DOCSLIB.ORG

Supporting Table 1 -Primers for Qrt-PCR

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Table 1 -Primers for Qrt-PCR Pavey et al., Microarray expression profiling in melanoma reveals a BRAF mutation signature. Supporting Information Page Number Supporting Text Text 1 – Cell culture and RNA extraction 2 Text 2 – PCR for genotyping BRAF and NRAS 3 Text 3 – Microarray probe preparation and hybridization 4 Text 4 – Quantitative RT-PCR 9 Supporting Tables Table 1 – Primers for qRT-PCR 10 Table 2 – BRAF and NRAS cell line mutations 11 Table 3 – BRAF non-parametric genelist 12 Table 4 – NRAS non-parametric genelist 62 Table 5 – Genes ranked within top 80 of SVM for BRAF classification 113 Table 6a – PTPRA qRT-PCR data 114 Table 6b – RAB2L qRT-PCR data 115 Table 6c – ANXA7 qRT-PCR data 116 Table 6d – CD2AP qRT-PCR data 117 Table 6e – DLAT qRT-PCR data 118 Table 6f – DLD qRT-PCR data 119 Table 6g – MUC18 qRT-PCR data 120 Table 6h – BUB3 qRT-PCR data 121 Table 6i – RAB11-FIB2 qRT-PCR data 122 Supporting Figure Figure 1 – ROC curve for BRAF prediction. 123 The ROC curve area was used as a measure of the prediction performance on samples not used to train the SVMs, obtaining an area of 82%. The ROC curve area corresponds to another more intuitive measure of discrimination: the probability that in a randomly chosen pair of samples, one wild type and one harboring a mutation, the wild type sample is the one with SVM output closest to the ideal output for that class. Supporting Text 1 – Cell Culture and RNA Extraction Cell Culture All cell lines were cultured in 150 cm2 flasks in RPMI 1640 (Gibco BRL) supplemented with penicillin (60 µg/ml) and steptomycin (100 µg/ml) in the presence of 10 % foetal bovine serum (FBS) from the same batch (CSL, Australia). Cells were split 1-2 days prior to RNA extraction so that on the day of collection, cultures were at approximately 70% confluency, and were in log phase growth. RNA Extraction Cell lysis was performed directly on the plate using Qiagen Midi Kits (Qiagen, Germany). Culture medium was aspirated and the cells were washed twice in 5 ml PBS, and excess PBS aspirated. A total of 2 ml of RLT buffer was added to each 150 cm2 flask and the flask was rotated to ensure complete lysis. Cell lysates were stored at -70oC until extraction, which was carried out as per the manufacturer’s instructions. RNA samples were quantitated spectrophotometrically by diluting in RNase-free water and measuring the absorbance at 260 nm (A260) against a water blank. The integrity and size distribution of total RNA was checked by denaturing agarose gel electrophoresis and ethidium bromide staining. RNA samples were aliquoted and stored at -70oC prior to cDNA synthesis to prevent repeated freeze-thawing. Preparation of Reference RNA using MM329 The cell line MM329 was used as a common reference for all hybridizations, and was prepared in one large batch. The cell line was expanded in culture as described above, and cell lysates were stored at -70oC until RNA extraction. RNA extraction was performed on cell lysates from all flasks of MM329 in one experiment, where the RNA was extracted and pooled, and quantitation and integrity checks were undertaken. The RNA was then aliquoted into 50 µg aliquots and stored at -70oC until hybridization to ensure that the samples were not repeatedly thawed and refrozen. Supporting Text 2 – PCR conditions to determine BRAF and NRAS mutation status Genotyping of Cell Lines. DNA was extracted from each cell line using an adaptation of the salting-out method (Miller et al., Nucleic Acids Res., 1988). BRAF was amplified to detect mutations in codons 463 and 468 (located in exon 11), and in codons 596 and 599 (located in exon 15). Using the primers BRAF_11F (ctctcaggcataaggtaatgtac) and BRAF_11R (gagtcccgactgctgtgaac), or BRAF_x15F (ctaagaggaaagatgaagtactatg) and BRAF_x15R (ctagtaactcagcagcatctcag), 360 bp and 328 bp PCR product were amplified respectively. Reactions contained 200 ng of DNA, QIAGEN PCR buffer (10x concentrated, containing