Pavey et al., Microarray expression profiling in melanoma reveals a BRAF mutation signature.

Supporting Information

Page Number Supporting Text Text 1 – Cell culture and RNA extraction 2 Text 2 – PCR for genotyping BRAF and NRAS 3 Text 3 – Microarray probe preparation and hybridization 4 Text 4 – Quantitative RT-PCR 9

Supporting Tables Table 1 – Primers for qRT-PCR 10 Table 2 – BRAF and NRAS cell line mutations 11 Table 3 – BRAF non-parametric genelist 12 Table 4 – NRAS non-parametric genelist 62 Table 5 – Genes ranked within top 80 of SVM for BRAF classification 113 Table 6a – PTPRA qRT-PCR data 114 Table 6b – RAB2L qRT-PCR data 115 Table 6c – ANXA7 qRT-PCR data 116 Table 6d – CD2AP qRT-PCR data 117 Table 6e – DLAT qRT-PCR data 118 Table 6f – DLD qRT-PCR data 119 Table 6g – MUC18 qRT-PCR data 120 Table 6h – BUB3 qRT-PCR data 121 Table 6i – RAB11-FIB2 qRT-PCR data 122

Supporting Figure Figure 1 – ROC curve for BRAF prediction. 123 The ROC curve area was used as a measure of the prediction performance on samples not used to train the SVMs, obtaining an area of 82%. The ROC curve area corresponds to another more intuitive measure of discrimination: the probability that in a randomly chosen pair of samples, one wild type and one harboring a mutation, the wild type sample is the one with SVM output closest to the ideal output for that class. Supporting Text 1 – Cell Culture and RNA Extraction

Cell Culture

All cell lines were cultured in 150 cm2 flasks in RPMI 1640 (Gibco BRL) supplemented with penicillin (60 µg/ml) and steptomycin (100 µg/ml) in the presence of 10 % foetal bovine serum (FBS) from the same batch (CSL, Australia). Cells were split 1-2 days prior to RNA extraction so that on the day of collection, cultures were at approximately 70% confluency, and were in log phase growth.

RNA Extraction

Cell lysis was performed directly on the plate using Qiagen Midi Kits (Qiagen, Germany). Culture medium was aspirated and the cells were washed twice in 5 ml PBS, and excess PBS aspirated. A total of 2 ml of RLT buffer was added to each 150 cm2 flask and the flask was rotated to ensure complete lysis. Cell lysates were stored at -70oC until extraction, which was carried out as per the manufacturer’s instructions. RNA samples were quantitated spectrophotometrically by diluting in RNase-free water and measuring the absorbance at 260 nm (A260) against a water blank. The integrity and size distribution of total RNA was checked by denaturing agarose gel electrophoresis and ethidium bromide staining. RNA samples were aliquoted and stored at -70oC prior to cDNA synthesis to prevent repeated freeze-thawing.

Preparation of Reference RNA using MM329

The cell line MM329 was used as a common reference for all hybridizations, and was prepared in one large batch. The cell line was expanded in culture as described above, and cell lysates were stored at -70oC until RNA extraction. RNA extraction was performed on cell lysates from all flasks of MM329 in one experiment, where the RNA was extracted and pooled, and quantitation and integrity checks were undertaken. The RNA was then aliquoted into 50 µg aliquots and stored at -70oC until hybridization to ensure that the samples were not repeatedly thawed and refrozen. Supporting Text 2 –

PCR conditions to determine BRAF and NRAS mutation status

Genotyping of Cell Lines.

DNA was extracted from each cell line using an adaptation of the salting-out method (Miller et al., Nucleic Acids Res., 1988). BRAF was amplified to detect mutations in codons 463 and 468 (located in exon 11), and in codons 596 and 599 (located in exon 15). Using the primers BRAF_11F (ctctcaggcataaggtaatgtac) and BRAF_11R (gagtcccgactgctgtgaac), or BRAF_x15F (ctaagaggaaagatgaagtactatg) and BRAF_x15R (ctagtaactcagcagcatctcag), 360 bp and 328 bp PCR product were amplified respectively. Reactions contained 200 ng of DNA, QIAGEN PCR buffer (10x concentrated, containing Tris-Cl, KCl, (NH4)2SO4, 15 mM MgCl2; pH 8.7), Q solution (PCR enhancer), 20 pmol/µl of each primer, 2 mM of each dNTP, and 1.25 U of QIAGEN Taq polymerase. Amplification involved 35 cycles of denaturation at 94°C for 45 sec, annealing at 56°C for 90 sec, and extension at 72°C for 90 sec. An initial 12 min denaturation step at 94°C and a final 3 min extension at 72°C were also used.

NRAS was also amplified to detect mutations in codons 12 and 13 (located in exon 1), and codon 61 (located in exon 2). Using the primers NRASX2F (ctggtttccaacaggttcttg) and NRASX2R (tgctactccaatcatctggtc), or NRASX3F (cacacccccaggattcttac) and NRASX3R (gttccaagtcattcccagtag), 567 bp and 438 bp PCR products were amplified respectively. DNA was amplified using QIAGEN Taq polymerase as described above. PCR involved a “touchdown” thermal cycling routine of two cycles at each annealing temperature, decreasing by steps of 2°C, followed by 25 cycles at the lowest temperature. Each cycle consisted of denaturation at 94°C for 45 sec, annealing at 65°C-57°C for 90 sec, and extension at 72°C for 90 sec. An initial 12 min denaturation at 94°C and a final 3 min extension at 72°C were also employed.

PCR products were electrophoresed through a 1.5% TAE/agarose gel stained with ethidium bromide, excised and purified using a QIAGEN QIAquick Gel Extraction Kit. The BRAF and NRAS PCR products were sequenced using Applied Biosystems (ABI) BigDye version 3 according to the manufacturer's instructions using 3.2 pmol/ul of either BRAF_x15R, NRASX2R, or NRASX3R primer. Sequencing products were precipitated using 75% isopropanol and were run on an ABI 377 automated sequencer (PE Applied Biosystems, Foster City, CA).

Supporting Text 3 – Microarray Probe Preparation and Hybridization Protocol

SOLUTIONS

RNase/DNase-free distilled water (Invitrogen, Cat #10977-015)

Oligo (dT)15 (Roche, Cat. # 814270) add 20 µl RNase free H2O (Final concentration of 2 µg/µl)

dNTP STOCKS - 25 mM dATP, dCTP, dGTP Mix. Using 100 mM dNTP’s (Promega, Cat # U1240) 50 µl of 100 mM dATP 50 µl of 100 mM dCTP 50 µl of 100 mM dGTP 50 µl of 50 mM Tris-HCl pH 8.0 Aliquot into 20 µl lots, store at –20oC.

dNTP STOCKS - 2.5 mM dTTP Using 100 mM dTTP in above product. 5 µl of 100 mM dTTP 195 µl of 50 mM Tris-HCl pH 8.0 Aliquot into 20 µl lots, store at –20oC.

Poly (dA) 25 units lyophilised (Amersham Pharmacia, Cat. # 27-7836).

A260 unit of single stranded polymer = 37 µg Therefore, resuspend in 92.5 µl MilliQ total. Aliquot in 10 µl lots in 0.5 ml tubes, and store at –20oC.

Cot-1 DNA 500 µg (Invitrogen, Cat. # 15279-011) Aliquot into 50 µl lots, and store at –20oC

Cy3- and Cy5-dUTP From NEN products (Geneworks) (Cat. # NEL-578 & NEL-579). Stored in dark at 4oC

0.5 M EDTA pH 8.0 Add 186.1g of disodium ethylenediaminetetraacetate-2H2O to 800 ml water. Stir vigorously on a magnetic stirrer. Adjust the pH to 8.0 with NaOH (~20 g of NaOH pellets). Filter sterilize.

1M Tris pH 8.0 Dissolve 121.1 g of Tris base in 800 ml of water. Adjust the pH to 8.0 by adding ~42 ml concentrated HCl. Adjust the volume of the solution to 1 L with water. Filter sterilize

20x SSC Dissolve 175.3 g of NaCl and 88.2 g of sodium citrate in 800ml of water. Adjust the pH to 7.0 with a few drops of 10 N solution of NaOH. Adjust the volume to 1 L with water. Filter using a 0.2 µm bottle top filter.

10% SDS Dissolve 100 g of electrophoresis-grade SDS in 900 ml of water. Heat to 68°C to assist dissolution. Adjust the pH to 7.2 by adding a few drops of concentrated HCl. Adjust the volume to 1 L with water. Filter using a 0.2 µm bottle top filter.

2M NaOH Add 80 g of NaOH pellets to 1 L of sterile water.

1M HCl Add 86.2 ml of concentrated HCl solution and make up to a final volume of 1 L with sterile water. LABELLING

1. Measure out RNA into a 0.2 ml thin wall PCR tube, (if volume is >17 µl add 1 µl of RNasin as below) and Speedivac down to 18 µl, without heat. Resuspend in RNase free H2O to final volume of 18 µl.

2. Mix the following: 40 µg total RNA (50 µg for mm329 reference) 17 µl RNasin (Promega) 1 µl Oligo d(T15) (2 µg/µl) 2 µl

3. Heat to 70oC for 10 min in thermal cycler in 0.2 ml tube

Prepare the following as a master mix and store on ice until required in Step 6:-

Reaction 3 × Reactions 8 × Reactions 10 x Reactions (1 chip) (3chips) (4 chips) 5 × First Strand Buffer (Invitrogen)* 8 µl 24 µl 64 µl 80 µl 100 mM DTT (Invitrogen) 4 µl 12 µl 32 µl 40 µl (stock) 25.0 mM dATP,dCTP,dGTP 1 µl 3 µl 8 µl 10 µl (stock) 2.5 mM dTTP 2 µl 6 µl 16 µl 20 µl

*Give the 5 × First Strand buffer and DTT a vortex before use

Add 15ul of reaction mix to each separate tube containing 2 µl of 1.0 mM Cy3- or Cy5-dUTP.

4. Remove tube and cool on ice for 2 min. Change temperature on thermal cycler to 45oC. Zip spin for ~10 seconds to bring down condensation.

5. Transfer back to thermal cycler at 45oC for 10 min.

6. Add the above Reaction Mix (containing the separate dyes) to the separate RNA + oligo (dT)15 mixes.

7. Mix well, zip spin and incubate at 42oC for 2 min.

8. Add 1.5 µl of Superscript II. Mix well & zip spin. Incubate for 60 min at 42oC for 1 hr.

9. Add another 1 µl of Superscript II and incubate for a further 1.5 hrs. Quench tubes on ice for 1 min. Zip spin to collect condensation.

10. Add 1 µl of 0.5 M EDTA (pH 8.0) and 2 µl of 2 M NaOH to each tube. Heat to 65oC for 10 min.

11. Add 4 µl 1 M HCl and 4 µl 1 M Tris (pH 8.0) .

12. Add 17 µl of 100 mM Sodium acetate (pH 5.2) to each reaction.

PURIFICATION (of labelled cDNA)

Amended Protocol for Qiaquick PCR purification column.

1. Add a total of 500 µl PB buffer to the reaction tubes. Do this by adding 166 µl PB buffer to each of the tubes, mixing, and transferring to a 1.5 ml tube. The final 166 µl is rinsed through each of the Cy3 and Cy5 reaction tubes. The pooled reactions are mixed well, and loaded onto Qiaquick column (Note that the solution will be purple in color).

2. Spin through at 14,000 rpm for 60 sec. Discard eluate (most of the dyes will go through as they are un-incorporated, so don’t be surprised at a bright purple colour in eluate).

3. Add 600 µl of PE buffer to the column.

4. Spin 14,000 rpm for 1 min and discard eluate. Transfer column to a fresh collection tube (not supllied (Qiagen Cat #19201).

5. Spin 14,000 rpm for 1 min (to dry).

6. Transfer to column to fresh collection tube (1.5 ml Eppendorf).

7. Add 40 µl of EB buffer to the middle of the column & incubate for 1-2 min.

8. Elute purified cDNA by spinning for 1 min at 14,000 rpm. The product is clear in appearance.

HYBRIDISATION

NB: Set-up 0.2 ml tubes and label.

1. To a fresh 0.2 ml tube add: Cot-1 DNA (1 µg/µl) 10 µl poly dA (10 µg/µl) 2 µl purified probe (from Qiaquick purification) ~40 µl

Speedivac down to ~11 µl with heat at 45oC.

2. Then add the following in order: 20 × SSC 8 µl Deionized Formamide 20 µl 10% SDS 2 µl

Mix, spin down, and heat sample to 95oC for 5 min.

3. Incubate the labelled target at 45oC for 45 min prior to placing on array.

Meanwhile, while the probe is incubating……

Prepare Hyb chambers as follows. - Ensure all slides in the black box are flat so that the OCI chips sit on top perfectly horizontal. - Add the following solution to the Hyb chamber (will keep the box humidified) • 1 ml 20x SSC • 2.5 ml deionised formamide • 250 µL 10% SDS • 1.4 ml H2O - Place the Hyb chamber inside a boehringer box and pre-heat in an oven at 45oC until probe is ready.

Make up the following Hyb solution (to be added to probe before placing on OCI chips): • 48 µL 20x SSC • 120 µL deionised formamide • 12 µL 10% SDS • 66 µL H2O

4. Place probe on ice for 10 sec, spin for 30 sec at room temperature. Don’t make probe too cold, in case of precipitation.

5. Add 60µL of the Hyb solution (see above) to the probe, so that probe solution totals ~100 µL.

6. Place first slide into Hyb chamber by holding the slide with forceps on the sticker end. Aim for the middle of the Hyb chamber. Place the second OCI slide on top of the first so that the stickers are at opposite ends and facing inwards. Position the top slide so that one of the long edges is slightly overhanging that of the bottom slide.

7. Carefully load 100 µL of room-temp probe between the top and bottom slides using a yellow tip and allow capillary action to distribute the slide between the two slides.

8. Carefully move the top slide so that it is completely aligned with the bottom slide. Close the lid of the Hyb chamber. 9. Run the hot tap, and fill a Boehringer box with 1-2 cm of hot water (Temp is about 50oC). Gently submerge the Hyb chamber into the water, and place in oven at 45oC for 14 - 24 hrs.

WASHING

1. Prepare the following (in 2 L beakers):

1 l of SDS Wash

MQ WATER 990 ml 20 x SSC 10 ml 10% SDS 5 ml

1 l of SSC Rinse

MQ WATER 990 ml 20 x SSC 10 ml

(An optional second SSC rinse station can also be added)

2. Prior to washing, pre-warm the warm wash solutions to ~37°C. Wrap foil around the washing beakers and wash slides in the dark to minimize light exposure.

3. After hybridisation, plunge each slide into the SDS/SSC Wash. Place slide into rack and then gently plunge holder for 15 sec every min for 3 min.

4. Rapidly transfer slide holder into SSC Wash, and gently plunge holder for 15 sec every min for 3min.

5. Remove slide with forceps and place in a 50 ml falcon tube and centrifuge at 600 rpm for 5 min to dry slide.

6. Store slides in slide box with closed lid to reduce quenching of fluorophores.

SCANNING

NB: Scan Cy5 first, as it is more photolabile.

1. Turn on scanner. Start GMS 418 Scanner program.

2. Using flat-forceps, insert slide into GMS 418 scanner.

• for OCI chips- place sticker end in first (so barcode is at bottom of slide image) OCI chip

3. Ensure laser selected is the “Red” one on the scanner window, and the correct sector of the wheel (underneath the slide insert window).

4. Select area you wish to scan by pressing “Go” button.

• for OCI chips- will need to move region to be scanned towards top of slide OCI chip

5. Go to “Advanced settings”, and select appropriate gain setting to ensure that elements remain withing a dynamic range. Scan slide and they save raw image.

6. When finished, select the laser to be used in the scanning window for “Green”, and physically change the sector of the wheel on the GMS 418 scanner. Repeat the above steps, until suitable images have been obtained and saved.

7. Press the “eject slide” button from the software and remove slide.

Supporting Text 4 – Quantitative RT-PCR Methods

To further confirm the validity of the microarray expression data, the mRNA levels of 12 unique transcripts selected from the 83 highest ranking genes from the SVM output were quantified by real-time quantitative RT-PCR.

Reverse Transcription The same RNA samples extracted for the microarray experiments were used. cDNA was made using Superscript III reverse transcriptase (Invitrogen) according to the manufacturer's protocol, with the reverse transcription undertaken for 3 hrs. All cDNAs were quantitated o used a spectrophotometer at A260nm, and were aliquoted and stored at -20 C.

Quantitative PCR Each PCR was performed in duplicate using a QuantiTect SYBR® Green PCR kit (Qiagen, Germany). Reactions contained 2 µl (20 ng) of cDNA, 0.5 µl of each primer (20 µM), 10 µl 2x QuantiTect SYBR® Green PCR Master Mix and 7 µl RNAse-free water. Test cell lines and the reference cell line (MM329) were amplified in parallel reactions using specific primers (for primer sequences, please refer to Supporting Table 1 on the PNAS web site).

All PCR’s were carried out on a Corbett RotorGene 3000 (Corbett Research, Australia). Each PCR reaction involved 45 cycles of denaturation at 95°C for 15 sec, annealing at 60°C for 20 sec, and extension at 72°C for 20 sec followed by a melt from 72oC to 99oC for 30 sec. The following primers required different annealing temperatures; RAB11 underwent annealing at 54°C and BUB3 and DLD underwent annealing at 58°C. An initial 15 min polymerase activation step at 95°C was also employed. Specificity of PCR products obtained was characterized by melting curve analysis. Gel electrophoresis and DNA sequencing was carried out on PCR products for each primer set to confirm identity.

To confirm accuracy and reproducibility of qRT-PCR the intra-assay precision was determined in 10 repeats within one run. Inter-assay variation was investigated in 10 different experimental runs performed over 8 days.

Supporting Table 1 - Primers used for Verification of Transcripts using Real-time RT-PCR

Transcripts Verified on total panel of 61 melanoma cell lines Verified Product Clone ID GenBank Unigene Locus Gene Melting Gene Name Forward primer Reverse primer length on Chip Accession cluster Link ID Symbol temp (C) (bp) No. H08441 H08441 Hs.26045 5786 Protein tyrosine phosphatase, receptor type, A PTPRA GAGAGGCCAGGAGAAGTGTG GAGGTCTCGGACGGTGTAG 83.1 118 R25789 R25789 Hs.170160 5863 RAB2, member RAS oncogene family-like RAB2L GCAGTGGACAGAGGTTTTGG AGTCAGCAGAGGAGCAGGAG 86.9 112 AA135740 BQ009475 Hs.78637 310 Annexin A7 ANXA7 GAAGACCATCTTGCAGTGTGC GGACCAGGGTGGAGTCATC 84.3 101 Trancripts Verified on all BRAF WT cell lines and and equal number of 17 random cell lines containing BRAF mutations Verified Product Clone ID GenBank Unigene Locus Gene Melting Gene Name Forward primer Reverse primer length on Chip Accession cluster Link ID Symbol temp (C) (bp) No. N21289 N31224 Hs.211579 4162 Melanoma cell adhesion molecule MCAM TCTCGTAAGACCGAACTTGTAG CGATGTATTTCTCTCCCTGGT 84.5 121 R80585 R80585 Hs.374340 23607 CD2-associated protein CD2AP GAAAAAGGATCACGGGAAAG AGGTCCACACCACTCAAGAAG 79.1 134 R60317 R60374 Hs.74635 1738 Dihydrolipoamide dehydrogenase (E3 component) DLD GTGCTGGAGAAATGGTAAATG TTCTGATAAGGTCGGATGTG 79.9 101 H12076 H12076 T83153 T83153 W46396 W46504 Hs.157101 1737 Dihydrolipoamide S-acetyltransferase (E2 component) DLAT AACATTCGTCGGGTTATTGC AAACATGCCAAAGCTGAAGC 78.6 185 Trancripts Verified on 10 BRAF WT cell lines and 10 BRAF Mutant cell lines (5 cell lines with highest expression and 5 with lowest expression) Verified Product Clone ID GenBank Unigene Locus Gene Melting Gene Name Forward primer Reverse primer length on Chip Accession cluster Link ID Symbol temp (C) (bp) No. W42423 BG770889 Hs.173656 22841 Rab11-family interacting protein 2 Rab11-FIP2 GTTCCAGAAAGTGGAAGTCTC TTCCGAAACACAATTCACC 78.6 112 N64618 N79947 Hs.40323 9184 BUB3 budding uninhibited by benzimidazoles 3 homolog BUB3 TAATGATGGGACTACGCTTG CAAGTACATGGTGACTTGGG 80.3 132 Realtime RT-PCR Control Verified Product Clone ID GenBank Unigene Locus Gene Melting Gene Name Forward primer Reverse primer length on Chip Accession cluster Link ID Symbol temp (C) (bp) No. Hs.169476 2597 Glyceraldehyde-3-phosphate dehydrogenase GAPDH GAAATCCCATCACCATCTTCC AAATGAGCCCCAGCCTTCTC 85.9 124 Supporting Table 2 - BRAF and NRAS mutation status

Name NRAS BRAF Summary - Statistical Breakdown (n=61) A02 WT V599E BRAF Mutations Frequency of Mutation# % of total A05 WT V599E L596S* 1/61 1.6% A07 G12S,Q61R WT L596V* 1/61 1.6% A11 WT WT V599E** 42/61 69% A15 WT V599K V599K** 1/61 1.6% A2058 WT V599E WT 17/61 28% BL WT V599E *Total Number of Mutations in codon 596 =2 C-32 WT V599E **Total number of mutations in Codon 599 =43 CJM Q61K WT #please note that one sample (D23) contained two BRAF mutations COLO-F WT V599E (L596V &V599E, and hence appears twice in this table) D04 Q61L WT D05 WT V599E NRAS Mutations Frequency of Mutation* % of total D08 Q61L WT G12S 1/61 1.6% D10 WT WT G13R 1/61 1.6% D11 Q61L WT Q61K 1/61 1.6% D14 WT V599E Q61L 4/61 6.5% D17 WT V599E Q61R 3/61 4.9% D20 WT V599E HD 1/61 1.6% D23 WT V599E,L596V WT 51/61 84% D24 WT WT *please note that one sample (A07) contained two NRAS mutations D25 WT V599E (G12S &Q61R, and hence appears twice in this table) HT144 WT V599E JA WT V599E BRAF mutation and NRAS Deletion Frequency % of total ME-1007 WT WT BRAF mutation and NRAS Deletion 1/61 1.6% ME10538 WT V599E ME1402 WT V599E ME-4405 Q61R WT Mel-FH WT WT Mel-RM WT WT Mel-RMU WT V599E MM127 G13R WT MM170 WT V599E MM200 WT V599E MM229 WT L596S MM253 WT V599E MM329 WT WT MM370 WT V599E MM383 WT V599E MM386 WT V599E MM415 Q61L WT MM426 WT V599E MM455 WT V599E MM466 WT V599E MM470 WT V599E MM472 WT V599E MM473 WT V599E MM485 Q61R WT MM537 WT V599E MM540 WT V599E MM595 WT V599E MM603 WT V599E MM608 WT V599E MM622 WT V599E MM629 WT V599E MM648 WT V599E MM649 HD V599E MM96L WT V599E RPMI 7932 WT WT SKMEL13 WT V599E WSB WT V599E WW WT V599E Supporting Table 3 - Mann-Whitney P-values and SVM consensus gene ranks for the BRAF classification and for all 5041 quality filtered genes. The genes are sorted according to SVM gene rank.

