, with overexpression of ADAM8, the phosphorylation of Src kinase was elevated (Figure 58C-D). From these results, it is likely that ADAM8 expression was positively associated with the activation of Src kinase and partially correlated with activation of p38 MAPK during HCC progression.

106

Results Small GTPase Rho A molecule is another downstream interaction partner of FAK and Src which is involved in the remodelling of the actin cytoskeleton. Activated FAK and Src kinase may cause the activation of Rho A (Del Re et al., 2008; Huveneers & Danen, 2009). Therefore, Rho A activation was analysed in Hepa1-6 cells to have a deeper insight into the downstream effectors of ADAM8. Interestingly, ADAM8 knockdown markedly reduced the activation of Rho GTPase activation (Figure 58E) which indicates that ADAM8 is critical for the signalling transduction pathway of actin- myosin contractility and cell migration during HCC progression.

107

Results

Figure 58: ADAM8 expression correlates with activation of MAPK (p38), Src and Rho A

A-B: Hepa1-6 (A) and HepG2 (B) cells were left untreated (WT), treated for knockdown of ADAM8 (A8_1 & A8_2 are two sequences of shRNA or siRNA) or received non-targeting control sequences (Ctrl). Subsequently, cells were studied for phosphorylation of MAPK (p-p38) at tyrosine 180 and

108

Results phosphorylation of Src kinase at tyrosine 416. The knockdown of ADAM8 was controlled in parallel. C- D: Hepa1-6 (C) and HepG2 cells (D) were left untreated (WT) of transduced with vector for overexpression of ADAM8 (ADAM8) or with control vector (Ctrl) and then analysed by Western blotting as described above. The overexpression of ADAM8 was controlled in parallel. E: Activation of Rho A GTPase was analysed in untreated Hepa1-6 cells, cells with ADAM8 knockdown, and control cells. After pull-down, the samples were subjected to Western blot analysis using the indicated antibodies. In A-E representative Western blots are shown. Signals were quantified by densitometry and calculated as phosphorylated/activated versus total forms. Data in E represent two independent experiments without statistical analysis. Other data are shown as mean + SD and are representative of 3- 4 independent experiments. * p< 0.05, ** p<0.01, *** p<0.001

Altogether these findings indicated the positive role of ADAM8 in the pathology of HCC through activation of the β1 integrin-FAK-Src kinase axis.

109

Discussion

5 Discussion

ADAMs are the multidomain proteins involved in various biological events carried out through catalytic proteolysis and adhesion. These functions of ADAMs are critical for the development and manifestation of various pathologies comprising inflammation, neurodegenerative disorders and cancers. Some of the ADAM proteinases such as ADAM10 and ADAM17 are also essential for the normal development and homeostasis of the organism. Compared to other ADAMs, ADAM8 is expressed at lower level in a healthy organism and does not seem to be essential for the development of normal body function. However, upon induction of ADAM8 expression, the protease severely amplifies the course of the disease. In various inflammatory and cancer models, the active role of ADAM8 has been established as proteolytic enzyme and as adhesion molecule. However, the function of ADAM8 in liver inflammation, particularly in NAFLD and LPS-induced liver injury, has not yet been explored. Additionally, ADAM8's contribution to the development and progress of HCC is only partially known..

The present study investigated the regulation of ADAM8 in an in-vitro setting of NAFLD and explored potential pro-inflammatory functions of ADAM8. The inflammatory function of the protease was further studied in-vitro with various cell types and in a murine model of LPS-induced liver injury using ADAM8 knockout (KO) mice. Second part of this study focuses on the general impact of ADAM8 on the cell functions of hepatoma cells which was investigated by knockdown (KD) and overexpression of ADAM8. Moreover, the partners and downstream effectors of ADAM8 which control the proliferation, basal migration, invasion and apoptosis were explored in hepatocellular carcinoma cells.

This study reveals the importance of ADAM8 in liver pathology using murine as well as human liver cells which provides two-fold evidence. The direct association of ADAM8 with inflammatory mediators was confirmed by ADAM8 KD. For human cells, a stable shRNA mediated KD was performed by selecting lentiviral vectors and the KD was confirmed after 72 h of the transduction with almost 70-80% efficiency. For murine cells, the KD was siRNA mediated and performed by a lipid-based chemical transfection of siRNA. Downregulation of ADAM8 could be confirmed at the

110

Discussion transcriptional level already after 24 h and on the translational level after 96 h, suggesting that ADAM8 protein might have a long half-life. This would mean that knockdown of ADAM8 synthesis does not directly lead to disappearance of the protein which remains in the cells for more than 48 h and becomes degraded at later time points. It has been reported that mRNA levels can over-estimate the efficiency of KD of that gene whose protein product comparatively has a long half-life (Bartlett & Davis, 2006). The protein stability of ADAM8 could be due to the vesicular localization (Wildeboer et al., 2006)

5.1 ADAM8 is upregulated during experimental in vitro and in vivo models of NAFLD/NASH and contributes to the release of pro-inflammatory cytokines and fibrotic processes by liver cells in vitro

The liver is more vulnerable to metabolic disorders such as NAFLD due to its association in the metabolism of glucose and lipids. Non-alcoholic fatty liver disease (NAFLD) is caused by excessive accumulation of fatty acids within the cells. This excessive fatty acids initiate the inflammatory response which, if persistant, can lead to chronic liver inflammation ending up with liver cirrhosis or carcinoma. Various members of the ADAM family are known to intervene in the process of inflammation such as ADAM8, ADAM9, ADAM10, ADAM12 and ADAM17. ADAM8 participates in various disease processes such as inflammation, neurodegeneration and carcinogenesis by either cleaving various cell surface proteins, cytokines and growth factors or interacting with other cell-surface proteins such as β-integrins and activating a cascade of downstream signalling.

In the present study, the regulation of ADAM8 in NAFLD was investigated. The findings demonstrated that ADAM8 is overexpressed in NAFLD liver tissues. ADAM8 was also found upregulated in murine and human hepatocyte cell lines (Hepa1-6 & HepG2), endothelial cell lines (LSEC & EA.hy926), hepatic stellate cell lines (GRX & LX-2) and murine primary hepatocytes under NAFLD conditions. The positive association of ADAM8 with cytokines was established by ADAM8 KD in both types of cell lines. The experimental evidence revealed that the expression of ADAM8 is correlated with the release of several inflammatory cytokines.

ADAM8 is upregulated and functionally involved in the development of several acute and chronic inflammatory disorders such as in experimental asthma (King et al., 111

Discussion 2004; Naus et al., 2010), acute lung inflammation (Dreymueller et al., 2017), periodontitis (Nimcharoen et al., 2019) and osteoarthritis (Duan et al., 2019). The current study demonstrated the elevated mRNA expression of ADAM8 and pro- inflammatory cytokines in an HFD model of NAFLD. The expression of ADAM8 is closely correlated with the expression levels of pro-inflammatory cytokines, TNFα and IL-6. Conversely, the expression of other two major ADAM family members, ADAM10 & 17 was rather downregulated in this model (Figure 8B-C). The overexpression of ADAM8 was also confirmed under NAFLD conditions in murine and human hepatoma cell lines (Hepa1-6 and HepG2). Following this, freshly isolated murine primary hepatocytes were analysed for ADAM8 regulation after fatty acids (FA) treatment. Constitutive expression of ADAM8 was found lower in primary hepatocytes, which was considerably elevated after FA and IL-1β treatment. The in- vitro investigation of primary hepatocyte responses stands always as a satisfactory model for NAFLD in-vivo because of their high functional relevance to the organ in- vivo (Müller & Sturla, 2019) However, due to limitations of cell culture duration, primary hepatocytes could not be grown for a longer time period. The results showed that it was difficult to knockdown ADAM8 in primary cells because of their reduced viability and less susceptibility towards siRNA mediated transfection.

In the present study, the up-regulation of ADAM8 in endothelial cells upon stimulation with the pro-inflammatory cytokines TNFα and INFγ showed the association of ADAM8 with inflammation. Liver sinusoidal endothelial cells (LSEC) play an important role in maintaining homeostasis through their selected regulation of macromolecules across the sinusoid under physiological conditions (Poisson et al., 2016). Endothelial cells also regulate the inflammatory process by producing inflammatory mediators and by facilitating the trans-endothelial migration of immune cells during NAFLD (Hammoutene & Rautou, 2019). LSEC injury activates Kupffer cells and liver stellate cells. These cells lead to the transition of liver inflammation to liver fibrosis (Hammoutene & Rautou, 2019; Miyao et al., 2015). Current data showed that liver stellate cell lines overexpress ADAM8 when treated with TGFβ. It is known that the release of TGFβ from activated Kupffer cells and migrated macrophages during liver inflammation activates hepatic stellate cells and trigger their differentiation into myofibroblasts (Tsuchida & Friedman, 2017). ADAM8 may likely have a role in the

112

Discussion activation of liver stellate cells. The present data are in line with previous reports that activated stellate cells express more mRNA of ADAM8 compared to the quiescent cells (Schwettmann et al., 2008).

At the next step, the correlation of ADAM8 with pro-inflammatory cytokines was established. The mRNA expression and release of TNFα and IL-6 were upregulated in liver cell lines under inflammatory conditions. Interestingly, ADAM8 KD reduced the expression and release of both cytokines. TNFα and IL-6 are considered as the early mediators of the inflammation (Dreymueller et al., 2012; Hamesch et al., 2015; Heymann & Tacke, 2016). Despite the protective role of IL-6 in the liver (Chae et al., 2018; Ji et al., 2016), it is known to be involved in obesity and insulin resistance-related liver inflammation (Matthews et al., 2010; Rudling et al., 2002). Regarding the participation of ADAM8, a recent study revealed that ADAM8 gene silencing reduced the release of TNFα and IL-6 in a chondrogenic osteoarthritis cell model by inhibiting EGFR/NF-κB signalling (Duan et al., 2019). It has been reported that stellate cells mediate a cytokine-induced inflammatory response which ultimately results in severe liver inflammation and fibrosis development (Fujita & Narumiya, 2016). The present study demonstrated that by silencing of ADAM8 the cytokine-mediated inflammatory response could be reduced.

The inflammatory cytokines TNFα, IL-6, IL-1β and IL-8 (which are the key modulators of the liver inflammatory process) were already described to be upregulated in the serum of patients with NASH (Braunersreuther et al., 2012; Kugelmas et al., 2003; Niederreiter & Tilg, 2018). In the present study, a positive correlation of ADAM8 expression and IL-8 release was also observed. This was demonstrated by ADAM8 knockdown which led to considerably reduced IL-8 expression in HepG2 cells. Interestingly for human endothelial cells EA.hy926, no such correlation was observed. In addition, KC, the murine homologue of IL-8 (Hol et al., 2010), was induced in Hepa1-6, LSEC and GRX and noticeably reduced upon ADAM8 silencing. This can be due to the fact that the ADAM8-dependent release of IL-8 and KC is cell-specific. The in-vivo relevance of this ADAM8-mediated effect is still unclear. It is well-known that the serum concentration of chemokines increases in response to the inflammatory challenge to the organism (Bhatia et al., 2012; Gao et al., 2018). KC (CXCL1) has been found upregulated in a murine LPS-induced acute lung inflammation model but

113

Discussion ADAM8 KO showed no influence on the release of KC (Dreymueller et al., 2017). By contrast, the involvement of ADAM8 in the release of IL-8 has been observed in lung cancer demonstrating that the truncated isoforms of ADAM8 were upregulated and correlated with increased IL-6 and IL-8 release contributing to aggressive metastatic phenotype of lung cancer (Hernández et al., 2010).

In contrast to IL-8, concentration of CXCL16 was not altered in most of the investigated cell lines upon activation with respective stimuli (except for EA.hy926 cells) and also ADAM8 KD revealed no impact on the release of CXCL16. This might indicate that CXCL16 expression is not linked to ADAM8 expression. But this does not rule out that CXCL16 is involved in inflammatory liver disease. In an in-vivo model of methionine-choline-deficient (MCD) diet-induced fatty liver disease CXCL16 has been observed to be potentially involved in the pathogenesis of liver disease by decreasing the infiltration of macrophages (Wehr et al., 2014). In another study, CXCL16 and ADAM10 expression has been upregulated in the livers of apolipoprotein E KO mice fed on HFD with casein injection. Also, an increase in CXCL16 expression has been observed in HepG2 cells by stimulating with cholesterol and IL- 1β. Moreover, knockdown of CXCL16 has rescued the hepatocyte injury (Ma et al., 2018). The increase in CXCL16 could be dependent on the method and approach of induction of liver inflammation. Of note, the expression of ADAM10 (a sheddase of CXCL16) was found downregulated in the model of HFD-induced steatosis in the present study. This may also account for the unaltered concentration of CXCL16 in supernatants of cell lines used in this study.

Moreover, a strong relationship of the chemokine CX3CL1 with ADAM8 was observed in endothelial cells. The silencing of ADAM8 reduced the released amount of CX3CL1. Likewise, hepatocytes and stellate cells also tend to reduce the release of CX3CL1 after ADAM8 knockdown but the differences were not significant. CX3CL1 is usually expressed on activated endothelial cells and takes part in the regulation of lymphocytes during inflammation by interacting with its receptor CX3CR1 (Imai & Yasuda, 2016). Soluble CX3CL1 increased during chronic liver inflammation and fibrosis, while the downregulation of CX3CL1 resulted in a curative effect for liver inflammation (Karlmark et al., 2010). Another study also revealed that increased expression and proteolytic shedding of CX3CL1 by hepatic stellate cells contributed to

114

Discussion liver inflammation and fibrosis (Bourd-Boittin et al., 2009). Although ADAM10 and ADAM17 are considered as the major sheddases of CX3CL1, interestingly, ADAM8 is also able to shed CX3CL1 (Naus et al., 2006). The observed effects in cell lines in the present study were tested in primary murine hepatocytes, and the upregulation of TNFα, IL-6, KC and CX3CL1 was found consistent with liver cell lines. The elevated release of these inflammatory mediators in primary hepatocytes might be associated with ADAM8 as the expression of ADAM8 was also upregulated. The summary of released cytokines and chemokines tested in this study is shown in table 12.

During the development of NASH, activated stellate cells release proinflammatory cytokines and predominantly produce the ECM components which efficiently contributes to liver fibrosis (Koyama & Brenner, 2017). The activation of stellate cells can be identified by evaluating the increased expression of alpha-smooth muscle actin (αSMA) and collagen type 1 or type 4 (Col1a1/Col1a4) (Fujita & Narumiya, 2016). In the present study, the elevated expression of pro-fibrotic markers αSMA and Col1a1 precisely confirmed the activation of hepatic stellate cells upon TGFβ treatment. Additionally, ADAM8 knockdown led to decreased expression of αSMA. Reduction in the expression of αSMA indicated that ADAM8 silencing might prevent stellate cell activation and hence prevents the liver fibrosis formation.

The crosstalk of hepatocytes and endothelial cells promotes cell migration and angiogenesis in-vitro and involves integrin-FAK-Rho GTPase axis activation (Feng et al., 2017). The conditioned medium from endothelial cells increased the expression of ADAM8 in hepatocytes. This indicates that ADAM8 may also play some role in the crosstalk of liver cells during inflammation.

115

Discussion

Table 12: Summarised results of the release of cytokine and chemokine through liver cells after ADAM8 KD

Symbol description: increased release compared to the stimulated control cells: ↑, decreased release compared to the stimulated control cells: ↓, no change compared to the stimulated control cells: =, not analysed: n.a., not significant changes: (↓)/(↑).

Analysed Treatments TNFα IL-6 IL-8/KC CXCL16 CX3CL1 cell lines ADAM8 KD Hepa1-6 ↓ ↓ ↓ = (↓) (FA+IL-1β) ADAM8 KD HepG2 ↓ ↓ ↓ = (↓) (FA+IL-1β) ADAM8 KD mLSEC n.a. ↓ ↓ = ↓ (TNFα+INFγ) ADAM8 KD EA.hy926 n.a. ↓ = = ↓ (TNFα+INFγ) ADAM8 KD GRX ↓ ↓ ↓ = (↓) (TGFβ) ADAM8 KD LX-2 ↓ ↓ = = (↓) (TGFβ)

Taken together, it is tempting to speculate that ADAM8 is involved in the development of NAFLD by promoting the production of several pro-inflammatory mediators and by promoting fibrotic responses of stellate cells (Figure 59). Moreover, ADAM8 exerts its activity already at the mRNA level indicating that it promotes the transcriptional response of the pro-inflammatory cytokines. The exact mechanism however remains unclear. To further investigate the pro-inflammatory and pro-fibrotic activities of ADAM8, animal experiments should be performed using the NAFLD mice model with ADAM8 knockout. Additionally, ADAM8 could be targeted in-vivo with inhibitory antibodies or with a recently described peptide inhibitor (Schlomann et al., 2015). These results demonstrate that ADAM8 is highly regulated in NAFLD-induced liver inflammation which elaborates its potential to be used as s therapeutic target to treat NAFLD.

116

Discussion 5.2 The up-regulation of ADAM8 by LPS is linked to increased inflammatory mediator production by liver cells but is not critical for LPS-induced liver inflammation in-vivo.

The present study provided evidence that liver mRNA expression of ADAM8 was considerably upregulated in mice upon LPS injection. A similar up-regulation was observed in cultured hepatocyte cell lines, primary hepatocytes and endothelial cells. The in-vitro findings were evaluated with human and murine liver cells. Consistently, it was observed that ADAM8 knockdown reduced the pro-inflammatory mediator production in these cell lines. Along with the upregulated expression of ADAM8, the expression and release of TNFα and IL-6 were upregulated in LPS-treated hepatocyte cell lines, primary murine hepatocytes and endothelial cells. This indicates the presence of the inflammatory response in these cells. It also suggests a link between activity and regulation of ADAM8 and the production of these cytokines. The induced mRNA expression of TNFα was alleviated in EA.hy926 cells upon ADAM8 knockdown. Also in primary murine hepatocytes TNFα induction was reduced by ADAM8 knockout. In the hepatocytes cell lines only a non-significant decline was observed. Contrary to mRNA expression, the level of released TNFα declined consistently and significantly in ADAM8 KD hepatocyte cell lines and primary hepatocytes. The reduction in soluble TNFα might be due to the reduced catalytic activity of ADAM8 in ADAM8 KD cells leading to reduced shedding of the membrane expressed TNFα.