Tris-Cl, KCl, (NH4)2SO4, 15 mM MgCl2; pH 8.7), Q solution (PCR enhancer), 20 pmol/µl of each primer, 2 mM of each dNTP, and 1.25 U of QIAGEN Taq polymerase. Amplification involved 35 cycles of denaturation at 94°C for 45 sec, annealing at 56°C for 90 sec, and extension at 72°C for 90 sec. An initial 12 min denaturation step at 94°C and a final 3 min extension at 72°C were also used. NRAS was also amplified to detect mutations in codons 12 and 13 (located in exon 1), and codon 61 (located in exon 2). Using the primers NRASX2F (ctggtttccaacaggttcttg) and NRASX2R (tgctactccaatcatctggtc), or NRASX3F (cacacccccaggattcttac) and NRASX3R (gttccaagtcattcccagtag), 567 bp and 438 bp PCR products were amplified respectively. DNA was amplified using QIAGEN Taq polymerase as described above. PCR involved a “touchdown” thermal cycling routine of two cycles at each annealing temperature, decreasing by steps of 2°C, followed by 25 cycles at the lowest temperature. Each cycle consisted of denaturation at 94°C for 45 sec, annealing at 65°C-57°C for 90 sec, and extension at 72°C for 90 sec. An initial 12 min denaturation at 94°C and a final 3 min extension at 72°C were also employed. PCR products were electrophoresed through a 1.5% TAE/agarose gel stained with ethidium bromide, excised and purified using a QIAGEN QIAquick Gel Extraction Kit. The BRAF and NRAS PCR products were sequenced using Applied Biosystems (ABI) BigDye version 3 according to the manufacturer's instructions using 3.2 pmol/ul of either BRAF_x15R, NRASX2R, or NRASX3R primer. Sequencing products were precipitated using 75% isopropanol and were run on an ABI 377 automated sequencer (PE Applied Biosystems, Foster City, CA). Supporting Text 3 – Microarray Probe Preparation and Hybridization Protocol SOLUTIONS RNase/DNase-free distilled water (Invitrogen, Cat #10977-015) Oligo (dT)15 (Roche, Cat. # 814270) add 20 µl RNase free H2O (Final concentration of 2 µg/µl) dNTP STOCKS - 25 mM dATP, dCTP, dGTP Mix. Using 100 mM dNTP’s (Promega, Cat # U1240) 50 µl of 100 mM dATP 50 µl of 100 mM dCTP 50 µl of 100 mM dGTP 50 µl of 50 mM Tris-HCl pH 8.0 Aliquot into 20 µl lots, store at –20oC. dNTP STOCKS - 2.5 mM dTTP Using 100 mM dTTP in above product. 5 µl of 100 mM dTTP 195 µl of 50 mM Tris-HCl pH 8.0 Aliquot into 20 µl lots, store at –20oC. Poly (dA) 25 units lyophilised (Amersham Pharmacia, Cat. # 27-7836). A260 unit of single stranded polymer = 37 µg Therefore, resuspend in 92.5 µl MilliQ total. Aliquot in 10 µl lots in 0.5 ml tubes, and store at –20oC. Cot-1 DNA 500 µg (Invitrogen, Cat. # 15279-011) Aliquot into 50 µl lots, and store at –20oC Cy3- and Cy5-dUTP From NEN products (Geneworks) (Cat. # NEL-578 & NEL-579). Stored in dark at 4oC 0.5 M EDTA pH 8.0 Add 186.1g of disodium ethylenediaminetetraacetate-2H2O to 800 ml water. Stir vigorously on a magnetic stirrer. Adjust the pH to 8.0 with NaOH (~20 g of NaOH pellets). Filter sterilize. 1M Tris pH 8.0 Dissolve 121.1 g of Tris base in 800 ml of water. Adjust the pH to 8.0 by adding ~42 ml concentrated HCl. Adjust the volume of the solution to 1 L with water. Filter sterilize 20x SSC Dissolve 175.3 g of NaCl and 88.2 g of sodium citrate in 800ml of water. Adjust the pH to 7.0 with a few drops of 10 N solution of NaOH. Adjust the volume to 1 L with water. Filter using a 0.2 µm bottle top filter. 10% SDS Dissolve 100 g of electrophoresis-grade SDS in 900 ml of water. Heat to 68°C to assist dissolution. Adjust the pH to 7.2 by adding a few drops of concentrated HCl. Adjust the volume to 1 L with water. Filter using a 0.2 µm bottle top filter. 2M NaOH Add 80 g of NaOH pellets to 1 L of sterile water. 