Mann-Whitney P-value: The P-value from the BRAF status analysis using all 61 samples. SVM consensus gene rank: The 25th percentile of the 30 ranks from the SVM cross-validation scheme. The ranks are based on the Mann-Whitney test. Sign: 1 if the gene has higher expression for samples with BRAF mutations. -1 if it has higher expression for BRAF wild type samples. Confidence in sign: 1 if the sign is identical for all 30 SVMs. 0 if the sign is 1 for 15 SVMs and -1 for 15 SVMs. *for sequence verification of Clone ID's on chip, please refer to the manufacter's website http:/www.microarrays.ca/support/glists.html Original Mann- SVM Original Confidence Original Gene Clone ID Whitney consensus Sign Original Gene Name* Unigene in sign Symbol* on Chip* P-value gene rank cluster* W88806 0.0001 5 -1 1 Uroporphyrinogen III synthase (congenital erythropoietic porphyria) UROS Hs.75593 W46396 0.0004 5 1 1 Dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex) DLAT Hs.115285 R60317 0.0006 8 1 1 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex) DLD Hs.74635 H78941 0.0004 9 -1 1 Thioesterase, adipose associated THEA Hs.234786 N63044 0.0003 11 -1 1 Hypothetical protein FLJ20048 FLJ20048 Hs.116470 R52086 0.0004 11 1 1 Hypothetical protein FLJ31657 FLJ31657 Hs.5518 H12076 0.0004 12 1 1 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex) DLD Hs.74635 W42423 0.0006 14 -1 1 Cyclin-dependent kinase 2 CDK2 Hs.19192 AA133960 0.0011 14 -1 1 Ubiquitin-conjugating enzyme E2A (RAD6 homolog) UBE2A Hs.80612 H08441 0.0008 16 1 1 Protein tyrosine phosphatase, receptor type, A PTPRA Hs.26045 T83153 0.001 17 1 1 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex) DLD Hs.74635 N29673 0.0011 17 1 1 Hypoxia up-regulated 1 HYOU1 Hs.277704 W42634 0.0004 20 1 1 Fibroblast activation protein, alpha FAP Hs.418 T91050 0.0008 20 1 1 KIAA1586 protein KIAA1586 Hs.180663 W58034 0.0015 20 -1 1 Small nuclear ribonucleoprotein polypeptide A' SNRPA1 Hs.80506 N27557 0.0008 21 -1 1 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 PSMD9 Hs.5648 N72115 0.0017 21 -1 1 Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) CDKN2C Hs.4854 R59224 0.0013 23 1 1 MBD2 (methyl-CpG-binding protein)-interacting zinc finger protein MIZF Hs.7987 R36627 0.001 24 1 1 POU transcription factor 10/11/2002 Hs.227115 AA001144 0.0007 26 -1 1 Similar to RIKEN cDNA 5730528L13 gene MGC17337 Hs.78531 AA033605 0.0015 26 1 1 CD2 antigen (cytoplasmic tail) binding protein 2 CD2BP2 Hs.202677 T79604 0.0021 26 1 1 Hypothetical protein DKFZp434F2322 DKFZp434F2322Hs.144633 AA102088 0.0021 26 -1 1 Tripartite motif-containing 37 TRIM37 Hs.8164 R13127 0.0019 28 1 1 Suppressor of potassium transport defect 3 SKD3 Hs.21263 N53295 0.0009 29 -1 1 Ribosomal protein L39-like RPL39L Hs.132748 N/A2 0.0016 29 1 1 - -- H90879 0.0015 30 -1 1 Hypothetical protein MGC8974 MGC8974 Hs.40094 AA001333 0.0036 32 -1 1 Fusion, derived from t(12;16) malignant liposarcoma FUS Hs.99969 R33452 0.0009 33 1 1 Protein O-fucosyltransferase 1 POFUT1 Hs.178292 N73284 0.0011 33 -1 1 KIAA1089 protein KIAA1089 Hs.4990 AA034917 0.0069 33 -1 1 Chaperonin containing TCP1, subunit 3 (gamma) CCT3 Hs.1708 N51855 0.0021 34 -1 1 ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2 ADPRTL2 Hs.24284 AA099636 0.001 35 -1 1 KIAA1039 protein KIAA1039 Hs.301552 AA041401 0.0017 35 -1 1 ESTs ESTs Hs.57967 H09315 0.0029 36 1 1 Proprotein convertase subtilisin/kexin type 7 PCSK7 Hs.32978 W87530 0.002 37 -1 1 Hypothetical protein FLJ32919 FLJ32919 Hs.293224 N21289 0.0018 38 1 1 Melanoma cell adhesion molecule MCAM Hs.211579 R80243 0.0019 38 1 1 X-box binding protein 1 XBP1 Hs.149923 R32855 0.004 38 1 1 - -- N52744 0.0014 39 -1 1 HSPC043 protein HSPC043 Hs.46624 AA101823 0.0026 42 -1 1 Elastin microfibril interface located protein EMILIN Hs.63348 N63458 0.002 43 -1 1 Sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase) SIAT6 Hs.48793 N64618 0.0022 43 -1 1 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) BUB3 Hs.40323 N66208 0.0025 43 -1 1 Protein phosphatase 1, regulatory (inhibitor) subunit 8 PPP1R8 Hs.356590 R35157 0.0021 45 1 1 Diacylglycerol kinase, delta 130kDa DGKD Hs.115907 T96118 0.0044 45 1 1 - - Hs.226313 R54062 0.0054 45 1 1 Crn, crooked neck-like 1 (Drosophila) CRNKL1 Hs.268281 N20259 0.0015 47 -1 1 Hypothetical protein MGC2840 similar to a putative glucosyltransferase MGC2840 Hs.155356 AA029361 0.0019 48 -1 1 - - Hs.31841 AA215407 0.0025 48 -1 1 - - Hs.349755 T80625 0.0044 48 1 1 Prohibitin PHB Hs.75323 R55182 0.0019 49 1 1 - - Hs.374526 H10318 0.002 49 1 1 HLA-B associated transcript 4 BAT4 Hs.247478 W31471 0.0024 50 -1 1 Hypothetical protein DKFZp547A023 DKFZp547A023 Hs.23921 H15871 0.0025 50 1 1 Nicotinamide nucleotide transhydrogenase NNT Hs.18136 R54777 0.0036 50 1 1 - - Hs.374908 H20850 0.0044 50 1 1 Thioredoxin 2 TXN2 Hs.211929 R80802 0.0036 52 1 1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 KDELR1 Hs.78040 W33047 0.0054 53 -1 1 - - Hs.348976 AA059311 0.0028 55 -1 1 Collagen, type VI, alpha 2 COL6A2 Hs.159263 T96379 0.0036 57 1 1 Protein phosphatase 2, regulatory subunit B (B56), delta isoform PPP2R5D Hs.118244 N36349 0.0034 59 -1 1 ESTs ESTs Hs.374577 W90083 0.0036 59 -1 1 Hypothetical protein BC013587 LOC219738 Hs.94943 N62816 0.0051 60 -1 1 Hypothetical protein FLJ11236 FLJ11236 Hs.10441 T39460 0.0049 61 -1 1 Protein phosphatase 1, catalytic subunit, alpha isoform PPP1CA Hs.183994 AA135740 0.0042 62 -1 1 ESTs ESTs Hs.135270 W37210 0.0031 63 1 1 Hypothetical protein MGC40361 MGC40361 Hs.284170 R34632 0.0034 63 1 1 Zinc finger, DHHC domain containing 6 ZDHHC6 Hs.22353 AA031913 0.0046 64 -1 1 - - Hs.351573 N79912 0.0036 65 -1 1 Guanine nucleotide binding protein (G protein), beta polypeptide 1 GNB1 Hs.215595 R06281 0.0062 65 1 1 KIAA0349 protein KIAA0349 Hs.15303 R25789 0.0072 65 1 1 RAB2, member RAS oncogene family-like RAB2L Hs.170160 AA033545 0.0031 71 -1 1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 TIAL1 Hs.182741 W15337 0.0049 71 -1 1 ESTs ESTs Hs.297784 W03395 0.0049 71 -1 1 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 ELOVL1 Hs.25597 AA099341 0.0051 72 -1 1 Golgi-specific brefeldin A resistance factor 1 GBF1 Hs.155499 R49336 0.0069 72 1 1 SKI-interacting protein SNW1 Hs.79008 H49981 0.0036 74 1 1 - - Hs.113994 R61759 0.0101 75 1 1 - - Hs.8078 N59182 0.0044 76 -1 1 - - Hs.311002 R07295 0.0105 76 -1 1 Sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1 SOAT1 Hs.14553 AA121306 0.0044 77 -1 1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 KDELR1 Hs.78040 R80585 0.0101 77 1 1 CD2-associated protein CD2AP Hs.374340 R55020 0.0032 81 1 1 - -- W87615 0.0038 82 -1 1 Isoprenylcysteine carboxyl methyltransferase ICMT Hs.183212 W78880 0.0076 83 -1 1 Hypothetical protein MGC14697 MGC14697 Hs.171625 H89834 0.0059 84 -1 1 Hypothetical protein BC000919 LOC90736 Hs.33020 R18713 0.0083 84 1 1 HLA-B associated transcript 8 BAT8 Hs.75196 H95383 0.0069 86 -1 1 Death effector domain containing DEDD Hs.169681 H80498 0.0096 86 -1 1 KIAA0286 protein KIAA0286 Hs.14912 AA045664 0.008 87 -1 1 Uncharacterized hematopoietic stem/progenitor cells protein MDS031 MDS031 Hs.110853 R44861 0.0105 87 1 1 Hypothetical protein FLJ10637 FLJ10637 Hs.22595 H16834 0.0096 90 1 1 Amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein APBA2BP Hs.324104 AA007350 0.0036 93 -1 1 Similar to yeast BET3 (S. cerevisiae) BET3 Hs.288013 W47619 0.0049 93 -1 1 2'-5'-oligoadenylate synthetase 3, 100kDa OAS3 Hs.56009 AA043334 0.008 93 1 1 Small nuclear RNA activating complex, polypeptide 3, 50kDa SNAPC3 Hs.164915 N93962 0.0092 93 -1 1 Mitochondrial ribosomal protein L43 MRPL43 Hs.151945 T87767 0.0062 94 1 1 ESTs ESTs Hs.16439 AA011556 0.0059 95 1 1 - - Hs.49136 H94763 0.0069 97 -1 1 SH3-domain GRB2-like endophilin B1 SH3GLB1 Hs.136309 N41035 0.0042 98 -1 1 - - Hs.378848 T94596 0.0046 98 -1 1 Vacuolar protein sorting 26 (yeast) VPS26 Hs.67052 N30054 0.0049 98 -1 1 - -- W47326 0.0072 98 -1 1 - - Hs.194051 N34758 0.0057 99 -1 1 Chromosome 2 open reading frame 6 C2orf6 Hs.196437 AA132089 0.0057 100 -1 1 Hypothetical protein FLJ20522 FLJ20522 Hs.35406 W37846 0.0101 100 -1 1 Hypothetical protein MGC955 MGC955 Hs.55608 AA032037 0.0057 102 -1 1 Ubiquitin-conjugating enzyme E2A (RAD6 homolog) UBE2A Hs.80612 R43738 0.0092 102 1 1 UDP-glucose ceramide glucosyltransferase-like 2 UGCGL2 Hs.22983 AA133962 0.008 104 -1 1 PRO0149 protein PRO0149 Hs.64056 H90406 0.0101 104 -1 1 Deoxythymidylate kinase (thymidylate kinase) DTYMK Hs.79006 R19317 0.0069 105 1 1 - -- N30854 0.0076 106 1 1 Lectin, mannose-binding, 1 LMAN1 Hs.287912 AA056541 0.0083 106 -1 1 D component of complement (adipsin) DF Hs.155597 AA193264 0.0057 107 -1 1 ESTs ESTs Hs.85875 N46198 0.0121 107 -1 1 - - Hs.43744 N34765 0.0151 107 -1 1 - -- H14441 0.0057 108 1 1 - -- R93361 0.0069 109 -1 1 - -- R46328 0.011 109 1 1 Trinucleotide repeat containing 5 TNRC5 Hs.56828 H45103 0.0087 112 1 1 Attractin ATRN Hs.194019 W48561 0.0096 113 -1 1 - -- R76088 0.011 113 1 1 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) UCHL3 Hs.77917 H78795 0.0076 115 -1 1 Heart and neural crest derivatives expressed 2 HAND2 Hs.36029 AA047468 0.0214 115 -1 1 - - Hs.127824 W42880 0.0046 116 -1 1 Tripartite motif-containing 8 TRIM8 Hs.54580 AA054518 0.0121 117 -1 1 Sm protein F LSM6 Hs.42438 N72125 0.0096 119 -1 1 - -- R27996 0.0092 120 1 1 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773 H04804 0.0062 121 1 1 ESTs ESTs Hs.374236 H38504 0.0087 121 1 1 DKFZP566I1024 protein DKFZP566I1024Hs.279696 AA150817 0.0116 121 -1 1 Thioredoxin TXN Hs.76136 H79622 0.0145 121 -1 1 ESTs ESTs Hs.13751 H85870 0.0066 122 1 1 - -- N73986 0.0087 122 -1 1 ESTs ESTs Hs.50408 W88723 0.008 123 -1 1 Peptidyl prolyl isomerase H (cyclophilin H) PPIH Hs.9880 W86900 0.0151 124 -1 1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 B4GALT2 Hs.206713 T96901 0.011 126 1 1 - -- N95545 0.0116 128 -1 1 Interleukin 11 IL11 Hs.1721 N45674 0.0151 128 1 1 KIAA0759 protein KIAA0759 Hs.7285 H26200 0.0151 128 1 1 - - Hs.121001 AA037600 0.0096 129 -1 1 Chromosome condensation 1 CHC1 Hs.84746 AA047163 0.0096 132 1 1 Hypothetical protein DKFZp434C0328 DKFZp434C032 Hs.24583 W42674 0.011 132 -1 1 FK506 binding protein 14, 22 kDa FKBP14 Hs.264636 N46185 0.0069 133 -1 1 ESTs ESTs Hs.165084 H59130 0.0145 134 1 1 Sec23 homolog B (S. cerevisiae) SEC23B Hs.173497 N66072 0.0224 134 1 1 ESTs ESTs Hs.13680 W86818 0.0069 135 -1 1 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein IKBKAP Hs.31323 R52104 0.0101 135 1 1 Gemin 5 GEMIN5 Hs.25882 N92371 0.0087 136 -1 1 Hypothetical protein, clone 24751 CL24751 Hs.29344 H00660 0.0145 136 -1 1 - - Hs.313342 W78867 0.0173 136 -1 1 Agrin AGRN Hs.273330 W60763 0.0092 137 -1 1 Thyroid hormone receptor-associated protein, 240 kDa subunit TRAP240 Hs.11861 AA029847 0.011 137 -1 1 Cyclin fold protein 1 CFP1 Hs.6820 H50481 0.0101 139 1 1 Dishevelled associated activator of morphogenesis 2 DAAM2 Hs.100113 AA136615 0.0151 139 -1 1 V-yes-1 Yamaguchi sarcoma viral related oncogene homolog LYN Hs.80887 W67797 0.0087 140 -1 1 Laminin, alpha 5 LAMA5 Hs.11669 T99677 0.0092 140 -1 1 CGI-105 protein LOC51011 Hs.279932 R78183 0.0158 140 1 1 Pre-B-cell leukemia transcription factor 2 PBX2 Hs.93728 N63962 0.0311 142 1 1 Component of oligomeric golgi complex 5 COG5 Hs.239631 R07187 0.0188 143 1 1 Ornithine decarboxylase antizyme 2 OAZ2 Hs.74563 H64252 0.0173 144 1 1 Acyl-Coenzyme A dehydrogenase family, member 8 ACAD8 Hs.14791 AA047569 0.0069 145 -1 1 Hypothetical protein FLJ10597 FLJ10597 Hs.90375 N44485 0.0127 145 -1 1 - - Hs.13809 H23246 0.0145 145 1 1 Hypothetical protein FLJ13433 FLJ13433 Hs.23259 N74700 0.0165 145 -1 1 Similar to Caenorhabditis elegans protein C42C1.9 KEO4 Hs.285818 AA045615 0.0205 146 1 1 Membrane-bound transcription factor protease, site 1 MBTPS1 Hs.75890 R79632 0.0138 147 1 1 Family with sequence similarity 3, member C FAM3C Hs.29882 R14667 0.0165 148 1 1 Zinc finger protein of the cerebellum 4 ZIC4 Hs.326796 R55696 0.011 149 1 1 KIAA1107 protein KIAA1107 Hs.21554 AA193317 0.0158 150 -1 1 - - Hs.356786 H58331 0.0173 150 1 1 Glucose regulated protein, 58kDa GRP58 Hs.289101 N42278 0.0121 151 -1 1 ADP-ribosylation-like factor 6 interacting protein 2 ARL6IP2 Hs.27099 R39865 0.0105 153 1 1 Jerky homolog (mouse) JRK Hs.142296 H17385 0.0145 153 1 1 Hypothetical protein DKFZp564D1378 DKFZP564D137Hs.318401 R02822 0.0127 154 1 1 - - Hs.243901 N56712 0.0116 156 -1 1 PWP2 periodic tryptophan protein homolog (yeast) PWP2H Hs.79380 T79507 0.0205 156 1 1 Erythropoietin receptor EPOR Hs.127826 H44309 0.0101 158 1 1 Solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 SLC25A1 Hs.111024 H95311 0.0127 159 -1 1 - - Hs.13431 R80587 0.0096 160 1 1 Protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform PPP2R2A Hs.179574 AA203686 0.0101 160 -1 1 Retinoid X receptor, alpha RXRA Hs.20084 AA054486 0.0158 160 -1 1 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650 H11233 0.0205 160 1 1 CGI-203 protein CGI-203 Hs.184860 N89775 0.0145 161 1 1 - - Hs.379753 AA040043 0.0096 162 -1 1 Protocadherin 20 PCDH20 Hs.132892 AA150112 0.011 162 -1 1 Intermediate filament protein syncoilin SYNCOILIN Hs.348415 R94555 0.0151 162 1 1 Collagen, type IV, alpha 2 COL4A2 Hs.75617 AA150894 0.011 163 -1 1 Guanine nucleotide binding protein 11 GNG11 Hs.83381 T91993 0.0132 163 1 1 ESTs ESTs Hs.347475 N25612 0.0138 163 -1 1 Papillomavirus regulatory factor PRF-1 LOC55893 Hs.27410 N39088 0.0173 163 -1 1 - - Hs.356387 N77922 0.0116 165 -1 1 - - Hs.343271 H20531 0.011 168 1 1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 B3GALT4 Hs.21495 H49329 0.0145 168 1 1 Breakpoint cluster region protein, uterine leiomyoma, 1; barrier to autointegration factor BCRP1 Hs.268763 W93073 0.0233 169 -1 1 - - Hs.269180 AA043805 0.0138 170 -1 1 Integrin beta 3 binding protein (beta3-endonexin) ITGB3BP Hs.82084 R60825 0.0145 170 1 1 Mitogen-activated protein kinase 9 MAPK9 Hs.246857 AA037078 0.0214 171 -1 1 B7-H1 protein B7-H1 Hs.97269 N74713 0.0105 172 -1 1 - -- AA151211 0.0092 173 -1 1 Bone morphogenetic protein 1 BMP1 Hs.1274 AA031501 0.0138 177 -1 1 Adaptor-related protein complex 3, mu 1 subunit AP3M1 Hs.298442 W47547 0.0151 177 -1 1 Adenylate cyclase 9 ADCY9 Hs.20196 AA136060 0.0188 177 -1 1 Hypothetical protein MGC16202 MGC16202 Hs.246914 H01676 0.0165 180 1 1 Hypothetical protein BC002494 LOC92579 Hs.294005 R71156 0.0275 180 1 1 Programmed cell death 7 PDCD7 Hs.143253 T83937 0.0092 181 1 1 Hypothetical protein FLJ31638 FLJ31638 Hs.14832 W63752 0.0145 182 -1 1 DnaJ (Hsp40) homolog, subfmaily B, member 1 DNAJB1 Hs.82646 N55283 0.0197 182 -1 1 KIAA0469 gene product KIAA0469 Hs.7764 AA056486 0.0188 183 -1 1 - -- W68453 0.0205 183 -1 1 Hypothetical protein FLJ10468 FLJ10468 Hs.48855 R32522 0.0138 184 1 1 Endothelial zinc finger protein 2 EZF-2 Hs.24545 R60480 0.018 184 1 1 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein) BECN1 Hs.12272 W25075 0.0254 184 -1 1 Hypothetical protein MGC23908 MGC23908 Hs.93748 N73741 0.0127 185 -1 1 Hypothetical protein DKFZp761P1121 DKFZp761P112 Hs.350243 T49898 0.0151 185 -1 1 Bladder cancer associated protein BLCAP Hs.5300 R40176 0.0165 185 1 1 Chemokine (C-X-C motif) ligand 14 CXCL14 Hs.24395 W04808 0.0127 186 1 1 - - Hs.16346 R72846 0.0233 186 1 1 Branched chain alpha-ketoacid dehydrogenase kinase BCKDK Hs.20644 N27828 0.0173 187 -1 1 Sentrin/SUMO-specific protease SENP7 Hs.30443 AA046891 0.0138 188 -1 1 Defender against cell death 1 DAD1 Hs.82890 N45678 0.0145 188 -1 1 CDC26 subunit of anaphase promoting complex CDC26 Hs.3991 T87973 0.0224 189 1 1 - - Hs.332988 R18948 0.0233 189 1 1 Cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa CRSP2 Hs.21586 N47294 0.0173 190 -1 1 - - Hs.350001 N42184 0.0165 192 -1 1 Hypothetical protein BC013073 LOC92703 Hs.17481 H58362 0.0121 194 1 1 Adaptor-related protein complex 2, beta 1 subunit AP2B1 Hs.74626 N36888 0.0224 196 -1 1 DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) DCLRE1A Hs.1560 AA005369 0.0287 196 1 1 KIAA1270 protein KIAA1270 Hs.197668 W31281 0.0145 197 -1 1 - - Hs.182036 R41888 0.018 198 1 1 - -- AA027986 0.0197 198 -1 1 Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform PPP2CB Hs.80350 N90947 0.0165 199 -1 1 - -- N91450 0.0173 199 -1 1 - - Hs.141003 AA142967 0.0233 200 -1 1 Uncharacterized hematopoietic stem/progenitor cells protein MDS029 MDS029 Hs.43549 H03208 0.0461 200 1 1 Mitotic control protein dis3 homolog DIS3 Hs.323346 H73928 0.0365 201 -1 1 Protein translocation complex beta SEC61B Hs.77028 N32500 0.0243 203 -1 1 ESTs ESTs Hs.170277 H83405 0.018 204 1 1 Faciogenital dysplasia (Aarskog-Scott syndrome) FGD1 Hs.1572 H18868 0.018 205 1 1 Ribonucleotide reductase M2 B (TP53 inducible) RRM2B Hs.94262 W92051 0.0151 206 -1 1 ESTs ESTs Hs.58694 AA015841 0.0224 206 1 1 Guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 GNGT1 Hs.73112 N20541 0.0411 206 -1 1 Cadherin 1, type 1, E-cadherin (epithelial) CDH1 Hs.194657 AA005173 0.0173 208 -1 1 Hypothetical protein FLJ21144 FLJ21144 Hs.59584 W73717 0.0188 208 -1 1 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650 T79713 0.0214 208 1 1 SET binding factor 1 SBF1 Hs.112049 H70971 0.0145 209 -1 1 - -- W68672 0.0197 209 -1 1 RAB, member of RAS oncogene family-like 2B RABL2B Hs.355874 W88468 0.0205 209 1 1 Hypothetical protein MGC20781 MGC20781 Hs.237536 N69475 0.0127 210 -1 1 Mitochondrial ribosomal protein L48 MRPL48 Hs.82389 T78823 0.0197 210 1 1 Hypothetical protein MGC5149 MGC5149 Hs.284741 R37665 0.0243 211 1 1 Pescadillo homolog 1, containing BRCT domain (zebrafish) PES1 Hs.13501 W58698 0.0264 211 -1 1 - - Hs.63236 H71793 0.0151 212 1 1 X-box binding protein 1 XBP1 Hs.149923 AA135452 0.0324 213 -1 1 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041 R71157 0.0264 217 1 1 Hypothetical protein FLJ10759 FLJ10759 Hs.15921 H90534 0.0287 217 -1 1 Adaptor-related protein complex 4, beta 1 subunit AP4B1 Hs.28298 H20853 0.0224 218 -1 1 - - Hs.288862 R55959 0.0243 218 1 1 KIAA1091 protein KIAA1091 Hs.26797 H17078 0.0205 219 1 1 Core-binding factor, runt domain, alpha subunit 2; translocated to, 2 CBFA2T2 Hs.153934 R38809 0.0254 221 1 1 ESTs ESTs Hs.13420 H11054 0.0254 223 1 1 Protein kinase C, delta PRKCD Hs.155342 T78696 0.0264 223 1 1 GS3955 protein GS3955 Hs.155418 N25614 0.0287 223 -1 1 - - Hs.270725 AA126700 0.0324 224 -1 1 Nucleolar and coiled-body phosphoprotein 1 NOLC1 Hs.75337 AA039224 0.0197 225 -1 1 Hypothetical protein MGC14817 MGC14817 Hs.124813 H15638 0.0243 225 1 1 Solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11 SLC25A11 Hs.184877 N99127 0.0138 227 -1 1 Hypothetical protein MGC5540 MGC5540 Hs.267400 W68490 0.0264 227 -1 1 TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa TAF9L Hs.171723 AA128472 0.0188 228 -1 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 GNAI3 Hs.73799 R53544 0.0214 228 1 1 - - Hs.4285 R54089 0.0158 230 1 1 Solute carrier family 19 (folate transporter), member 1 SLC19A1 Hs.84190 H14085 0.0127 231 1 1 Transmembrane 4 superfamily member tetraspan NET-5 NET-5 Hs.129826 H26559 0.0214 231 1 1 TGFB1-induced anti-apoptotic factor 1 TIAF1 Hs.75822 R75921 0.0233 232 1 1 Serologically defined breast cancer antigen 84 SDBCAG84 Hs.169992 H70044 0.0287 233 -1 1 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma CAMK2G Hs.12436 N41921 0.0287 233 -1 1 - - Hs.33264 N52383 0.0243 235 -1 1 Hypothetical protein FLJ20079 FLJ20079 Hs.165948 AA041262 0.0275 235 1 1 KIAA1228 protein KIAA1228 Hs.306867 W60704 0.0287 235 -1 1 Hypothetical protein FLJ20312 FLJ20312 Hs.7862 T96535 0.0243 236 1 1 Zinc finger protein 278 ZNF278 Hs.27801 H62271 0.0287 236 1 1 D11lgp1e-like LGP1 Hs.38039 R76298 0.0197 238 1 1 Heat shock transcription factor 1 HSF1 Hs.1499 T87794 0.0365 238 1 1 - -- N90789 0.038 238 1 1 Membrane component, chromosome 11, surface marker 1 M11S1 Hs.278672 R22893 0.0395 238 1 1 Synaptosomal-associated protein, 23kDa SNAP23 Hs.184376 R56756 0.018 239 1 1 Hypothetical protein FLJ20422 FLJ20422 Hs.26570 AA054522 0.038 242 -1 1 Similar to triple functional domain (PTPRF interacting) LOC115557 Hs.61581 R36709 0.0275 243 1 1 Over-expressed breast tumor protein OBTP Hs.347297 R68948 0.0145 244 1 1 Calumenin CALU Hs.7753 T66879 0.0243 244 1 1 Hypothetical protein LOC54103 LOC54103 Hs.12969 H87311 0.018 246 1 1 Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antiseERCC1 Hs.59544 H43602 0.0224 246 1 1 Chondroitin 4-O-sulfotransferase 2 C4S-2 Hs.25204 R20810 0.0311 246 1 1 Topoisomerase (DNA) I TOP1 Hs.317 T99761 0.038 246 1 1 Programmed cell death 8 (apoptosis-inducing factor) PDCD8 Hs.18720 W61132 0.0173 247 1 1 - - Hs.301226 R38922 0.0214 247 1 1 High-mobility group protein 2-like 1 HMG2L1 Hs.92260 AA150397 0.0224 247 -1 1 - -- N70274 0.0287 247 1 1 CGI-87 protein LOC51112 Hs.5008 R28554 0.0337 248 -1 1 Hypothetical protein DKFZp313A2432 DKFZp313A2432Hs.349096 R93042 0.0243 250 1 1 - -- AA047414 0.0337 250 -1 1 Lactate dehydrogenase A LDHA Hs.2795 AA099585 0.0214 252 -1 1 Phosphodiesterase 7B PDE7B Hs.283016 AA029775 0.0351 252 -1 1 Lung cancer candidate FUS1 Hs.8186 R67103 0.0444 252 1 1 Bone morphogenetic protein 6 BMP6 Hs.285671 AA041349 0.0427 253 -1 1 Macrophage erythroblast attacher MAEA Hs.20815 R59227 0.0233 254 1 1 KIAA0365 gene product KIAA0365 Hs.190452 T81712 0.0411 254 1 1 Defensin, alpha 1, myeloid-related sequence DEFA1 Hs.274463 N92363 0.0287 256 -1 1 Ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) UBE2I Hs.84285 H02915 0.0311 256 1 1 Trans-activated by hepatitis C virus core protein 1 TAHCCP1 Hs.118087 R45681 0.0233 257 1 1 TRAF and TNF receptor-associated protein AD022 Hs.46847 H73751 0.0337 257 -1 1 Mitogen-activated protein kinase kinase kinase 6 MAP3K6 Hs.194694 AA034395 0.038 257 -1 1 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 PIN1 Hs.161362 R51179 0.0224 258 1 1 - -- W85882 0.0395 258 -1 1 Hypothetical protein FLJ10349 FLJ10349 Hs.19333 N63791 0.0444 258 -1 1 - - Hs.355772 AA149333 0.0287 260 -1 1 Actinin, alpha 1 ACTN1 Hs.119000 H39162 0.0299 261 1 1 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) AGPAT1 Hs.240534 N79649 0.018 262 -1 1 C21orf19-like protein LOC51072 Hs.20814 W37878 0.0287 263 -1 1 - - Hs.294142 H46056 0.0224 264 1 1 Radixin RDX Hs.263671 N93218 0.0299 264 -1 1 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919 H84657 0.0365 264 1 1 Glutamate rich WD repeat protein GRWD GRWD Hs.218842 T66745 0.0497 264 -1 1 Mitochondrial glutamate carrier 1 GC1 Hs.99486 H03098 0.0264 265 1 1 - -- R84453 0.0224 266 -1 1 DKFZP586F1524 protein DKFZP586F152 Hs.241543 N41672 0.0254 266 -1 1 Adenylyl cyclase-associated protein CAP Hs.104125 R71970 0.0324 266 1 1 Retinoic acid receptor, alpha RARA Hs.250505 AA016242 0.0536 266 -1 1 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965 H39095 0.0264 269 1 1 Cell cycle progression 2 protein CPR2 Hs.347349 N54526 0.0365 273 -1 1 KIAA1979 protein KIAA1979 Hs.352638 R52017 0.0275 274 1 1 Uncharacterized bone marrow protein BM036 BM036 Hs.7731 H53288 0.0395 276 1 1 BCL2-associated athanogene 4 BAG4 Hs.194726 AA115939 0.0427 276 1 1 Capping protein (actin filament) muscle Z-line, alpha 2 CAPZA2 Hs.75546 H00120 0.0311 277 1 1 - -- R69581 0.0716 277 1 1 PRO1914 protein PRO1914 Hs.5327 N59231 0.0243 278 -1 1 Pyruvate carboxylase PC Hs.89890 AA150891 0.0479 278 -1 1 SET domain-containing protein 7 SET7 Hs.78521 H06739 0.0254 281 1 1 Collagen, type V, alpha 2 COL5A2 Hs.82985 H29857 0.0275 283 1 1 Transducer of ERBB2, 1 TOB1 Hs.178137 H28168 0.0351 283 1 1 Centaurin, gamma 3 CENTG3 Hs.286084 N29431 0.0461 284 -1 1 NEDD8 ultimate buster-1 LOC51667 Hs.279780 H97361 0.0516 284 1 1 - - Hs.36258 H94541 0.0411 285 -1 1 Chromosome 20 open reading frame 64 C20orf64 Hs.282990 N24689 0.0643 286 1 1 - - Hs.372542 H19719 0.0479 287 1 1 Gemin 5 GEMIN5 Hs.25882 N72697 0.0395 288 -1 0.93 Hypothetical protein FLJ10604 FLJ10604 Hs.26516 R56381 0.0556 288 1 1 Hypothetical protein FLJ14775 FLJ14775 Hs.334878 T92246 0.0287 289 -1 1 Hypothetical protein FLJ20265 FLJ20265 Hs.7099 N70500 0.0299 289 -1 1 KIAA0842 protein KIAA0842 Hs.74569 N24364 0.0311 290 -1 1 Hypothetical protein FLJ13154 FLJ13154 Hs.25303 AA056695 0.0395 290 -1 1 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608 N21545 0.0536 290 -1 1 KIAA1033 protein KIAA1033 Hs.12144 N45464 0.0395 291 -1 1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 SMARCAL1 Hs.16933 T75394 0.0536 293 1 1 Eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa EIF2B3 Hs.283627 R56010 0.0254 294 1 1 HIRA interacting protein 3 HIRIP3 Hs.26484 N35485 0.0497 295 -1 1 MAD1 mitotic arrest deficient-like 1 (yeast) MAD1L1 Hs.7345 AA034009 0.0311 296 -1 1 Outer dense fibre of sperm tails 2 ODF2 Hs.129055 H51380 0.0536 296 1 0.93 P450 (cytochrome) oxidoreductase POR Hs.167246 R34801 0.0716 296 1 1 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa TAF2 Hs.122752 R34696 0.0351 297 1 1 - -- H77593 0.0643 298 -1 1 CDA017 protein CDA017 Hs.39780 N21648 0.0243 299 -1 1 MpV17 transgene, murine homolog, glomerulosclerosis MPV17 Hs.75659 W03386 0.0254 301 -1 1 - - Hs.29808 H90643 0.0287 301 -1 1 - -- AA031495 0.0691 302 -1 0.93 Peptidylprolyl isomerase E (cyclophilin E) PPIE Hs.33251 H00846 0.0299 303 1 1 Chromosome 11 hypothetical protein ORF4 LOC56834 Hs.25274 W78790 0.0667 305 1 1 TNF receptor-associated factor 4 TRAF4 Hs.8375 H97357 0.0667 305 -1 1 - - Hs.227699 AA213820 0.0427 307 -1 1 - - Hs.256533 W42446 0.0287 309 -1 1 NICE-5 protein HSA243666 Hs.337078 R35007 0.0287 309 -1 1 - -- AA043510 0.0395 309 -1 1 Nm23-phosphorylated unknown substrate MGC15437 Hs.55067 R12987 0.0264 310 1 1 - -- R12743 0.0287 310 1 1 KIAA1131 protein KIAA1131 Hs.210850 N62491 0.0299 310 -1 1 Folate hydrolase (prostate-specific membrane antigen) 1 FOLH1 Hs.1915 H97136 0.0598 310 -1 1 CGI-41 protein LOC51093 Hs.5056 H38703 0.0351 313 -1 1 Hypothetical protein FLJ10512 FLJ10512 Hs.93581 H93167 0.0516 313 -1 1 KIAA0332 protein KIAA0332 Hs.7976 N20579 0.062 314 -1 1 Proteasome (prosome, macropain) 26S subunit, ATPase, 2 PSMC2 Hs.61153 N30625 0.0287 315 -1 1 - - Hs.44205 N63825 0.0577 315 -1 1 Ras homolog gene family, member G (rho G) ARHG Hs.75082 AA058632 0.0427 318 -1 1 Kinesin family member 1B KIF1B Hs.375193 AA039452 0.0365 319 -1 1 YY1 transcription factor YY1 Hs.97496 N43796 0.0479 319 -1 1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876 AA130095 0.062 320 -1 1 Hypothetical protein FLJ21749 FLJ21749 Hs.288761 W04645 0.0768 320 -1 1 ESTs ESTs Hs.322915 W37084 0.0556 321 -1 1 Hypothetical protein FLJ14743 FLJ14743 Hs.169577 H72575 0.0299 324 1 1 Ninein (GSK3B interacting protein) NIN Hs.44054 R50403 0.0691 326 1 1 Chromosome 20 open reading frame 188 C20orf188 Hs.168073 N36411 0.0411 327 -1 1 ESTs ESTs Hs.44754 T79660 0.0598 327 1 1 - - Hs.14600 N63795 0.0479 328 -1 1 ESTs ESTs Hs.355467 T87912 0.0479 328 -1 1 - - Hs.16478 AA045207 0.0536 328 -1 1 Actin related protein 2/3 complex, subunit 5, 16kDa ARPC5 Hs.82425 AA043906 0.0351 329 -1 1 ESTs ESTs Hs.367688 T83255 0.0351 330 1 1 Zinc finger protein 106 ZFP106 Hs.15220 N92218 0.0411 330 -1 1 KIAA1598 protein KIAA1598 Hs.23740 W47177 0.0577 330 -1 1 GCN5 general control of amino-acid synthesis 5-like 1 (yeast) GCN5L1 Hs.94672 N92370 0.062 331 -1 1 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) PCBD Hs.3192 R50163 0.0667 331 1 1 Hypothetical protein similar to beta-transducin family FLJ10458 Hs.85570 AA136073 0.0395 332 -1 1 Hypothetical protein FLJ36888 FLJ36888 Hs.103845 H93335 0.0823 332 -1 1 Zinc finger protein, subfamily 1A, 4 (Eos) ZNFN1A4 Hs.302031 AA047135 0.0427 333 -1 1 Ribonuclease/angiogenin inhibitor RNH Hs.75108 R31309 0.0556 333 1 1 MAP-kinase activating death domain MADD Hs.82548 H20726 0.0351 334 1 1 Casein kinase 2, beta polypeptide CSNK2B Hs.165843 W61360 0.0365 335 -1 1 Hypothetical protein MGC15563 MGC15563 Hs.64552 AA194944 0.0427 335 1 1 - -- R51875 0.0536 335 1 1 Breakpoint cluster region BCR Hs.234799 R28281 0.0536 337 -1 1 - -- AA131566 0.0365 338 -1 1 Fatty-acid-Coenzyme A ligase, long-chain 2 FACL2 Hs.154890 R53567 0.038 338 1 1 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) HMGCS1 Hs.77910 N93443 0.0275 339 -1 1 Ubiquitin protein ligase UBE3B Hs.17639 N44152 0.0516 339 -1 1 Hypothetical protein HSPC196 HSPC196 Hs.22546 N63830 0.0556 339 -1 0.93 - - Hs.6127 W46553 0.0667 339 -1 1 Hypothetical protein FLJ38984 FLJ38984 Hs.112023 H87044 0.038 340 1 1 Translocase of inner mitochondrial membrane 22 homolog (yeast) TIMM22 Hs.87595 W58176 0.0427 340 -1 1 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c'' ATP6V0B Hs.7476 AA101859 0.0516 340 -1 1 Endosulfine alpha ENSA Hs.111680 H26555 0.0516 340 -1 1 Protein phosphatase 1, regulatory subunit 7 PPP1R7 Hs.36587 H96308 0.0365 341 -1 1 - - Hs.58210 AA136060 0.0497 341 -1 1 Hypothetical protein MGC16202 MGC16202 Hs.246914 N49623 0.0516 341 -1 1 Hypothetical protein AL133206 LOC64744 Hs.7750 R40400 0.0598 341 1 1 Cell adhesion molecule with homology to L1CAM (close homolog of L1) CHL1 Hs.210863 W47334 0.0254 342 -1 1 Hypothetical protein MGC5560 MGC5560 Hs.233150 T96059 0.0444 344 1 1 Uterine-derived 14 kDa protein LOC64150 Hs.173780 N58731 0.0444 345 -1 1 - -- W15280 0.0275 346 -1 1 Chromosome 9 open reading frame 5 C9orf5 Hs.86412 H94177 0.0337 346 -1 1 High-mobility group nucleosomal binding domain 2 HMGN2 Hs.181163 N50370 0.0287 349 -1 1 - - Hs.178485 R53566 0.0351 350 1 1 - - Hs.184779 R42536 0.0536 350 1 1 Dachshund homolog (Drosophila) DACH Hs.63931 R85099 0.0577 350 1 1 ADP-ribosylation factor 3 ARF3 Hs.119177 H23370 0.0461 351 1 1 RAB22A, member RAS oncogene family RAB22A Hs.288968 R85666 0.0556 353 1 1 KIAA1634 protein KIAA1634 Hs.49169 AA204664 0.0324 354 -1 1 SMC1 structural maintenance of chromosomes 1-like 2 (yeast) SMC1L2 Hs.182437 R52048 0.0337 354 1 1 Upstream regulatory element binding protein 1 UREB1 Hs.3383 H03079 0.0427 354 -1 1 Hypothetical protein FLJ21156 FLJ21156 Hs.26058 R68168 0.0577 354 1 1 MRNA decapping enzyme DCPS Hs.279900 AA029926 0.0243 355 1 1 - - Hs.351292 R45593 0.0427 355 1 1 FLN29 gene product FLN29 Hs.5148 N66188 0.0444 355 -1 1 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965 R55180 0.0497 355 1 1 Muskelin 1, intracellular mediator containing kelch motifs MKLN1 Hs.288791 W60936 0.0299 356 -1 1 Tripartite motif-containing 8 TRIM8 Hs.54580 AA039447 0.0768 356 -1 1 Suppressor of fused homolog (Drosophila) SUFU Hs.21431 R36089 0.0479 357 1 1 Nuclear receptor subfamily 2, group F, member 6 NR2F6 Hs.239752 AA147549 0.038 359 -1 1 KIAA1999 protein KIAA1999 Hs.9343 AA043477 0.0427 359 -1 1 Zinc finger protein 36, C3H type, homolog (mouse) ZFP36 Hs.343586 AA031564 0.0536 360 -1 1 - - Hs.221255 W06829 0.0497 361 -1 1 - - Hs.356718 R26222 0.0536 361 1 0.93 - - Hs.379149 R78049 0.038 362 1 1 DKFZP566I1024 protein DKFZP566I1024Hs.279696 AA054948 0.0444 363 -1 1 - - Hs.61307 W15295 0.0497 363 -1 1 BCL2-associated athanogene 5 BAG5 Hs.5443 AA011445 0.0497 364 -1 1 Caspase 3, apoptosis-related cysteine protease CASP3 Hs.74552 N93302 0.1113 364 -1 0.93 Hypothetical protein MGC4549 MGC4549 Hs.326422 H66700 0.0351 365 1 1 Hypothetical protein FLJ20758 FLJ20758 Hs.274248 R13936 0.0411 366 1 1 Deoxyhypusine synthase