LPS treatment also induced the mRNA expression and release of IL-6 in hepatocyte cell lines and primary hepatocytes. The release of IL-6 was reduced after ADAM8 silencing. This might indicate the differential response of ADAM8 on the expression of cytokines upon different stimulations. These findings were in part similar to those described above for NAFLD. It is therefore conceivable that ADAM8 holds a special role in inflammatory mediator production and that this function basically depends on the specific type of stimuli. Despite these clear pro-inflammatory activities of ADAM8 in in-vitro experiments, no clear results could be obtained to answer whether ADAM8 KO can critically affect the outcome of LPS-induced liver injury in- vivo. As expected, the liver mRNA expression of ADAM8 was considerably upregulated in wild type mice upon LPS injection. However, ADAM8 KO did not show significant changes in the expression of liver inflammatory cytokines.

117

Discussion It is still a controversial debate that whether ADAM8 activity is detrimental during inflammatory disorders. However, the expression of ADAM8 is upregulated during inflammation. For example, Dreymueller et al., showed that inhibition of ADAM8 attenuates LPS-induced acute lung inflammation where ADAM8 silencing in endothelial cells reduced the leucocyte recruitment through endothelial cells (Dreymueller et al., 2017). By contrast lung epithelial ADAM8 did not promote leucocyte recruitment and it rather the raised the epithelial cell migration for potential tissue repair. Hence ADAM8 holds a differential role depending on the type of cells (Dreymueller et al., 2017). The controversial functions of ADAM8 anti- or pro- inflammatory, during the development of airway inflammation have been discussed in detail elsewhere (Chen et al., 2013). The role of ADAM8 in the manifestation of moderate or severe asthma has been addressed in several studies and the therapeutic option of ADAM8 inhibition has been evaluated by using ADAM8 deficient mice or an ADAM8 blocking antibody in a model of severe airway inflammation (Chen et al., 2016).

Although the expression of ADAM8 is increased in neurodegenerative conditions, it has been found that ADAM8 offers a neuroprotective role by enhancing the shedding of TNF-R1 induced by over produced TNFα in the neuronal cells (Bartsch et al., 2010). On the other hand, during periodontitis and osteoarthritis, ADAM8 was shown to be over-expressed and lack of ADAM8 had protective effects (Duan et al., 2019; Nimcharoen et al., 2019). ADAM8 expression has been found to be increased also in atherosclerosis but ADAM8 deficiency did not lead to protection against the development of advanced atherosclerosis (Theodorou et al., 2017). Another study demonstrated a general association of ADAM8 with cardiovascular diseases in murine and human tissues suggesting that ADAM8 can serve as a marker for the development of cardiovascular disease (Schick et al., 2019).

The present study is in agreement with the fact that ADAM8 is upregulated during inflammation, as observed in hepatocytes and endothelial cells upon LPS stimulation and also in the systemic model of i.p. LPS-injection in murine liver tissues. Previously it has been described that the expression of ADAM8 was elevated in CCl4 induced liver injury. Administration of an antibody against ADAM8 has neutralized the expression of ADAM8 in the liver which also reduced the liver inflammation, indicated by reduced

118

Discussion serum ALT and AST levels. Suppression of ADAM8 with antibody also resulted in tissue repair induction by increasing vascular endothelial growth factor (VEGF), cytochrome P450 1A2 and PCNA expressions in a dose-dependent manner (Li et al., 2014).

The in-vivo investigations showed that after 6 h LPS administration the liver mRNA expression of TNFα and IL-6 increased as a quick response to the LPS-induced inflammation. Contrary to the ADAM8 KO primary hepatocytes, the increase was observed in wild-type mice as well as in ADAM8 KO mice. Interestingly, ADAM8 mRNA expression was upregulated in liver tissues of the LPS-treated control group, but ADAM10 and ADAM17 expressions remained unaltered. It is therefore arguable that ADAM8 might be among the early induced inflammatory proteins as observed in different liver injury models i.e. NAFLD, LPS+GalN, BDL and PH. However, as demonstrated in the present study ADAM8 knockout did not lead to a profound and clear reduction of TNFα and IL-6 expression which suggests that ADAM8 may not play a critical role in the acute stage of LPS-induced liver injury. Nevertheless, a trend towards a reduction of the serum concentration of IL-6 and liver enzymes upon ADAM8 knockout could be observed but due to high variability among the animals, the difference between the control and ADAM8 KO groups was not significant. This does not exclude the possibility that the proteinase contributes to the chronic or more severe liver pathology.

The LPS-induced liver injury was considered as acute or mild inflammation because it did not significantly affect the serum levels of ALT and AST which are the established markers for the extent of liver injury. This may also be due to the variation among the animals. As no signs of tissue injury were observed in liver tissues after LPS-treatment during this study, the LPS dosage was considered insufficient to induce liver injury. Nevertheless, the increased mRNA expression of cytokines after LPS treatment indicates the initiation of the acute inflammatory response (Figure 59). However, the serum levels of these cytokines were also unaltered. Therefore, to reach an exact outcome, the experiments should be confirmed using higher animal numbers to reduce the variability, and a higher LPS dosage also for a longer period i.e 12 h or 24 h. Moreover, LPS can be combined with a hepatotoxic agent D-galactosamine (D- GalN) which may tremendously increase the liver damage by inhibiting the production

119

Discussion of several macro-molecules resulting in increased hepatocyte death as described (Hamesch et al., 2015).

The effect of ADAM8 KD or KO on the production of different mediators in in- vitro or in-vivo study respectively is summarised in the following table (Table 13).

Table 13: Summarised results of ADAM8 effects on LPS-induced liver injury

ADAM8 KD/KO mRNA Soluble protein Time LPS TNFα IL-6 TNFα IL-6 Hepatocyte cell lines 24 h (↓) (↓) ↓ ↓ Endothelial cell lines 24 h ↓ = n.a n.a Primary murine 24 h ↓ (↓) ↓ ↓ hepatocytes Liver / serum (in- 6 h = = = = vivo)

120

Discussion

Figure 59: Illustrative model of the role of ADAM8 in manifestation of liver inflammation

When liver cells, especially hepatocytes, are triggered by external stimuli such as LPS or fatty acids, the expression of ADAM8 (at both, gene and protein levels) is induced. ADAM8 upregulation is linked to inducing the gene expression of pro-inflammatory cytokines possibly by activating the NF-κB pathway. This correlates with increased release of cytokines and chemokines (TNFα, IL-6, IL-8 and CX3CL1). Additionally, ADAM8 may contribute to the shedding of TNFα and CX3CL1. The enhanced cytokines initiate the acute phase response resulting in inflammation and hepatocyte damage. The released cytokines and TGFβ activate liver stellate cells expressing a high level of ADAM8. In stellate cells, ADAM8 is also positively correlated with the expression of αSMA which may cause fibrosis. Dotted lines and question marks represent the unexplored mechanism of activation of inflammatory pathways in association with ADAM8.

Although no signs of liver tissue injury were observed in liver of LPS-treated animals, some other interesting features were observed. The constitutive expression of TNFα mRNA was less in the ADAM8 KO group compared to the control group of animals. Similar observations were made in primary hepatocytes obtained from the livers of ADAM KO mice. It has been reported that macrophages from ADAM8 deficient mice secrete lesser amounts of TNFα (Bartsch et al., 2010) which highlighted

121

Discussion the catalytic role of ADAM8. However, there is no study yet demonstrating the reduction in constitutive gene expression of TNFα in ADAM8 deficient mice.

The haematoxylin and eosin (H & E) staining of the liver tissues revealed some proliferating bodies which were slightly more in number in ADAM8 KO mice liver tissues compared with the control mice's liver tissues. It is known that ADAM8 does not take part in the normal homeostasis of the body organs and the total KO of ADAM8 resulted in the production of completely healthy animals with normal phenotype (Kelly et al., 2005). These abnormal proliferating figures in the liver were reported in this study for the first time which was also confirmed by a proliferation marker Ki67. The presence of more proliferating cells in ADAM8 KO liver tissues might be conceived as a pre-cancerous phenotype.

5.3 ADAM8 critically controls the proliferation and migration in hepatoma cells by regulating the malignant signalling events

In the present study, the influence of ADAM8 on the signalling events involved in the metastasis of hepatocellular carcinoma (HCC) was investigated. The findings revealed that ADAM8 is predominantly upregulated in liver tissues from HCC mice. The murine and human hepatoma cell lines (Hepa1-6 and HepG2 respectively) expressed elevated levels of ADAM8 when compared with primary murine hepatocytes. Furthermore, ADAM8 knockdown (KD) and overexpression (OE) was performed to demonstrate the importance of ADAM8 in the metastatic events during HCC. This evidence illustrated that ADAM8 critically regulates cell proliferation, cell migration, ECM invasion and apoptosis. On the molecular level, experimental pieces of evidence showed that these cellular functions are correlated with PCNA and β1 integrin expression, as well as with the activation of FAK, Src kinase, p38 MAPK and Rho A, which all depend on ADAM8 expression. Also, it was found that endothelial cells require ADAM8 for efficient cell migration and angiogenesis (Figure 60).

ADAM8 was found to be highly expressed in the hepatic cell lines (HepG2 and Hepa1-6) which are derived from hepatic carcinoma whereas the expression of ADAM8 was comparatively less in murine primary hepatocytes. Similarly, mRNA expression of ADAM8 was highly upregulated in the murine HCC liver tissues compared to the healthy liver tissues. The expression of other proteases such as ADAM10 and ADAM17 were also upregulated in HCC but to a lesser extent. Among 122

Discussion other ADAM proteinases, ADAM8 has been reported to be highly over-expressed in many carcinomas such as lung cancer (Ishikawa et al., 2004; Zhang et al., 2013), head and neck carcinoma (Zielinski et al., 2012), brain tumours (Wildeboer et al., 2006), leukemias (Miyauchi et al., 2018), pancreatic cancer (Schlomann et al., 2015), gastric cancer (He et al., 2016), triple-negative breast cancer (Romagnoli et al., 2014) and also in liver carcinoma (Li et al., 2015; Zhang et al., 2013).

In liver carcinoma, ADAM8 has been reported to be overexpressed in a murine model of diethylnitrosamine-induced HCC (Li et al., 2015). has Additionally, overexpression has been described to be associated with poor prognosis in HCC patients (Zhang et al., 2013). Valkovskaya et al, demonstrated that ADAM8 is overexpressed in pancreatic ductal adenocarcinoma and its high expression is correlated with poor prognosis (Valkovskaya et al., 2007). Similarly, Romagnoli et al. showed that ADAM8 is upregulated in human breast cancer tissues and this is again linked with reduced patient outcomes (Romagnoli et al., 2014). Furthermore, expression of ADAM8 is associated with cell growth and poor survival of patients with colorectal cancer (Z. Yang et al., 2014). This may illustrate that ADAM8 can serve as a more general indicator and biomarker of various malignant processes. However, besides cancers, ADAM8 expression is enhanced also in other pathologies as described earlier in this discussion. Therefore, ADAM8 expression could be a general biomarker for inflammation and carcinomas. This would limit the use of ADAM8 as a biomarker for the prediction of cancers.

5.3.1 ADAM8 regulates cell proliferation, cell migration, cell invasion and apoptosis with HCC metastasis and angiogenesis

The present study demonstrated that ADAM8 expression is correlated with cell proliferation as observed in hepatoma cells. Silencing of ADAM8 alleviated the cell growth whereas overexpression of ADAM8 increased hepatoma cell proliferation. s influence on cell growth was also evidenced by clonogenic assays and׳ADAM8 PCNA expression analysis. Proliferating cell nuclear antigen (PCNA) facilitates and controls DNA replication. It is a well-known marker of proliferating cells in various cancers (Bologna-Molina et al., 2013; Yin et al., 2017; Zhao et al., 2012). However, PCNA is predominantly regulated by post-translational events (Mailand et al., 2013). In this study mRNA expression of PCNA was not changed in hepatoma cells upon

123

Discussion ADAM8 KD. Protein expression of PCNA in both hepatoma cell lines was downregulated in ADAM8 knockdown cells and upregulated in ADAM8 overexpression cells compared to the respective controls. Interestingly, this data is in good agreement with the previous report that the treatment with a monoclonal antibody against ADAM8 has reduced HCC proliferation in mice as suggested by reduced detection of PCNA expression in liver tissues (Li et al., 2014).

Furthermore, apoptosis in hepatoma cells was increased by ADAM8 silencing and vice versa decreased by overexpression of ADAM8 in hepatoma cells. It is therefore clear that ADAM8 makes cancer cells more resistant toward apoptosis. Another related study has shown that treatment with recombinant ADAM8 protein caused a reduction in the proliferation of normal hepatocytes but not in hepatoma cells. Moreover, the treatment suppressed apoptosis in hepatoma cells but not in normal hepatocytes (Li et al., 2015). These results are in part contrary to the present findings that the soluble recombinant ADAM8 may not necessarily interact with other cellular proteins e.g. integrins. Nevertheless, accumulating shreds of evidence are pointing in the direction that ADAM8 can induce hepatoma cell proliferation and reduce apoptosis.

ADAM8 was found critically involved in hepatoma cell migration and invasion. Metastasis of tumour cells is an alarming event that is also found in HCC with an increased tendency to develop intrahepatic metastasis as well as extrahepatic metastasis (Llovet et al., 2008; Xu et al., 2015). The metastatic spread of tumours involves critically controlled cell migration and cell invasion into the ECM. This Ph.D. study revealed that ADAM8 controls cell migration as shown by wound healing assays. Similar results were found for cell migration through matrigel, illustrating that ADAM8 also regulates the cell invasion through the components of the ECM. These findings are consistent with previous reports about the pro-migratory role of ADAM8 in other cells such as human and murine leucocyte migration in-vitro and in a murine ADAM8 KO model of acute lung inflammation (Dreymueller et al., 2017). In breast cancer cells, ADAM8 is required for efficient cell migration (Romagnoli et al., 2014). Also, high expression of ADAM8 in pancreatic ductal adenocarcinoma cells is associated with enhanced cell migration, and inhibition of ADAM8 using a peptidomimetic inhibitor has reduced the metastasis of implanted pancreatic tumour cells in-vivo (Schlomann et al., 2015).

124

Discussion Angiogenesis is the formation of new vessels into the regenerating or the metastatic area which is a critical factor for tumour growth and metastasis as it is a source of nutrient supply to the newly developing tumour. By suppressing angiogenesis, tumour development can be reduced in several carcinomas (Bouquet et al., 2006; Li et al., 2018). The present study indicates another important function of ADAM8 in endothelial cells. The silencing of ADAM8 can effectively reduce proliferation, cell migration and angiogenesis of endothelial cells which is in good agreement with the previously described involvement of ADAM8 in angiogenesis. It is known that during spinal cord injury ADAM8 is selectively up-regulated in endothelial cells which is associated with the migration and proliferation of endothelial cells for angiogenesis (Mahoney et al., 2009). Similarly, another study using an orthotopic mouse model demonstrated that tumour developed from ADAM8 knockdown breast cancer cells showed poor vascularization which was regulated by both catalytic shedding of VEGF and interaction of β1 integrin with ADAM8 (Romagnoli et al., 2014). Therefore, by targeting ADAM8, the angiogenic capability of cells can be suppressed resulting in limitation of metastasis as tumours cannot grow in the absence of blood supply (Nishida et al., 2006).

The involvement of ADAM8 in various basal cellular functions in liver cells is summarised in the following table 14.

Table 14: Summarised results of ADAM8 involvement in various cellular functions

Symbol description: increased compared to the control cells: ↑, decreased compared to the control cells: ↓.

Analysed Results after ADAM8 KD or Analysed cells parameters OE compared to control cells Cell proliferation ↓ Hepa1-6 and HepG2 Cell migration ↓ ADAM8 KD Cell invasion ↓ Apoptosis ↑ Cell proliferation ↑ Hepa1-6 and HepG2 Cell migration ↑ ADAM8 OE Cell invasion ↑ Apoptosis ↓ Cell proliferation ↓ LSEC and EA.hy926 Cell migration ↓ ADAM8 KD Tube formation ↓

125

Discussion

5.3.2 ADAM8 is associated with β1 integrin, FAK, Src kinase and Rho A activation in hepatoma cells

In the present study, the mechanism of regulation of these cellular activities by ADAM8 was also investigated. Various mechanisms may account for the pro- migratory function of ADAM8 depending upon different cell types and disease settings. This may either involve the shedding activity of the metalloproteinase domain or the interaction of the disintegrin domain with integrins. Regarding catalytic activity, ADAM8 has been found to cleave the P-selectin glycoprotein ligand (PSGL1) which may influence leucocyte transmigration through endothelial cells (Conrad et al., 2018). However, the condition may be altered for the migration of cells through ECM. In the present study, the already well-established ability of ADAM8 to bind β1intergrin by its disintegrin domain appeared more relevant (Le et al., 2018; Schlomann et al., 2015). Analysis of β1 integrin expression in hepatocellular carcinoma cells showed a positive association with ADAM8 expression. β1 integrin expression was lower down in ADAM8 KD hepatoma cells and conversely its expression was upregulated with ADAM8 OE. Similarly, also in leucocytes β1 integrin up-regulation requires ADAM8 (Dreymueller et al., 2017). This enhanced expression of β1 integrin could offer an increased interaction with β1 integrin extracellular ligands as well as activation of intracellular signalling by integrins and thereby enhancing cell migration. A previous study revealed that the peptidomimetic inhibitor of ADAM8, which reduced the process of cell migration, functions by blocking the interaction of ADAM8 with β1 integrin (Schlomann et al., 2015). In addition, ADAM8 can exercise pro-migratory functions by interacting with β1 integrin in different tumour cell types and the current research work indicates that hepatoma cells also possess the same functions.

β1 integrin-induced signalling primarily involves the intracellular activation of the focal adhesion kinase (FAK). The expression of β1 integrin has a strong positive correlation with the phosphorylation of FAK at tyrosine (tyr or Y) 925 and tyr 397 residues whereas these phosphorylation sites of FAK are potentially involved in cell adhesion to ECM and cell migration (Calalb et al., 1995; Owen et al., 1999). Tyr 397 is an auto-phosphorylation site of FAK and requires tethering to the β1 integrin which creates the binding site for (Src homology domain 2) SH2 of Src kinase (Shi &

126

Discussion Boettiger, 2003). The complex of FAK with Src activates other cellular proteins to trigger the downstream signalling through its kinase activity. This relationship of β1 integrin and FAK was studied in mammary cancer stem cells, where the inactivation of FAK resulted in reduced breast cancer growth and progression (Guan, 2010). The phosphorylation of FAK Y925 is necessary for p38 MAPK/VEGF pathway activation which, in turn, is necessary for the facilitation of the angiogenic switch in tumours (Mitra et al., 2006). The relationship between FAK and HCC demonstrates that depletion of FAK suppresses human hepatocellular carcinoma by inducing apoptosis, growth arrest, and modulating several cancer-related genes (Gnani et al., 2017).