1M HCl Add 86.2 ml of concentrated HCl solution and make up to a final volume of 1 L with sterile water. LABELLING 1. Measure out RNA into a 0.2 ml thin wall PCR tube, (if volume is >17 µl add 1 µl of RNasin as below) and Speedivac down to 18 µl, without heat. Resuspend in RNase free H2O to final volume of 18 µl. 2. Mix the following: 40 µg total RNA (50 µg for mm329 reference) 17 µl RNasin (Promega) 1 µl Oligo d(T15) (2 µg/µl) 2 µl 3. Heat to 70oC for 10 min in thermal cycler in 0.2 ml tube Prepare the following as a master mix and store on ice until required in Step 6:- Reaction 3 × Reactions 8 × Reactions 10 x Reactions (1 chip) (3chips) (4 chips) 5 × First Strand Buffer (Invitrogen)* 8 µl 24 µl 64 µl 80 µl 100 mM DTT (Invitrogen) 4 µl 12 µl 32 µl 40 µl (stock) 25.0 mM dATP,dCTP,dGTP 1 µl 3 µl 8 µl 10 µl (stock) 2.5 mM dTTP 2 µl 6 µl 16 µl 20 µl *Give the 5 × First Strand buffer and DTT a vortex before use Add 15ul of reaction mix to each separate tube containing 2 µl of 1.0 mM Cy3- or Cy5-dUTP. 4. Remove tube and cool on ice for 2 min. Change temperature on thermal cycler to 45oC. Zip spin for ~10 seconds to bring down condensation.
Load more

Recommended publications
  • Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist
    (19) TZZ _ __T (11) EP 2 192 197 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 02.06.2010 Bulletin 2010/22 C12Q 1/68 (2006.01) (21) Application number: 08170119.5 (22) Date of filing: 27.11.2008 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Habets, Winand Designated Extension States: Life Science Patents AL BA MK RS PO Box 5096 6130 PB Sittard (NL) (71) Applicant: Vereniging voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek en Patiëntenzorg 1081 HV Amsterdam (NL) (54) Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist (57) The invention relates to methods for predicting a clinical response to a therapy with a soluble TNF antagonist, TNF or a TNF receptor agonist and a kit for use in said methods. EP 2 192 197 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 192 197 A1 Description [0001] The invention relates to methods for predicting a clinical response to a treatment with a soluble TNF antagonist, with TNF or a TNF receptor agonist using expression levels of genes of the Type I INF pathway and a kit for use in said 5 methods. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with a soluble TNF antagonist, TNF or a TNF receptor agonist.
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • MIRA-Assisted Microarray Analysis, a New Technology for The
    Research Article MIRA-Assisted Microarray Analysis, a New Technology for the Determination of DNA Methylation Patterns, Identifies Frequent Methylation of Homeodomain-Containing Genes in Lung Cancer Cells Tibor Rauch,1 Hongwei Li,1 Xiwei Wu,2 and Gerd P. Pfeifer1 Divisions of 1Biology and 2Biomedical Informatics, Beckman Research Institute of the City of Hope, Duarte, California Abstract hypermethylation generally leads to inactivation of gene expres- We present a straightforward and comprehensive approach sion, this epigenetic alteration is considered to be a key mechanism for DNA methylation analysis in mammalian genomes. The for long-term silencing of tumor suppressor genes. The importance methylated-CpG island recovery assay (MIRA), which is based of promoter methylation in functional inactivation of lung cancer on the high affinity of the MBD2/MBD3L1 complex for suppressor genes is becoming increasingly recognized. It is methylated DNA, has been used to detect cell type–dependent estimated that between 0.5% and 3% of all genes carrying CpG- differences in DNA methylation on a microarray platform. The rich promoter sequences (so-called CpG islands) may be silenced procedure has been verified and applied to identify a series of by DNA methylation in lung cancer (1, 11). This means that there novel candidate lung tumor suppressor genes and potential are most likely several hundred genes that are incapacitated by this DNA methylation markers that contain methylated CpG pathway. Some of these genes may be bona fide tumor suppressor islands. One gene of particular interest was DLEC1, located genes, but in other cases, the methylation event may be a at a commonly deleted area on chromosome 3p22-p21.3, consequence of gene silencing or may somehow be associated with which was frequently methylated in primary lung cancers and tumor formation rather than being a cause of tumorigenesis.