DHPS Hs.79064 H16934 0.0536 367 1 1 Zinc finger protein 278 ZNF278 Hs.27801 R97690 0.1225 367 -1 1 Limkain beta 2 FLJ22471 Hs.288909 R50246 0.0365 368 1 1 - - Hs.351469 R19117 0.0395 369 1 1 ESTs ESTs Hs.169142 H21835 0.0427 369 1 1 - -- R14816 0.0461 369 1 1 - -- W37381 0.0411 370 -1 1 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965 H50517 0.0427 370 1 1 Gamma-aminobutyric acid (GABA) B receptor, 1 GABBR1 Hs.167017 T86392 0.0444 370 1 1 Dynein, cytoplasmic, heavy polypeptide 1 DNCH1 Hs.7720 T95699 0.0461 370 1 1 Chromosome 11 hypothetical protein ORF4 LOC56834 Hs.25274 AA195600 0.0643 370 -1 1 Follistatin FST Hs.9914 W37098 0.0337 371 -1 1 Fukuyama type congenital muscular dystrophy (fukutin) FCMD Hs.55777 AA137082 0.0823 371 -1 1 - - Hs.351869 N50369 0.0444 372 1 1 Nijmegen breakage syndrome 1 (nibrin) NBS1 Hs.25812 AA029842 0.0516 372 -1 1 Mature T-cell proliferation 1 MTCP1 Hs.3548 H73971 0.038 374 -1 1 ESTs ESTs Hs.53455 AA010033 0.0395 375 -1 1 CDNA FLJ00103 FLJ00103 Hs.380465 R74076 0.038 376 1 1 Hypothetical protein FLJ30656 FLJ30656 Hs.349887 H27344 0.0395 376 -1 1 Hypothetical protein MGC5338 MGC5338 Hs.99598 T66784 0.0411 376 1 1 Zinc-fingers and homeoboxes 1 ZHX1 Hs.12940 AA044632 0.1113 377 -1 1 - -- W65276 0.0852 378 1 1 Hypothetical protein FLJ10900 FLJ10900 Hs.16277 T80134 0.0427 379 1 1 Tubulin-specific chaperone d TBCD Hs.12570 H47146 0.0444 379 1 1 Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antiseERCC1 Hs.59544 H93200 0.0497 380 -1 1 ESTs ESTs Hs.269052 H45907 0.0411 381 1 1 - -- R74161 0.0556 381 1 1 Phosphorylase, glycogen; liver (Hers disease, glycogen storage disease type VI) PYGL Hs.771 N63319 0.0299 383 1 1 Protein tyrosine phosphatase, receptor type, A PTPRA Hs.26045 W38759 0.0365 383 -1 1 - - Hs.356739 AA040219 0.0577 383 -1 1 Nuclear transcription factor Y, gamma NFYC Hs.168157 W88821 0.0795 383 -1 1 - - Hs.288924 R62973 0.0577 384 -1 1 Hypothetical protein MGC4796 MGC4796 Hs.21396 AA114976 0.0912 385 -1 0.87 Tenascin XB TNXB Hs.169886 R43900 0.0577 388 1 1 Calcineurin binding protein 1 CABIN1 Hs.7840 H42146 0.0365 390 -1 1 Inositol polyphosphate-5-phosphatase, 40kDa INPP5A Hs.124029 AA046359 0.0395 391 -1 1 Protein predicted by clone 23882 HSU79303 Hs.82482 H03156 0.0351 392 1 1 Glutamine-fructose-6-phosphate transaminase 1 GFPT1 Hs.1674 T66813 0.038 392 -1 1 - EST Hs.12947 N29706 0.0497 392 -1 1 Hypothetical protein FLJ10587 FLJ10587 Hs.7296 R64091 0.0742 392 -1 1 ESTs ESTs Hs.28482 W04611 0.0351 394 -1 1 Hypothetical protein FLJ22794 FLJ22794 Hs.19525 R31115 0.038 394 1 1 Polymerase (RNA) mitochondrial (DNA directed) POLRMT Hs.153880 H90918 0.0598 394 -1 0.93 KIAA0368 protein KIAA0368 Hs.3852 R28329 0.0365 395 1 1 Hypothetical protein MGC16063 MGC16063 Hs.288544 N45541 0.0556 395 -1 1 Adenosine kinase ADK Hs.94382 H00845 0.0395 396 -1 1 Mitochondrial ribosomal protein L33 MRPL33 Hs.14454 W31516 0.0516 396 -1 1 - - Hs.7000 W32115 0.0577 396 -1 1 Cryptochrome 1 (photolyase-like) CRY1 Hs.151573 AA028144 0.1008 397 -1 0.87 BCS1-like (yeast) BCS1L Hs.150922 AA099137 0.0444 398 -1 1 Clathrin, light polypeptide (Lca) CLTA Hs.104143 T75481 0.1042 398 1 0.93 Ras responsive element binding protein 1 RREB1 Hs.171942 T96934 0.062 399 1 1 Exportin 5 XPO5 Hs.9805 AA101862 0.0643 399 -1 1 Source of immunodominant MHC-associated peptides SIMP Hs.183454 T84038 0.0427 400 1 1 POU domain, class 2, transcription factor 1 POU2F1 Hs.182237 R00170 0.0643 400 1 1 Bifunctional apoptosis regulator BFAR Hs.168159 H10393 0.0395 401 1 1 Hypothetical protein FLJ13117 FLJ13117 Hs.152982 N24109 0.0577 401 -1 1 Annexin A11 ANXA11 Hs.75510 H49910 0.0943 401 -1 0.93 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206 H62189 0.0497 403 1 1 Elongator protein 2 ELP2 Hs.8739 AA142937 0.0516 403 -1 1 Claudin 10 CLDN10 Hs.26126 H79507 0.0768 404 -1 1 - -- R49307 0.0556 405 1 1 Formin 2 FMN2 Hs.24889 N66251 0.038 407 1 1 - -- W63760 0.0479 407 -1 1 Coilin COIL Hs.966 R66209 0.0882 408 -1 1 Synaptosomal-associated protein, 29kDa SNAP29 Hs.194714 N49880 0.0598 409 -1 1 RAS p21 protein activator (GTPase activating protein) 1 RASA1 Hs.758 N30285 0.0395 410 -1 1 FUS interacting protein (serine-arginine rich) 1 FUSIP1 Hs.3530 W31524 0.0461 410 -1 1 - - Hs.95262 AA054503 0.0479 410 -1 1 - -- R28236 0.0768 410 -1 1 Hypothetical protein MGC12217 MGC12217 Hs.288193 W52126 0.038 411 -1 1 - -- R26919 0.1042 411 1 0.93 Down syndrome critical region gene 1-like 2 DSCR1L2 Hs.129319 AA047382 0.0411 412 -1 1 Clathrin, light polypeptide (Lcb) CLTB Hs.380749 AA059202 0.0536 412 -1 1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) GALNT7 Hs.246315 N34004 0.062 412 -1 1 Signal transducer and activator of transcription 6, interleukin-4 induced STAT6 Hs.181015 N25611 0.0598 413 -1 1 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ACTR1A Hs.153961 N39233 0.0691 413 -1 1 - - Hs.44976 N33577 0.0912 413 -1 1 - - Hs.24359 R05282 0.0516 416 -1 1 ESTs ESTs Hs.272116 H38541 0.0577 416 1 1 CCR4-NOT transcription complex, subunit 3 CNOT3 Hs.343571 AA056740 0.1225 416 1 1 Heterogeneous nuclear ribonucleoprotein K HNRPK Hs.129548 AA120872 0.0716 417 1 1 - - Hs.27552 R73175 0.0427 418 1 1 Leucine-zipper-like transcriptional regulator, 1 LZTR1 Hs.78788 R53743 0.0444 418 1 1 Ankyrin 3, node of Ranvier (ankyrin G) ANK3 Hs.75893 R45669 0.0497 418 1 1 MORF-related gene 15 MRG15 Hs.6353 R17720 0.0577 420 1 1 ESTs ESTs Hs.13287 R93685 0.0643 420 1 1 Werner helicase interacting protein WHIP Hs.236828 AA044954 0.0598 421 -1 1 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608 W68614 0.0667 422 -1 1 DnaJ (Hsp40) homolog, subfamily B, member 12 DNAJB12 Hs.7960 N74698 0.0823 422 -1 0.87 ESTs ESTs Hs.114536 H08164 0.0598 423 1 0.93 KIAA1265 protein KIAA1265 Hs.355925 H12750 0.0667 423 1 1 - -- N70020 0.1077 423 -1 1 - - Hs.272034 R71067 0.0444 425 1 1 Low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) LRP1 Hs.89137 R52315 0.0479 425 1 1 Oculocutaneous albinism II (pink-eye dilution homolog, mouse) OCA2 Hs.82027 W47128 0.0598 425 -1 1 Cyclin-dependent kinase 9 (CDC2-related kinase) CDK9 Hs.150423 R67243 0.038 426 1 1 Chromosome 20 open reading frame 99 C20orf99 Hs.28608 AA047640 0.0479 426 -1 1 Dolichyl-phosphate mannosyltransferase polypeptide 3 DPM3 Hs.110477 R17665 0.0691 426 1 1 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) COPS5 Hs.198767 H43477 0.1077 426 1 0.87 PCF11p homolog PCF11 Hs.123654 N43796 0.0411 427 -1 1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876 H12151 0.0497 427 1 1 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazol GART Hs.82285 T72620 0.0516 427 1 1 ESTs ESTs Hs.117915 R63546 0.0556 427 1 0.93 KIAA1728 protein KIAA1728 Hs.252748 H30758 0.0643 428 1 1 Glucose phosphate isomerase GPI Hs.279789 N64271 0.0577 429 -1 1 - -- R89061 0.062 429 1 1 Hypothetical protein MGC12909 MGC12909 Hs.33862 AA203162 0.0598 430 -1 1 - -- H09002 0.038 431 1 1 ESTs ESTs Hs.170267 N36387 0.0556 431 -1 1 ESTs ESTs Hs.93813 AA007617 0.1225 431 1 0.93 Hypothetical protein AD034 AD034 Hs.281397 W33159 0.0768 432 -1 1 Phospholipase C, beta 1 (phosphoinositide-specific) PLCB1 Hs.41143 T95778 0.0882 432 -1 0.93 SH3-domain binding protein 4 SH3BP4 Hs.17667 R77028 0.0943 432 1 0.93 Lymphotoxin beta receptor (TNFR superfamily, member 3) LTBR Hs.1116 T77325 0.0691 433 -1 1 Polycystic kidney disease 2 (autosomal dominant) PKD2 Hs.82001 R77424 0.0691 436 1 1 - -- W57953 0.0497 437 -1 1 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650 R54445 0.0427 438 1 1 HSPC189 protein HSPC189 Hs.20768 T84046 0.0497 438 1 1 - - Hs.372951 R48060 0.0395 440 1 1 DKFZP564O243 protein DKFZP564O243Hs.92700 N24030 0.0556 440 -1 1 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma IKBKG Hs.43505 AA037763 0.0598 440 -1 1 WAS protein family, member 2 WASF2 Hs.288908 R28109 0.0577 441 1 1 Single stranded DNA binding protein 4 SSBP4 Hs.324618 AA053304 0.0976 441 -1 1 Hypothetical protein BC017169 LOC91137 Hs.75639 T98226 0.0598 442 -1 1 Tropomyosin 4 TPM4 Hs.250641 R26509 0.0742 442 -1 1 Platelet-derived growth factor receptor, beta polypeptide PDGFRB Hs.76144 T81220 0.062 443 1 1 - -- N74710 0.0536 444 -1 1 Signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 STAM Hs.153487 AA203677 0.0768 444 -1 1 - -- R53559 0.0742 447 1 1 Non-metastatic cells 1, protein (NM23A) expressed in NME1 Hs.118638 AA039649 0.0691 448 -1 1 Hypothetical protein FLJ10743 FLJ10743 Hs.3376 H03532 0.0461 449 -1 1 Discs, large (Drosophila) homolog 5 DLG5 Hs.170290 R13557 0.0598 450 -1 1 Replication protein A2, 32kDa RPA2 Hs.79411 H89739 0.0716 450 -1 0.93 ESTs ESTs Hs.114280 H08480 0.0823 450 1 1 MDS024 protein MDS024 Hs.286122 H00122 0.0643 451 1 1 - -- R78627 0.0497 452 1 1 - - Hs.23240 R52542 0.0643 452 1 1 IMP (inosine monophosphate) dehydrogenase 1 IMPDH1 Hs.850 R39264 0.1077 452 1 1 Mitotic phosphoprotein 44 LOC129401 Hs.180591 N71361 0.1187 452 -1 1 ESTs ESTs Hs.50019 R49537 0.0497 453 1 1 Met proto-oncogene (hepatocyte growth factor receptor) MET Hs.285754 R96161 0.0516 453 -1 1 - -- N36043 0.0497 454 -1 1 Hypothetical protein FLJ10597 FLJ10597 Hs.90375 W85901 0.0716 454 -1 1 Eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa EIF2S2 Hs.12163 H15553 0.0536 455 1 1 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) COX10 Hs.77513 H47425 0.0716 457 -1 1 Proteolipid protein 2 (colonic epithelium-enriched) PLP2 Hs.77422 AA010187 0.062 458 -1 1 Pericentrin 2 (kendrin) PCNT2 Hs.15896 H50240 0.0643 459 1 1 - - Hs.250879 W37617 0.0667 459 -1 1 Transmembrane 7 superfamily member 1 (upregulated in kidney) TM7SF1 Hs.15791 W44318 0.0427 460 -1 1 Mitogen-activated protein kinase 1 MAPK1 Hs.324473 R73412 0.0536 461 1 1 NS1-associated protein 1 NSAP1 Hs.46801 R20452 0.062 461 -1 0.93 Calpain 10 CAPN10 Hs.112218 N26506 0.0795 462 -1 1 Ribosomal protein S17 RPS17 Hs.5174 W74523 0.0395 463 -1 1 Aldo-keto reductase family 1, member A1 (aldehyde reductase) AKR1A1 Hs.89529 H81036 0.0536 463 -1 1 Hypothetical protein FLJ22059 FLJ22059 Hs.13323 AA210734 0.062 463 -1 1 ESTs ESTs Hs.291386 N20517 0.0556 464 -1 0.93 Hypothetical protein DKFZp434A1319 DKFZP434A131 Hs.307084 W67797 0.0598 464 -1 0.93 Laminin, alpha 5 LAMA5 Hs.11669 W49768 0.0643 466 -1 0.93 Interferon, alpha-inducible protein (clone IFI-6-16) G1P3 Hs.265827 R31364 0.0556 467 1 1 - - Hs.128676 H58445 0.0598 469 1 1 Nucleoporin 98kDa NUP98 Hs.112255 H94111 0.062 469 -1 1 Tyrosylprotein sulfotransferase 2 TPST2 Hs.26350 R69765 0.0716 469 1 1 Target of myb1 (chicken) TOM1 Hs.9482 AA029451 0.0768 470 -1 1 Transcription factor 7-like 2 (T-cell specific, HMG-box) TCF7L2 Hs.348412 R54435 0.0882 471 1 1 - - Hs.352614 R61014 0.0716 472 1 0.93 Leucine-zipper-like transcriptional regulator, 1 LZTR1 Hs.78788 R45198 0.0395 473 1 1 Hypothetical protein CDA08 CDA08 Hs.23047 R52301 0.0444 473 1 1 - - Hs.302182 N92254 0.0516 473 -1 1 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965 W52888 0.0912 473 -1 1 Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1 SERPINB1 Hs.183583 W92014 0.0516 474 -1 1 Alcohol dehydrogenase 6 (class V) ADH6 Hs.76800 H64513 0.0912 477 -1 0.93 - -- AA055938 0.0742 478 -1 1 Laminin, alpha 4 LAMA4 Hs.78672 N93186 0.0882 479 1 1 Heme oxygenase (decycling) 2 HMOX2 Hs.284279 H86876 0.0536 480 1 1 Heparan sulfate (glucosamine) 3-O-sulfotransferase 1 HS3ST1 Hs.40968 R15291 0.0598 480 1 1 - -- AA130297 0.0768 481 -1 1 - - Hs.379757 R88246 0.1077 481 -1 1 Adrenergic, beta, receptor kinase 1 ADRBK1 Hs.83636 W00877 0.0444 483 -1 1 - -- H13698 0.0598 483 1 0.93 CGI-83 protein LOC51110 Hs.118554 H49062 0.0742 483 -1 1 Hypothetical protein FLJ22056 FLJ22056 Hs.24956 N44132 0.0852 483 -1 1 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919 N79042 0.0598 484 1 1 - -- AA147003 0.0577 485 -1 1 - - Hs.356291 R34443 0.0768 485 1 1 - - Hs.4194 W24393 0.1225 485 -1 0.93 Syntaxin 10 STX10 Hs.43812 H89655 0.0768 486 -1 1 Hypothetical protein FLJ10607 similar to glucosamine-phosphate N-acetyltransferase FLJ10607 Hs.27931 R60482 0.1389 486 -1 1 DNA methyltransferase 1-associated protein 1 DMAP1 Hs.8008 W56466 0.0742 489 -1 0.93 ESTs ESTs Hs.130214 AA151485 0.0823 489 -1 1 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206 N24276 0.1389 489 -1 0.87 Transaldolase 1 TALDO1 Hs.77290 H96619 0.0556 492 -1 1 Seven in absentia homolog 1 (Drosophila) SIAH1 Hs.295923 N43860 0.0536 493 -1 1 Polymyositis/scleroderma autoantigen 1, 75kDa PMSCL1 Hs.91728 H30227 0.0598 493 1 1 Putative mitochondrial solute carrier MRS3/4 Hs.326104 H87262 0.0852 493 1 1 - -- AA055457 0.0882 495 -1 1 Down syndrome critical region gene 2 DSCR2 Hs.5198 N28014 0.0768 496 -1 1 BRCA1 associated protein BRAP Hs.122764 H06405 0.062 497 1 1 PCTAIRE protein kinase 1 PCTK1 Hs.171834 R81742 0.0795 497 1 1 Solute carrier family 23 (nucleobase transporters), member 1 SLC23A1 Hs.82042 N20373 0.0667 498 1 1 - -- W46155 0.0643 499 -1 1 - - Hs.355892 N21515 0.1522 499 -1 0.8 Choline/ethanolaminephosphotransferase CEPT1 Hs.363572 T79937 0.0643 500 1 1 Cutaneous T-cell lymphoma tumor antigen se70-2 SE70-2 Hs.39140 N52622 0.1305 500 -1 0.93 General transcription factor IIH, polypeptide 1, 62kDa GTF2H1 Hs.89578 AA047464 0.0768 501 -1 0.93 RAN binding protein 2 RANBP2 Hs.199179 R66525 0.0768 501 1 1 - - Hs.99804 W78924 0.0691 503 -1 1 HSPC142 protein HSPC142 Hs.6468 W86640 0.0716 503 -1 1 Receptor (TNFRSF)-interacting serine-threonine kinase 1 RIPK1 Hs.296327 H28053 0.0768 503 1 1 Down-regulated by Ctnnb1, a DRCTNNB1A Hs.85603 R56028 0.0852 504 1 1 - - Hs.293407 T65042 0.0643 505 1 1 - -- R13546 0.0795 506 1 1 Endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 EDG1 Hs.154210 AA046034 0.1113 506 -1 1 Retinoblastoma binding protein 1 RBBP1 Hs.380994 H87204 0.0742 507 1 1 Cyclin-dependent kinase 5 CDK5 Hs.166071 R01627 0.0852 511 1 1 Major histocompatibility complex, class II, DQ beta 1 HLA-DQB1 Hs.73931 H13699 0.0691 512 1 1 ESTs ESTs Hs.171575 R01529 0.1389 513 1 0.93 Interferon (alpha, beta and omega) receptor 2 IFNAR2 Hs.86958 T99676 0.1113 514 1 1 Hypothetical protein MGC40405 MGC40405 Hs.193482 AA044141 0.1225 515 1 1 Chromosome 20 open reading frame 98 C20orf98 Hs.286128 AA211825 0.1265 516 -1 0.93 - -- H66279 0.0556 518 1 1 - - Hs.216226 H53712 0.0912 518 1 1 Protein kinase C, delta PRKCD Hs.155342 R62399 0.1265 520 1 0.93 Tetraspanin similar to TM4SF9 DC-TM4F2 Hs.101395 R60159 0.0795 521 1 1 Topoisomerase (DNA) I TOP1 Hs.317 N22841 0.0536 523 -1 1 Hypothetical protein MGC17943 MGC17943 Hs.106390 N30234 0.0852 523 -1 1 Tripartite motif-containing 33 TRIM33 Hs.287414 W58440 0.0691 524 -1 1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 B4GALT1 Hs.198248 W67706 0.0556 526 -1 1 Natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B) NPR2 Hs.78518 H40373 0.0795 526 1 1 S164 protein S164 Hs.180789 T86358 0.0823 526 1 1 - - Hs.193931 H14291 0.0882 526 1 1 Amyloid beta (A4) precursor-like protein 1 APLP1 Hs.74565 R90829 0.0742 527 1 1 Vascular endothelial growth factor B VEGFB Hs.78781 H51393 0.0768 528 1 1 Transient receptor potential cation channel, subfamily V, member 2 TRPV2 Hs.279746 H26802 0.1008 528 1 1 - - Hs.352614 N27996 0.0643 529 -1 1 Hypothetical protein MGC26818 MGC26818 Hs.23765 R16551 0.0667 529 -1 1 - -- N56633 0.0795 530 -1 0.97 Syntaxin 12 STX12 Hs.106823 H22702 0.0912 530 1 1 Hypothetical protein MGC10540 MGC10540 Hs.108824 H15059 0.0577 531 1 1 KIAA0582 protein KIAA0582 Hs.79507 H26567 0.0643 532 -1 1 Bone morphogenetic protein 1 BMP1 Hs.1274 W04643 0.0691 532 -1 1 Solute carrier family 17 (anion/sugar transporter), member 5 SLC17A5 Hs.117865 AA033874 0.1113 532 -1 0.93 - - Hs.12035 AA005070 0.0823 533 1 1 Hypothetical protein FLJ10890 FLJ10890 Hs.17283 N50315 0.0768 534 -1 1 Pre-mRNA splicing SR protein rA4 KIAA1172 Hs.125134 N67638 0.1149 535 -1 1 Disrupted in renal carcinoma 2 DIRC2 Hs.11360 AA134878 0.0598 536 -1 1 KIAA0117 protein KIAA0117 Hs.322478 W61184 0.062 536 -1 1 ATPase, Class VI, type 11B ATP11B Hs.75478 N95220 0.0716 536 -1 1 Hypothetical protein MBC3205 MBC3205 Hs.43621 AA001329 0.0598 537 -1 1 Cyclin A2 CCNA2 Hs.85137 R20578 0.0976 538 1 1 ESTs ESTs Hs.90431 AA194129 0.0912 539 -1 0.93 Hypothetical protein FLJ13102 FLJ13102 Hs.225160 R51121 0.1042 539 1 0.93 KIAA1880 protein KIAA1880 Hs.100256 H93203 0.0667 540 -1 1 Nesca protein NESCA Hs.226499 AA057293 0.0691 541 1 1 Peptidylprolyl isomerase C (cyclophilin C) PPIC Hs.110364 R05441 0.0556 542 1 1 MT-protocadherin KIAA1775 Hs.137556 R56535 0.0823 542 -1 1 ESTs ESTs Hs.106672 AA148461 0.0943 542 1 1 Hypothetical protein LOC51315 LOC51315 Hs.5721 N51027 0.1008 542 -1 1 Hypothetical protein FLJ10420 FLJ10420 Hs.289087 H82175 0.0691 543 1 1 Sialidase 1 (lysosomal sialidase) NEU1 Hs.118721 N31564 0.0742 544 -1 1 - - Hs.111364 N95196 0.0577 545 -1 1 Deoxyribonuclease II, lysosomal DNASE2 Hs.118243 AA045668 0.0742 545 1 1 TRIAD3 protein TRIAD3 Hs.86228 H16449 0.1042 545 1 1 Staufen, RNA binding protein (Drosophila) STAU Hs.6113 N41715 0.0643 546 -1 1 Hypothetical protein FLJ11294 FLJ11294 Hs.107000 AA031407 0.0667 546 1 1 ESTs ESTs Hs.303016 AA035451 0.1113 546 -1 0.93 - - Hs.295963 N92570 0.0577 547 -1 1 Uncharacterized bone marrow protein BM042 BM042 Hs.324136 R87400 0.0667 548 1 1 Butyrophilin, subfamily 2, member A1 BTN2A1 Hs.169963 T75252 0.0742 548 1 1 Hypothetical protein DKFZp434B195 DKFZP434B195 Hs.10748 AA046086 0.1008 548 -1 1 CDC-like kinase 1 CLK1 Hs.2083 R39774 0.0976 549 1 1 KIAA1698 protein KIAA1698 Hs.6259 N28568 0.0598 550 1 1 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773 AA149493 0.0912 550 1 1 - -- R51495 0.0667 551 1 1 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa NDUFB8 Hs.198273 H52752 0.1077 551 1 1 Heat shock 70kDa protein 9B (mortalin-2) HSPA9B Hs.3069 R05480 0.0852 552 1 1 Solute carrier family 26, member 6 SLC26A6 Hs.298476 H19945 0.1042 553 1 1 Syntaxin 5A STX5A Hs.302300 N78845 0.0852 554 -1 1 Hypothetical protein FLJ20542 FLJ20542 Hs.6449 AA001141 0.0667 555 -1 1 Heparan sulfate proteoglycan 2 (perlecan) HSPG2 Hs.211573 AA059276 0.1113 555 1 1 Hypothetical protein MGC13010 MGC13010 Hs.332040 H95186 0.0667 559 -1 1 - - Hs.378739 N72995 0.0795 560 -1 1 Neuroblastoma, suppression of tumorigenicity 1 NBL1 Hs.76307 H26288 0.0976 562 1 1 Hypothetical protein FLJ13448 FLJ13448 Hs.288945 R77731 0.1522 562 -1 0.93 DKFZP566C0424 protein DKFZP566C042Hs.226770 N90242 0.0852 563 -1 1 Glyoxylate reductase/hydroxypyruvate reductase GRHPR Hs.155742 H19829 0.062 564 1 1 Rab acceptor 1 (prenylated) RABAC1 Hs.11417 R54957 0.1225 564 1 1 - - Hs.356757 AA037447 0.1617 564 -1 0.93 Acid phosphatase 1, soluble ACP1 Hs.75393 N98296 0.0716 565 1 1 Hypothetical protein FLJ10808 FLJ10808 Hs.59838 T81296 0.0823 565 1 0.93 Glucocorticoid receptor DNA binding factor 1 GRLF1 Hs.102548 H38160 0.0691 566 1 1 Hypothetical protein FLJ10769 FLJ10769 Hs.8083 R79616 0.0716 566 1 1 Thioredoxin domain containing TXNDC Hs.24766 R36452 0.1008 566 -1 0.93 ESTs ESTs Hs.300817 T86647 0.1042 566 1 1 ESTs ESTs Hs.332087 H98836 0.0536 567 -1 1 Sac domain-containing inositol phosphatase 3 SAC3 Hs.10037 H98783 0.0882 567 -1 1 Hypothetical protein FLJ31413 FLJ31413 Hs.24643 H69082 0.0912 567 1 1 KIAA0241 protein KIAA0241 Hs.150275 N94471 0.0667 569 -1 1 Small membrane protein 1 SMP1 Hs.107979 R97175 0.0882 570 1 1 - - Hs.110783 N25631 0.1042 570 -1 0.93 Regulatory factor X-associated ankyrin-containing protein RFXANK Hs.296776 AA009672 0.1113 570 -1 0.87 Tyrosine kinase 2 TYK2 Hs.75516 AA069400 0.0882 571 -1 0.93 Hypothetical protein MGC10974 MGC10974 Hs.111099 R32023 0.1818 571 1 0.8 Golgi autoantigen, golgin subfamily a, 5 GOLGA5 Hs.241572 H05096 0.0716 573 1 0.93 ESTs ESTs Hs.138417 W32998 0.1265 573 -1 1 - - Hs.355841 R37498 0.062 575 1 1 V-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein) RALB Hs.348024 R16301 0.0823 575 1 1 - -- H08027 0.1187 575 1 0.93 - - Hs.288963 R18453 0.1225 576 1 1 - -- H30637 0.0768 577 1 1 ESTs ESTs Hs.27362 R17409 0.1077 577 1 0.93 - -- N20343 0.1008 578 -1 0.87 - -- R18817 0.0716 579 1 1 ESTs ESTs Hs.22550 W16814 0.0742 580 -1 1 Hypothetical protein MGC18257 MGC18257 Hs.350860 W93648 0.0852 580 -1 1 CD47 antigen (Rh-related antigen, integrin-associated signal transducer) CD47 Hs.82685 AA134944 0.1225 580 1 0.93 - -- H18491 0.1432 580 1 1 - - Hs.268701 AA150728 0.0823 581 -1 1 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3 ADPRTL3 Hs.271742 H41751 0.0943 581 1 1 General transcription factor IIF, polypeptide 1, 74kDa GTF2F1 Hs.68257 R08338 0.0823 582 1 1 - - Hs.309257 N49523 0.1008 583 -1 1 DKFZP434C128 protein DKFZP434C128Hs.222909 AA099692 0.0976 584 -1 0.93 Epsilon-tubulin LOC51175 Hs.34851 H14838 0.1042 584 -1 0.93 Defender against cell death 1 DAD1 Hs.82890 N58012 0.0691 585 -1 1 - -- H65659 0.1187 585 1 0.93 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 Hs.379991 N73090 0.0716 586 1 1 Homolog of yeast MAF1 MAF1 Hs.324157 AA045730 0.0976 586 -1 0.93 TGFB inducible early growth response TIEG Hs.82173 H92328 0.0667 587 1 1 Hypothetical protein FLJ10874 FLJ10874 Hs.30318 R25107 0.0716 587 -1 1 Protein phosphatase methylesterase-1 PME-1 Hs.63304 R11719 0.0943 587 1 1 Nucleolar protein 1, 120kDa NOL1 Hs.15243 R36748 0.1113 587 1 0.87 - - Hs.22545 T78109 0.0976 588 1 1 - - Hs.296322 N80155 0.0976 589 -1 1 - - Hs.18672 H00239 0.1008 589 1 1 ATP-binding cassette, sub-family F (GCN20), member 2 ABCF2 Hs.153612 AA203552 0.0643 590 -1 1 - - Hs.193007 R13215 0.1113 591 1 0.93 Protocadherin 19 PCDH19 Hs.4993 R16127 0.1265 591 -1 0.93 - - Hs.121575 N42484 0.0691 592 -1 1 - -- T80880 0.0823 592 1 1 ESTs ESTs Hs.268957 AA148577 0.0852 592 1 1 Zinc finger protein 20 (KOX 13) ZNF20 Hs.110956 H50391 0.0882 592 -1 1 Acid phosphatase 1, soluble ACP1 Hs.75393 W86860 0.1042 592 -1 1 Nuclear VCP-like NVL Hs.58927 R59448 0.0497 594 -1 1 Aryl hydrocarbon receptor nuclear translocator-like ARNTL Hs.74515 R14321 0.0943 595 1 1 NEL-like 1 (chicken) NELL1 Hs.21602 W07372 0.1113 595 -1 1 MBIP protein MBIP Hs.16755 AA203394 0.1008 596 -1 1 ESTs ESTs Hs.365593 W90154 0.1477 596 -1 1 DKFZP434B168 protein DKFZP434B168 Hs.48604 R70694 0.0912 597 1 1 ESTs ESTs Hs.29126 T98538 0.1042 602 1 1 Adaptor-related protein complex 3, beta 1 subunit AP3B1 Hs.155172 AA125942 0.0882 605 -1 1 ESTs ESTs Hs.61881 R93690 0.0823 607 1 1 Hydroxysteroid (17-beta) dehydrogenase 4 HSD17B4 Hs.75441 H03286 0.1347 607 -1 1 3 beta-hydroxy-delta 5-C27-steroid oxidoreductase C(27)-3BETA-HSHs.23628 AA054102 0.1225 608 -1 0.93 Suppressor of cytokine signaling 5 SOCS5 Hs.169836 R51894 0.0795 610 1 1 Replication factor C (activator 1) 1, 145kDa RFC1 Hs.166563 W03006 0.0882 611 -1 1 Myristoylated alanine-rich protein kinase C substrate MARCKS Hs.75607 W32102 0.1077 611 -1 1 UDP-glucose pyrophosphorylase 2 UGP2 Hs.77837 R21785 0.1042 612 1 1 Nucleoporin 155kDa NUP155 Hs.23255 R54764 0.0742 614 1 1 KIAA1295 protein KIAA1295 Hs.26204 R60752 0.1077 614 1 1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) NDUFS1 Hs.8248 AA036794 0.1225 614 -1 0.93 Hypothetical protein MGC3162 MGC3162 Hs.95196 H43499 0.0742 615 1 1 Immunoglobulin lambda locus IGL@ Hs.181125 N92087 0.0795 615 -1 1 Cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphatase) CDKN3 Hs.84113 N46505 0.1305 615 -1 0.93 Hypothetical protein FLJ13273 FLJ13273 Hs.126119 R31564 0.1008 616 1 1 Prenylcysteine lyase PCL1 Hs.278627 H03154 0.1347 616 -1 1 CAC-1 CAC-1 Hs.343912 R37954 0.0882 617 1 1 Ras association (RalGDS/AF-6) domain family 2 RASSF2 Hs.80905 R97935 0.1265 617 1 0.93 Cell division cycle 34 CDC34 Hs.76932 AA150238 0.0912 619 -1 1 - -- R55688 0.1008 619 1 0.93 KIAA0349 protein KIAA0349 Hs.15303 T78869 0.1149 619 1 1 ESTs ESTs Hs.182898 N56810 0.1305 619 -1 0.93 CAMP responsive element modulator CREM Hs.155924 H38879 0.0497 621 1 1 Phosphoserine phosphatase PSPH Hs.56407 H89555 0.0852 622 1 1 Hypothetical protein FLJ34588 FLJ34588 Hs.375580 AA010355 0.1008 622 -1 1 ESTs ESTs Hs.187568 H68440 0.1008 623 1 1 Phosphatidylinositol-4-phosphate 5-kinase, type I, beta PIP5K1B Hs.78406 R01094 0.1225 624 1 1 Likely ortholog of mouse brain protein 17 BRP17 Hs.375161 H91044 0.1389 624 -1 0.93 Mitogen-activated protein kinase phosphatase x MKPX Hs.29106 AA033982 0.0768 625 -1 1 - - Hs.110059 R59009 0.0976 626 1 1 KIAA0052 protein KIAA0052 Hs.278608 H87272 0.1569 626 1 0.97 RAB2, member RAS oncogene family RAB2 Hs.78305 N21528 0.0768 627 -1 1 Leucine rich repeat (in FLII) interacting protein 2 LRRFIP2 Hs.57672 H10355 0.062 628 1 0.93 Transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) TCEB2 Hs.172772 AA039984 0.0882 628 -1 1 CCR4-NOT transcription complex, subunit 8 CNOT8 Hs.26703 AA069620 0.0882 628 -1 1 - - Hs.198552 AA121519 0.1008 629 -1 1 - -- W31441 0.1715 629 -1 1 UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase GNE Hs.5920 AA099587 0.0795 630 -1 1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 DDX31 Hs.69331 H21773 0.1077 632 1 0.93 - - Hs.31845 H15697 0.0976 634 1 0.93 Propionyl Coenzyme A carboxylase, beta polypeptide PCCB Hs.63788 N90788 0.1477 634 -1 0.93 Annexin A4 ANXA4 Hs.77840 R14323 0.0742 635 1 1 MDN1, midasin homolog (yeast) MDN1 Hs.76730 T74342 0.1042 635 1 0.87 - -- H83003 0.1187 635 1 1 Immunoglobulin superfamily, member 1 IGSF1 Hs.22111 R70121 0.0912 636 1 1 Inositol 1,3,4-triphosphate 5/6 kinase ITPK1 Hs.6453 AA010675 0.1766 636 1 0.87 Glycogen synthase 1 (muscle) GYS1 Hs.772 W92270 0.0943 637 1 1 Fc fragment of IgG, low affinity IIa, receptor for (CD32) FCGR2A Hs.78864 N32221 0.1042 637 -1 1 Solute carrier family 12 (potassium/chloride transporters), member 6 SLC12A6 Hs.4876 AA053221 0.1113 637 -1 1 Seven in absentia homolog 2 (Drosophila) SIAH2 Hs.20191 AA036894 0.0976 638 1 1 Hypothetical protein FLJ20303 FLJ20303 Hs.17138 AA040805 0.1077 638 -1 0.93 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 PSMD5 Hs.193725 W07300 0.1305 638 1 1 Adaptor-related protein complex 1, gamma 1 subunit AP1G1 Hs.5344 AA099327 0.1077 639 -1 1 General transcription factor IIA, 2, 12kDa GTF2A2 Hs.76362 T94447 0.1149 639 -1 0.87 Cortical thymocyte receptor (X. laevis CTX) like CTXL Hs.112377 R00798 0.0852 640 1 1 Solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17 SLC25A17 Hs.62245 N28293 0.0852 640 -1 1 Autism-related protein 1 KIAA0442 Hs.32168 R20373 0.1113 641 1 0.93 Transmembrane trafficking protein TMP21 Hs.74137 R35160 0.2038 641 1 0.87 Insulin-like growth factor 2 receptor IGF2R Hs.76473 N54859 0.1077 642 -1 1 Hypothetical protein FLJ11151 FLJ11151 Hs.14992 AA114842 0.1305 642 -1 0.93 Tripartite motif-containing 3 TRIM3 Hs.321576 W93272 0.1225 643 -1 0.93 Diphosphate dimethylallyl diphosphate isomerase 2 IDI2 Hs.9270 AA044119 0.0976 644 1 1 - - Hs.103441 N39391 0.1008 644 -1 1 Hypothetical protein MGC14799 MGC14799 Hs.333166 N23976 0.1042 645 -1 1 Dystroglycan 1 (dystrophin-associated glycoprotein 1) DAG1 Hs.76111 AA121308 0.0516 646 -1 1 TRNA isopentenylpyrophosphate transferase IPT Hs.356554 H99486 0.0795 647 -1 1 LIM and SH3 protein 1 LASP1 Hs.334851 N33563 0.2339 647 -1 0.87 Transgelin TAGLN Hs.75777 AA004801 0.1008 648 -1 0.93 - -- H15131 0.1008 648 1 0.93 - - Hs.4866 AA134529 0.1042 648 -1 0.93 DKFZP566D193 protein DKFZP566D193Hs.106909 W04539 0.1389 649 1 1 KIAA0295 protein KIAA0295 Hs.155979 W96076 0.1389 650 -1 0.93 Immediate early protein ETR101 Hs.737 N81096 0.1008 651 -1 1 KIAA0614 protein KIAA0614 Hs.7314 H13047 0.0823 652 1 1 F-box only protein 22 FBXO22 Hs.369030 T78404 0.0912 653 1 0.93 ESTs ESTs Hs.14280 W47134 0.1077 653 -1 1 CGI-58 protein CGI-58 Hs.19385 H14810 0.1149 653 -1 1 - - Hs.303154 N95821 0.1265 653 -1 0.93 KIAA0768 protein LEC3 Hs.21917 R51937 0.1077 655 1 1 LIM domain kinase 2 LIMK2 Hs.278027 AA131821 0.0823 656 -1 1 Proteasome (prosome, macropain) subunit, beta type, 2 PSMB2 Hs.1390 H04766 0.0943 656 -1 1 - -- AA150896 0.0976 656 -1 1 Hypothetical protein MGC13090 MGC13090 Hs.333389 AA128183 0.0667 657 -1 1 Meningioma expressed antigen 5 (hyaluronidase) MGEA5 Hs.5734 T77239 0.1149 657 1 1 - -- AA056090 0.1347 659 -1 1 - -- N46725 0.0823 660 1 1 Hypothetical protein FLJ22679 FLJ22679 Hs.5472 W93096 0.1042 660 -1 1 - -- T88726 0.1113 663 1 0.93 Hypothetical protein FLJ20313 FLJ20313 Hs.126721 R44195 0.1225 663 1 1 DiGeorge syndrome critical region gene DGSI; likely ortholog of mouse expressed sequence 2 embryonic lethal DGSI Hs.154879 R12050 0.1149 665 -1 1 KIAA0014 gene product KIAA0014 Hs.155650 AA129727 0.1569 665 -1 0.93 RAB5C, member RAS oncogene family RAB5C Hs.479 R18944 0.2534 666 1 0.87 Transcriptional co-repressor Sin3A SIN3A Hs.22583 R24934 0.1305 667 1 1 - - Hs.356564 W73052 0.0943 669 -1 1 Ring-box 1 RBX1 Hs.279919 N27829 0.1077 672 -1 0.93 Hypothetical protein BC013035 LOC114926 Hs.10018 H90247 0.1225 672 -1 1 - - Hs.356089 N72901 0.1265 672 -1 0.93 U5 snRNP-specific 40 kDa protein (hPrp8-binding) HPRP8BP Hs.10290 H44601 0.1715 672 -1 1 ESTs ESTs Hs.134542 W20391 0.0852 673 -1 1 Kinesin-like 2 KNSL2 Hs.20830 AA035651 0.1008 674 -1 1 ESTs ESTs Hs.143813 N55023 0.0823 675 -1 1 HSPC150 protein similar to ubiquitin-conjugating enzyme HSPC150 Hs.5199 R62636 0.1008 676 -1 1 ESTs ESTs Hs.107060 H53623 0.0943 677 -1 1 - -- W05750 0.0943 677 -1 1 Protein containing CXXC domain 2 PCCX2 Hs.199009 H39920 0.1265 677 1 1 - -- H28138 0.1389 677 1 1 HLA-B associated transcript 1 BAT1 Hs.55296 AA099135 0.1008 679 -1 0.93 Hypothetical protein FLJ20186 FLJ20186 Hs.62771 AA131615 0.1113 680 -1 0.93 HRAS-like suppressor 3 HRASLS3 Hs.37189 AA005389 0.1305 680 -1 1 DKFZP727G051 protein DKFZP727G051Hs.119960 AA127846 0.1077 681 1 0.93 ESTs ESTs Hs.348901 H62770 0.1113 681 -1 0.97 ESTs ESTs Hs.176721 W52798 0.1187 681 -1 0.93 Emerin (Emery-Dreifuss muscular dystrophy) EMD Hs.2985 T85141 0.1305 681 1 1 Golgi coiled coil 1 GCC1 Hs.4783 W38635 0.1477 681 -1 0.97 Protein kinase C substrate 80K-H PRKCSH Hs.1432 W52914 0.1187 682 -1 1 - - Hs.188212 W58432 0.0852 683 -1 1 Microtubule-associated protein 4 MAP4 Hs.239298 AA131579 0.0882 683 -1 1 Platelet-derived growth factor receptor, beta polypeptide PDGFRB Hs.76144 AA005154 0.0716 684 -1 1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin) DDX9 Hs.74578 T66206 0.1305 684 1 1 VCY2 interacting protein 1 VCY2IP1 Hs.66048 H20507 0.1477 685 1 0.93 Similar to ecotropic viral integration site 5; Neuroblastoma stage 4S gene LOC115704 Hs.26870 N89707 0.1077 686 -1 0.87 Dynein light chain 2A DNLC2A Hs.100002 N50349 0.1113 687 -1 0.93 Rho guanine nucleotide exchange factor (GEF) 10 ARHGEF10 Hs.20695 H87034 0.1265 687 -1 1 Bicaudal D homolog 1 (Drosophila) BICD1 Hs.164975 R42203 0.1617 687 1 1 Mitochondrial ribosomal protein S27 MRPS27 Hs.122669 W58197 0.1872 687 1 1 Amyloid beta (A4) precursor-like protein 2 APLP2 Hs.279518 H10439 0.1008 688 -1 1 Hypothetical protein MGC5560 MGC5560 Hs.233150 AA056378 0.1187 688 -1 0.93 Alveolar soft part sarcoma chromosome region, candidate 1 ASPSCR1 Hs.298351 AA058623 0.0912 690 -1 1 Proteasome (prosome, macropain) subunit, beta type, 1 PSMB1 Hs.75748 T99083 0.1617 690 1 1 CSE1 chromosome segregation 1-like (yeast) CSE1L Hs.90073 R92026 0.1265 691 1 0.93 Fracture callus 1 homolog (rat) FXC1 Hs.54943 R20380 0.1569 692 -1 0.9 ESTs ESTs Hs.12758 H05616 0.1008 693 -1 1 Nuclear receptor co-repressor 1 NCOR1 