It has been also shown that integrins can activate the MAPK/ERK pathway, Src family kinases and other downstream protein kinases (PK) (Humphries et al., 2019; Moreno-Layseca & Streuli, 2014; Naci & Aoudjit, 2014; Playford & Schaller, 2004). These pathways are hyper-activated in various tumour types. Dong et al. evaluated that ADAM8 overexpression leads to the activation of intracellular PI3K/Akt/PKB and ERK1/2 signalling in U87 cells (human glioblastoma cell line) resulting in an increased cell proliferation (Dong et al., 2015). Moreover, pancreatic cancer cells with ADAM8 knockdown show a decrease in phosphorylation of ERK1/2, MEK1/2 and Akt (Schlomann et al., 2015). It is reported here for hepatoma cells that activation of MAPK/p38 and Src kinase was reduced after ADAM8 silencing. On the other hand, the expression of activated Src kinase presented an increased after ADAM8 overexpression while activation of p38 remained unaffected. Another downstream molecule of integrin signalling is Rho GTPase which is actively involved in the tumour cell migration processes as well as cell cycle regulation (Playford & Schaller, 2004). Indeed, also Rho GTPase was found to be less activated in ADAM8 knockdown hepatoma cells.

Several signalling pathways such as MAPK pathway, Wnt signalling, IL-6/STAT3 (signal transducer and activator of transcription 3) signalling, NF-κB pathway, Hippo signalling and Notch signalling play a critical role in supporting liver cancer stemness (Tsui et al., 2020). ADAM8 is known to induce some of these pathways including MAPK pathway (Dong et al., 2015), Notch and NF-κB signalling (Duan et al., 2019). Thus, it is likely that ADAM8 could be involved in the stemness of cancer cells. ADAM8 expression was found high in chronic myeloid leukemia stem cells and this

127

Discussion was the reason for the failure of tyrosine kinase inhibitor therapy (Miyauchi et al., 2018). The summary of association of ADAM8 to the proteins analysed in this study is shown in table 15.

Table 15: Summarised results for the regulation of ADAM8 associated proteins in hepatoma cells

Symbol description: increased compared to the control cells: ↑, decreased compared to the control cells: ↓, no change compared to the control cells: =, not analysed: n.a., not significant changes: (↓)/(↑). KD: knockdown. OE: overexpression

Analysed cells Analysed proteins Outcome β1 integrin ↓ pFAK (397) ↓ Hepa1-6 pFAK (925) ↓ ADAM8 KD pSrc ↓ pp38 ↓ Rho A ↓ β1 integrin ↓ pFAK (397) ↓ HepG2 pFAK (925) ↓ ADAM8 KD pSrc ↓ pp38 ↓ Rho A n.a. β1 integrin ↑ pFAK (397) ↑ Hepa1-6 pFAK (925) = ADAM8 OE pSrc ↑ pp38 = Rho A n.a. β1 integrin ↑ pFAK (397) ↑ HepG2 pFAK (925) = ADAM8 OE pSrc ↑ pp38 = Rho A n.a.

Taken together, these findings provide evidence that ADAM8 is essentially involved in the HCC metastasis by regulating cell proliferation, cell migration, cell invasion and caspase 3/7 mediated apoptosis and angiogenesis. These effects are mediated through the interaction of ADAM8 with β1 integrin, leading to activation of several downstream signalling molecules such as FAK, Src kinase, p38MAPK and Rho

128

Discussion A (Figure 60). Therefore, it can be concluded that ADAM8 may serve as a potential target to treat HCC.

Figure 60: Illustrative model of the proposed role of ADAM8 in the prognosis of hepatocellular carcinoma

ADAM8 is highly upregulated in hepatoma cells and HCC liver tissues. ADAM8 may interact with activated β1 integrin. Though the interaction of ADAM8 is not described in this study, however, the expression of ADAM8 is positively associated with the expression of β1 integrin. This interaction ultimately results in the activation of focal adhesion kinase and Src kinase. Activated FAK and Src kinase lead to the survival signalling, growth, angiogenesis, migration and invasion. Several downstream molecules relay on the signals from FAK including p38 mitogen-activated protein kinase (MAPK). ADAM8 over-expression also activates cell survival signals decreasing apoptosis. The ADAM8 induced angiogenesis may also involve the release of vascular endothelial growth factor (VEGF). Question mark represent the unexplored mechanism of interaction of ADAM8 with β1 integrin. .

5.4 Conclusion

This Ph.D. study illustrates the regulation and role of metalloproteinase ADAM8 in liver inflammation and liver cancer. It was indicated that the gene expression of ADAM8 is significantly upregulated in various liver pathologies including NAFLD, LPS-induced liver injury, BDL-induced liver injury, after partial hepatectomy and in hepatocellular carcinoma. From the provided pieces of evidence in the in-vitro studies, it is clear that ADAM8 expression is strongly upregulated under NAFLD conditions or

129

Discussion with LPS treatment in liver cells. Consistent with the previous reports, present data also suggested the enhanced expression of ADAM8 is associated with increased expression and production of various cytokines and chemokines where ADAM8 KD resulted in reduced levels of the tested cytokines and chemokines. ADAM8 also regulates the expression of profibrotic markers in stellate cells. Altogether, these data illustrate that ADAM8 has an important role in the pathogenesis of liver inflammation and the production of pro-inflammatory mediators but ADAM8 may hold different mechanisms of action for different liver injuries. In-vivo evidence is still lacking here to further confirm the specific role of ADAM8 in the pathology of NAFLD-induced liver injury. ADAM8 was described before to behave differently in in-vivo models of different disease (Dreymueller et al., 2017; Theodorou et al., 2017).

ADAM8 is overexpressed in HCC and it influences hepatoma cell invasion and migration. According to the present data high ADAM8 expression acts pro-migratory and pro-metastatic in HCC, and this likely occurs through the integrin/FAK axis as well as activation of MAPK/p38, Src and Rho GTPase. The silencing of ADAM8 expression in hepatoma cells is associated with considerable suppression of these responses and vice versa with ADAM8 overexpression. These data suggest that the specific inhibition of ADAM8 in future therapy regimens could optimize HCC therapy and prevent metastasis. It has been shown that treatment with an anti-ADAM8 antibody reduced the primary tumour burden and cancer metastasis in a murine breast cancer model (Romagnoli et al., 2014). Additionally, the peptidomimetic ADAM8 inhibitor can improve survival in the murine Kras-driven pancreatic cancer model (Schlomann et al., 2015) and ADAM8 KO mice have also shown protection against acute lung inflammation (Dreymueller et al., 2017). It is proposed from the present findings that ADAM8 exhibits anti-inflammatory and anti-tumour activities that include the reduced production of inflammatory cytokines, inhibition of cell proliferation and metastasis formation via suppression of the β1 integrin/FAK signalling axis and down-regulation of MAPK cascade signalling (Figure 60). Further studies are still required to scrutinize these beneficial anti-tumour functions from side effects. The genetic knockout of ADAM8 in mice did not affect tissue homeostasis in healthy individuals (Kelly et al., 2005), therefore targeting of ADAM8 may represent a comparatively safe therapeutic approach. These data demonstrate a detrimental role of ADAM8 in liver fibrosis, acute

130

Discussion liver inflammation and liver cancer metastasis. Further experiments with ADAM8 knock out mice are required to prove the pro-fibrotic, pro-inflammatory and pro- metastatic functions of ADAM8 in the liver.

5.5 Outlook

The role of ADAM8 in liver inflammation could be studied in more detail by using in-vivo models. The conclusion made in this study that ADAM8 influences the expression and release of the cytokine in liver cells under NAFLD and LPS conditions, needs to be further explored, and also the mechanism should be investigated which drives this regulation.

Hepatic steatosis results in the apoptosis of hepatocytes (Feldstein et al., 2003; Kanda et al., 2018) which was also found to be the consequence of ADAM8 KD in hepatocyte in the present study. It was also reported that recombinant ADAM8 can induce apoptosis in hepatoma cell line HepG2 but not in normal hepatocyte cell line L02 (Li et al., 2015). Keeping in view the previous reports and present observations, the apoptosis should be studied under NAFLD conditions in normal hepatocytes which may be the primary hepatocytes and hepatoma cell lines to observe the differences. An in-vivo model of ADAM8 KO mice with NAFLD could further confirm the outcomes.

ADAM8 exhibits its functions via catalytic activity and interaction with integrins. It should be explored whether these two activities are independent of each other. This could be achieved by producing a catalytically inactive mutant of ADAM8 (EA_ADAM8) and to observe the effect of this mutant on the production of cytokines and to discover the mechanism behind. Additionally, the involvement of ADAM8 in cell migration, proliferation and apoptosis could be verified whether these cellular activities are independent of the catalytic activity of ADAM8 or not.

According to present investigations in hepatoma cells, ADAM8 exerts its metastatic function by interacting through its disintegrin domain with β1 integrin and activating further downstream mediators of integrin. With the help of this mutant, it could be clarified that the interaction of the disintegrin domain with β1 integrin needs the processing of ADAM8 or not. Mice could be generated with EA mutant ADAM8 via CRISPR Cas9 and could be compared with ADAM KO mice to verify the findings in a physiological environment. The metastatic activity of ADAM8 KO, ADAM8 OE

131

Discussion and ADAM8 EA mutant (introduction of a point mutation in the zinc binding domain by replacing glutamate with glutamine) hepatoma cell lines could be better demonstrated by developing a metastatic mice model. The migration and proliferation of these genetically modified hepatocyte cell lines could be assessed and compared for their metastatic relevance in-vivo. The present Ph.D. study also indicated that ADAM8 affects the migration and angiogenic property of endothelial cells but the mechanism was not investigated. Vascular endothelial growth factor (VEGF) plays an important role in migration and endothelial cell migration. This should be investigated regarding ADAM8 KD, OE and EA mutant. The correlation of ADAM8 VEGF has been already described in angiogenesis during breast cancer (Romagnoli et al., 2014) and in the in- vivo model of diethylnitrosamine-induced HCC (Li et al., 2015). Other regulators of angiogenesis including nitric oxide synthase (NOS3), matrix metalloproteinases (MMPs) and interleukin 4 (IL-4) (Saleh et al., 2015) should be investigated with the association of ADAM8 in liver endothelial cells.

ADAM8 KD was observed to induce apoptosis in hepatoma cell lines (Hepa1-6 & HepG2 but the tunel staining experiments revealed no considerable effect of ADAM8 KO on apoptosis in the liver. However, to study this in detail further experiments are needed which may include stimulating the hepatocyte apoptosis by a hepatotoxic agent such as D-GalN and analysing the effect of ADAM8 KO on liver cell apoptosis. It has been described that liver apoptosis is increased with aging (Zhong et al., 2017); hence the livers of ADAM8 KO mice at an older age could be studied to get a deep insight into the relationship of ADAM8 and apoptosis in the liver. Regulation of apoptosis by ADAM8 should be studied in a liver inflammatory and HCC model side by side to explore whether ADAM8 exhibits different mechanisms during inflammation and cancer.

132

Summary

6 Summary

The liver is the main site for the metabolism of lipids, proteins, and carbohydrates and is constantly exposed to the gut-derived metabolites such as lipopolysaccharides (LPS) and toxins which could normally trigger an immune response in the liver resulting in liver inflammation. LPS is also involved in the development and progression of chronic liver injury which includes viral hepatitis, alcoholic liver disease, and non-alcoholic fatty liver disease (NAFLD). NAFLD includes a spectrum of diseases ranging from simple steatosis to a progressive form of the disease that is non-alcoholic steatohepatitis which can further progress to cirrhosis and hepatocellular carcinoma (HCC).

During the past decades, ADAM family members have been discussed vastly for their role in the development of inflammation and cancer. ADAM8 is one of the important members of the ADAM family that is strongly associated with inflammation and metastasis, not only via its catalytic activity but also via interaction with other cell surface proteins. The present study aimed to establish and explore the relationship of ADAM8 with liver inflammation and liver carcinoma.

In inflammatory mouse models such as NAFLD, LPS, bile duct ligation (BDL) and after partial hepatectomy the mRNA expression of ADAM8 was upregulated compared to healthy controls. The enhanced mRNA expression of ADAM8 in the tested mouse models was associated with elevated expression of TNFα and IL-6. In parallel, the regulation of ADAM8 expression was studied in-vitro using different cultured liver cell types. ADAM8 expression was highly upregulated on mRNA and protein levels in human and murine hepatocyte cell lines, endothelial cell lines and liver stellate cells and also in primary murine hepatocytes, under NAFLD conditions. ADAM8 expression was then silenced in murine cells by using siRNA and in human cells using shRNA. The induction of released TNFα, IL-6, IL-8/KC, and CX3CL1 showed a positive association with ADAM8 expression in almost all cell types. Moreover, ADAM8 KD also reduced the mRNA expression of αSMA in liver stellate cells.

The role of ADAM8 for the response to LPS was studied by using ADAM8 KD liver cells and ADAM8 knockout (KO) mice. Primary murine hepatocytes were also

133

Summary obtained from healthy control (WT) and ADAM8 KO mice and treated with LPS. LPS treatment increased the expression of ADAM8 in primary hepatocytes from control mice and in hepatocyte and endothelial cell lines. Along with this, the expression and release of TNFα and IL-6 were also increased and this response was reduced upon ADAM8 silencing. For in-vivo investigations, healthy controls and ADAM8 KO mice were either treated with saline or LPS to induce acute liver inflammation. LPS treatment elevated the mRNA expression of ADAM8, TNFα and IL-6 in healthy controls. ADAM8 KO appeared to reduce the expression of IL-6 only but this was not significant due to high variability among the animals. The release of TNFα and IL-6, and the liver enzyme levels were not much induced by LPS treatment. This may be explained by these circumstances that that this was a mild inflammation in the liver which could only elevate the mRNA expression of cytokines.

The expression of ADAM8 is also highly upregulated in various cancers, which is correlated often with poor prognosis. In the present study, ADAM8 expression was found enhanced in HCC liver tissues. The comparison of ADAM8 expression in hepatocyte cell lines (hepatoma cell lines; HepG2 & Hepa1-6) and primary hepatocytes showed that ADAM8 is expressed at a much higher level in hepatoma cell lines. ADAM8 KD in hepatoma cell lines decreased cell proliferation, cell migration and cell invasion while ADAM8 overexpression increased all these cellular activities. Endothelial cells also showed decreased cell proliferation, migration and invasion upon ADAM8 KD. Additionally, tube formation capability of endothelial cells was reduced after ADAM8 KD. The apoptosis was highly induced in ADAM8 KD hepatoma cells and decreased upon ADAM8 overexpression. Furthermore, a positive relationship of ADAM8 was established with β1 integrin expression and activation of downstream signalling molecules including FAK, Src kinase, MAPK and Rho GTPase using hepatoma cell lines. These results indicate the critical role of ADAM8 in regulating metastasis via activating the β1-integrin-FAK-Rho axis in HCC cells. ADAM8 was also found essential for angiogenesis and targeting ADAM8 could not only control metastasis and proliferation but also angiogenesis in HCC.

134

Summary Zusammenfassung

Die Leber ist der Hauptort der Metabolisierung von Lipiden, Proteinen und Kohlenhydraten. Aus dem Darm stammende Abbauprodukte wie Lipopolysaccharid (LPS) oder Toxine können eine Immunantwort in der Leber hervorrufen, welche zu einer Leberentzündung führen kann. Zudem kann LPS die Entwicklung chronischer Leberschäden beeinflussen, welche bei Erkrankungen wie der Virushepatitis, der alkoholischen Lebererkrankungen und der nichtalkoholische Fettlebererkrankungen (NAFLD) zu beobachten sind. NAFLD umfasst ein Spektrum von Krankheiten, das von einer einfachen Steatose ausgehend zu einer nichtalkoholischen Steatohepatitis, einer fortschreitenden Zirrhose und schließlich einem hepatozellulären Karzinom (HCC) reicht.

In den letzten Jahrzehnten wurden Mitglieder der A Disintegrin And Metalloproteinase (ADAM)-Familie ausführlich hinsichtlich ihrer Rolle bei der Entwicklung von Inflammation und Krebs untersucht. ADAM8 als Mitglied der ADAM-Familie beeinflusst nicht nur durch seine katalytische Aktivität Prozesse der Entzündung und Metastasierung, sondern auch durch seine Wechselwirkung mit anderen Zelloberflächenproteinen. Die vorliegende Studie zielte darauf ab, den Einfluss von ADAM8 in der Leberentzündung und dem Leberkarzinom zu untersuchen. In murinen Entzündungsmodellen wie NAFLD, der LPS-induzierten Entzündung, der Gallengangsligatur (BDL) und der partiellen Hepatektomie stieg die mRNA- Expression von ADAM8 im Vergleich zu gesunden Kontrolltieren an. Die verstärkte mRNA-Expression von ADAM8 in den getesteten Mausmodellen ging mit einer erhöhten mRNA-Expression von Tumornekrosefaktor (TNF) α und Interleukin (IL)-6 einher. Parallel dazu wurde die Regulation der ADAM8-Expression in vitro durch Verwendung verschiedener kultivierter Leberzelltypen untersucht. Eine starke Induktion der ADAM8-Expression unter NALFD-Bedingungen konnte auf transkriptioneller und translationaler Ebene in Zelllinien humaner und muriner Hepatozyten (Hepatom-Zelllinien; HepG2 & Hepa1-6), in humanen und murinen Endothelzelllinien und hepatischen Sternzellen, als auch in primären murinen Hepatozyten nachgewiesen werden. Eine Herabregulation der ADAM8-Expression in murinen Zellen durch small interfering RNA (siRNA) und in humanen Zellen durch short hairpin RNA (shRNA) zeigte, dass die Induktion von freigesetztem TNFα, IL-6,

135

Summary IL-8 / keratinocytes-derived chemokine (KC) und CX3CL1 in fast allen Zelltypen positiv mit der ADAM8-Expression assoziiert ist. Darüber hinaus reduzierte der ADAM8-Knockdown die mRNA-Expression von α smooth muscle actin (αSMA) in Lebersternzellen.