    [Show full text]
  • Antibodies Products
    Chapter 2 : Gentaur Products List • WDSUB1 contains 1 SAM sterile alpha motif domain 1 U Defects in DLG3 are the cause of mental retardation X • Sodium hydrogen exchangers NHEs such as SLC9A8 are box domain and 7 WD repeats The function of WDSUB1 linked type 90 MRX90 integral transmembrane proteins that exchange extracellular remains unknown • SLC25A20 is one of several closely related mitochondrial Na for intracellular H NHEs have multiple functions including • RNF217 is an E3 ubiquitin protein ligase which accepts membrane carrier proteins that shuttle substrates between intracellular pH ho ubiquitin from E2 ubiquitin conjugating enzymes in the form cytosol and the intramitochondrial matrix space It mediates • SLCO1C1 is a member of the organic anion transporter of a thioester and then directly transfers the ubiquitin to the transport of acylcarn family SLCO1C1 is a transmembrane receptor that mediates targeted substrates • The sodium iodide symporter NIS or SLC5A5 is a key the sodium independent uptake of thyroid hormones in brain • TRIM60 contains a RING finger domain a motif present in a plasma membrane protein that mediates active I uptake in tissues This protein has part variety of functionally distinct proteins and known to be thyroid lactating breast and other tissues with an • SLC35A5 belongs to the nucleotide sugar transporter involved in protein protein and protein DNA interactions The electrogenic stoichiometry of 2 Na family SLC35A subfamily It is a multi pass membrane protein encoded by thi • SLC2A9 is a member of the SLC2A
    [Show full text]
  • Ep 2 136 209 A1
    (19) & (11) EP 2 136 209 A1 (12) EUROPEAN PATENT APPLICATION published in accordance with Art. 153(4) EPC (43) Date of publication: (51) Int Cl.: 23.12.2009 Bulletin 2009/52 G01N 33/15 (2006.01) G01N 33/50 (2006.01) (21) Application number: 08721397.1 (86) International application number: PCT/JP2008/053977 (22) Date of filing: 05.03.2008 (87) International publication number: WO 2008/111464 (18.09.2008 Gazette 2008/38) (84) Designated Contracting States: • SAGANE, Koji AT BE BG CH CY CZ DE DK EE ES FI FR GB GR Tsukuba-shi HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT Ibaraki 300-2635 (JP) RO SE SI SK TR • UESUGI, Mai Tsukuba-shi (30) Priority: 05.03.2007 US 904774 P Ibaraki 300-2635 (JP) 28.09.2007 US 960403 P • KADOWAKI, Tadashi Tsukuba-shi (71) Applicant: Eisai R&D Management Co., Ltd. Ibaraki 300-2635 (JP) Tokyo 112-8088 (JP) • YOSHIDA, Taku Tsukuba-shi (72) Inventors: Ibaraki 300-2635 (JP) • MIZUI, Yoshiharu Tsukuba-shi (74) Representative: Woods, Geoffrey Corlett Ibaraki 300-2635 (JP) J.A. Kemp & Co. • HATA, Naoko 14 South Square Tsukuba-shi Gray’s Inn Ibaraki 300-2635 (JP) London • IWATA, Masao WC1R 5JJ (GB) Tsukuba-shi Ibaraki 300-2635 (JP) (54) METHOD FOR EXAMINATION OF ACTION OF ANTI-CANCER AGENT UTILIZING SPLICING DEFECT AS MEASURE (57) An object of the present invention is to provide a method, a probe, a primer, an antibody, a reagent, and a kit for assaying an action of a pladienolide derivative to a living subject.