Hs.144904 AA044402 0.1113 693 -1 0.93 Hypothetical protein FLJ11749 FLJ11749 Hs.22897 N36912 0.1347 693 -1 0.93 KIAA1737 protein KIAA1737 Hs.22452 N95498 0.1665 693 -1 0.8 - - Hs.109007 W03011 0.1187 694 -1 0.93 MSTP043 protein MSTP043 Hs.306881 T81806 0.1225 694 1 0.87 - -- R59532 0.1305 696 1 1 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazol GART Hs.82285 W92049 0.1008 697 -1 1 - -- N38855 0.1265 697 1 0.93 Enhancer of invasion 10 HEI10 Hs.107003 W07487 0.0976 698 -1 1 KIAA0870 protein KIAA0870 Hs.18166 R20713 0.0852 699 1 1 - -- AA054499 0.1347 699 -1 0.93 - - Hs.143885 W42742 0.1389 699 -1 0.93 CGI-29 protein LOC51074 Hs.104058 R12730 0.1522 699 1 0.93 Ocular development-associated gene ODAG Hs.21145 H02918 0.1926 699 1 0.73 Hypothetical protein MGC2941 MGC2941 Hs.288217 AA010318 0.1149 701 -1 1 Striatin, calmodulin binding protein STRN Hs.258538 H58427 0.0852 702 1 1 ESTs ESTs Hs.307940 H78479 0.1042 703 -1 1 Thioredoxin-like 2 TXNL2 Hs.42644 N68522 0.1042 703 -1 1 Transforming growth factor, beta 3 TGFB3 Hs.2025 T93107 0.1113 703 -1 0.93 - - Hs.110771 W21221 0.1389 703 -1 0.93 RNA binding motif protein 4 RBM4 Hs.42826 W70111 0.1389 704 -1 1 Alcohol dehydrogenase 5 (class III), chi polypeptide ADH5 Hs.78989 N48198 0.0823 705 -1 1 Zinc finger protein 151 (pHZ-67) ZNF151 Hs.33532 R01903 0.2276 705 -1 0.93 Dystonia 1, torsion (autosomal dominant; torsin A) DYT1 Hs.19261 H18275 0.1225 706 -1 1 - -- N48742 0.1522 706 -1 1 Hypothetical protein FLJ12788 FLJ12788 Hs.20242 H24644 0.0882 707 1 1 - -- N41670 0.1766 707 1 0.93 KIAA1673 KIAA1673 Hs.301444 N30514 0.2096 707 -1 1 Adenylosuccinate synthase ADSS Hs.90011 H95278 0.1042 710 -1 1 Phosphogluconate dehydrogenase PGD Hs.75888 N22357 0.1522 710 1 0.87 - -- W31460 0.0943 711 1 1 Aldehyde dehydrogenase 9 family, member A1 ALDH9A1 Hs.2533 W86191 0.1008 711 -1 1 Pseudouridylate synthase 1 PUS1 Hs.23723 N93937 0.1042 711 -1 1 Amyloid beta precursor protein (cytoplasmic tail) binding protein 2 APPBP2 Hs.84084 R87373 0.1926 711 -1 0.87 - -- AA101835 0.0912 713 -1 1 - - Hs.374524 AA011400 0.1347 714 -1 1 Dipeptidylpeptidase 9 DPP9 Hs.237617 N40831 0.1389 716 -1 1 Microsomal glutathione S-transferase 3 MGST3 Hs.111811 H87736 0.0742 717 1 1 - -- R74454 0.1305 717 1 1 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 B3GNT1 Hs.173203 W40108 0.0742 720 1 1 - - Hs.346735 R22904 0.1347 721 1 1 8D6 antigen 8D6A Hs.106196 N39954 0.1265 722 -1 1 - - Hs.109012 H83363 0.1477 722 -1 1 Translocase of inner mitochondrial membrane 10 homolog (yeast) TIMM10 Hs.355993 N53897 0.1305 723 1 1 - - Hs.58966 N42428 0.1569 723 -1 1 Ribosomal protein S24 RPS24 Hs.180450 N35859 0.0795 725 -1 1 Phosphodiesterase 7A PDE7A Hs.21857 AA009678 0.0882 725 -1 1 - -- H12615 0.0912 725 1 1 Hypothetical protein FLJ11273 FLJ11273 Hs.3542 W47189 0.1008 726 -1 0.93 HSPC041 protein LOC51125 Hs.7953 H05532 0.1149 726 1 1 Hypothetical protein BC004501 LOC90231 Hs.110906 N79577 0.1926 726 -1 0.93 Hypothetical protein MGC4368 MGC4368 Hs.9732 N79584 0.1569 727 1 0.93 CK2 interacting protein 1; HQ0024c protein CKIP-1 Hs.173380 T96407 0.1665 729 -1 0.87 - -- N34884 0.0768 731 -1 1 NIF3 NGG1 interacting factor 3-like 1 (S. pombe) NIF3L1 Hs.21943 H28165 0.0943 731 1 1 Chaperone, ABC1 activity of bc1 complex like (S. pombe) CABC1 Hs.273186 R46262 0.1042 731 1 1 Hypothetical protein MGC17515 MGC17515 Hs.350549 R68213 0.1149 731 1 1 AD026 protein AD026 Hs.28847 AA056755 0.1305 731 1 1 Peroxisomal proliferator-activated receptor A interacting complex 285 PRIC285 Hs.151714 N54855 0.1149 732 -1 0.93 ESTs ESTs Hs.269340 T39635 0.1347 733 -1 1 ESTs ESTs Hs.345204 AA046800 0.1008 734 1 1 Tuftelin interacting protein 11 TFIP11 Hs.20225 AA142987 0.1347 734 -1 1 DKFZP586I111 protein DKFZP586I111 Hs.227429 H19181 0.1477 734 1 1 Ureidopropionase, beta UPB1 Hs.126926 N26477 0.1187 735 -1 1 Iduronate 2-sulfatase (Hunter syndrome) IDS Hs.172458 W56088 0.1305 735 -1 1 Ethanolamine kinase EKI1 Hs.120439 R17312 0.1477 736 1 1 SON DNA binding protein SON Hs.92909 N99008 0.1715 736 1 0.87 DnaJ (Hsp40) homolog, subfamily A, member 1 DNAJA1 Hs.94 N79538 0.1113 737 -1 1 - - Hs.380093 R02581 0.1225 738 1 1 F-box only protein 9 FBXO9 Hs.11050 N38958 0.1077 739 -1 0.93 CCCTC-binding factor (zinc finger protein) CTCF Hs.57419 AA043504 0.1617 741 -1 0.87 Inositol polyphosphate phosphatase-like 1 INPPL1 Hs.75339 H00297 0.2038 741 1 0.8 CGI-100 protein LOC50999 Hs.348996 N49756 0.1008 742 -1 1 - - Hs.348978 N99911 0.1149 742 -1 0.93 SNARE associated protein snapin SNAPAP Hs.32018 R88190 0.0742 743 1 1 Solute carrier family 5 (sodium/glucose cotransporter), member 2 SLC5A2 Hs.356900 AA031950 0.1432 744 -1 0.87 Hypothetical protein FLJ22688 FLJ22688 Hs.288800 AA043899 0.1042 745 -1 1 - -- N69540 0.1008 746 -1 1 - - Hs.351310 AA026302 0.1265 746 -1 1 Myeloid leukemia factor 1 MLF1 Hs.85195 R34766 0.1187 747 -1 0.93 Dipeptidylpeptidase III DPP3 Hs.22880 W45534 0.1569 747 1 0.93 Laminin, alpha 4 LAMA4 Hs.78672 N90844 0.2339 747 -1 0.8 Alcohol dehydrogenase 5 (class III), chi polypeptide ADH5 Hs.78989 R72314 0.0912 749 1 1 - -- W57795 0.0976 749 1 1 TSC-22-like THG-1 Hs.102447 H25530 0.1077 749 1 1 - -- AA035227 0.1872 749 -1 0.87 Unknown LOC51693 Hs.27445 AA058815 0.1389 750 -1 0.93 Hypothetical protein BC000919 LOC90736 Hs.33020 W76572 0.0943 751 -1 1 Nudix (nucleoside diphosphate linked moiety X)-type motif 1 NUDT1 Hs.388 H28105 0.1113 751 1 1 Small nuclear ribonucleoprotein polypeptide N SNRPN Hs.48375 AA035000 0.1225 751 1 1 - -- N31736 0.1766 751 -1 0.93 Hypothetical protein FLJ25211 FLJ25211 Hs.44269 AA024810 0.1149 752 -1 1 S100 calcium binding protein A10 (annexin II ligand, calpactin I, light polypeptide (p11)) S100A10 Hs.119301 H06584 0.1477 752 1 0.93 Tetratricopeptide repeat domain 3 TTC3 Hs.118174 H58750 0.1432 754 1 1 Similar to RIKEN cDNA 2610030J16 gene MGC2541 Hs.173103 H03409 0.1477 754 1 1 Alg5, S. cerevisiae, homolog of ALG5 Hs.227933 N32277 0.1818 754 -1 0.87 - -- N95811 0.1766 755 1 0.87 Williams Beuren syndrome chromosome region 22 WBSCR22 Hs.155020 N95462 0.1149 756 1 1 ATP-binding cassette, sub-family F (GCN20), member 2 ABCF2 Hs.153612 H52742 0.1305 756 1 0.93 HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae) HRMT1L2 Hs.20521 T66828 0.1665 756 -1 0.93 Hypothetical protein FLJ36748 FLJ36748 Hs.64313 T84742 0.1187 757 1 1 Prenylcysteine lyase PCL1 Hs.278627 N34756 0.1477 757 -1 1 Sorting nexin 4 SNX4 Hs.267812 H78210 0.2038 757 1 0.93 Uridine kinase-like 1 URKL1 Hs.39850 T79936 0.1766 758 -1 0.87 ESTs ESTs Hs.119583 H22827 0.1113 759 1 1 Serine hydroxymethyltransferase 2 (mitochondrial) SHMT2 Hs.75069 T80795 0.1305 759 1 0.87 - -- R45197 0.1766 759 1 0.87 Hypothetical protein MGC11349 MGC11349 Hs.288697 R60239 0.1715 760 1 0.93 Similar to S. cerevisiae SSM4 TEB4 Hs.380875 T92561 0.1008 761 1 1 Suppression of tumorigenicity 7 ST7 Hs.5814 W48875 0.1113 761 -1 1 Ras association (RalGDS/AF-6) domain family 1 RASSF1 Hs.26931 N41297 0.2096 761 1 0.93 ESTs ESTs Hs.355658 N24066 0.1077 762 1 1 Cold shock domain protein A CSDA Hs.198726 AA011361 0.1077 762 -1 1 Soc-2 suppressor of clear homolog (C. elegans) SHOC2 Hs.104315 R59976 0.1113 762 -1 1 KIAA1831 protein KIAA1831 Hs.26714 H10444 0.1042 763 1 1 Era G-protein-like 1 (E. coli) ERAL1 Hs.3426 N36628 0.1149 763 -1 0.93 - - Hs.233382 N79772 0.1225 764 1 1 Mitochondrial ribosomal protein S10 MRPS10 Hs.380887 R94106 0.2468 765 1 0.8 - -- W85899 0.1715 767 1 1 Cytidine monophosphate N-acetylneuraminic acid synthetase CMAS Hs.12492 N72764 0.0823 768 -1 1 - -- AA036798 0.0882 768 -1 1 - - Hs.339024 AA044429 0.1042 768 -1 1 Tho2 THO2 Hs.16411 R88082 0.0976 773 -1 1 ESTs ESTs Hs.31755 H90090 0.1766 773 -1 1 DKFZP564G0222 protein DKFZP564G022Hs.13370 W87791 0.1818 773 -1 0.93 - -- N28014 0.0882 774 -1 1 BRCA1 associated protein BRAP Hs.122764 N23517 0.1265 775 -1 0.93 Heterogeneous nuclear ribonucleoprotein F HNRPF Hs.808 AA149279 0.1569 775 -1 1 DNAJ domain-containing MCJ Hs.279884 AA127818 0.1265 776 -1 1 - -- H44523 0.1569 776 1 1 KIAA0370 protein KIAA0370 Hs.70500 R77994 0.1477 777 1 0.87 Zinc finger protein 313 ZNF313 Hs.10590 R71648 0.1265 780 1 1 CDC2-related protein kinase 7 CRK7 Hs.278346 AA043201 0.0943 781 -1 1 - - Hs.179891 N55592 0.1347 781 -1 1 Ubiquitin specific protease 20 USP20 Hs.5452 W05850 0.1432 782 -1 0.93 Emopamil binding protein (sterol isomerase) EBP Hs.75105 W46270 0.2215 782 -1 0.93 Hypothetical protein FLJ22625 FLJ22625 Hs.106534 H17025 0.1477 783 1 0.93 Phosphotidylinositol transfer protein, beta PITPNB Hs.7370 R88297 0.2038 785 1 1 - - Hs.144531 R26953 0.1077 787 1 1 Solute carrier family 31 (copper transporters), member 1 SLC31A1 Hs.380728 R24850 0.1389 790 1 1 - -- R02587 0.1113 791 -1 1 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ACTR1A Hs.153961 R88098 0.1432 791 1 1 Myosin IC MYO1C Hs.286226 N50617 0.1522 791 -1 0.93 Small nuclear ribonucleoprotein polypeptide A' SNRPA1 Hs.80506 W60492 0.1347 794 -1 0.93 Amino-terminal enhancer of split AES Hs.244 H11043 0.2602 796 1 0.73 Kinesin family member 3B KIF3B Hs.301206 H50522 0.1617 797 1 1 Proteasome (prosome, macropain) inhibitor subunit 1 (PI31) PSMF1 Hs.75925 R62925 0.1617 798 1 0.93 - - Hs.285193 N64706 0.1225 799 1 1 KIAA1951 protein KIAA1951 Hs.137282 R99213 0.1665 799 1 0.93 Diacylglycerol O-acyltransferase homolog 1 (mouse) DGAT1 Hs.288627 AA150792 0.1818 800 -1 0.93 - -- AA039374 0.1715 801 -1 1 - -- N90432 0.1477 802 -1 0.93 Hypothetical protein FLJ10706 FLJ10706 Hs.273193 R11184 0.1818 802 -1 0.73 - - Hs.14337 AA099134 0.1187 803 1 0.93 Hypoxia up-regulated 1 HYOU1 Hs.277704 R77347 0.1926 804 1 0.87 Peptidyl-prolyl isomerase G (cyclophilin G) PPIG Hs.77965 H68838 0.0912 805 1 1 Nuclear receptor subfamily 2, group C, member 1 NR2C1 Hs.108301 H63676 0.1042 805 1 1 Optic atrophy 1 (autosomal dominant) OPA1 Hs.147946 H27818 0.1347 805 1 1 Hypothetical protein FLJ30656 FLJ30656 Hs.349887 R88840 0.2096 805 -1 0.93 - - Hs.268832 R48249 0.1149 806 1 1 - - Hs.301885 N71038 0.0943 808 1 0.93 Wiskott-Aldrich syndrome-like WASL Hs.170065 R86231 0.1149 809 1 1 PC326 protein PC326 Hs.279882 R25983 0.1225 809 1 1 N-ethylmaleimide-sensitive factor NSF Hs.108802 AA046886 0.1077 810 -1 1 Hypothetical protein FLJ20473 FLJ20473 Hs.9096 AA047085 0.1926 810 -1 0.93 Synaptotagmin-like 2 SYTL2 Hs.92254 N51196 0.1149 812 -1 1 - -- N63416 0.1926 812 -1 0.8 - - Hs.82719 R41613 0.1149 813 1 1 ESTs ESTs Hs.22514 AA026136 0.1113 814 -1 1 Proteasome (prosome, macropain) subunit, alpha type, 6 PSMA6 Hs.74077 N64488 0.1187 814 -1 0.93 Putative homeodomain transcription factor 1 PHTF1 Hs.123637 H72283 0.1305 814 1 1 KIAA0265 protein KIAA0265 Hs.192966 AA150728 0.1389 814 1 0.87 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3 ADPRTL3 Hs.271742 T65539 0.1225 816 1 1 Kinesin heavy chain member 2 KIF2 Hs.113319 N23950 0.1008 817 -1 1 High-mobility group box 2 HMGB2 Hs.80684 N42666 0.1389 817 -1 1 Preimplantation protein 3 PREI3 Hs.107942 H95259 0.1149 818 -1 1 Membrane protein, palmitoylated 1, 55kDa MPP1 Hs.1861 N48827 0.1477 818 -1 1 FLJ23277 protein FLJ23277 Hs.334477 R47837 0.1665 818 1 1 Zinc finger protein 265 ZNF265 Hs.194718 W15595 0.1818 818 1 1 Coactivator for steroid receptors COASTER Hs.172329 AA156746 0.1665 819 -1 1 FLJ00005 protein FLJ00005 Hs.367690 T77388 0.1981 819 1 0.87 Hypothetical protein FLJ38045 FLJ38045 Hs.170226 AA032039 0.1347 820 -1 1 Hypothetical protein FLJ13102 FLJ13102 Hs.225160 AA035309 0.2276 821 1 0.8 Hypothetical protein 20D7-FC4 20D7-FC4 Hs.128702 R71531 0.1113 822 1 1 Hypothetical protein FLJ32731 FLJ32731 Hs.380474 R34114 0.1305 822 -1 1 - - Hs.352487 T90545 0.1569 823 1 0.87 KIAA1536 protein KIAA1536 Hs.156667 AA135498 0.1766 823 1 1 CCAAT/enhancer binding protein (C/EBP), beta CEBPB Hs.99029 R11580 0.1225 824 1 1 Formin binding protein 3 FNBP3 Hs.107213 H39913 0.1522 824 -1 0.87 - - Hs.144532 N47456 0.1818 824 -1 0.87 KH domain containing, RNA binding, signal transduction associated 1 KHDRBS1 Hs.119537 N79069 0.1187 825 -1 1 - -- N47346 0.1569 825 -1 1 G-protein gamma-12 subunit LOC55970 Hs.8107 AA045053 0.1113 826 -1 1 Pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1) PTN Hs.44 N26378 0.1305 826 -1 1 Glycerol kinase GK Hs.1466 R40254 0.1522 826 1 0.93 Hypothetical protein DKFZp434L0718 DKFZP434L0718Hs.59236 T91747 0.1818 826 -1 0.87 ESTs ESTs Hs.268612 R10284 0.1187 827 1 1 Hyaluronan-mediated motility receptor (RHAMM) HMMR Hs.72550 N32304 0.1818 828 -1 0.8 Proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) PSME1 Hs.75348 W02274 0.1305 830 -1 1 - -- AA029543 0.1872 830 -1 0.93 - - Hs.112619 R17664 0.1715 831 1 1 Methyltransferase-like 1 METTL1 Hs.42957 AA195759 0.1477 832 -1 0.93 ESTs ESTs Hs.142104 AA043530 0.1766 832 -1 0.93 - - Hs.99841 R46183 0.1225 833 1 0.93 Hypothetical protein DKFZp313A2432 DKFZp313A2432Hs.349096 AA126902 0.1305 833 -1 1 UBX domain containing 1 UBXD1 Hs.11081 T74007 0.1347 834 1 1 Nicastrin NCSTN Hs.4788 N28908 0.1432 835 -1 0.93 - - Hs.356659 R08800 0.1149 836 1 1 Tubulin, gamma 2 TUBG2 Hs.279669 N53193 0.1389 836 -1 1 Polymerase (DNA directed), epsilon POLE Hs.166846 AA004836 0.1818 836 -1 0.93 Hypothetical nuclear factor SBBI22 LOC57117 Hs.26323 T96870 0.1766 837 -1 1 ESTs ESTs Hs.17910 R20016 0.1766 837 1 0.87 - - Hs.22689 R64137 0.1225 838 1 0.93 ESTs ESTs Hs.108887 R50300 0.1522 845 1 0.93 Hypothetical protein DKFZp434N1923 DKFZP434N192Hs.295866 AA147492 0.1187 847 -1 1 - - Hs.343211 W60893 0.1187 848 -1 1 Polymerase (DNA-directed), delta 4 POLD4 Hs.82520 H30717 0.1665 848 -1 0.87 GRB2-associated binding protein 2 GAB2 Hs.30687 R34667 0.1981 848 1 1 Hypothetical protein DKFZP434G1411 DKFZP434G141Hs.3837 H69320 0.1766 849 1 1 Vesicle docking protein p115 P115 Hs.325948 T79825 0.1305 850 1 1 - EST Hs.332668 R75976 0.1617 850 1 0.93 - - Hs.373548 R20435 0.1981 850 1 0.93 ESTs ESTs Hs.167361 AA156696 0.2403 850 -1 0.87 B-cell translocation gene 1, anti-proliferative BTG1 Hs.77054 AA056534 0.2038 851 1 0.8 ESTs ESTs Hs.110294 T51729 0.1347 852 -1 0.93 Regulator of G-protein signalling 14 RGS14 Hs.9347 T78059 0.1569 854 1 0.87 Protein associated with PRK1 AWP1 Hs.83954 AA057338 0.1617 854 -1 1 General transcription factor IIH, polypeptide 1, 62kDa GTF2H1 Hs.89578 W35315 0.1477 855 -1 1 - - Hs.381207 AA041347 0.2096 855 -1 0.8 Hypothetical protein FLJ13984 FLJ13984 Hs.135146 T93597 0.1187 857 1 1 ESTs ESTs Hs.187429 R98049 0.1818 857 1 1 Testis intracellular mediator protein PEAS Hs.281706 AA028073 0.1569 860 -1 0.93 - -- R89246 0.1665 860 1 1 KIAA0711 gene product KIAA0711 Hs.5333 T77481 0.1477 861 1 0.93 LIS1-interacting protein NUDEL; endooligopeptidase A NUDEL Hs.3850 T83747 0.1617 861 1 1 - -- H07904 0.1872 861 1 0.93 Hypothetical protein FLJ38045 FLJ38045 Hs.170226 R71560 0.1077 862 1 1 - -- AA031672 0.1522 863 -1 1 Dual specificity phosphatase 12 DUSP12 Hs.44229 H70392 0.1522 863 1 1 ATP-dependent RNA helicase ROK1 Hs.380430 H55914 0.1818 863 -1 1 - -- W46792 0.1432 864 -1 1 Transcription factor Dp-2 (E2F dimerization partner 2) TFDP2 Hs.19131 H63547 0.2155 864 1 0.67 N-ethylmaleimide-sensitive factor attachment protein, alpha NAPA Hs.75932 H69659 0.1389 866 1 1 - -- R52052 0.1477 866 1 1 Hypothetical protein BC012357 LOC89953 Hs.53447 H85577 0.1265 867 1 1 Hypothetical protein FLJ11273 FLJ11273 Hs.3542 R79439 0.1305 867 1 1 ADP-ribosylation factor-like 1 ARL1 Hs.242894 H01133 0.1522 867 -1 0.97 - - Hs.30120 N64510 0.2468 867 -1 0.8 - - Hs.350475 R12917 0.1818 868 1 1 - - Hs.21195 AA134109 0.1569 869 1 0.93 Hypothetical protein MGC14327 MGC14327 Hs.231029 H57791 0.2038 869 1 0.87 - -- N33225 