Die Rolle von ADAM8 in der durch LPS induzierten entzündlichen Reaktion wurde unter Verwendung von primären Hepatozyten und eines murinen in vivo Modells untersucht. Primäre murine Hepatozyten aus gesunden Kontroll- (WT) und ADAM8- KO-Mäusen wurden präpariert und in vitro mit LPS behandelt. Die LPS-Behandlung führte zu einem Anstieg der ADAM8-Expression in den primären Hepatozyten der Kontrolltiere, ein Effekt, der auch in Hepatozyten- und Endothelzelllinien beobachtet wurde. Gleichzeitig stiegt sowohl die Expression als auch die Freisetzung von TNFα und IL-6. Dieser Effekt wurde durch den Knockdown bzw. Knockout von ADAM8 verringert. Für in vivo-Untersuchungen wurden gesunde Kontroll-(WT) und ADAM8- KO-Mäuse entweder mit Kochsalzlösung oder LPS behandelt, um eine akute Leberentzündung zu induzieren. In Kontrolltieren führte die LPS-Behandlung zu einem Anstieg der mRNA-Expression von ADAM8, TNFα und IL-6. Der ADAM8-KO schien nur die Expression von IL-6 zu reduzieren, was jedoch aufgrund der hohen Variabilität unter den Tieren keine statistische Signifikanz erreichte. Die Freisetzung von TNFα und IL-6, sowie die Leberenzymwerte wurden durch die LPS-Behandlung nicht stark induziert. Dies kann dadurch erklärt werden, dass es sich hier nur um eine leichte Entzündung in der Leber handelte, welche die mRNA-Expression von Zytokinen nur geringfügig erhöhte.

Die Expression von ADAM8 ist auch bei verschiedenen Krebsarten stark induziertun korreliert häufig mit einer schlechten Prognose. In der vorliegenden Studie wurde festgestellt, dass die ADAM8-Expression in HCC-Lebergeweben erhöht ist. Der Vergleich der ADAM8-Expression in Hepatozyten-Zelllinien (Hepatom-Zelllinien; HepG2 & Hepa1-6) und primären Hepatozyten zeigte, dass ADAM8 in Hepatom- Zelllinien auf einem viel höheren Niveau exprimiert wird. Die Herabregulation von ADAM8 in Hepatom-Zelllinien verringerte die Zellproliferation, die Zellmigration und die Zellinvasion, während die ADAM8-Überexpression all diese zellulären Aktivitäten erhöhte. Auch Endothelzellen zeigten eine verminderte Zellproliferation, Migration und Invasion bei ADAM8-Knockdown. Zusätzlich war die Fähigkeit zur Bildung von

136

Summary Tubuli in Endothelzellen nach ADAM8-Knockdown verringert. Die Herabregulation von ADAM8 in Hepatomzellen führte zu einer starken Induktion von Apoptose, welche durch die Überexpression der Protease reduziert wurde. Darüber hinaus wurde eine positive Beziehung von ADAM8 zur β1-Integrin-Expression und zur Aktivierung von nachgeschalteten Signalmolekülen einschließlich focal adhesion kinase (FAK), Src- Kinase, mitogen-activated protein kinase (MAPK) und Rho-GTPase unter Verwendung von Hepatomzelllinien nachgewiesen. Diese Ergebnisse belegen eine entscheidende Rolle von ADAM8 bei der Regulation der Metastasierung durch die Aktivierung der β1-Integrin-FAK-Rho-Achse in HCC-Zellen. Zudem fördert ADAM8 die Angiogenese. Damit stellt ADAM8 ein Zielmolekül dar, über welches nicht nur die Metastasierung und Proliferation, sondern auch die Angiogenese bei HCC therapeutisch beeinflusst werden könnte.

137

Literature

7 Literature

Ainola, M., Li, T. F., Mandelin, J., Hukkanen, M., Choi, S. J., Salo, J., & Konttinen, Y. T. (2009). Involvement of a disintegrin and a metalloproteinase 8 (ADAM8) in osteoclastogenesis and pathological bone destruction. Annals of the Rheumatic Diseases, 68(3), 427–434. https://doi.org/10.1136/ard.2008.088260 Amour, A., English, W. R., Knäuper, V., Murphy, G., Webster, A., Slocombe, P. M., Docherty, A. J. P., & Becherer, J. D. (2002). The enzymatic activity of ADAM8 and ADAM9 is not regulated by TIMPs. FEBS Letters, 524(1–3), 154–158. https://doi.org/10.1016/S0014-5793(02)03047-8 Arnaoutova, I., & Kleinman, H. K. (2010). In vitro angiogenesis: Endothelial cell tube formation on gelled basement membrane extract. Nature Protocols, 5(4), 628– 635. https://doi.org/10.1038/nprot.2010.6 Babendreyer, A. (2018). Influence of laminar shear stress on transmembrane chemokines and proteases of the ADAM family in endothelial cells. Bartlett, D. W., & Davis, M. E. (2006). Insights into the kinetics of siRNA-mediated gene silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Research, 34(1), 322–333. https://doi.org/10.1093/nar/gkj439 Bartsch, J. W., Wildeboer, D., Koller, G., Naus, S., Rittger, A., Moss, M. L., Minai, Y., & Jockusch, H. (2010). Tumor necrosis factor-α (TNF-α) regulates shedding of TNF-α receptor 1 by the metalloprotease-disintegrin ADAM8: Evidence for a protease-regulated feedback loop in neuroprotection. Journal of Neuroscience, 30(36), 12210–12218. https://doi.org/10.1523/JNEUROSCI.1520-10.2010 Bertino, G., Demma, S., Ardiri, A., Proiti, M., Gruttadauria, S., Toro, A., Malaguarnera, G., Bertino, N., Malaguarnera, M., Malaguarnera, M., & Carlo, I. Di. (2014). Hepatocellular Carcinoma : Novel Molecular Targets in Carcinogenesis for Future Therapies. BioMed Research International, 2014. https://doi.org/https://doi.org/10.1155/2014/203693 Bhatia, M., Zemans, R. R. & Jeyaseelan, S. (2012). Role of chemokines in pathogenesis of acute lung injury. American Journal of Cellular and Molecular Biology, 46(5), 566-572. doi: 10.1165/rcmb.2011-0392TR Block, T. M., Mehta, A. S., Fimmel, C. J., & Jordan, R. (2003). Molecular viral oncology of hepatocellular carcinoma. Oncogene, 22, 5093–5107. https://doi.org/10.1038/sj.onc.1206557 Bode, W., Gomis-Rüth, F. X., & Stöckler, W. (1993). Astacins, serralysins, snake venom and matrix metalloproteinases exhibit identical zinc-binding environments (HEXXHXXGXXH and Met-turn) and topologies and should be grouped into a common family, the “metzincins.” FEBS Letters, 331(1–2), 134–140. https://doi.org/10.1016/0014-5793(93)80312-I Bologna-Molina, R., Mosqueda-Taylor, A., Molina-Frechero, N., Mori-Estevez, A. D., & Sánchez-Acuña, G. (2013). Comparison of the value of PCNA and Ki-67 as markers of cell proliferation in ameloblastic tumors. Medicina Oral, Patologia Oral y Cirugia Bucal, 18(2), e174–e179. https://doi.org/10.4317/medoral.18573

138

Literature Bouquet, C., Lamandé, N., Brand, M., Gasc, J. M., Jullienne, B., Faure, G., Griscelli, F., Opolon, P., Connault, E., Perricaudet, M., & Corvol, P. (2006). Suppression of angiogenesis, tumor growth, and metastasis by adenovirus-mediated gene transfer of human angiotensinogen. Molecular Therapy, 14(2), 175–182. https://doi.org/10.1016/j.ymthe.2006.01.017 Bourd-Boittin, K., Basset, L., Bonnier, D., L’Helgoualc’H, A., Samson, M., & Théret, N. (2009). CX3CL1/fractalkine shedding by human hepatic stellate cells: Contribution to chronic inflammation in the liver. Journal of Cellular and Molecular Medicine, 13(8A), 1526–1535. https://doi.org/10.1111/j.1582- 4934.2009.00787.x Braunersreuther, V., Viviani, G. L., Mach, F., & Montecucco, F. (2012). Role of cytokines and chemokines in non-alcoholic fatty liver disease. World Journal of Gastroenterology, 18(8), 727–735. https://doi.org/10.3748/wjg.v18.i8.727 Bray, F., Ferlay, J., Soerjomataram, I., Siegel, R. L., Torre, L. A., & Jemal, A. (2018). Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer Journal for Clinicians, 68(6), 394–424. https://doi.org/10.3322/caac.21492 Breiner, K. M., Schaller, H., & Knolle, P. A. (2001). Endothelial cell-mediated uptake of a hepatitis B virus: A new concept of liver targeting of hepatotropic microorganisms. Hepatology, 34(4), 803–808. https://doi.org/10.1053/jhep.2001.27810 Buckley, C. A., Rouhani, F. N., Kaler, M., Adamik, B., Hawari, F. I., & Levine, S. J. (2005). Amino-terminal TACE prodomain attenuates TNFR2 cleavage independently of the cysteine switch. American Journal of Physiology - Lung Cellular and Molecular Physiology, 288, 1132–1138. https://doi.org/10.1152/ajplung.00429.2004 Calalb, M. B., Polte, T. R., & Hanks, S. K. (1995). Tyrosine phosphorylation of focal adhesion kinase at sites in the catalytic domain regulates kinase activity: a role for Src family kinases. Molecular and Cellular Biology, 15(2), 954–963. https://doi.org/10.1128/mcb.15.2.954 Cauli, O., Rodrigo, R., Boix, J., Piedrafita, B., Agusti, A., & Felipo, V. (2008). Acute liver failure-induced death of rats is delayed or prevented by blocking NMDA receptors in brain. American Journal of Physiology - Gastrointestinal and Liver Physiology, 295(3), G503–G511. https://doi.org/10.1152/ajpgi.00076.2008 Chae, M. S., Moon, K. U., Chung, H. S., Park, C. S., Lee, J., Choi, J. H., & Hong, S. H. (2018). Serum interleukin-6 and tumor necrosis factor-α are associated with early graft regeneration after living donor liver transplantation. PLoS ONE, 13(4), 1–13. https://doi.org/10.1371/journal.pone.0195262 Chen, J., Deng, L., Dreymuller, D., Jiang, X., Long, J., Duan, Y., Wang, Y., Luo, M., Lin, F., Mao, L., Muller, B., Koller, G., & Bartsch, J. W. (2016). A novel peptide ADAM8 inhibitor attenuates bronchial hyperresponsiveness and Th2 cytokine mediated inflammation of murine asthmatic models. Scientific Reports, 6. https://doi.org/10.1038/srep30451 Chen, J., Jiang, X., Duan, Y., Long, J., Bartsch, J. W., & Deng, L. (2013). ADAM8 in Asthma Friend or Foe to Airway Inﬂammation? Translational Review, 49(6), 875– 139

Literature 884. https://doi.org/10.1165/rcmb2013-0168TR Chen, J. S., Huang, X. H., Wang, Q., Chen, X. L., Fu, X. H., Tan, H. X., Zhang, L. J., Li, W., & Bi, J. (2010). FAK is involved in invasion and metastasis of hepatocellular carcinoma. Clinical and Experimental Metastasis, 27(2), 71–82. https://doi.org/10.1007/s10585-010-9306-3 Chen, Y., Li, Q., Tu, K., Wang, Y., Wang, X., Liu, D., Chen, C., Liu, D., Yang, R., Qiu, W., & Kang, N. (2020). Focal Adhesion Kinase Promotes Hepatic Stellate Cell Activation by Regulating Plasma Membrane Localization of TGFβ Receptor 2. Hepatology Communications, 4(2), 268–283. https://doi.org/10.1002/hep4.1452 Choi, S. J., Han, J. H., & Roodman, G. D. (2001). ADAM8: A novel osteoclast stimulating factor. Journal of Bone and Mineral Research, 16(5), 814–822. https://doi.org/10.1359/jbmr.2001.16.5.814 Choo, S. P., Tan, W. L., Goh, B. K. P., Tai, W. M., & Zhu, A. X. (2016). Comparison of hepatocellular carcinoma in Eastern versus Western populations. Cancer, 122(22), 3430–3446. https://doi.org/10.1002/cncr.30237.This Conrad, C., Benzel, J., Dorzweiler, K., Cook, L., Schlomann, U., Zarbock, A., Slater, E. P., Nimsky, C., & Bartsch, J. W. (2019). ADAM8 in invasive cancers: Links to tumor progression, metastasis, and chemoresistance. Clinical Science, 133(1), 83– 99. https://doi.org/10.1042/CS20180906 Conrad, C., Götte, M., Schlomann, U., Roessler, M., Pagenstecher, A., Anderson, P., Preston, J., Pruessmeyer, J., Ludwig, A., Li, R., Kamm, R. D., Ritz, R., Carl, B., Nimsky, C., & Bartsch, J. W. (2018). ADAM8 expression in breast cancer derived brain metastases: Functional implications on MMP-9 expression and transendothelial migration in breast cancer cells. International Journal of Cancer, 142(4), 779–791. https://doi.org/10.1002/ijc.31090 Cousin, H., Gaultier, A., Bleux, C., Darribère, T., & Alfandari, D. (2000). PACSIN2 is a regulator of the metalloprotease/disintegrin ADAM13. Developmental Biology, 227(1), 197–210. https://doi.org/10.1006/dbio.2000.9871 Del Re, D. P., Miyamoto, S., & Brown, J. H. (2008). Focal adhesion kinase as a RhoA- activable signaling scaffold mediating akt activation and cardiomyocyte protection. Journal of Biological Chemistry, 283(51), 35622–35629. https://doi.org/10.1074/jbc.M804036200 Desgrosellier, J. S., & Cheresh, D. A. (2010). Integrins in cancer: Biological implications and therapeutic opportunities. Nature Reviews Cancer, 10(1), 9–22. https://doi.org/10.1038/nrc2748 Domínguez-Luis, M., Lamana, A., Vazquez, J., García-Navas, R., Mollinedo, F., Sánchez-Madrid, F., Díaz-González, F., & Urzainqui, A. (2011). The metalloprotease ADAM8 is associated with and regulates the function of the adhesion receptor PSGL-1 through ERM proteins. European Journal of Immunology, 41(12), 3436–3442. https://doi.org/10.1002/eji.201141764 Dong, F., Eibach, M., Bartsch, J. W., Dolga, A. M., Schlomann, U., Conrad, C., Schieber, S., Schilling, O., Biniossek, M. L., Culmsee, C., Strik, H., Koller, G., Carl, B., & Nimsky, C. (2015). The metalloprotease-disintegrin ADAM8

140

Literature contributes to temozolomide chemoresistance and enhanced invasiveness of human glioblastoma cells. Neuro-Oncology, 17(11), 1474–1485. https://doi.org/10.1093/neuonc/nov042 Dreymueller, D., Martin, C., Kogel, T., Pruessmeyer, J., Hess, F. M., Horiuchi, K., Uhlig, S., & Ludwig, A. (2012). Lung endothelial ADAM17 regulates the acute inflammatory response to lipopolysaccharide. EMBO Molecular Medicine, 4, 412–423. https://doi.org/10.1002/emmm.201200217 Dreymueller, D., Pruessmeyer, J., Schumacher, J., Fellendorf, S., Hess, F. M., Seifert, A., Babendreyer, A., Bartsch, J. W., & Ludwig, A. (2017). The metalloproteinase ADAM8 promotes leukocyte recruitment in vitro and in acute lung inflammation. American Journal of Physiology - Lung Cellular and Molecular Physiology, 313, 602–614. https://doi.org/10.1152/ajplung.00444.2016 Duan, B., Liu, Y., Hu, H., Shi, F. G., Liu, Y. L., Xue, H., Yun, X. Y., Yan, M. Y., Han, X. R., Chen, A. F., Wang, Y., & Li, Z. H. (2019). Notch1-ADAM8 positive feedback loop regulates the degradation of chondrogenic extracellular matrix and osteoarthritis progression. Cell Communication and Signaling, 17(1), 1–17. https://doi.org/10.1186/s12964-019-0443-2 Duffy, M. J., McKiernan, E., O’Donovan, N., & McGowan, P. M. (2009). Role of ADAMs in cancer formation and progression. Clinical Cancer Research, 15(4), 1140–1144. https://doi.org/10.1158/1078-0432.CCR-08-1585 Edwards, D. R., Handsley, M. M., & Pennington, C. J. (2009). The ADAM metalloproteinases. Molecular Aspects of Medicine, 29, 258–289. https://doi.org/10.1016/j.mam.2008.08.001 Eto, K., Huet, C., Tarui, T., Kupriyanov, S., Liu, H. Z., Puzon-McLaughlin, W., Zhang, X. P., Sheppard, D., Engvall, E., & Takada, Y. (2002). Functional classification of ADAMs based on a conserved motif for binding to integrin α9β1. Implications for sperm-egg binding and other cell interactions. Journal of Biological Chemistry, 277(20), 17804–17810. https://doi.org/10.1074/jbc.M200086200 Fang, H., Liu, A., Chen, X., Cheng, W., Dirsch, O., & Dahmen, U. (2018). The severity of LPS induced inflammatory injury is negatively associated with the functional liver mass after LPS injection in rat model. Journal of Inflammation, 15(1), 1–9. https://doi.org/10.1186/s12950-018-0197-4 Farges, O., & Dokmak, S. (2010). Malignant transformation of liver adenoma: An analysis of the literature. Digestive Surgery, 27(1), 32–38. https://doi.org/10.1159/000268405 Feldstein, A. E., Canbay, A., Angulo, P., Taniai, M., Burgart, L. J., Lindor, K. D., & Gores, G. J. (2003). Hepatocyte apoptosis and Fas expression are prominent features of human nonalcoholic steatohepatitis. Gastroenterology, 125(2), 437– 443. https://doi.org/10.1016/S0016-5085(03)00907-7 Feng, T., Yu, H., Xia, Q., Ma, Y., Yin, H., Shen, Y., & Liu, X. (2017). Cross-talk mechanism between endothelial cells and hepatocellular carcinoma cells via growth factors and integrin pathway promotes tumor angiogenesis and cell migration. Oncotarget, 8(41), 69577–69593. https://doi.org/10.18632/oncotarget.18632