    [Show full text]
  • TABLE 5. Proteins Identified in Cumulus and Oocyte. GI Number
    TABLE 5. Proteins identified in Cumulus and Oocyte. GI Cell Protein DDF Protein name Peptides number typea categoryb fraction 30523262 100 kDa coactivator C K 5 2 2852383 14-3-3 protein beta C K 2 4 2852385 14-3-3 protein gamma C K 14 4 298639 155 kda myosin light chain kinase homolog O K 1 1 576 17,000 dalton myosin light chain CO K 5 3 8118661 17-beta-hydroxysteroid dehydrogenase type 1 C K 2 3 17864970 17-beta-hydroxysteroid dehydrogenase type 1 CO K 38 3 59857747 1-acylglycerol-3-phosphate O-acyltransferase 4 O K 1 3 30017445 2',5'-oligoadenylate synthetase 1, 40/46kDa C K 2 4,3 66792906 2'-5' oligoadenylate synthetase 2 C K 1 1 7271506 2-amino-3-ketobutyrate coenzyme A ligase O K 2 1 31414871 2-enoyl thioester reductase C K 2 4,1 45219953 5-hydroxytryptamine receptor 2A C K 2 4,1 47564115 5-oxo-L-prolinase CO K 5 1 34392345 90-kDa heat shock protein beta CO K 54 1 56967054 A Chain A, Crystal Structure Of Bosus Mitochondrial Elongation Factor TuT O K 2 3 27807141 A disintegrin-like and metalloprotease (reprolysin type) with thrombos O K 1 3 89579 A23707 aminomethyltransferase (EC 2.1.2.10) precursor C K 3 3 89381 A29600 alkaline phosphatase (EC 3.1.3.1) precursor, hepatic - bovine O K 1 1 108687 A36623 gap junction protein Cx43 C K 3 4 89346 A40981 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17), cGMP-stimulated C K 1 4 1363022 A56351 cleavage and polyadenylation specificity factor 100K chain C K 1 3 1363051 A56534 interferon-induced double-stranded RNA-activated protein kinase inhibitor C K 1 4 14194421 AAKG1_BOVIN 5'-AMP-activated protein kinase, gamma-1 subunit C K 1 4 62751897 Abhydrolase domain containing 2 CO K 2 1 61554426 Abl-philin 2 isoform 2 CO K 2 3 63092048 Acetyl-CoA carboxylase, type beta C K 1 3 6006405 Acetyl-CoA-carboxylase C K 3 1 163596 Acid phosphatase C K 1 4 1649041 Acidic ribosomal phosphoprotein C K 2 1 2293577 Acidic ribosomal phosphoprotein PO C K 6 1 600177 Acidic ribosomal protein P2 C K 9 4 1351857 ACON_BOVIN Aconitate hydratase, mitochondrial precursor CO K 27 1 58013001 Actin [Cryptosporidium sp.
    [Show full text]
  • Molecular Karyotypes of Hodgkin and Reed–Sternberg Cells at Disease Onset Reveal Distinct Copy Number Alterations in Chemosensitive Versus Refractory Hodgkin Lymphoma
    Published OnlineFirst March 8, 2011; DOI: 10.1158/1078-0432.CCR-10-1071 Clinical Cancer Predictive Biomarkers and Personalized Medicine Research Molecular Karyotypes of Hodgkin and Reed–Sternberg Cells at Disease Onset Reveal Distinct Copy Number Alterations in Chemosensitive versus Refractory Hodgkin Lymphoma Marilyn L. Slovak1, Victoria Bedell1, Ya-Hsuan Hsu1, Dolores B. Estrine1, Norma J. Nowak5, Maria L. Delioukina2, Lawrence M. Weiss3, David D. Smith, and Stephen J. Forman2 Abstract Purpose: To determine the recurring DNA copy number alterations (CNA) in classical Hodgkin lymphoma (HL) by microarray-based comparative genomic hybridization (aCGH) using laser capture þ microdissected CD30 Hodgkin and Reed–Sternberg (HRS) cells. þ Experimental Design: Archived tissues from 27 CD30 HL plus control samples were analyzed by DNA microarrays. The HL molecular karyotypes were compared with the genomic profiles of germinal center B cells and treatment outcome (chemotherapy responsive vs. primary refractory disease). Results: Gains and losses observed in more than 35% of HL samples were localized to 22 and 12 chromosomal regions, respectively. Frequent gains (>65%) were associated with growth and proliferation, NF-kB activation, cell-cycle control, apoptosis, and immune and lymphoid development. Frequent losses (>40%) observed encompassed tumor suppressor genes (SPRY1, NELL1,andID4, inhibitor of DNA binding 4), transcriptional repressors (TXNIP, thioredoxin interacting protein), SKP2 (S-phase kinase-associated protein 2; ubiquitin ligase component), and an antagonist of NF-kB activation (PPARGC1A). In comparison to the germinal center profiles, the most frequent imbalances in HL were losses in 5p13 (AMACR, GDNF, and SKP2), and gains in 7q36 (SHH, sonic hedgehog homolog) and 9q34 (ABL1, CDK9, LCN2, and PTGES).