0.1522 870 -1 1 ESTs ESTs Hs.237749 R91821 0.1715 870 1 1 ESTs ESTs Hs.245997 AA054477 0.1389 871 -1 1 - - Hs.25391 H06915 0.2096 871 1 0.73 Hypothetical protein FLJ21919 FLJ21919 Hs.105894 H84980 0.1305 872 1 1 Tripartite motif-containing 11 TRIM11 Hs.13543 R65823 0.1389 872 1 1 Two-pore channel 1, homolog KIAA1169 Hs.26440 H66475 0.1347 873 -1 1 Homolog of rat nadrin RICH1 Hs.14169 N47249 0.2339 873 -1 0.73 - - Hs.28264 R27994 0.1477 874 1 0.97 - - Hs.83086 R14811 0.1818 875 1 1 ESTs ESTs Hs.380463 T98251 0.2038 875 1 0.87 - - Hs.288581 R76958 0.1665 876 1 1 Muscleblind-like protein MBLL39 MBLL39 Hs.283609 H21748 0.1926 876 1 0.8 Caveolin 2 CAV2 Hs.139851 AA047259 0.2276 876 1 0.8 Endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamilyEBAF Hs.25195 AA099381 0.1665 877 -1 0.87 COX15 homolog, cytochrome c oxidase assembly protein (yeast) COX15 Hs.226581 R39405 0.1926 877 1 0.93 Dishevelled, dsh homolog 2 (Drosophila) DVL2 Hs.118640 H22657 0.2884 877 -1 0.83 Carboxylesterase 2 (intestine, liver) CES2 Hs.282975 R35798 0.1265 878 1 0.93 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ABCC4 Hs.139336 N25348 0.1926 878 1 0.73 V-ets erythroblastosis virus E26 oncogene homolog 1 (avian) ETS1 Hs.18063 R38456 0.1225 879 -1 1 - -- T95724 0.1432 879 1 1 Solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 SLC25A15 Hs.78457 R00710 0.1818 879 1 0.83 - - Hs.379472 N24302 0.2096 881 1 1 Zinc finger protein 146 ZNF146 Hs.301819 R54426 0.1225 882 1 1 - - Hs.96716 N71955 0.1818 884 -1 0.93 Chromosome 20 open reading frame 111 C20orf111 Hs.75798 N74427 0.1008 885 -1 1 ESTs ESTs Hs.222413 R72283 0.1569 885 1 1 Hypothetical protein FLJ12089 FLJ12089 Hs.11896 R53336 0.1715 885 1 0.93 Ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) RAC3 Hs.45002 AA031411 0.1715 885 1 1 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318 N48162 0.1389 886 -1 1 P53-regulated DDA3 DDA3 Hs.77550 R45618 0.1617 887 1 1 Hypothetical protein FLJ20498 FLJ20498 Hs.97925 AA044143 0.1305 888 1 1 Molybdenum cofactor synthesis 1 MOCS1 Hs.349416 AA029359 0.3508 889 -1 0.73 Laminin, beta 2 (laminin S) LAMB2 Hs.90291 H74279 0.1715 891 -1 0.73 Hypothetical protein DKFZp547B1713 DKFZp547B1713Hs.349262 R60613 0.2403 891 1 0.8 General transcription factor II, i GTF2I Hs.278589 AA046615 0.1522 892 1 1 Interleukin 2 receptor, beta IL2RB Hs.75596 N80988 0.2276 893 1 0.8 GTP binding protein 2 GTPBP2 Hs.13011 AA046918 0.1477 894 1 0.87 Splicing factor 3b, subunit 2, 145kDa SF3B2 Hs.75916 N27188 0.1818 894 1 0.93 Hypothetical protein from BCRA2 region CG005 Hs.23518 R35358 0.1347 896 -1 1 Hypothetical protein FLJ20011 FLJ20011 Hs.334647 N52496 0.2096 896 -1 0.87 BTG family, member 3 BTG3 Hs.77311 W07319 0.2155 896 -1 1 Zinc finger protein 41 ZNF41 Hs.143700 T96932 0.1305 897 1 1 Chromosome 6 open reading frame 11 C6orf11 Hs.17930 T87251 0.1432 897 1 0.93 ESTs ESTs Hs.114604 N28259 0.1389 898 -1 1 - - Hs.12030 H50906 0.2215 898 1 0.8 Stannin SNN Hs.76691 H18273 0.1389 899 1 1 Bernardinelli-Seip congenital lipodystrophy 2 (seipin) BSCL2 Hs.293981 H88463 0.1432 899 1 1 Lysophospholipase I LYPLA1 Hs.12540 R61769 0.1522 899 1 0.93 Crm, cramped-like (Drosophila) CRAMP1L Hs.15441 R19512 0.1665 900 1 1 Regulator of G-protein signalling 19 RGS19 Hs.22698 N92759 0.274 900 1 0.87 Cytoskeleton-associated protein 4 CKAP4 Hs.74368 R26339 0.1569 901 1 1 Adaptor-related protein complex 2, alpha 2 subunit AP2A2 Hs.19121 AA044234 0.2215 901 -1 0.93 Inositol 1,4,5-trisphosphate 3-kinase C ITPKC Hs.21453 AA135731 0.385 902 -1 0.73 ESTs ESTs Hs.71428 H18242 0.1766 903 1 0.93 Neighbor of A-kinase anchoring protein 95 NAKAP95 Hs.96200 T70331 0.1766 903 1 0.93 - -- AA037091 0.1926 904 -1 1 Transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) TCEB1 Hs.184693 AA040152 0.1077 905 -1 1 Cleavage and polyadenylation specific factor 3, 73kDa CPSF3 Hs.16251 R07975 0.1477 905 -1 1 Hypothetical protein MGC955 MGC955 Hs.55608 H86108 0.1347 906 1 1 RAB11A, member RAS oncogene family RAB11A Hs.75618 W17368 0.2276 906 1 0.8 - - Hs.261734 AA011515 0.1715 907 -1 1 KIAA0451 gene product KIAA0451 Hs.18586 W67471 0.2096 907 -1 0.93 Ras homolog gene family, member B ARHB Hs.204354 H44128 0.1477 908 1 1 Eukaryotic translation elongation factor 1 alpha 1 EEF1A1 Hs.181165 AA034352 0.1766 911 -1 0.93 MADS box transcription enhancer factor 2, polypeptide A (myocyte enhancer factor 2A) MEF2A Hs.182280 W46217 0.2339 911 -1 0.73 Tigger transposable element derived 6 TIGD6 Hs.169333 T78899 0.1389 912 -1 0.93 NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) NDUFS8 Hs.90443 R01692 0.1766 913 1 1 Junctional adhesion molecule 1 JAM1 Hs.12284 W55903 0.1617 914 -1 0.93 Adipose differentiation-related protein ADFP Hs.3416 H69440 0.1872 914 1 0.93 NY-REN-25 antigen NY-REN-25 Hs.15301 AA203234 0.1872 916 1 0.93 KIAA1728 protein KIAA1728 Hs.252748 W74601 0.2339 916 1 0.93 Phosphotidylinositol transfer protein PITPN Hs.79709 N24671 0.1225 917 -1 1 CGI-111 protein LOC51015 Hs.11085 H57853 0.2038 917 1 0.93 CGI-43 protein LOC51622 Hs.289112 R52021 0.2155 917 1 0.73 - -- W72686 0.1113 918 -1 0.93 Diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) DBI Hs.78888 R91793 0.1522 918 1 0.8 ESTs ESTs Hs.369100 AA127687 0.1665 919 1 0.93 - -- AA043535 0.1665 919 -1 1 Lysophosphatidic acid acyltransferase-delta LPAAT-delta Hs.353175 R84726 0.1715 919 1 1 Adenosine A1 receptor ADORA1 Hs.77867 N48166 0.2403 919 -1 0.8 Histone deacetylase 11 HDAC11 Hs.74280 R12704 0.1347 921 1 1 - -- H00267 0.1389 921 1 1 Hypothetical protein FLJ22955 FLJ22955 Hs.83097 N42817 0.1766 921 1 0.97 Cytochrome c oxidase subunit VIc COX6C Hs.351875 W68697 0.2339 921 -1 0.93 Hypothetical protein FLJ10998 FLJ10998 Hs.78110 R12622 0.1715 923 1 1 FtsJ homolog 2 (E. coli) FTSJ2 Hs.279877 R00802 0.1766 924 -1 0.93 ESTs ESTs Hs.191359 R14520 0.1818 924 1 0.93 ESTs ESTs Hs.137129 H26621 0.1187 925 1 1 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen) MCP Hs.83532 R14307 0.1225 927 1 1 Low density lipoprotein receptor-related protein 4 LRP4 Hs.4930 R60451 0.1225 928 1 1 N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase LOC51172 Hs.21334 N59460 0.2096 928 -1 0.93 Hypothetical protein FLJ14824 FLJ14824 Hs.22399 H43653 0.1522 929 1 1 Cytochrome c oxidase subunit VIII COX8 Hs.374980 H15400 0.2038 929 1 1 Hypothetical protein FLJ12661 FLJ12661 Hs.318526 R62209 0.2096 929 -1 0.8 - - Hs.120785 AA037777 0.1766 930 -1 0.93 Phosphatidylinositol 4-kinase type II PI4KII Hs.25300 N71958 0.2468 930 1 0.93 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa NDUFA9 Hs.75227 R76834 0.274 930 1 0.87 Hypothetical protein FLJ10392 FLJ10392 Hs.20887 H48031 0.2038 931 1 0.93 Tankyrase 1 binding protein 1, 182kDa TNKS1BP1 Hs.9645 R55335 0.1715 932 -1 1 - -- H03870 0.1265 933 1 1 Chromosome 20 open reading frame 18 C20orf18 Hs.247280 AA149853 0.1477 934 -1 1 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4 CITED4 Hs.355820 T84822 0.1617 934 1 1 TAR (HIV) RNA binding protein 1 TARBP1 Hs.151518 R72217 0.1715 935 1 1 Acetyl-Coenzyme A carboxylase beta ACACB Hs.183857 W33066 0.1477 938 -1 1 Mitochondrial ribosomal protein L9 MRPL9 Hs.288936 AA044810 0.1715 938 1 0.93 KIAA0547 gene product KIAA0547 Hs.200596 H00554 0.1347 939 1 1 Putative G-protein coupled receptor GPCR41 FLJ11856 Hs.6459 W72937 0.1617 939 1 1 Caldesmon 1 CALD1 Hs.325474 R76897 0.1569 940 1 1 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) UBE2D3 Hs.118797 AA010057 0.1522 941 -1 0.93 Thyroid hormone receptor interactor 11 TRIP11 Hs.85092 AA046217 0.1926 941 -1 0.93 - - Hs.293821 W47352 0.2602 941 -1 0.73 Ribosomal protein S6 kinase, 70kDa, polypeptide 2 RPS6KB2 Hs.103081 R22967 0.1347 942 1 1 Hypothetical protein FLJ12442 FLJ12442 Hs.84753 R91819 0.1872 942 1 1 Phosphoinositide-3-kinase, regulatory subunit, polypeptide 2 (p85 beta) PIK3R2 Hs.211586 AA034317 0.2339 942 1 0.93 Candidate tumor suppressor protein LOC57107 Hs.16608 R66879 0.1617 943 1 0.87 KIAA1911 protein KIAA1911 Hs.290931 N24676 0.1665 943 -1 1 Chaperonin containing TCP1, subunit 4 (delta) CCT4 Hs.79150 AA055220 0.1477 944 -1 0.93 Cell death regulator aven LOC57099 Hs.63168 AA193393 0.1926 944 -1 0.87 Hypothetical protein FLJ20294 FLJ20294 Hs.7995 W68755 0.1305 945 -1 0.93 Nucleotide binding protein 1 (MinD homolog, E. coli) NUBP1 Hs.81469 H53827 0.1715 945 1 0.93 ESTs ESTs Hs.36822 AA115289 0.1926 945 1 1 Huntingtin-associated protein interacting protein (duo) HAPIP Hs.8004 N46182 0.2155 945 -1 1 ATP-binding cassette, sub-family A (ABC1), member 1 ABCA1 Hs.211562 N92463 0.1766 946 1 0.93 - -- W90607 0.1872 946 1 1 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 HERPUD1 Hs.146393 R11717 0.1981 946 1 0.93 Dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) DUSP11 Hs.14611 H64822 0.1569 947 -1 1 RNA binding motif protein 8A RBM8A Hs.10283 R12731 0.1715 947 1 0.93 Zinc finger protein 335 ZNF335 Hs.165983 AA156753 0.1981 947 1 1 Chromosome 14 open reading frame 3 C14orf3 Hs.204041 N36299 0.2215 947 -1 1 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) COX10 Hs.77513 N90248 0.1432 948 1 1 Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) ST13 Hs.119222 N66214 0.1569 948 -1 0.93 Aminopeptidase puromycin sensitive NPEPPS Hs.293007 T87998 0.1665 948 1 0.93 ESTs ESTs Hs.16414 N52681 0.2215 950 -1 0.87 Golgi complex associated protein 1, 60kDa GOCAP1 Hs.6831 R72548 0.2602 950 -1 0.8 Serine/threonine kinase 11 interacting protein STK11IP Hs.22410 H44228 0.2215 951 -1 1 Calcium/calmodulin-dependent protein kinase kinase 2, beta CAMKK2 Hs.108708 T85558 0.2276 951 1 0.8 ESTs ESTs Hs.332720 N24593 0.267 951 1 0.73 - - Hs.170538 R59901 0.1617 952 1 0.93 Mevalonate kinase (mevalonic aciduria) MVK Hs.130607 N36898 0.1522 954 -1 1 Similar to rat nuclear ubiquitous casein kinase 2 NUCKS Hs.118064 AA028145 0.1617 954 -1 0.87 Tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory) TIMP3 Hs.245188 R36970 0.2038 954 -1 0.93 Sec22 homolog SEC22A Hs.183655 N32803 0.2276 955 -1 0.87 KIAA0494 gene product KIAA0494 Hs.62515 N25352 0.1665 956 -1 1 Coxsackie virus and adenovirus receptor CXADR Hs.79187 N22700 0.1766 956 -1 0.93 Hypothetical protein FLJ12584 FLJ12584 Hs.288897 H87188 0.1981 957 -1 0.87 Hypothetical protein FLJ14511 FLJ14511 Hs.40919 N91510 0.2215 957 -1 0.87 Hypothetical protein from EUROIMAGE 2107395 LOC58492 Hs.38004 R66367 0.1981 958 1 0.87 ESTs ESTs Hs.118769 T70340 0.2215 958 1 0.93 General transcription factor IIIC, polypeptide 3, 102kDa GTF3C3 Hs.90847 T85305 0.2468 958 1 0.8 - -- AA040370 0.1569 959 1 1 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 CDS2 Hs.24812 R48247 0.2096 960 1 0.87 Hypothetical protein MGC15429 MGC15429 Hs.79 T83725 0.1389 961 1 1 KIAA1255 protein KIAA1255 Hs.351633 R98214 0.1265 962 1 0.93 Chromosome 1 open reading frame 22 C1orf22 Hs.279951 R54946 0.1569 962 1 1 - -- W25036 0.1818 963 -1 0.87 Hypothetical protein BC009925 LOC113246 Hs.9634 H82729 0.1872 963 1 0.93 Homeo box C9 HOXC9 Hs.40408 N73879 0.1113 965 -1 0.93 - - Hs.109553 N25253 0.2468 965 1 0.87 Chromosome 5 open reading frame 8 C5orf8 Hs.75864 N36070 0.1665 966 -1 1 Hypothetical protein DKFZp564A176 DKFZp564A176 Hs.322844 R31649 0.2339 966 1 0.93 Huntingtin interacting protein 2 HIP2 Hs.155485 R68921 0.2155 968 1 0.93 Exportin 1 (CRM1 homolog, yeast) XPO1 Hs.79090 AA036844 0.267 968 -1 0.8 - - Hs.20000 AA043836 0.1522 970 -1 1 Hypothetical protein BC009518 LOC90799 Hs.135265 T69714 0.1715 970 -1 1 Polymerase (DNA directed), beta POLB Hs.180107 R05889 0.1766 970 1 1 Chromosome 1 open reading frame 2 C1orf2 Hs.19554 R87929 0.1225 971 1 1 H326 H326 Hs.110707 H15640 0.1766 972 -1 1 - - Hs.279607 H71112 0.1715 973 -1 0.93 MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae) MCM2 Hs.57101 N27830 0.1872 973 1 1 - - Hs.43047 N39021 0.3032 973 -1 0.8 Solute carrier family 20 (phosphate transporter), member 1 SLC20A1 Hs.78452 T86389 0.1432 975 1 0.93 ESTs ESTs Hs.100640 H43647 0.2534 975 1 1 Uncharacterized hematopoietic stem/progenitor cells protein MDS033 MDS033 Hs.54960 T96045 0.3508 975 1 0.67 - -- N45679 0.1305 976 1 0.93 Likely ortholog of mouse variant polyadenylation protein CSTF-64 CSTF2T Hs.21992 AA039275 0.1818 976 1 0.93 - - Hs.125073 R13700 0.2339 976 1 0.8 Hypothetical protein MGC5442 MGC5442 Hs.238513 N71552 0.267 976 -1 0.67 Hypothetical protein DKFZp434D1428 DKFZp434D142 Hs.321775 H88039 0.1305 977 -1 1 - - Hs.55098 AA028961 0.2155 977 1 0.87 Hypothetical protein FLJ12150 FLJ12150 Hs.118983 W15390 0.1766 978 -1 1 Bone morphogenetic protein receptor, type IA BMPR1A Hs.2534 T80623 0.3186 979 1 0.73 - -- N30036 0.1569 981 -1 0.93 Chorionic gonadotropin, beta polypeptide CGB Hs.348407 AA043503 0.1872 981 -1 0.87 Down-regulator of transcription 1, TBP-binding (negative cofactor 2) DR1 Hs.16697 N35883 0.3265 981 -1 0.83 Profilin 2 PFN2 Hs.91747 H25547 0.1569 982 1 1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34 DDX34 Hs.151706 AA135452 0.1715 982 -1 1 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041 AA053340 0.2811 983 -1 0.73 - - Hs.109212 AA007448 0.3345 983 -1 0.6 Retinoblastoma binding protein 4 RBBP4 Hs.16003 H85363 0.1432 984 -1 1 - -- N52339 0.2096 984 -1 0.8 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) ELAVL1 Hs.12379 H49724 0.1477 985 -1 1 KIAA1373 protein KIAA1373 Hs.16229 N74271 0.1715 985 1 1 Membrane-bound transcription factor protease, site 1 MBTPS1 Hs.75890 AA035052 0.2096 985 -1 0.87 Ornithine aminotransferase (gyrate atrophy) OAT Hs.75485 R84594 0.267 986 1 1 Suppressor of G2 allele of SKP1, S. cerevisiae, homolog of SGT1 Hs.5169 R86128 0.1432 987 1 1 Nucleoporin-like protein 1 NLP_1 Hs.168352 AA028142 0.1766 987 -1 1 SLC2A4 regulator SLC2A4RG Hs.170088 W19744 0.2155 987 1 0.93 - - Hs.180059 N90250 0.1872 988 -1 1 ESTs ESTs Hs.94881 AA036873 0.2811 988 1 0.87 Chromosome 20 open reading frame 108 C20orf108 Hs.352413 R51929 0.1522 989 1 0.97 KIAA0864 protein KIAA0864 Hs.84883 W93379 0.1715 990 -1 0.87 NIMA (never in mitosis gene a)-related kinase 2 NEK2 Hs.153704 H16828 0.267 990 1 0.87 Cyclic AMP phosphoprotein, 19 kD ARPP-19 Hs.7351 W89053 0.1617 991 -1 1 Hypothetical protein FLJ20343 FLJ20343 Hs.252692 T77328 0.1432 992 1 0.93 Similar to HYPOTHETICAL 34.0 KDA PROTEIN ZK795.3 IN CHROMOSOME IV MGC19606 Hs.91579 H59065 0.1522 992 1 1 - -- R64079 0.267 993 -1 0.87 KIAA0592 protein KIAA0592 Hs.13273 H17492 0.1715 995 1 1 DnaJ (Hsp40) homolog, subfamily B, member 2 DNAJB2 Hs.77768 H57824 0.2534 995 1 0.87 ESTs ESTs Hs.128746 T67521 0.2096 996 1 0.93 U2 small nuclear ribonucleoprotein auxiliary factor, small subunit 2 U2AF1RS2 Hs.171909 AA057033 0.1981 997 1 0.93 - - Hs.103388 N54113 0.2811 998 -1 0.8 Progesterone receptor membrane component 1 PGRMC1 Hs.90061 H59203 0.1981 999 1 0.93 CDC6 cell division cycle 6 homolog (S. cerevisiae) CDC6 Hs.69563 W00952 0.2468 999 1 0.8 ESTs ESTs Hs.118163 H25840 0.1872 1000 1 1 V-crk sarcoma virus CT10 oncogene homolog (avian) CRK Hs.343220 N35067 0.1522 1001 1 0.93 Cell division cycle 2-like 5 (cholinesterase-related cell division controller) CDC2L5 Hs.59498 R54992 0.1926 1003 1 1 - -- R01105 0.1766 1005 1 1 ATP-binding cassette, sub-family E (OABP), member 1 ABCE1 Hs.12013 R43082 0.2602 1005 -1 0.87 - - Hs.41974 T66828 0.1926 1006 1 0.93 Hypothetical protein FLJ36748 FLJ36748 Hs.64313 H10385 0.1389 1010 1 1 - - Hs.374535 AA136889 0.1766 1010 -1 1 ESTs ESTs Hs.62578 R98866 0.2038 1011 1 1 Proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) PRG2 Hs.99962 R18145 0.1981 1012 1 0.93 ESTs ESTs Hs.22381 AA059201 0.2096 1012 -1 1 Ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) UBE2E3 