141

Literature Flannery, C. R., Zeng, W., Corcoran, C., Collins-Racie, L. A., Chockalingam, P. S., Hebert, T., Mackie, S. A., McDonagh, T., Crawford, T. K., Tomkinson, K. N., LaVallie, E. R., & Morris, E. A. (2002). Autocatalytic cleavage of ADAMTS-4 (aggrecanase-1) reveals multiple glycosaminoglycan-binding sites. Journal of Biological Chemistry, 277(45), 42775–42780. https://doi.org/10.1074/jbc.M205309200 Foley, S. C., Mogas, A. K., Olivenstein, R., Fiset, P. O., Chakir, J., Bourbeau, J., Ernst, P., Lemière, C., Martin, J. G., & Hamid, Q. (2007). Increased expression of ADAM33 and ADAM8 with disease progression in asthma. Journal of Allergy and Clinical Immunology, 119(4), 863–871. https://doi.org/10.1016/j.jaci.2006.12.665 Fourie, A. M., Coles, F., Moreno, V., & Karlsson, L. (2003). Catalytic activity of ADAM8, ADAM15, and MDC-L (ADAM28) on synthetic peptide substrates and in ectodomain cleavage of CD23. Journal of Biological Chemistry, 278(33), 30469–30477. https://doi.org/10.1074/jbc.M213157200 Franken, N. A. P., Rodermond, H. M., Stap, J., Haveman, J., & van Bree, C. (2006). Clonogenic assay of cells in vitro. Nature Protocols, 1(5), 2315–2319. https://doi.org/10.1038/nprot.2006.339 Fritzsche, F. R., Jung, M., Xu, C., Rabien, A., Schicktanz, H., Stephan, C., Dietel, M., Jung, K., & Kristiansen, G. (2006). ADAM8 expression in prostate cancer is associated with parameters of unfavorable prognosis. Virchows Archiv, 449(6), 628–636. https://doi.org/10.1007/s00428-006-0315-1 Fujita, T., & Narumiya, S. (2016). Roles of hepatic stellate cells in liver inflammation: A new perspective. Inflammation and Regeneration, 36(1), 1–6. https://doi.org/10.1186/s41232-016-0005-6 Gabarra-Niecko, V., Schaller, M.D. & Dunty, J. . (2003). FAK regulates biological processes important for the pathogenesis of cancer. Cancer Metastasis Rev, 22, 359–374. https://doi.org/https://doi.org/10.1023/A:1023725029589 Ganz, M., Bukong, T. N., Csak, T., Saha, B., Park, J. K., Ambade, A., Kodys, K., & Szabo, G. (2015). Progression of non-alcoholic steatosis to steatohepatitis and fibrosis parallels cumulative accumulation of danger signals that promote inflammation and liver tumors in a high fat-cholesterol-sugar diet model in mice. Journal of Translational Medicine, 13(193). https://doi.org/10.1186/s12967-015- 0552-7 Gao, B., Ahmed, M. F., Nagy, L. E. & Tsukamoto, H. (2018). Inflammatory pathways in alcoholic steatohepatitis. Journal of Hepatology, 70, 249-259. Gaultier, A., Cousin, H., Darribère, T., & Alfandari, D. (2002). ADAM13 disintegrin and cysteine-rich domains bind to the second heparin-binding domain of fibronectin. Journal of Biological Chemistry, 277(26), 23336–23344. https://doi.org/10.1074/jbc.M201792200 Giebeler, N., & Zigrino, P. (2016). A disintegrin and metalloprotease (ADAM): Historical overview of their functions. Toxins, 8(4). https://doi.org/10.3390/toxins8040122 Gnani, D., Romito, I., Artuso, S., Chierici, M., Stefanis, C. De, Panera, N., Crudele, A.,

142

Literature Ceccarelli, S., Carcarino, E., Oria, V. D., Porru, M., Giorda, E., Ferrari, K., Miele, L., Villa, E., Balsano, C., Pasini, D., Furlanello, C., Locatelli, F., Leonetti, C. (2017). Focal adhesion kinase depletion reduces human hepatocellular carcinoma growth by repressing enhancer of zeste homolog 2. Cell Death and Differentiation, 24, 889–902. https://doi.org/10.1038/cdd.2017.34 Golubovskaya, V. M., & Cance, W. (2010). Focal Adhesion Kinase and p53 signal transduction pathways in cancer. Frontiers in Bioscience, 15(3), 901–912. https://doi.org/10.2741/3653 Gomez-Gaviro, M., Dominguez-Luis, M., Canchado, J., Calafat, J., Janssen, H., Lara- Pezzi, E., Fourie, A., Tugores, A., Valenzuela-Fernandez, A., Mollinedo, F., Sanchez-Madrid, F., & Diaz-Gonzalez, F. (2007). Expression and Regulation of the Metalloproteinase ADAM-8 during Human Neutrophil Pathophysiological Activation and Its Catalytic Activity on L-Selectin Shedding. The Journal of Immunology, 178, 8053–8063. https://doi.org/10.4049/jimmunol.178.12.8053 Guan, J. L. (2010). Integrin signaling through FAK in the regulation of mammary stem cells and breast cancer. IUBMB Life, 62(4), 268–276. https://doi.org/10.1002/iub.303 Hall, T., Leone, J. W., Wiese, J. F., Griggs, D. W., Pegg, L. E., Pauley, A. M., Tomasselli, A. G., & Zack, M. D. (2009). Autoactivation of human ADAM8: A novel preprocessing step is required for catalytic activity. Bioscience Reports, 29(4), 217–228. https://doi.org/10.1042/BSR20080145 Hamesch, k., Borkham-Kamphorst, E., Strnad, P., & Weiskirchen, R. (2015). Lipopolysaccharide-induced inflammatory liver injury in mice. Laboratory Animals, 49, 37–46. https://doi.org/10.1177/0023677215570087 Hammoutene, A., & Rautou, P. E. (2019). Role of liver sinusoidal endothelial cells in non-alcoholic fatty liver disease. Journal of Hepatology, 70(6), 1278–1291. https://doi.org/10.1016/j.jhep.2019.02.012 Hanahan, D., & Weinberg, R. A. (2011). Hallmarks of cancer: The next generation. Cell, 144(5), 646–674. https://doi.org/10.1016/j.cell.2011.02.013 He, N., Jin, Q., Shi, L., Wu, K., Wang, G., & Tao, K. (2016). ADAM8 promotes gastric cancer cell invasiveness via EGFR/ERK signaling pathway to upregulate matrix metalloproteinases 2 and 9 expression. International Journal of Clinical and Experimental Pathology, 9(10), 9963–9973. Heim, J. B., McDonald, C. A., Wyles, S. P., Sominidi-Damodaran, S., Squirewell, E. J., Li, M., Motsonelidze, C., Böttcher, R. T., van Deursen, J., & Meves, A. (2018). FAK auto-phosphorylation site tyrosine 397 is required for development but dispensable for normal skin homeostasis. PLoS ONE, 13(7), 1–14. https://doi.org/10.1371/journal.pone.0200558 Hernández, I., Moreno, J. L., Zandueta, C., Montuenga, L., & Lecanda, F. (2010). Novel alternatively spliced ADAM8 isoforms contribute to the aggressive bone metastatic phenotype of lung cancer. Oncogene, 29(26), 3758–3769. https://doi.org/10.1038/onc.2010.130 Hess, F. M., 2012. The role of the metalloproteases ADAM8, 9, 10 and 17 in leukocyte migration in vitro.

143

Literature Heymann, F., & Tacke, F. (2016). Immunology in the liver-from homeostasis to disease. In Nature Reviews Gastroenterology and Hepatology, 13(2), 88–110. Nature Publishing Group. https://doi.org/10.1038/nrgastro.2015.200 Hol, J., Wilhelmsen, L., & Haraldsen, G. (2010). The murine IL-8 homologues KC, MIP-2, and LIX are found in endothelial cytoplasmic granules but not in Weibel- Palade bodies. Journal of Leukocyte Biology, 87(3), 501–508. https://doi.org/10.1189/jlb.0809532 Huang, C. R., Lee, C. T., Chang, K. Y., Chang, W. C., Liu, Y. W., Lee, J. C., & Chen, B. K. (2015). Down-regulation of ARNT promotes cancer metastasis by activating the fibronectin/integrin β1/FAK axis. Oncotarget, 6(13), 11530–11546. https://doi.org/10.18632/oncotarget.3448 Humphries, J. D., Chastney, M. R., Askari, J. A., & Humphries, M. J. (2019). Signal transduction via integrin adhesion complexes. In Current Opinion in Cell Biology (Vol. 56, pp. 14–21). Elsevier Ltd. https://doi.org/10.1016/j.ceb.2018.08.004 Huveneers, S., & Danen, E. H. J. (2009). Adhesion signaling - Crosstalk between integrins, Src and Rho. Journal of Cell Science, 122(8), 1059–1069. https://doi.org/10.1242/jcs.039446 Iba, K., Albrechtsen, R., Gilpin, B., Fröhlich, C., Loechel, F., Zolkiewska, A., Ishiguro, K., Kojima, T., Liu, W., Langford, J. K., Sanderson, R. D., Brakebusch, C., Fässler, R., & Wewer, U. M. (2000). The cysteine-rich domain of human ADAM 12 supports cell adhesion through syndecans and triggers signaling events that lead to β1 integrin-dependent cell spreading. Journal of Cell Biology, 149(5), 1143– 1155. https://doi.org/10.1083/jcb.149.5.1143 Iida, A., Sakaguchi, K., Sato, K., Sakurai, H., Nishimura, D., Iwaki, A., Takeuchi, M., Kobayashi, M., Misaki, K., Yonemura, S., Kawahara, A., & Sehara-Fujisawa, A. (2010). Metalloprotease-dependent onset of blood circulation in Zebrafish. Current Biology, 20(12), 1110–1116. https://doi.org/10.1016/j.cub.2010.04.052 Imai, T., & Yasuda, N. (2016). Therapeutic intervention of inflammatory/ immune diseases by inhibition of the fractalkine (CX3CL1)-CX3CR1 pathway. Inflammation and Regeneration, 36(1), 16–20. https://doi.org/10.1186/s41232- 016-0017-2 Ishikawa, N., Daigo, Y., Yasui, W., Inai, K., Nishimura, H., Tsuchiya, E., Kohno, N., & Nakamura, Y. (2004). ADAM8 as a novel serological and histochemical marker for lung cancer. Clinical Cancer Research, 10(24), 8363–8370. https://doi.org/10.1158/1078-0432.CCR-04-1436 Ishizuka, H., García-Palacios, V., Lu, G., Subler, M. A., Zhang, H., Boykin, C. S., Choi, S. J., Zhao, L., Patrene, K., Galson, D. L., Blair, H. C., Hadi, T. M., Windle, J. J., Kurihara, N., & Roodman, G. D. (2011). ADAM8 enhances osteoclast precursor fusion and osteoclast formation in vitro and in vivo. Journal of Bone and Mineral Research, 26(1), 169–181. https://doi.org/10.1002/jbmr.199 Itoh, S., Maeda, T., Shimada, M., Aishima, S., Shirabe, K., & Tanaka, S. (2004). Role of Expression of Focal Adhesion Kinase in Progression of Hepatocellular Carcinoma. Clinical Cancer Research, 10, 2812–2817. Ji, T., Li, G., Chen, J., Zhao, J., Li, X., Lin, H., Cai, X., & Cang, Y. (2016). Distinct

144

Literature role of interleukin-6 and tumor necrosis factor receptor-1 in oval cell- mediated liver regeneration and inflammationassociated hepatocarcinogenesis. Oncotarget, 7(41), 66635–66646. https://doi.org/10.18632/oncotarget.11365 Jirillo, E., Caccavo, D., Magrone, T., Piccigallo, E., Amati, L., Lembo, A., Kalis, C., & Gumenscheimer, M. (2002). The role of the liver in the response to LPS: Experimental and clinical findings. In Journal of Endotoxin Research, 8(5), 319– 327. https://doi.org/10.1179/096805102125000641 Kanda, T., Matsuoka, S., Yamazaki, M., Shibata, T., Nirei, K., Takahashi, H., Kaneko, T., Fujisawa, M., Higuchi, T., Nakamura, H., Matsumoto, N., Yamagami, H., Ogawa, M., Imazu, H., Kuroda, K., & Moriyama, M. (2018). Apoptosis and non- alcoholic fatty liver diseases. World Journal of Gastroenterology, 24(25), 2661– 2672. https://doi.org/10.3748/wjg.v24.i25.2661 Karlmark, K. R., Zimmermann, H. W., Roderburg, C., Gassler, N., Wasmuth, H. E., Luedde, T., Trautwein, C., & Tacke, F. (2010). The fractalkine receptor CX3CR1 protects against liver fibrosis by controlling differentiation and survival of infiltrating hepatic monocytes. Hepatology, 52(5), 1769–1782. https://doi.org/10.1002/hep.23894 Katyal, S. J. H. O., Peterson, M. S., Ferris, J. V, Carr, B. S., & Baron, R. L. (2000). Extrahepatic Metastases of Hepatocellular Carcinoma. Radiology, 216(3), 698– 703. https://doi.org/https://doi.org/10.1148/radiology.216.3.r00se24698 Kelly, K., Hutchinson, G., Nebenius-Oosthuizen, D., Smith, A. J. H., Bartsch, J. W., Horiuchi, K., Rittger, A., Manova, K., Docherty, A. J. P., & Blobel, C. P. (2005). Metalloprotease-disintegrin ADAM8: Expression analysis and targeted deletion in mice. Developmental Dynamics, 232, 221–231. https://doi.org/10.1002/dvdy.20221 Kheder, R. K., Hobkirk, J., & Stover, C. M. (2016). In vitro modulation of the LPS- induced proinflammatory profile of hepatocytes and macrophages-approaches for intervention in obesity? Frontiers in Cell and Developmental Biology, 4(JUN). https://doi.org/10.3389/fcell.2016.00061 King, N. E., Zimmermann, N., Pope, S. M., Fulkerson, P. C., Nikolaidis, N. M., Mishra, A., Witte, D. P., & Rothenberg, M. E. (2004). Expression and regulation of a disintegrin and metalloproteinase (ADAM) 8 in experimental asthma. American Journal of Respiratory Cell and Molecular Biology, 31(3), 257–265. https://doi.org/10.1165/rcmb.2004-0026OC Kmiec, Z. (2001). Cooperation of liver cells in health and disease. https://doi.org/10.1007/978-3-642-56553-3 Knolle, P. A., & Thimme, R. (2014). Hepatic immune regulation and its involvement in viral hepatitis infection. In Gastroenterology, 146(5), 1193–1207. W.B. Saunders. https://doi.org/10.1053/j.gastro.2013.12.036 Knook, D. L., Blansjaar, N., & Ch SLEYSTER, E. (1977). Isolation and characterization of Kupffer and endothelial cels from rhe rat liver. Experimental Cell Research, 109, 317–329. Knook, D. L., & Seffelaar, A. M. (1982). Fat storing cells of the liver; Their isolation and purification. Experimental Cell Research, 139, 468-471.

145

Literature Koller, G., Schlomann, U., Golfi, P., Ferdous, T., Naus, S., & Bartsch, J. (2009). ADAM8/MS2/CD156, an Emerging Drug Target in the Treatment of Inflammatory and Invasive Pathologies. Current Pharmaceutical Design, 15, 2272–2281. https://doi.org/10.2174/138161209788682361 Koyama, Y., & Brenner, D. A. (2017). Liver inflammation and fibrosis. In Journal of Clinical Investigation (Vol. 127, Issue 1, pp. 55–64). American Society for Clinical Investigation. https://doi.org/10.1172/JCI88881 Kugelmas, M., Hill, D. B., Vivian, B., Marsano, L., & McClain, C. J. (2003). Cytokines and NASH: A pilot study of the effects of lifestyle modification and vitamin E. Hepatology, 38(2), 413–419. https://doi.org/10.1053/jhep.2003.50316 Kuno, K., Kanada, N., Nakashirma, E., Fujiki, F., Ichimura, F., & Matsushima, K. (1997). Molecular cloning of a gene encoding a new type of metalloproteinase- disintegrin family protein with thrombospondin motifs as an inflammation associated gene. Journal of Biological Chemistry, 272(1), 556–562. https://doi.org/10.1074/jbc.272.1.556 Le, H. T., Atif, J., Mara, D. L., Castellana, B., Treissman, J., Baltayeva, J., & Beristain, A. G. (2018). ADAM8 localizes to extravillous trophoblasts within the maternal- fetal interface and potentiates trophoblast cell line migration through a β1 integrin- mediated mechanism. Molecular Human Reproduction, 24(10), 495–509. https://doi.org/10.1093/molehr/gay034 Li, S. Q., Zhu, S., Wan, X.-D., Xu, Z.-S., & Ma, Z. (2014). Neutralization of ADAM8 ameliorates liver injury and accelerates liver repair in carbon tetrachloride-induced acute liver injury. The Journal of Toxicological Sciences, 39(2), 339-351. https://doi.org/10.2131/jts.39.339 Li, S. Q., Wang, D. M., Zhu, S., Ma, Z., Li, R. F., Xu, Z. S., & Han, H. M. (2015). The important role of ADAM8 in the progression of hepatocellular carcinoma induced by diethylnitrosamine in mice. Human and Experimental Toxicology. https://doi.org/10.1177/0960327114567767 Li, S. Q., Hu, Z. H., Zhu, S., Wang, D. M., Han, H. M., & Lu, H. J. (2015). The Effect of ADAM8 on the Proliferation and Apoptosis of Hepatocytes and Hepatoma Carcinoma Cells. Journal of Biochemical and Molecular Toxicology. https://doi.org/10.1002/jbt.21737 Li, T., Kang, G., Wang, T., & Huang, H. (2018). Tumor angiogenesis and anti- angiogenic gene therapy for cancer. Oncology Letters, 16(1), 687–702. https://doi.org/10.3892/ol.2018.8733 Limmer, A., & Knolle, P. A. (2001). Liver Sinusoidal Endothelial Cells: A New Type of Organ-Resident Antigen-Presenting Cell. Archivum Immunologiae et Therapiae Experimentalis, 49, S7–S11. Llovet, J. M., Di Bisceglie, A. M., Bruix, J., Kramer, B. S., Lencioni, R., Zhu, A. X., Sherman, M., Schwartz, M., Lotze, M., Talwalkar, J., & Gores, G. J. (2008). Design and endpoints of clinical trials in hepatocellular carcinoma. In Journal of the National Cancer Institute, 100(10), 698–711. https://doi.org/10.1093/jnci/djn134 Lu, H., Ouyang, W., Huang, C., Lu, H., Ouyang, W., & Huang, C. (2006). Inflammation