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2005/0239060A1 Tang Et Al
    US 2005O239060A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2005/0239060A1 Tang et al. (43) Pub. Date: Oct. 27, 2005 (54) NOVEL NUCLEICACIDS AND (21) Appl. No.: 10/122,851 POLYPEPTIDES (22) Filed: Apr. 12, 2002 (76) Inventors: Y. Tom Tang, San Jose, CA (US); Chenghua Liu, San Jose, CA (US); Related U.S. Application Data Vinod Asundi, Foster City, CA (US); Jie Zhang, Campbell, CA (US); Feiyan (60) Division of application No. 09/620,312, filed on Jul. Ren, Cupertino, CA (US); Rui-hong 19, 2000, now Pat. No. 6,569,662, which is a con Chen, Foster City, CA (US); Qing A. tinuation-in-part of application No. 09/552,317, filed Zhao, San Jose, CA (US); Tom on Apr. 25, 2000, now abandoned, which is a con Wehrman, Stanford, CA (US); Aidong tinuation-in-part of application No. 09/488,725, filed J. Xue, Sunnyvale, CA (US); on Jan. 21, 2000, now abandoned. Yonghong Yang, San Jose, CA (US); O O Jian-Rui Wang, Cupertino, CA (US); Publication Classification Ping Zhou, San Jose, CA (US); 7 Yunqing Ma, Sunnyvale, CA (US); (51) Int. Cl. ............................ C12O 1/68; CE,...; E. WE Miles. AARs). (52) U.S. Cl. ............................. 435/6; 435/69.1; 435/183; Radoje T. Drmanac, Palo Alto, CA 435/320.1; 435/325; 536/23.2 (US) Correspondence Address: (57) ABSTRACT Leslie A. Mooi HYSEQ, INC. The present invention provides novel nucleic acids, novel 670 Almanor Avenue polypeptide Sequences encoded by these nucleic acids and Sunnyvale, CA 94085 (US) uses thereof. US 2005/0239060A1 Oct.
    [Show full text]
  • Wo 2010/040571 A2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 15 April 2010 (15.04.2010) WO 2010/040571 A2 (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12N 15/11 (2006.01) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, (21) International Application Number: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, PCT/EP2009/00743 1 DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (22) International Filing Date: HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, 12 October 2009 (12.10.2009) KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, (25) Filing Language: English NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (26) Publication Language: English SE, SG, SK, SL, SM, ST, SV, SY, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: 08075816.2 10 October 2008 (10.10.2008) DE (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (71) Applicant (for all designated States except US): GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, FRAUNHOFER-GESELLSCHAFT ZUR ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, FORDERUNG DER ANGEWANDTEN TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, FORSCHUNG E.V.