146

Literature , a Key Event in Cancer Development Inflammation , a Key Event in Cancer Development. 221–233. https://doi.org/10.1158/1541-7786.MCR-05-0261 Lu, Q., Clemetson, J. M., & Clemetson, K. J. (2005). Snake venoms and hemostasis. Journal of Thrombosis and Haemostasis, 3(8), 1791–1799. https://doi.org/10.1111/j.1538-7836.2005.01358.x Ma, K. L., Wu, Y., Zhang, Y., Wang, G. H., Hu, Z. B., & Ruan, X. Z. (2018). Activation of the CXCL16/CXCR6 pathway promotes lipid deposition in fatty livers of apolipoprotein e knockout mice and HepG2 cells. American Journal of Translational Research, 10(6), 1802–1816. Mahoney, E. T., Benton, R. L., Maddie, M. A., Whittemore, S. R., & Hagg, T. (2009). ADAM8 is selectively up-regulated in endothelial cells and is associated with angiogenesis after spinal cord injury in adult mice. Journal of Comparative Neurology, 512(2), 243–255. https://doi.org/10.1002/cne.21902 Mailand, N., Gibbs-Seymour, I., & Bekker-Jensen, S. (2013). Regulation of PCNA- protein interactions for genome stability. Nature Reviews Molecular Cell Biology, 14(5), 269–282. https://doi.org/10.1038/nrm3562 Mandelin, J., Li, T. F., Hukkanen, M. V. J., Liljeström, M., Chen, Z. K., Santavirta, S., Kitti, U., & Konttinen, Y. T. (2003). Increased expression of a novel osteoclast- stimulating factor, ADAM8, in interface tissue around loosened hip prostheses. Journal of Rheumatology, 30(9), 2033–2038. Marchesini, G., Day, C. P., Dufour, J. F., Canbay, A., Nobili, V., Ratziu, V., Tilg, H., Roden, M., Gastaldelli, A., Yki-Jarvinen, H., Schick, F., Vettor, R., Fruhbeck, G., & Mathus-Vliegen, L. (2016). EASL-EASD-EASO Clinical Practice Guidelines for the management of non-alcoholic fatty liver disease. Journal of Hepatology, 64(6), 1388–1402. https://doi.org/10.1016/j.jhep.2015.11.004 Martin D Knolle, Takahiro Nakajima, Anja Hergrueter, Kushagra Gupta, Francesca Polverino, Vanessa J Craig, Susanne E Fyfe, Muhammad Zahid, Perdita Permaul, Manuela Cernadas, Gilbert Montano, Yohannes Tesfaigzi, Lynette Sholl, Lester Kobzik, Elliot Israel, C. A. O. (2013). Adam8 Limits the Development of Allergic Airway Inflammation in Mice. Journal of Immunology, 190(12), 6434–6449. https://doi.org/doi: 10.4049/jimmunol.1202329 Marvie, P., Lisbonne, M., L’Helgoualc’h, A., Rauch, M., Turlin, B., Preisser, L., Bourd-Boittin, K., Théret, N., Gascan, H., Piquet-Pellorce, C., & Samson, M. (2010). Interleukin-33 overexpression is associated with liver fibrosis in mice and humans. Journal of Cellular and Molecular Medicine, 14(6 B), 1726–1739. https://doi.org/10.1111/j.1582-4934.2009.00801.x Mats W. Johansson, Manav Khanna, Valeriu Bortnov, Douglas S. Annis, C. L., & Nguyen, and D. F. M. (2017). IL-5-stimulated eosinophils adherent to periostin undergo stereotypic morphological changes and ADAM8-dependent migration. Clin Exp Allergy, 47(10), 1263–1274. https://doi.org/10.1111/cea.12934 Matsuno, O., Miyazaki, E., Nureki, S., Ueno, T., Kumamoto, T., & Higuchi, Y. (2006). Role of ADAM8 in experimental asthma. Immunology Letters. https://doi.org/10.1016/j.imlet.2005.07.006 Matthews, V. B., Allen, T. L., Risis, S., Chan, M. H. S., Henstridge, D. C., Watson, N.,

147

Literature Zaffino, L. A., Babb, J. R., Boon, J., Meikle, P. J., Jowett, J. B., Watt, M. J., Jansson, J. O., Bruce, C. R., & Febbraio, M. A. (2010). Interleukin-6-deficient mice develop hepatic inflammation and systemic insulin resistance. Diabetologia, 53(11), 2431–2441. https://doi.org/10.1007/s00125-010-1865-y Mitra, S. K., Mikolon, D., Molina, J. E., Hsia, D. A., Hanson, D. A., Chi, A., Lim, S. T., Bernard-Trifilo, J. A., Ilic, D., Stupack, D. G., Cheresh, D. A., & Schlaepfer, D. D. (2006). Intrinsic FAK activity and Y925 phosphorylation facilitate an angiogenic switch in tumors. Oncogene, 25(44), 5969–5984. https://doi.org/10.1038/sj.onc.1209588 Mitra, V., & Metcalf, J. (2012). Metabolic functions of the liver. Anaesthesia & Intensive Care Medicine, 13(2), 54–55. https://doi.org/10.1016/j.mpaic.2011.11.006 Miyao, M., Kotani, H., Ishida, T., Kawai, C., Manabe, S., Abiru, H., & Tamaki, K. (2015). Pivotal role of liver sinusoidal endothelial cells in NAFLD/NASH progression. Laboratory Investigation. https://doi.org/10.1038/labinvest.2015.95 Miyauchi, M., Koya, J., Arai, S., Yamazaki, S., Honda, A., Kataoka, K., Yoshimi, A., Taoka, K., Kumano, K., & Kurokawa, M. (2018a). ADAM8 Is an Antigen of Tyrosine Kinase Inhibitor-Resistant Chronic Myeloid Leukemia Cells Identified by Patient-Derived Induced Pluripotent Stem Cells. Stem Cell Reports, 10(3). https://doi.org/10.1016/j.stemcr.2018.01.015 Moreno-Layseca, P., & Streuli, C. H. (2014). Signalling pathways linking integrins with cell cycle progression. In Matrix Biology, 34, 144–153. Elsevier. https://doi.org/10.1016/j.matbio.2013.10.011 Müller, F. A., & Sturla, S. J. (2019). Human in vitro models of nonalcoholic fatty liver disease. Current Opinion in Toxicology, 16, 9–16. https://doi.org/10.1016/j.cotox.2019.03.001 Murphy, E. F., Cotter, P. D., Hogan, A., O’Sullivan, O., Joyce, A., Fouhy, F., Clarke, S. F., Marques, T. M., O’Toole, P. W., Stanton, C., Quigley, E. M. M., Daly, C., Ross, P. R., O’Doherty, R. M., & Shanahan, F. (2013). Divergent metabolic outcomes arising from targeted manipulation of the gut microbiota in diet-induced obesity. Gut, 62(2), 220–226. https://doi.org/10.1136/gutjnl-2011-300705 Murphy, G. (2008). The ADAMs: Signalling scissors in the tumour microenvironment. Nature Reviews Cancer, 8(12), 929–941. https://doi.org/10.1038/nrc2459 Mygind, K. J., Schwarz, J., Sahgal, P., Ivaska, J., & Kveiborg, M. (2018). Loss of ADAM9 expression impairs β1 integrin endocytosis, focal adhesion formation and cancer cell migration. Journal of Cell Science, 131(1). https://doi.org/10.1242/jcs.205393 Naci, D., & Aoudjit, F. (2014). Alpha2beta1 integrin promotes T cell survival and migration through the concomitant activation of ERK/Mcl-1 and p38 MAPK pathways. Cellular Signalling, 26(9), 2008–2015. https://doi.org/10.1016/j.cellsig.2014.05.016 Nath, D., Slocombe, P. M., Stephens, P. E., Warn, A., Hutchinson, G. R., Yamada, K. M., Docherty, A. J. P., & Murphy, G. (1999). Interaction of metargidin (ADAM- 15) with α(v)β3 and α5β1 integrins on different haemopoietic cells. Journal of Cell

148

Literature Science, 112(4), 579–587. Naus, S., Blanchet, M. R., Gossens, K., Zaph, C., Bartsch, J. W., McNagny, K. M., & Ziltener, H. J. (2010). The metalloprotease-disintegrin ADAM8 is essential for the development of experimental asthma. American Journal of Respiratory and Critical Care Medicine, 181(12), 1318–1328. https://doi.org/10.1164/rccm.200909-1396OC Naus, S., Reipschläger, S., Wildeboer, D., Lichtenthaler, S. F., Mitterreiter, S., Guan, Z., Moss, M. L., & Bartsch, J. W. (2006). Identification of candidate substrates for ectodomain shedding by the metalloprotease-disintegrin ADAM8. Biological Chemistry, 387(3), 337–346. https://doi.org/10.1515/BC.2006.045 Naus, S., Richter, M., Wildeboer, D., Moss, M., Schachner, M., & Bartsch, J. W. (2004). Ectodomain Shedding of the Neural Recognition Molecule CHL1 by the Metalloprotease-disintegrin ADAM8 Promotes Neurite Outgrowth and Suppresses Neuronal Cell Death. Journal of Biological Chemistry, 279(16), 16083–16090. https://doi.org/10.1074/jbc.M400560200 Niederreiter, L., & Tilg, H. (2018). Cytokines and fatty liver diseases. Liver Research, 2(1), 14–20. https://doi.org/10.1016/j.livres.2018.03.003 Nimcharoen, T., Aung, W. P. P., Makeudom, A., Sastraruji, T., Khongkhunthian, S., Sirinirund, B., Krisanaprakornkit, S., & Montreekachon, P. (2019). Reduced ADAM8 levels upon non-surgical periodontal therapy in patients with chronic periodontitis. Archives of Oral Biology, 97(October 2018), 137–143. https://doi.org/10.1016/j.archoralbio.2018.10.021 Nishida, N., Yano, H., Nishida, T., Kamura, T., & Kojiro, M. (2006). Angiogenesis in cancer. Vascular Health and Risk Management, 2(3), 213–219. https://doi.org/10.2147/vhrm.2006.2.3.213 Nishimura, D., Sakai, H., Sato, T., Sato, F., Nishimura, S., Toyama-Sorimachi, N., Bartsch, J. W., & Sehara-Fujisawa, A. (2015). Roles of ADAM8 in elimination of injured muscle fibers prior to skeletal muscle regeneration. Mechanisms of Development, 135. https://doi.org/10.1016/j.mod.2014.12.001 Owen, J. D., Ruest, P. J., Fry, D. W., & Hanks, S. K. (1999). Induced Focal Adhesion Kinase (FAK) Expression in FAK-Null Cells Enhances Cell Spreading and Migration Requiring Both Auto- and Activation Loop Phosphorylation Sites and Inhibits Adhesion-Dependent Tyrosine Phosphorylation of Pyk2. Molecular and Cellular Biology, 19(7), 4806–4818. https://doi.org/10.1128/mcb.19.7.4806 Ozougwu, J. C. (2017). Physiology of the liver. International Journal of Research in Pharmacy and Biosciences, 4(8), 13-24. Pan, Y., Bi, F., Liu, N., Xue, Y., Yao, X., Zheng, Y., & Fan, D. (2004). Expression of seven main Rho family members in gastric carcinoma. Biochemical and Biophysical Research Communications, 315(3), 686–691. https://doi.org/10.1016/j.bbrc.2004.01.108 Parsons, J. T. (2003). Focal adhesion kinase: The first ten years. Journal of Cell Science, 116(8), 1409–1416. https://doi.org/10.1242/jcs.00373 Pasqualon, T., Pruessmeyer, J., Jankowski, V., Babendreyer, A., Groth, E., Schumacher, J., Koenen, A., Weidenfeld, S., Schwarz, N., Denecke, B., Jahr, H., 149

Literature Dreymueller, D., Jankowski, J., & Ludwig, A. (2015). A cytoplasmic C-terminal fragment of syndecan-1 is generated by sequential proteolysis and antagonizes syndecan-1 dependent lung tumor cell migration. Oncotarget, 6(31), 31295– 31312. https://doi.org/10.18632/oncotarget.5174 Paulissen, G., Rocks, N., Guéders, M. M., Bedoret, D., Crahay, C., Quesada-Calvo, F., Hacha, J., Bekaert, S., Desmet, C., Foidart, J. M., Bureau, F., Noel, A., & Cataldo, D. D. (2011). ADAM-8, a metalloproteinase, drives acute allergen-induced airway inflammation. European Journal of Immunology, 41(2), 380-391. https://doi.org/10.1002/eji.200940286 Playford, M. P., & Schaller, M. D. (2004). The interplay between Src and integrins in normal and tumor biology. Oncogene, 23(48;7), 7928–7946. https://doi.org/10.1038/sj.onc.1208080 Poisson, J., Lemoinne, S., Boulanger, C., Durand, F., Moreau, R., Valla, D., & Rautou, P.-E. (2016). Liver sinusoidal endothelial cells: Physiology and role in liver diseases. Journal of Hepatology, 66, 212–227. Polverino, F., Rojas-Quintero, J., Wang, X., Petersen, H., Zhang, L., Gai, X., Higham, A., Zhang, D., Gupta, K., Rout, A., Yambayev, I., Pinto-Plata, V., Sholl, L. M., Cunoosamy, D., Celli, B. R., Goldring, J., Singh, D., Tesfaigzi, Y., Wedzicha, J., Owen, C. A. (2018). A disintegrin and metalloproteinase domain-8: A novel protective proteinase in chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine, 198(10), 1254–1267. https://doi.org/10.1164/rccm.201707-1331OC Qin, J., Li, Y., Cai, Z., Li, S., Zhu, J., Zhang, F., Liang, S., Zhang, W., Guan, Y., Shen, D., Peng, Y., Zhang, D., Jie, Z., Wu, W., Qin, Y., Xue, W., Li, J., Han, L., Lu, D., Wang, J. (2012). A metagenome-wide association study of gut microbiota in type 2 diabetes. Nature, 490(7418), 55–60. https://doi.org/10.1038/nature11450 Raitoharju, E., Seppälä, I., Levula, M., Kuukasjärvi, P., Laurikka, J., Nikus, K., Huovila, A. P. J., Oksala, N., Klopp, N., Illig, T., Laaksonen, R., Karhunen, P. J., Viik, J., Lehtinen, R., Pelto-Huikko, M., Tarkka, M., Kähönen, M., & Lehtimäki, T. (2011). Common variation in the ADAM8 gene affects serum sADAM8 concentrations and the risk of myocardial infarction in two independent cohorts. Atherosclerosis, 218(1), 127–133. https://doi.org/10.1016/j.atherosclerosis.2011.05.005 Ramachandran, A., & Jaeschke, H. (2016). Experimental Models of Hepatotoxicity for the Testing of Natural Products. Reference Module in Chemistry, Molecular Sciences and Chemical Engineering. Elsevier. https://doi.org/10.1016/b978-0-12- 409547-2.11715-9 Rao, H., Lu, G., Kajiya, H., Garcia-Palacios, V., Kurihara, N., Anderson, J., Patrene, K., Sheppard, D., Blair, H. C., Windle, J. J., Choi, S. J., & Roodman, G. D. (2006). α9β1: A novel osteoclast integrin that regulates osteoclast formation and function. Journal of Bone and Mineral Research, 21(10), 1657–1665. https://doi.org/10.1359/jbmr.060718 Rawla, P., Sunkara, T., & Muralidharan, P. (2018). Update in global trends and aetiology of hepatocellular carcinoma. Rawlings, B. N. D., & Barrett, A. J. (1995). Evolutionary Families of 150

Literature Metallopeptidases, 248(1992). Reiss, K., Ludwig, A., & Saftig, P. (2006). Breaking up the tie: Disintegrin-like metalloproteinases as regulators of cell migration in inflammation and invasion. Pharmacology and Therapeutics, 111(3), 985–1006. https://doi.org/10.1016/j.pharmthera.2006.02.009 Richens, J., Fairclough, L., Ghaemmaghami, A. M., Mahdavi, J., Shakib, F., & Sewell, H. F. (2007). The detection of ADAM8 protein on cells of the human immune system and the demonstration of its expression on peripheral blood B cells, dendritic cells and monocyte subsets. Immunobiology, 212(1), 29–38. https://doi.org/10.1016/j.imbio.2006.06.012 Roemer, A., Schwettmann, L., Jung, M., Stephan, C., Roigas, J., Kristiansen, G., Loening, S. A., Lichtinghagen, R., & Jung, K. (2004). The membrane proteases ADAMs and hepsin are differentially expressed in renal cell carcinoma. Are they potential tumor markers? Journal of Urology, 172(6 I), 2162–2166. https://doi.org/10.1097/01.ju.0000144602.01322.49 Romagnoli, M., Mineva, N. D., Polmear, M., Conrad, C., Srinivasan, S., Loussouarn, D., Barill, S., Georgakoudi, I., Mcdermott, E. W., Bartsch, W., Duffy, M. J., Mcgowan, P. M., Schlomann, U., Parsons, M., & Sonenshein, G. E. (2014). ADAM 8 expression in invasive breast cancer promotes tumor dissemination and metastasis. EMBO Molecular Medicine, 6(2), 278–294. Rudling, M., Wallenius, K., Dickson, S. L., Jansson, J.-O., Ahrén, B., Wallenius, V., Ohlsson, C., & Carlsten, H. (2002). Interleukin-6-deficient mice develop mature- onset obesity. Nature Medicine, 8(1), 75–79. http://doi/10.1038/nm0102-75 Saleh, A., Stathopoulou, M. G., Dadé, S., Ndiaye, N. C., Azimi-Nezhad, M., Murray, H., Masson, C., Lamont, J., Fitzgerald, P., & Visvikis-Siest, S. (2015). Angiogenesis related genes NOS3, CD14, MMP3 and IL4R are associated to VEGF gene expression and circulating levels in healthy adults. BMC Medical Genetics, 16(1), 3–12. https://doi.org/10.1186/s12881-015-0234-6 Santos, A. R. C., Corredor, R. G., Obeso, B. A., Trakhtenberg, E. F., Wang, Y., Ponmattam, J., Dvoriantchikova, G., Ivanov, D., Shestopalov, V. I., Goldberg, J. L., Fini, M. E., & Bajenaru, M. L. (2012). β1 Integrin-Focal Adhesion Kinase (FAK) Signaling Modulates Retinal Ganglion Cell (RGC) Survival. PLoS ONE, 7(10). https://doi.org/10.1371/journal.pone.0048332 Sass, D. A., Chang, P., & Chopra, K. B. (2005). Nonalcoholic fatty liver disease: A clinical review. Digestive Diseases and Sciences, 50(1), 171–180. https://doi.org/10.1007/s10620-005-1267-z Scharfenberg, F., Helbig, A., Sammel, M., Benzel, J., Schlomann, U., Peters, F., Wichert, R., Bettendorff, M., Schmidt-Arras, D., Rose-John, S., Moali, C., Lichtenthaler, S. F., Pietrzik, C. U., Bartsch, J. W., Tholey, A., & Becker-Pauly, C. (2020). Degradome of soluble ADAM10 and ADAM17 metalloproteases. Cellular and Molecular Life Sciences, 77(2), 331–350. https://doi.org/10.1007/s00018-019-03184-4 Schick, D., Babendreyer, A., Wozniak, J., Awan, T., Noels, H., Liehn, E., Bartsch, J. W., Vlacil, A. K., Grote, K., Zayat, R., Goetzenich, A., Ludwig, A., & Dreymueller, D. (2019). Elevated expression of the metalloproteinase ADAM8 151

Literature associates with vascular diseases in mice and humans. Atherosclerosis, 286(March), 163–171. https://doi.org/10.1016/j.atherosclerosis.2019.03.008 Schlomann, U, Rathke-Hartlieb, S., Yamamoto, S., Jockusch, H., & Bartsch, J. W. (2000). Tumor necrosis factor alpha induces a metalloprotease-disintegrin, ADAM8 (CD 156): implications for neuron-glia interactions during neurodegeneration. The Journal of Neuroscience : The Official Journal of the Society for Neuroscience. https://doi.org/10.1038/ncomms2409 Schlomann, U., Koller, G., Conrad, C., Ferdous, T., Golfi, P., Garcia, A. M., Parsons, M., Costa, P., Soper, R., Bossard, M., Hagemann, T., Roshani, R., Sewald, N., Ketchem, R. R., Moss, M. L., Rasmussen, F. H., Miller, M. A., Lauffenburger, D. A., Tuveson, D. A., & Nimsky, C. (2015). ADAM8 as a drug target in pancreatic cancer. Nature Communications. https://doi.org/10.1038/ncomms7175 Schlomann, U., Rathke-Hartlieb, S., Yamamoto, S., Jockusch, H., Rg, J., & Bartsch, W. (2000). Tumor Necrosis Factor Induces a Metalloprotease-Disintegrin, ADAM8 (CD 156): Implications for Neuron-Glia Interactions during Neurodegeneration. Schlomann, U., Wildeboer, D., Webster, A., Antropova, O., Zeuschner, D., Knight, C. G., Docherty, A. J. P., Lambert, M., Skelton, L., Jockusch, H., & Bartsch, J. W. (2002). The metalloprotease disintegrin ADAM8. Processing by autocatalysis is required for proteolytic activity and cell adhesion. Journal of Biological Chemistry, 277(50), 48210–48219. https://doi.org/10.1074/jbc.M203355200 Schluesener, H. J. (1998). The disintegrin domain of ADAM 8 enhances protection against rat experimental autoimmune encephalomyelitis, neuritis and uveitis by a polyvalent autoantigen vaccine. Journal of Neuroimmunology, 87(1–2), 197–202. https://doi.org/10.1016/S0165-5728(98)00080-0 Schnabl, B., & Brenner, D. A. (2014). Interactions between the intestinal microbiome and liver diseases. Gastroenterology, 146(6), 1513–1524. https://doi.org/10.1053/j.gastro.2014.01.020 Schumann, R. R. (2011). Old and new findings on lipopolysaccharide-binding protein: A soluble pattern-recognition molecule. Biochemical Society Transactions, 39(4), 989–993. https://doi.org/10.1042/BST0390989 Schwettmann, L., Wehmeier, M., Jokovic, D., Aleksandrova, K., Brand, K., Manns, M. P., Lichtinghagen, R., & Bahr, M. J. (2008). Hepatic expression of A Disintegrin And Metalloproteinase (ADAM) and ADAMs with thrombospondin motives (ADAM-TS) enzymes in patients with chronic liver diseases. Journal of Hepatology, 49(2), 243–250. https://doi.org/10.1016/j.jhep.2008.03.020 Seals, D. F., & Courtneidge, S. A. (2003). The ADAMs family of metalloproteases: Multidomain proteins with multiple functions. Genes and Development, 17(1), 7– 30. https://doi.org/10.1101/gad.1039703 Seo, T., Sakon, T., Nakazawa, S., Nishioka, A., Watanabe, K., Matsumoto, K., Akasaka, M., Shioi, N., Sawada, H., & Araki, S. (2017). Haemorrhagic snake venom metalloproteases and human ADAMs cleave LRP5/6, which disrupts cell– cell adhesions in vitro and induces haemorrhage in vivo. FEBS Journal, 284(11), 1657–1671. https://doi.org/10.1111/febs.14066

152

Literature Serrano, S. M. T., Jia, L. G., Wang, D., Shannon, J. D., & Fox, J. W. (2005). Function of the cysteine-rich domain of the haemorrhagic metalloproteinase atrolysin A: Targeting adhesion proteins collagen I and von Willebrand factor. Biochemical Journal, 391(1), 69–76. https://doi.org/10.1042/BJ20050483 Severgnini, M., Sherman, J., Sehgal, A., Jayaprakash, N. K., Aubin, J., Wang, G., Zhang, L., Peng, C. G., Yucius, K., Butler, J., & Fitzgerald, K. (2012). A rapid two-step method for isolation of functional primary mouse hepatocytes: Cell characterization and asialoglycoprotein receptor based assay development. Cytotechnology, 64(2), 187–195. https://doi.org/10.1007/s10616-011-9407-0 Shetty, S., Lalor, P. F., & Adams, D. H. (2018). Liver sinusoidal endothelial cells — gatekeepers of hepatic immunity. Nature Reviews Gastroenterology and Hepatology, 15(9), 555–567. Nature Publishing Group. https://doi.org/10.1038/s41575-018-0020-y Shi, Q., & Boettiger, D. (2003). A Novel Mode for Integrin-mediated Signaling: Tethering Is Required for Phosphorylation of FAK Y397. Molecular Biology of the Cell, 14(December), 5069–5081. https://doi.org/10.1091/mbc.E03 Smedsrad, B., Pertoft, H., Eggertsen, G., & Sundstr6m, C. (1985). Functional and morphological characterization of cultures of Kupffer cells and liver endothelial cells prepared by means of density separation in Percoll, and selective substrate adherence. Cell Tissue Research, 241. Smith, K. M., Gaultier, A., Cousin, H., Alfandari, D., White, J. M., & DeSimone, D. W. (2002). The cysteine-rich domain regulates ADAM protease function in vivo. Journal of Cell Biology, 159(5), 893–902. https://doi.org/10.1083/jcb.200206023 Sonntag, R., Giebeler, N., Nevzorova, Y. A., Bangen, J. M., Fahrenkamp, D., Lambertz, D., Haas, U., Hu, W., Gassler, N., Cubero, F. J., Müller-Newen, G., Abdallah, A. T., Weiskirchen, R., Ticconi, F., Costa, I. G., Barbacid, M., Trautwein, C., & Liedtke, C. (2018). Cyclin E1 and cyclin-dependent kinase 2 are critical for initiation, but not for progression of hepatocellular carcinoma. Proceedings of the National Academy of Sciences of the United States of America, 115(37), 9282– 9287. https://doi.org/10.1073/pnas.1807155115 Soond, S. M., Everson, B., Riches, D. W. H., & Murphy, G. (2005). ERK-mediated phosphorylation of Thr735 in TNFα-converting enzyme and its potential role in TACE protein trafficking. Journal of Cell Science, 118(11), 2371–2380. https://doi.org/10.1242/jcs.02357 Srinivasan, S., Romagnoli, M., Bohm, A., & Sonenshein, G. E. (2014). N-glycosylation regulates ADAM8 processing and activation. Journal of Biological Chemistry, 289(48), 33676–33688. https://doi.org/10.1074/jbc.M114.594242 Stocker, W., Grams, F., Baumann, U., Reinemer, P., Mckay, D. B., & Bode, W. (1995). The metzincins -- Topological and sequential relations between the The metzincins -Topological and sequential relations between the astacins , adamalysins , serralysins , of zinc-peptidases. Protein Science, 4, 823–840. Sulzmaier, F. J., Jean, C., & Schlaepfer, D. D. (2014). FAK in cancer: Mechanistic findings and clinical applications. Nature Reviews Cancer, 14(9), 598–610. https://doi.org/10.1038/nrc3792

153

Literature Szabo, G., & Petrasek, J. (2015). Inflammasome activation and function in liver disease. In Nature Reviews Gastroenterology and Hepatology. https://doi.org/10.1038/nrgastro.2015.94 Takeda, S., Igarashi, T., Mori, H., & Araki, S. (2006). Crystal structures of VAP1 reveal ADAMs ’ MDC domain architecture and its unique C-shaped scaffold. 25(11), 2388–2396. https://doi.org/10.1038/sj.emboj.7601131 Tellmann, G. (2006). The E-Method: A highly accurate technique for gene-expression analysis. Nature Methods, 3(7). https://doi.org/10.1038/nmeth894 Theodorou, K., Van Der Vorst, E. P. C., Gijbels, M. J., Wolfs, I. M. J., Jeurissen, M., Theelen, T. L., Sluimer, J. C., Wijnands, E., Cleutjens, J. P., Li, Y., Jansen, Y., Weber, C., Ludwig, A., Bentzon, J. F., Bartsch, J. W., Biessen, E. A. L., & Donners, M. M. P. C. (2017). Whole body and hematopoietic ADAM8 deficiency does not influence advanced atherosclerotic lesion development, despite its association with human plaque progression. Scientific Reports, 7(1). https://doi.org/10.1038/s41598-017-10549-x Thorgeirsson, Snorris S. and Grisham, J. W. (2016). Molecular pathogenesis of hepatocellular carcinoma. Liver Cancer, 5(4), 290–302. https://doi.org/10.1159/000449340 Tiegs, G., & Lohse, A. W. (2010). Immune tolerance: What is unique about the liver. In Journal of Autoimmunity, 34(1), 1–6. https://doi.org/10.1016/j.jaut.2009.08.008 Tripathi, A., Debelius, J., Brenner, D. A., Karin, M., Loomba, R., Schnabl, B., & Knight, R. (2018). The gut-liver axis and the intersection with the microbiome. Nature Reviews Gastroenterology and Hepatology, 15(7), 397–411. Nature Publishing Group. https://doi.org/10.1038/s41575-018-0011-z Tsuchida, T., & Friedman, S. L. (2017). Mechanisms of hepatic stellate cell activation. Nature Reviews Gastroenterology and Hepatology, 14(7), 397–411. Nature Publishing Group. https://doi.org/10.1038/nrgastro.2017.38 Tsui, Y. M., Chan, L. K., & Ng, I. O. L. (2020). Cancer stemness in hepatocellular carcinoma: mechanisms and translational potential. British Journal of Cancer, 122(10), 1428–1440. https://doi.org/10.1038/s41416-020-0823-9 Turnbaugh, P. J., Hamady, M., Yatsunenko, T., Cantarel, B. L., Duncan, A., Ley, R. E., Sogin, M. L., Jones, W. J., Roe, B. A., Affourtit, J. P., Egholm, M., Henrissat, B., Heath, A. C., Knight, R., & Gordon, J. I. (2009). A core gut microbiome in obese and lean twins. Nature, 457(7228), 480–484. https://doi.org/10.1038/nature07540 Turnbaugh, P. J., Ley, R. E., Mahowald, M. A., Magrini, V., Mardis, E. R., & Gordon, J. I. (2006). An obesity-associated gut microbiome with increased capacity for energy harvest. Nature, 444(7122), 1027–1031. https://doi.org/10.1038/nature05414 Valkovskaya, N., Kayed, H., Felix, K., Hartmann, D., Giese, N. A., Osinsky, S. P., Friess, H., & Kleeff, J. (2007). ADAM8 expression is associated with increased invasiveness and reduced patient survival in pancreatic cancer. Journal of Cellular and Molecular Medicine, 11(5), 1162–1174. https://doi.org/10.1111/j.1582- 4934.2007.00082.x Van Goor, H. (2008). Adamalysins in biology and disease. 1(June), 231–241. 154

Literature https://doi.org/10.1002/path Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., & Speleman, F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology, 3(7), 1–12. https://doi.org/10.1186/gb-2002-3-7-research0034 Victor H Guaiquil , Steven Swendeman, Wenhui Zhou, Patricio Guaiquil, Gisela Weskamp, Jörg W Bartsch, C. P. B. (2010). ADAM8 is a negative regulator of retinal neovascularization and of the growth of heterotopically injected tumor cells in mice. Journal of Molecular Medicine, 88(5), 497–505. https://doi.org/10.1007/s00109-010-0591-8 Vrieze, A., Van Nood, E., Holleman, F., Salojärvi, J., Kootte, R. S., Bartelsman, J. F. W. M., Dallinga-Thie, G. M., Ackermans, M. T., Serlie, M. J., Oozeer, R., Derrien, M., Druesne, A., Van Hylckama Vlieg, J. E. T., Bloks, V. W., Groen, A. K., Heilig, H. G. H. J., Zoetendal, E. G., Stroes, E. S., De Vos, W. M., Nieuwdorp, M. (2012). Transfer of intestinal microbiota from lean donors increases insulin sensitivity in individuals with metabolic syndrome. Gastroenterology, 143(4). https://doi.org/10.1053/j.gastro.2012.06.031 Wang, C., Chen, W., Wu, Y., You, P., Zheng, S., Liu, C., Xiang, D., Wang, M., Cai, Y., Zhao, Q., Borjigin, U., Liu, W., Xiong, W., & Wangensteen, K. J. (2018). The extent of liver injury determines hepatocyte fate toward senescence or cancer. Cell Death and Disease, 9:575, 1-14. https://doi.org/10.1038/s41419-018-0622-x Wehr, A., Baeck, C., Ulmer, F., Gassler, N., Hittatiya, K., Luedde, T., Neumann, U. P., Trautwein, C., & Tacke, F. (2014). Pharmacological inhibition of the chemokine CXCL16 diminishes liver macrophage infiltration and steatohepatitis in chronic hepatic injury. PLoS ONE, 9(11). https://doi.org/10.1371/journal.pone.0112327 Wewer, U. M., Mörgelin, M., Holck, P., Jacobsen, J., Lydolph, M. C., Johnsen, A. H., Kveiborg, M., & Albrechtsen, R. (2006). ADAM12 is a four-leafed clover: The excised prodomain remains bound to the mature enzyme. Journal of Biological Chemistry, 281(14), 9418–9422. https://doi.org/10.1074/jbc.M513580200 White, J. M. (2003). ADAMs: Modulators of cell-cell and cell-matrix interactions. Current Opinion in Cell Biology, 15(5), 598–606. https://doi.org/10.1016/j.ceb.2003.08.001 Wildeboer, D., Naus, S., Sang, Q. X. A., Bartsch, J. W., & Pagenstecher, A. (2006). Metalloproteinase disintegrins ADAM8 and ADAM19 are highly regulated in human primary brain tumors and their expression levels and activities are associated with invasiveness. Journal of Neuropathology and Experimental Neurology, 65(5), 516-527. https://doi.org/10.1097/01.jnen.0000229240.51490.d3 Wu, H., Xu, J. B., He, Y. L., Peng, J. J., Zhang, X. H., Chen, C. Q., Li, W., & Cai, S. R. (2012). Tumor-associated macrophages promote angiogenesis and lymphangiogenesis of gastric cancer. Journal of Surgical Oncology, 106(4), 462– 468. https://doi.org/10.1002/jso.23110 Xu, J. F., Liu, X. Y., Wang, S., & Wen, H. X. (2015). Surgical treatment for hepatocellular carcinoma with portal vein tumor thrombus: A novel classification. World Journal of Surgical Oncology, 13(1). https://doi.org/10.1186/s12957-015- 155

Literature 0493-x Yang, J. D., Hainaut, P., Gores, G. J., Amadou, A., Plymoth, A., & Roberts, L. R. (2019). A global view of hepatocellular carcinoma: trends, risk, prevention and management. Nature Reviews Gastroenterology & Hepatology, 16, 589-604. https://doi.org/10.1038/s41575-019-0186-y Yang, Z., Bai, Y., Huo, L., Chen, H., Huang, J., Li, J., Fan, X., Yang, Z., Wang, L., & Wang, J. (2014). Expression of A disintegrin and metalloprotease 8 is associated with cell growth and poor survival in colorectal cancer. BMC Cancer, 14(1), 1– 12. https://doi.org/10.1186/1471-2407-14-568 Yin, S., Li, Z., Huang, J., Miao, Z., Zhang, J., Lu, C., Xu, H., & Xu, H. (2017). Prognostic value and clinicopathological significance of proliferating cell nuclear antigen expression in gastric cancer: A systematic review and meta-analysis. OncoTargets and Therapy, 10, 319–327. https://doi.org/10.2147/OTT.S126551 Yoshida, S., Setoguchi, M., Higuchi, Y., Akizuki, S., & Yamamoto, S. (1990). Molecular cloning of cDNA encoding MS2 antigen, a novel cell surface antigen strongly expressed in murine monocytic lineage. International Immunology, 2(6), 585–591. https://doi.org/10.1093/intimm/2.6.585 Yoshiyama, K., Higuchi, Y., Kataoka, M., Matsuura, K., & Yamamoto, S. (1997). CD156 (human ADAM8): Expression, primary amino acid sequence, and gene location. Genomics, 41(1), 56–62. https://doi.org/10.1006/geno.1997.4607 Zack, M. D., Malfait, A. M., Skepner, A. P., Yates, M. P., Griggs, D. W., Hall, T., Hills, R. L., Alston, J. T., Nemirovskiy, O. V., Radabaugh, M. R., Leone, J. W., Arner, E. C., & Tortorella, M. D. (2009). ADAM-8 isolated from human osteoarthritic chondrocytes cleaves fibronectin at Ala271. Arthritis and Rheumatism, 60(9), 2704–2713. https://doi.org/10.1002/art.24753 Zaefarian, F., Abdollahi, M. R., Cowieson, A., & Ravindran, V. (2019). Avian liver: The forgotten organ. Animals, 9(2), 1–23. https://doi.org/10.3390/ani9020063 Zarbock, A., & Rossaint, J. (2011). Regulating inflammation: ADAM8 - a new player in the game. European Journal of Immunology, 41(12), 3419–3422. https://doi.org/10.1002/eji.201142196 Zhang, W., Wan, M., Ma, L., Liu, X., & He, J. (2013). Protective effects of ADAM8 against cisplatin-mediated apoptosis in non-small-cell lung cancer. Cell Biology International, 37(1), 47–53. https://doi.org/10.1002/cbin.10011 Zhang, Y., Tan, Y. F., Jiang, C., Zhang, K., Zha, T. Z., & Zhang, M. (2013). High ADAM8 expression is associated with poor prognosis in patients with hepatocellular carcinoma. Pathology and Oncology Research, 19(1), 79–88. https://doi.org/10.1007/s12253-012-9560-6 Zhao, H., Ho, P. C., Lo, Y. H., Espejo, A., Bedford, M. T., Hung, M. C., & Wang, S. C. (2012). Interaction of proliferation cell nuclear antigen (PCNA) with c-Abl in cell proliferation and response to DNA damages in breast cancer. PLoS ONE, 7(1). https://doi.org/10.1371/journal.pone.0029416 Zhong, H. H., Hu, S. J., Yu, B., Jiang, S. S., Zhang, J., Luo, D., Yang, M. W., Su, W. Y., Shao, Y. L., Deng, H. L., Hong, F. F., & Yang, S. L. (2017). Apoptosis in the aging liver. Oncotarget, 8(60), 102640–102652. 156