    [Show full text]
  • Method for a Genome Wide Identification of Expression
    (19) TZZ ___T (11) EP 2 177 615 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 21.04.2010 Bulletin 2010/16 C12N 15/11 (2006.01) (21) Application number: 08075816.2 (22) Date of filing: 10.10.2008 (84) Designated Contracting States: • Weltmeier, Fridtjof, Dr. AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 30627 Hannover (DE) HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Baumbach, Friedrich Designated Extension States: Patentanwalt AL BA MK RS Robert-Rössle-Strasse 10 13125 Berlin (DE) (71) Applicant: Fraunhofer-Gesellschaft zur Förderung der Remarks: angewandten Forschung e.V. Claims 16-27,29,31,33-44 and 46-47 are deemed to 80686 München (DE) be abandoned due to non-payment of the claims fees (Rule 45(3) EPC). (72) Inventors: • Borlak, Jürgen, Prof. Dr. 31275 Lehrte OT Immensen (DE) (54) Method for a genome wide identification of expression regulatory sequences and use of genes and molecules derived thereof for the diagnosis and therapy of metabolic and/or tumorous diseases (57) The invention is directed to the use of particular located within the chromosomal position specified by par- human genes, nucleic acids hybridizing to said genes, ticular start and end sites. and gene products encoded thereby in the context of the The invention further relates to a method for a diagnosis and/or therapy of metabolic and/or cancerous genomewide identification of functional binding sites at diseases, preferably of diabetes mellitus and/or colorec- specifically targeted DNA sequences with high resolu- tal cancer, wherein the gene is selected from the group tion, wherein the method comprises, or preferably con- of the human chromosomal genes having at least one sists of, the steps of: expression regulatory sequence according to matrix 1 a.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2009/0004173 A1 Evans Et Al
    US 200900.041.73A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0004173 A1 Evans et al. (43) Pub. Date: Jan. 1, 2009 (54) DIAGNOSIS AND TREATMENT OF DRUG Related U.S. Application Data RESISTANT LEUKEMA (60) Provisional application No. 60/575,762, filed on May 28, 2004. (75) Inventors: William E. Evans, Cordova, TN Publication Classification (US); Robert Pieters, Rotterdam (51) Int. Cl. (NL); Meyling H. Cheok, A638/50 (2006.01) Memphis, TN (US); Monique L. GOIN 33/50 (2006.01) den Boer, Rotterdam (NL); C40B 30/06 (2006.01) Wenjian Yang, Germantown, TN A63L/437 (2006.01) (US) C40B 40/00 (2006.01) A6IP35/02 (2006.01) A63L/35 (2006.01) Correspondence Address: A 6LX 3/573 (2006.01) ALSTON AND BIRD LLP C40B 30/00 (2006.01) ST. JUDE CHILDREN'S RESEARCH HOSP (52) U.S. Cl. ................ 424/94.6; 702/19; 506/10; 506/7; TAL 514/285; 514/459; 506/13 BANK OF AMERICA PLAZA, 101 SOUTH TRYON STREET, SUITE 4000 (57) ABSTRACT CHARLOTTE, NC 28280-4000 (US) The present invention encompasses methods and composi tions useful in the diagnosis and treatment of drug resistant (73) Assignee: St. Jude Children's Research leukemia. The invention provides a number of genes that are Hospital, Memphis, TN (US) differentially expressed between drug resistant and drug sen sitive acute lymphoblastic leukemia (ALL). These genes act as biomarkers for drug resistant leukemia, and further serve as (21) Appl. No.: 11/597,468 molecular targets for drugs useful in treating drug resistant leukemia. Accordingly, the invention provides methods of diagnosing drug resistant leukemia and methods of selecting (22) PCT Filed: May 18, 2005 a therapy for Subjects affected by drug-resistant leukemia.
    [Show full text]
  • Synuclein Toxicity Using a Caenorhabditis Elegans
    IDENTIFICATION OF NEUROPROTECTIVE GENES AGAINST ALPHA- SYNUCLEIN TOXICITY USING A CAENORHABDITIS ELEGANS PARKINSON DISEASE MODEL by SHUSEI HAMAMICHI A DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biological Sciences in the Graduate School of The University of Alabama TUSCALOOSA, ALABAMA 2009 Copyright Shusei Hamamichi 2009 ALL RIGHTS RESERVED ABSTRACT Recent functional analyses of nine gene products linked to familial forms of Parkinson disease (PD) have revealed several cellular mechanisms that are associated with PD pathogenesis. For example, α-synuclein ( α-syn), a primary component of Lewy bodies found in both familial and idiopathic forms of PD, has been shown to cause defects in proteasomal and lysosomal protein degradation machineries and induce mitochondrial/oxidative stress. These findings are further supported by the fact that additional gene products are involved in the same pathways. While these studies have been invaluable to elucidate the etiology of this disease, it has been reported that monogenic forms of PD only account for 5-10% of all PD cases, indicating that multiple genetic susceptibility factors and intrinsic metabolic changes associated with aging may play a significant role. Here we report the use of an organism, Caenorhabditis elegans , to model two central PD pathological features to rapidly identify genetic components that modify α-syn misfolding in body wall muscles and neurodegeneration in DA neurons. We determined that proteins that function in lysosomal protein degradation, signal transduction, vesicle trafficking, and glycolysis, when knocked down by RNAi, enhanced α-syn misfolding. Furthermore, these components, when overexpressed, rescued DA neurons from α-syn-induced neurodegeneration, and several of them have been validated using mammalian system.
    [Show full text]