Literature https://doi.org/10.18632/oncotarget.21123 Zhou, W. C., Zhang, Q. B., & Qiao, L. (2014). Pathogenesis of liver cirrhosis. World Journal of Gastroenterology, 20(23), 7312–7324. https://doi.org/10.3748/wjg.v20.i23.7312 Zielinski, V., Brunner, M., Heiduschka, G., Schneider, S., Seemann, R., Erovic, B., & Thurnher, D. (2012). ADAM8 in squamous cell carcinoma of the head and neck: A retrospective study. BMC Cancer, 12(1), 76. https://doi.org/10.1186/1471- 2407-12-76

157

Appendix

8 Appendix

8.1 List of figures

Figure 1: Liver lobule structure and types of cells ...... 2

Figure 2: Inflammatory pathways in liver ...... 5

Figure 3: Integrin and FAK mediated signalling pathways in cancer ...... 8

Figure 4: The structure of ADAMs and other metalloproteinases...... 10

Figure 5: Activation and processing of ADAM8 ...... 13

Figure 6: Schematic presentations of the study objectives ...... 21

Figure 7: General design of oligonucleotides containing the shRNA target sequences ...... 29

Figure 8: High-fat diet induces the expression of ADAMs ...... 47

Figure 9: High-fat diet induces the expression of pro-inflammatory mediators; TNFα and IL-6 ...... 47

Figure 10: mRNA and protein expression of ADAM8 in murine liver cell lines...... 49

Figure 11: mRNA and protein expression of ADAM8 in human liver cell lines ...... 50

Figure 12: ADAM8 expression is elevated after fatty acid and IL-1β stimulation in hepatoma cell lines ...... 51

Figure 13: ADAM8 expression is elevated after TNFα and INFγ stimulation in endothelial cell lines ...... 52

Figure 14: ADAM8 expression is increased after TGFβ stimulation in hepatic stellate cell lines ...... 53

Figure 15: ADAM8 expression is upregulated after fatty acids and IL-1β stimulation in primary hepatocytes ...... 54

Figure 16: Knockdown of ADAM8 in Hepa1-6 using pLVTHM lentivirus system ... 55

Figure 17: Knockdown of ADAM8 in Hepa1-6 using short interfering RNA (siRNA) ...... 56

Figure 18: Knockdown of ADAM8 in LSEC and GRX cell lines by using siRNA .... 57 158

Appendix Figure 19: Knockdown of ADAM8 in HepG2 cells using pLVTHM lentivirus ...... 58

Figure 20: Knockdown of ADAM8 in EA.hy926 and LX-2 cells using pLVTHM lentivirus ...... 59

Figure 21: Regulation of mRNA expression of TNFα and IL-6 after ADAM8 KD in hepatoma cell lines ...... 60

Figure 22: Regulation of cytokines and chemokines release by ADAM8 in hepatoma cell lines ...... 63

Figure 23: Regulation of cytokines and chemokines release by ADAM8 in endothelial cell lines ...... 64

Figure 24: Regulation of cytokines and chemokines release by ADAM8 in stellate cell lines ...... 67

Figure 25: Regulation of pro-fibrotic molecules by ADAM8 in stellate cell lines ..... 68

Figure 26: Regulation of cytokines and chemokines release from murine primary hepatocytes after stimulating with fatty acid and IL-1β ...... 69

Figure 27: Conditioned medium from endothelial cell lines induces the expression of ADAM8 in hepatoma cell lines ...... 71

Figure 28: Regulation of ADAM proteases and cytokines in different liver injury murine models ...... 73

Figure 29: ADAM8 expression is elevated after LPS stimulation in hepatoma cell lines ...... 74

Figure 30: LPS strongly induces the expression of ADAM8 in endothelial cell lines 75

Figure 31: LPS induces the expression of ADAM8 in primary murine hepatocytes .. 76

Figure 32: Effect of ADAM8 silencing on the mRNA expression of TNFα after LPS treatment ...... 77

Figure 33: Effect of ADAM8 silencing on the mRNA expression of IL-6 after LPS treatment ...... 78

Figure 34: ADAM8 silencing reduced the induced release of cytokines in hepatoma cell lines and primary hepatocytes ...... 79

159

Appendix Figure 35: Expression of TNFα and IL-6 in livers of ADAM8 KO mice after LPS administration ...... 81

Figure 36: Expression of ADAM8, 10 and 17 in livers of mice after LPS administration ...... 81

Figure 37: ADAM8 silencing does not affect the release of TNFα and IL-6 in mice serum after LPS administration ...... 82

Figure 38: Amount of liver enzymes in serum of control and ADAM8 KO mice after LPS administration...... 83

Figure 39A: Hematoxylin and eosin staining of liver sections of control and ADAM8 KO mice after LPS administration ...... 84

Figure 40: Ki67-stainings of liver sections of NaCl control and ADAM8 KO mice .. 86

Figure 41: Expression of ADAM proteases in HCC tissue ...... 87

Figure 42: Comparison of expression of ADAM8 in hepatoma cell lines and primary hepatocytes ...... 88

Figure 43: hADAM8 over-expression in Hepa1-6 and HepG2 cells using pMOWs expression vector ...... 89

Figure 44: ADAM8 knockdown reduces the proliferation in hepatoma cell lines ...... 90

Figure 45: ADAM8 overexpression induces the proliferation in hepatoma cell lines 91

Figure 46:ADAM8 expression is associated with cell growth in hepatoma cell lines 92

Figure 47: ADAM8 expression is correlated with PCNA protein expression in hepatoma cell lines ...... 94

Figure 48: ADAM8 expression is negatively correlated with caspase 3/7 mediated apoptosis of hepatoma cell lines ...... 95

Figure 49: ADAM8 KO does not show enhanced apoptosis in liver tissues ...... 96

Figure 50: ADAM8 silencing reduces cell migration in hepatoma cell lines ...... 97

Figure 51: ADAM8 overexpression enhanced cell migration in hepatoma cell lines . 98

Figure 52: ADAM8 silencing reduces cell invasion through ECM in hepatoma cells 99

160

Appendix Figure 53: ADAM8 overexpression enhances cell invasion through ECM in hepatoma cells ...... 100

Figure 54: ADAM8 knockdown reduces the proliferation in endothelial cells ...... 101

Figure 55: ADAM8 silencing reduces cell migration in endothelial cell lines ...... 102

Figure: 56 ADAM8 knockdown reduces the tube formation capability of endothelial cell lines ...... 103

Figure 57: ADAM8 expression in hepatoma cells is positively associated with the expression of β1 integrin and activation of focal adhesion kinase ...... 106

Figure 58: ADAM8 expression correlates with activation of MAPK (p38), Src and Rho A ...... 108

Figure 59: Illustrative model of the role of ADAM8 in manifestation of liver inflammation ...... 121

Figure 60: Illustrative model of the proposed role of ADAM8 in the prognosis of hepatocellular carcinoma ...... 129

Figure 61: Plasmid map of pLVTHM ...... 166

Figure 62: Plasmid map of pMD2.G...... 167

Figure 63: Plasmid map of psPAX2 ...... 168

Figure 64: Plasmid map of pMOWs ...... 169

Figure 65: Example of ADAM8 genotyping PCR ...... 170

8.2 List of tables

Table 1: Shedding substrates of ADAM8 which are involved in development of diseases ...... 17

Table 2: Special chemicals used in this work ...... 22

Table 3: Particular consumables used in this study ...... 23

Table 4: Kits used in this study ...... 24

Table 5: List of plasmids used ...... 24

161

Appendix

Table 6: Antibodies used in this study ...... 25

Table 7: Buffers and their composition ...... 26

Table 8: List of qPCR oligonucleotides used in this study ...... 28

Table 9: List of shRNA sequences used ...... 30

Table 10: List of cells used in this study...... 30

Table 11: Composition of separating and separating gels ...... 35

Table 12: Summarised results of the release of cytokine and chemokine through liver cells after ADAM8 KD ...... 116

Table 13: Summarised results of ADAM8 effects on LPS-induced liver injury ...... 120

Table 14: Summarised results of ADAM8 involvement in various cellular functions ...... 125

Table 15: Summarised results for the regulation of ADAM8 associated proteins in hepatoma cells ...... 128

8.3 Abbreviations

µm micrometer ADAM a disintegrin and metalloproteinase ADAMTS ADAM with thrombospondin motifs ALD alcoholic liver disease APP amyloid-beta precursor protein ASH alcoholic steatohepatitis BDL bile duct ligation CCL2 C-C chemokine family CCl4 carbon tetrachloride CD cluster of differentiation cDNA complementary DNA CNS central nervous system Col1a1 collagen type 1 alpha 1 chain COPD chronic obstructive pulmonary disease CX3CL1 CX3C motif ligand 1 CXCL16 C-X-C motif ligand 16

162

Appendix DAMP damage-associate molecular pattern DMEM Dulbecco’s modified eagle medium DNA deoxyribonucleic acid ECM extracellular matrix EDTA ethylene diamine tetraacetic acid EGF epidermal growth factor ELISA enzyme-linked immunosorbent assay ERK extracellular signal-regulated kinase FAK focal adhesion kinase FCS fetal calf serum GAPDH glyceraldehyde-3-phosphate dehydrogenase GFP green fluorescent protein h hour HCC hepatocellular carcinoma HEK293 human embryonic kidney cells 293 HEPES 4-(2-hydroxyethyl)-1-piperazine ethane sulfonic acid HMGB1 high mobility group protein B 1 HRP horseradish peroxidase HSC hepatic stellate cells HUVEC human umbilical vein endothelial cells i.p intraperitoneal IgG immunoglobulin IL interleukin INFγ interferon-gamma KCs Kupffur cells KD knockdown kDa kilo Dalton KO knockout LBP LPS-binding protein LPS lipopolysaccharide LSEC liver sinusoidal endothelial cells MAPK mitogen-activated protein kinase min minute MMP matrix metalloproteinase

163

Appendix mRNA messenger RNA NaCl natrium chloride NAFLD non-alcoholic fatty liver disease NASH non-alcoholic steatohepatitis NF-κB nuclear factor kappa-light-chain-enhancer of activated B cells NLRP3 NOD-, LRR- and pyrin domain-containing protein 3 OVA ovalbumin PBS phosphate-buffered saline PBST phosphate-buffered saline with tween PCR polymerase chain reaction PECAM platelet-endothelial cell adhesion molecule PFA paraformaldehyde PMH primary murine hepatocytes PSGL-1 P-selectin glycoprotein ligand 1 PVDF polyvinylidene difluoride qPCR quantitative PCR Rho A Ras homolog family member A RNA ribonucleic acid RPS29 ribosomal protein S29 SDS sodium dodecyl sulfate SDS-PAGE SDS-polyacrylamide gel electrophoresis SEC sinusoidal endothelial cell SH Src homology shRNA small hairpin RNA siRNA small interfering RNA SVMP snake venom metalloproteinase TAE tris base, acetic acid and EDTA TBS tris buffered saline TBST tris buffered saline with tween TGFβ transforming growth factor-beta TIMP tissue inhibitor of metalloproteinase TLR toll-like receptor TNF tumour necrosis factor TNFR tumour necrosis factor receptor 164

Appendix VCAM-1 vascular cell adhesion molecule 1 VEGF vascular endothelial growth factor WT wildtype αSMA alpha smooth muscle actin

165

Appendix

8.4 Vector maps

pLVTHM

Figure 61: Plasmid map of pLVTHM

Addgene number: 12247

166

Appendix

pMD2.G

Figure 62: Plasmid map of pMD2.G

Addgene number: 12259

167

Appendix

psPAX2

Figure 63: Plasmid map of psPAX2

Addgene number: 12260

168

Appendix

pMOWs

Figure 64: Plasmid map of pMOWs

169

Appendix 8.5 Mice genotyping

ADAM8 Primers: Primer forward ADAM8 GCA AGT GGT GGC ATT GCA GCA G Primer reverse ADAM8 CAC TGT TGG ACT GGC TAA GGT G Primer forward LacZ GAT CTG GAC GAA GAG CAT CAG Primer reverse LacZ CTG GCC TCC CTC ACA GTA CAG PCR mix: 5x Premix 2.4 µl MgCl 0.96 µl 25 dNTP 0.96 µl mM 2.5 Primer each 0.12 µl mM 100 µM Taq 0.1 µl 5 U/µl H2O 5.34 µl

Cycler program: Step Temperature Duration Cycles 1 94ºC 4 min 1 94ºC 30 s 2 63ºC 30 s 35 72ºC 60 s 3 72ºC 7 min 1 4 94ºC hold 1

Example:

- + - - + - ADAM8 LacZ Figure 65: Example of ADAM8 genotyping PCR

Genotyping PCR for wildtype ADAM8 and LacZ

170

Publications

9 Publications

Articles

1. Schick D, Babendreyer A, Wozniak J, Awan T, Noels H, Liehn E, Bartsch JW, Vlacil AK, Grote K, Zayat R, Goetzenich A, Ludwig A, Dreymueller, D. Elevated expression of the metalloproteinase ADAM8 associates with vascular diseases in mice and humans. Atherosclerosis, 2019 286 (March), 163–171. https://doi.org/10.1016/j.atherosclerosis.2019.03.008

2. Awan T, Babendreyer A, Alvi AM, Duesterhoeft S, Bartsch JW, Liedtke C, Ludwig A. Expression level of the metalloproteinase ADAM8 critically regulates proliferation, migration and malignant signalling events in hepatoma cells. Journal of Cellular and Molecular Medicine. 2020, 00:1- 18. DOI: 10.1111/jcmm.16015

Poster presentation:

1. Awan, T., Babendreyer A., Seifert, A., Naveed, M., Alvi, A.M., Liedtke, C. and Ludwig, A. “ADAM8 controls cell migration and proliferation via activation of focal adhesion kinase and β1 integrin pathway in hepatoma cell”. Metalloproteinases, Gordon Research Conference, “Structure, Function and New Methods in Metalloproteinases”, held at Tuscany II, Ciocco Luca (Burga), Italy, 2019, May 12– 17. (Poster and rapid-fire talk)

171

Curriculum Vitae

10 Curriculum Vitae

Personal Data

Name: Tanzeela Awan

Date of Birth: 26th October 1985

Place of Birth: Layyah, Pakistan

Nationality: Pakistani

Education:

From April 2016 Doctoral Student at Institute of Pharmacology and Toxicology, University Hospital, RWTH Aachen University, Aachen, Germany. Supervisor: Prof. Dr. rer. nat. Andreas Ludwig Topic: “Role and regulation of the metalloproteinase ADAM8 in liver inflammation and hepatocellular carcinoma” 2010-2012

M. Phil – Pharmacology Department of Physiology and Pharmacology, Faculty of Veterinary Science, University of Agriculture, Faisalabad, Pakistan Thesis Title: “Gastroprotective activity of Glycyrrhiza glabra on gastric ulcers induced by aspirin in albino mice” 2004-2009

Doctor of Pharmacy Department of Pharmacy, Bahauddin Zakariya University, Multan Pakistan 2001-2004

Higher Secondary School Certificate /A-Level Islamabad Model College for Girls, F-6/2, Pakistan 1991-2001

Secondary School Certificate /O-Level Science Layyah Public Girls Higher Secondary School, Layyah, Pakistan

172

Declaration

11 Declaration

I hereby declare, that this thesis was carried out at RWTH Aachen University, within the Institute for Pharmacology and Toxicology. It was exclusively performed by me, unless otherwise stated in the text. To my knowledge, it contains no material used in other publications or thesis, except where reference is made in the text.

Place, Date ______Signature ______(Tanzeela Awan)

173

Acknowledgement

12 Acknowledgment

I have received a great deal of support and assistance to undertake this research work. I deem it an utmost pleasure to be able to express the profound gratitude to reverend supervisor, Professor Dr. Andreas Ludwig, who guided me in an excellent and most professional manner throughout my research, and navigate me in the world of science. His insightful feedback and constructive criticism pushed me to sharpen my thinking and brought my work to a higher level.

I would like to pay my thanks to Professor Dr. Gabriele Pradel and Professor Dr. Martin Zenke for their readiness to review my research work. Professor Dr. Ralph Panstruga, thank you for agreeing to be my examiner in the Ph.D. defense.

I owe further thanks to Professor Dr. Christian Liedtke for his wonderful collaboration during this project. I would like to thank Dr. Daniela Yildiz for enlightening me the first glance of research. I am also very thankful to Dr. Aaron Babendreyer and Dr. Stefan Duesterhoeft for their valuable guidance and assistance throughout my studies. I would sincerely thank Dr. Aaron for helping me to learn statistical software and Dr. Stefan for guiding me through molecular biology experiments.

A great gratitude goes to Mrs. Tanja Woopen and Mrs. Daniela Lambertz for providing me excellent technical assistance and support in the laboratory. A few lines are too short to make a complete account of my deep appreciation and hearties gratitude to my colleagues Justyna Wozniak, Anke Seifert, and Anja Giese for their scientific advices and friendly chats. I am thankful to Justyna also for critically reviewing my thesis which greatly increased the quality of the work. I would like to thank all the great people in this work group who have accompanied me during my work.

I heartiest thanks to my friends especially Dr. Shaista Ilyas, Bushra Ghufran, Saira Sajid and Sidhu for providing me stimulation discussions and happy distraction to rest my mind. Dr. Shaista Ilyas also deserve my gratitude for proofreading this manuscript.

I am greatly indebted to my mother for being there for me whenever I need her and for her mellifluous affections and consistent & priceless prayers. I transcend my power of narration to express how I feel obliged to my husband, Dr. Abid Mahmood Alvi. He

174

Acknowledgement always boosted my morale to fly too high to accomplish my goal and took me out of all predicaments, whenever I was into them. I am also very grateful to my loving children, Ayesha and Umer whose patience and benevolence gave me the time and strength to work on this thesis. Without their thousand hugs and good wishes, I would not be able to complete my work.

Finally, thanks to Higher Education Commission (HEC) of Pakistan and German Academic Exchange Service (DAAD) for providing financial assistance to accomplish this project in Germany.

175