Hs.4890 N39397 0.1872 1013 -1 0.87 Brain acyl-CoA hydrolase BACH Hs.8679 H74312 0.2403 1014 -1 0.87 Phosphatidic acid phosphatase type 2B PPAP2B Hs.173717 AA055948 0.1766 1015 -1 1 Rho-associated, coiled-coil containing protein kinase 2 ROCK2 Hs.58617 T75396 0.2276 1015 1 1 GMPR2 for guanosine monophosphate reductase isolog LOC51292 Hs.234546 AA039437 0.2534 1015 -1 0.93 Solute carrier family 39 (zinc transporter), member 1 SLC39A1 Hs.7854 R59435 0.2096 1016 1 0.93 HCCA2 protein HCCA2 Hs.19223 R26854 0.1522 1017 1 1 - - Hs.261734 W04706 0.2811 1017 -1 0.8 Hypothetical protein FLJ10300 FLJ10300 Hs.42233 R51991 0.1522 1019 1 1 Similar to ubiquitin binding protein UBPH Hs.3459 AA136755 0.2339 1019 1 0.87 ESTs ESTs Hs.29475 AA029467 0.1187 1020 1 1 - -- W21233 0.2096 1020 -1 0.93 Hypothetical protein FLJ10496 FLJ10496 Hs.379807 W45562 0.2339 1021 1 0.93 - -- R41426 0.1569 1022 1 1 ESTs ESTs Hs.175370 R88034 0.1477 1023 1 1 Hypothetical protein MGC3101 MGC3101 Hs.301394 N92710 0.1522 1023 -1 1 Cold inducible RNA binding protein CIRBP Hs.119475 H60436 0.1766 1023 1 1 Hypothetical protein FLJ10422 FLJ10422 Hs.267905 W56249 0.1818 1024 -1 0.93 - - Hs.80285 H11807 0.2155 1024 -1 0.9 CTP synthase CTPS Hs.251871 H78668 0.2276 1026 -1 0.93 - - Hs.189869 H03349 0.3186 1027 1 0.8 DNA (cytosine-5-)-methyltransferase 3 alpha DNMT3A Hs.241565 H83706 0.1872 1029 -1 0.93 ESTs ESTs Hs.141358 AA152287 0.1766 1030 1 1 Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon NFKBIE Hs.182885 N36068 0.1569 1031 -1 1 Nit protein 2 NIT2 Hs.15627 H75548 0.2155 1031 -1 0.93 Tumor protein p53 binding protein, 1 TP53BP1 Hs.170263 AA129848 0.2038 1032 1 1 Exosome component Rrp41 FLJ20591 Hs.343589 AA135334 0.2276 1032 -1 0.93 TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa TAF1C Hs.153022 H80760 0.1818 1035 1 1 Hypothetical protein BM-009 BM-009 Hs.92918 R93621 0.2038 1035 1 0.87 Eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa EIF2S2 Hs.12163 N74411 0.1305 1037 1 0.93 Trophinin associated protein (tastin) TROAP Hs.171955 AA009926 0.2602 1037 -1 0.93 - -- R50640 0.3109 1038 -1 0.8 DKFZP564C186 protein DKFZP564C186Hs.134200 AA151290 0.1522 1039 1 1 Double ring-finger protein, Dorfin DORFIN Hs.48320 N91060 0.2096 1039 1 0.87 Vascular endothelial growth factor VEGF Hs.73793 AA055986 0.2096 1040 -1 0.93 Chromosome 20 open reading frame 80 C20orf80 Hs.10726 T78441 0.3032 1040 1 0.63 KIAA0553 protein KIAA0553 Hs.105749 AA010640 0.1872 1041 1 1 N-myristoyltransferase 1 NMT1 Hs.111039 H79768 0.2534 1041 -1 0.93 Activity-dependent neuroprotector ADNP Hs.3657 AA041273 0.267 1041 -1 0.87 BRG1-binding protein ELD/OSA1 ELD/OSA1 Hs.73287 N62464 0.2276 1042 -1 0.87 - - Hs.355530 H92226 0.2602 1042 -1 0.87 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa TAF12 Hs.82037 H89571 0.1715 1043 -1 0.93 - -- H92968 0.2403 1043 -1 0.93 - -- AA203723 0.3265 1043 -1 0.73 ESTs ESTs Hs.188016 N48155 0.1818 1044 -1 1 - - Hs.46826 H72121 0.2215 1045 1 0.8 Mitochondrial ribosomal protein S12 MRPS12 Hs.9964 R35255 0.3032 1045 -1 0.73 - - Hs.283839 W70336 0.3265 1045 -1 0.63 Hypothetical protein BC007540 LOC144097 Hs.63405 AA053317 0.2403 1046 1 1 Bromodomain adjacent to zinc finger domain, 2B BAZ2B Hs.8383 AA045295 0.3677 1046 -1 0.63 - - Hs.376116 AA147010 0.1617 1049 -1 1 Hypothetical protein BC015148 LOC93081 Hs.13413 H60343 0.1569 1050 1 0.93 Hypothetical protein LOC57143 LOC57143 Hs.15251 W94597 0.1617 1050 1 1 ATPase, Ca++ transporting, plasma membrane 1 ATP2B1 Hs.78546 AA054495 0.1818 1050 -1 0.87 - -- H80862 0.1818 1050 -1 0.87 Hypothetical protein KIAA1259 KIAA1259 Hs.40193 T77588 0.1926 1051 -1 0.8 ESTs ESTs Hs.187466 H46276 0.1926 1052 1 1 RNA, U17D small nucleolar RNU17D Hs.196769 W93342 0.2038 1052 -1 0.8 Hypothetical protein FLJ22127 FLJ22127 Hs.59457 N48615 0.2155 1055 -1 1 GS3955 protein GS3955 Hs.155418 H05163 0.2155 1055 1 0.87 FGF receptor activating protein 1 FRAG1 Hs.133968 T53417 0.2339 1055 -1 0.93 Purinergic receptor P2X, ligand-gated ion channel, 4 P2RX4 Hs.321709 W39414 0.1432 1057 -1 0.93 ESTs ESTs Hs.55327 N50068 0.1981 1057 -1 0.93 - - Hs.356733 R13348 0.1617 1058 1 0.93 Plexin A1 PLXNA1 Hs.334666 R46209 0.1926 1058 1 0.93 Phosphatidylglycerophosphate synthase PGS1 Hs.162604 AA043365 0.1477 1059 -1 1 Origin recognition complex, subunit 4-like (yeast) ORC4L Hs.55055 R69953 0.2155 1059 1 0.93 - - Hs.27552 R25877 0.2276 1059 1 0.93 Hypothetical protein FLJ10511 FLJ10511 Hs.106768 R76008 0.1432 1061 1 1 RAB11B, member RAS oncogene family RAB11B Hs.239018 AA056998 0.1665 1061 1 1 - -- N98535 0.1872 1061 -1 1 Chromosome 20 open reading frame 7 C20orf7 Hs.44296 R39529 0.1766 1063 1 1 Homolog of yeast long chain polyunsaturated fatty acid elongation enzyme 2 HELO1 Hs.250175 H11653 0.1818 1064 1 1 - -- R51977 0.1926 1064 1 0.93 KIAA1402 protein KIAA1402 Hs.86392 AA131255 0.2096 1064 -1 0.87 AD24 protein AD24 Hs.74899 N40345 0.1477 1065 1 0.93 Ras homolog gene family, member J ARHJ Hs.243010 W32961 0.1766 1066 1 1 ESTs ESTs Hs.271125 N75222 0.2339 1067 -1 1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28 DDX28 Hs.155049 N76007 0.2811 1069 1 0.87 - - Hs.141648 R42552 0.1981 1070 1 1 ESTs ESTs Hs.351142 R43198 0.2276 1071 1 0.87 Nuclear factor (erythroid-derived 2)-like 3 NFE2L3 Hs.22900 W02149 0.2468 1071 -1 0.87 Cell division cycle 2-like 1 (PITSLRE proteins) CDC2L1 Hs.214291 T70741 0.1766 1073 1 1 - - Hs.293476 T93721 0.2096 1073 1 0.87 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16 DDX16 Hs.12797 R60241 0.2276 1073 1 0.8 Hypothetical protein FLJ21908 FLJ21908 Hs.26750 R35530 0.2602 1075 -1 0.8 RAD23 homolog B (S. cerevisiae) RAD23B Hs.178658 H92499 0.1715 1080 1 1 ESTs ESTs Hs.289083 N43897 0.2339 1081 -1 0.87 Integrin beta 4 binding protein ITGB4BP Hs.5215 R12025 0.1981 1085 1 0.93 Bifunctional apoptosis regulator BFAR Hs.168159 H49229 0.2534 1085 -1 0.93 Hypothetical protein FLJ20040 FLJ20040 Hs.61960 AA029328 0.2811 1085 -1 0.87 KIAA0073 protein KIAA0073 Hs.1191 N29889 0.1872 1086 1 1 UBX domain containing 2 UBXD2 Hs.77495 N51684 0.2096 1086 -1 1 - - Hs.47315 T83158 0.1926 1089 -1 0.93 Hypothetical protein DJ328E19.C1.1 DJ328E19.C1.1 Hs.218329 N48160 0.1665 1091 -1 0.87 - - Hs.43619 R52828 0.2534 1091 1 0.87 Retinoic acid induced 14 RAI14 Hs.15165 T50083 0.2534 1091 -1 0.73 ESTs ESTs Hs.22247 R93504 0.1766 1092 -1 1 Rag C protein GTR2 Hs.110950 AA010467 0.1926 1094 -1 0.93 Lysyl oxidase-like 1 LOXL1 Hs.65436 R82847 0.267 1095 1 0.87 PHD finger protein 7 PHF7 Hs.30127 AA043838 0.1981 1096 -1 0.93 Cleavage and polyadenylation specific factor 6, 68kDa CPSF6 Hs.64542 AA099522 0.2468 1096 -1 0.8 Hypothetical protein FLJ11565 FLJ11565 Hs.61763 R48311 0.2215 1097 1 0.93 - -- R13362 0.2884 1097 1 0.8 - - Hs.262716 T82149 0.1766 1099 1 0.93 - - Hs.252873 AA054041 0.2038 1099 -1 1 Protein kinase C substrate 80K-H PRKCSH Hs.1432 H30688 0.2215 1100 1 0.93 - -- AA149043 0.2215 1100 -1 0.93 Type I transmembrane protein Fn14 FN14 Hs.10086 R93168 0.2403 1100 -1 0.93 Immune associated nucleotide 4 like 1 (mouse) IAN4L1 Hs.26194 AA151027 0.2155 1101 -1 0.87 Chromosome 21 open reading frame 108 C21orf108 Hs.18759 N95253 0.2276 1101 -1 0.8 ESTs ESTs Hs.5669 N90287 0.1872 1102 -1 0.87 - -- N54088 0.3763 1102 -1 0.73 - - Hs.96566 N39072 0.1872 1103 -1 0.93 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 GNAI1 Hs.203862 AA147542 0.1477 1104 -1 1 Serine/arginine repetitive matrix 1 SRRM1 Hs.18192 R01912 0.1617 1104 1 1 Ubiquitin specific protease 7 (herpes virus-associated) USP7 Hs.78683 R72179 0.1926 1105 1 1 Hypothetical protein DKFZp761H0421 DKFZp761H042 Hs.218182 AA046956 0.2155 1105 -1 0.87 DAZ associated protein 1 DAZAP1 Hs.65588 H56935 0.2468 1106 1 1 Hypothetical protein MGC32124 MGC32124 Hs.284163 R70167 0.267 1107 1 0.87 Hypothetical protein MDS025 MDS025 Hs.154938 AA057870 0.4593 1107 -1 0.6 Solute carrier family 26, member 10 SLC26A10 Hs.353207 T81538 0.1926 1108 1 0.93 MADS box transcription enhancer factor 2, polypeptide B (myocyte enhancer factor 2B) MEF2B Hs.78881 R17451 0.2215 1108 1 1 Male-enhanced antigen MEA Hs.278362 T97034 0.2602 1108 1 0.67 KIAA0877 protein KIAA0877 Hs.11217 H15287 0.2602 1110 -1 1 P21(CDKN1A)-activated kinase 6 PAK6 Hs.21420 R76588 0.1926 1112 1 0.93 - -- AA039284 0.2534 1112 -1 0.87 Hypothetical protein FLJ10290 FLJ10290 Hs.25516 R05455 0.2958 1112 1 0.87 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300 R62439 0.1818 1113 1 0.87 - -- H44888 0.1715 1114 1 0.93 - - Hs.57483 AA126734 0.2038 1114 -1 0.93 Downstream neighbor of SON DONSON Hs.17834 R09420 0.1766 1115 1 1 Hypothetical protein FLJ20397 FLJ20397 Hs.272688 N51855 0.274 1116 1 0.8 ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2 ADPRTL2 Hs.24284 R24816 0.1715 1118 1 1 KIAA0056 protein KIAA0056 Hs.13421 AA151305 0.1872 1118 -1 0.93 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569 R37626 0.2038 1119 1 0.87 - - Hs.6630 R39303 0.2403 1120 1 0.93 Rab geranylgeranyltransferase, alpha subunit RABGGTA Hs.78920 H38496 0.2811 1120 1 0.93 REV3-like, catalytic subunit of DNA polymerase zeta (yeast) REV3L Hs.115521 R55789 0.2038 1121 -1 1 Amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like) APBA2 Hs.26468 N95418 0.2602 1121 1 0.87 FK506 binding protein 8, 38kDa FKBP8 Hs.173464 R86309 0.2602 1123 1 0.93 Vacuolar protein sorting 35 (yeast) VPS35 Hs.355901 H03130 0.2811 1123 1 0.93 ESTs ESTs Hs.24370 R83178 0.2155 1124 1 1 Hydroxysteroid (17-beta) dehydrogenase 7 HSD17B7 Hs.187579 AA044639 0.3186 1124 -1 0.87 - -- N69464 0.1818 1125 -1 1 Hypothetical protein FLJ22087 FLJ22087 Hs.17230 R98672 0.2038 1125 1 1 - - Hs.27004 W85843 0.2215 1125 -1 1 - - Hs.101282 W90601 0.267 1125 1 0.93 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctionHADHA Hs.75860 N21661 0.2096 1126 -1 0.93 BMP-2 inducible kinase BIKE Hs.20137 W52940 0.2534 1126 1 0.8 MIL1 protein MIL1 Hs.10267 R40486 0.1818 1127 1 0.93 Mitogen-activated protein kinase kinase kinase 7 interacting protein 1 MAP3K7IP1 Hs.31472 H59215 0.267 1127 1 0.93 Solute carrier family 25, member 13 (citrin) SLC25A13 Hs.9599 N78968 0.2958 1127 -1 0.73 Diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor) DTR Hs.799 AA043491 0.2958 1127 1 0.83 Chromosome 6 open reading frame 1 C6orf1 Hs.62620 H48016 0.2155 1128 1 1 - -- W38442 0.2534 1128 -1 0.93 Acidic 82 kDa protein mRNA HSU15552 Hs.85769 H83025 0.2602 1130 1 0.93 ESTs ESTs Hs.151692 R69610 0.3186 1130 1 0.73 B-cell receptor-associated protein BAP29 BAP29 Hs.27135 H79508 0.2215 1131 -1 1 - -- N52646 0.2602 1131 -1 0.93 KIAA0144 gene product KIAA0144 Hs.8127 AA035296 0.2276 1132 1 0.87 Vasodilator-stimulated phosphoprotein VASP Hs.93183 AA116105 0.1926 1133 -1 1 - - Hs.351649 H73169 0.2403 1133 -1 0.93 Hypothetical protein MGC2454 MGC2454 Hs.38399 N33089 0.274 1133 -1 0.67 CGI-128 protein LOC51647 Hs.9825 H43827 0.1617 1134 1 1 V-myc myelocytomatosis viral oncogene homolog (avian) MYC Hs.79070 N28915 0.2038 1134 -1 1 Ceramide kinase CERK Hs.34516 N48163 0.267 1134 -1 0.8 Hypothetical protein MGC13186 MGC13186 Hs.16034 AA047258 0.2038 1135 -1 0.93 TNF receptor-associated factor 5 TRAF5 Hs.29736 N93130 0.2096 1135 -1 0.93 Glutamate-cysteine ligase, modifier subunit GCLM Hs.89709 AA001906 0.267 1135 -1 0.87 Thyroid hormone receptor-associated protein, 240 kDa subunit TRAP240 Hs.11861 W44535 0.2276 1136 -1 0.87 Neurochondrin NCDN Hs.94653 AA037360 0.274 1136 1 0.8 - - Hs.90960 AA134766 0.2155 1137 1 0.93 Chromosome 7 open reading frame 11 C7orf11 Hs.66666 AA129763 0.1872 1138 1 1 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctionHADHB Hs.146812 H61280 0.2884 1138 1 0.8 - -- AA056752 0.3109 1139 -1 0.67 Hypothetical protein FLJ20568 FLJ20568 Hs.279581 W32039 0.1617 1140 -1 1 Hypothetical protein dJ37E16.5 DJ37E16.5 Hs.5790 T86448 0.1926 1141 1 0.87 - -- H82057 0.267 1141 -1 0.93 - - Hs.372741 H73053 0.1617 1142 -1 1 Von Hippel-Lindau syndrome VHL Hs.174007 AA040506 0.1926 1142 -1 0.93 - - Hs.251865 AA152194 0.1926 1142 -1 0.93 Hypothetical protein FLJ37312 FLJ37312 Hs.181480 N80145 0.2215 1142 1 1 ESTs ESTs Hs.50873 AA047388 0.1981 1143 -1 0.93 Hepatitis C virus core-binding protein 6 HCBP6 Hs.283674 W24394 0.2276 1143 1 0.87 Alpha-2-macroglobulin A2M Hs.74561 R27100 0.274 1145 1 0.87 Hypothetical protein FLJ10826 FLJ10826 Hs.24809 R33031 0.2811 1145 1 0.93 Adaptor-related protein complex 3, sigma 2 subunit AP3S2 Hs.154782 N79456 0.1347 1147 -1 1 Ferritin, heavy polypeptide 1 FTH1 Hs.62954 N77703 0.1766 1147 -1 0.93 Unknown MGC21654 product MGC21654 Hs.95631 AA040372 0.2468 1147 -1 1 Proline-rich protein HaeIII subfamily 1 PRH1 Hs.278469 H52618 0.1665 1148 1 1 - -- AA044021 0.1715 1148 -1 1 Cyclin C CCNC Hs.118442 AA034109 0.3109 1149 1 0.87 Misshapen/NIK-related kinase MINK Hs.112028 R19913 0.2884 1150 -1 0.87 ESTs ESTs Hs.22860 H23269 0.1818 1151 1 0.93 Vacuolar protein sorting 41 (yeast) VPS41 Hs.180941 R49227 0.1926 1151 1 0.93 - - Hs.13702 H40662 0.2339 1151 -1 0.93 - -- H28872 0.2096 1153 1 0.93 Aspartyl-tRNA synthetase DARS Hs.80758 T78019 0.274 1153 1 0.87 - - Hs.5461 N94606 0.274 1154 -1 0.73 HSCARG protein HSCARG Hs.288969 N36402 0.2276 1155 1 0.87 Hypothetical protein PRO2032 PRO2032 Hs.372571 H51373 0.2276 1155 -1 0.93 - -- W47644 0.2096 1156 -1 0.87 Transmembrane 4 superfamily member 7 TM4SF7 Hs.26518 H24050 0.1981 1157 -1 0.93 ESTs ESTs Hs.28039 H12710 0.3109 1157 -1 0.83 KIAA0802 protein KIAA0802 Hs.27657 T79066 0.4212 1157 1 0.73 Hypothetical protein FLJ10460 FLJ10460 Hs.14347 R53661 0.267 1158 1 0.8 Phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) PDE4D Hs.172081 AA044383 0.2215 1159 -1 0.93 Interferon regulatory factor 2 IRF2 Hs.83795 AA131302 0.2339 1159 1 0.93 - - Hs.71404 W47002 0.2534 1159 -1 0.87 Non-metastatic cells 2, protein (NM23B) expressed in NME2 Hs.275163 R70784 0.2276 1160 1 1 MCT-1 protein MCT-1 Hs.102696 W90758 0.2038 1163 1 1 Hypothetical protein FLJ10514 FLJ10514 Hs.59346 R71647 0.2276 1163 -1 1 Pleckstrin homology, Sec7 and coiled/coil domains 3 PSCD3 Hs.7984 AA054454 0.274 1164 -1 0.73 Proteasome (prosome, macropain) subunit, alpha type, 1 PSMA1 Hs.82159 H95380 0.2339 1165 1 1 Hydroxysteroid (17-beta) dehydrogenase 7 HSD17B7 Hs.187579 H47495 0.1715 1166 1 1 Hypothetical protein MGC15504 MGC15504 Hs.13810 H04530 0.274 1166 -1 0.93 Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial ECHS1 Hs.76394 H08978 0.2884 1166 1 0.73 Calcium channel, voltage-dependent, beta 3 subunit CACNB3 Hs.250712 R51134 0.2339 1168 1 0.93 ESTs ESTs Hs.378118 R91050 0.2534 1168 1 0.67 Endoplasmic reticulum resident protein 44 kDa ERp44 Hs.154023 N31721 0.2215 1169 -1 0.93 DKFZP434N161 protein DKFZP434N161Hs.284208 R65863 0.2534 1169 1 0.7 Ring finger protein 13 RNF13 Hs.6900 N27628 0.2884 1169 -1 0.87 - -- T85113 0.2403 1174 1 0.93 Tumor protein, translationally-controlled 1 TPT1 Hs.279860 AA053876 0.1872 1175 -1 0.93 DKFZP586M1523 protein DKFZP586M152Hs.22981 N58733 0.1872 1175 -1 0.87 - -- AA130176 0.3186 1175 -1 0.8 SNF-1 related kinase SNRK Hs.79025 N68160 0.2155 1176 -1 0.87 Hypothetical protein FLJ23306 FLJ23306 Hs.5890 R37031 0.2811 1176 1 0.93 G protein-coupled receptor 108 GPR108 Hs.167641 W33069 0.3032 1177 1 0.87 SFRS protein kinase 2 SRPK2 Hs.78353 T88719 0.2276 1178 -1 1 Baculoviral IAP repeat-containing 5 (survivin) BIRC5 Hs.1578 H09731 0.267 1178 -1 0.87 - - Hs.7133 R77598 0.274 1179 -1 0.93 Hypothetical protein FLJ22530 FLJ22530 Hs.14570 H06560 0.2811 1179 -1 0.93 F-box and leucine-rich repeat protein 11 FBXL11 Hs.219614 AA045634 0.2958 1179 -1 0.8 ESTs ESTs Hs.364644 AA099489 0.2468 1181 -1 0.8 KIAA0111 gene product KIAA0111 Hs.79768 R01677 0.267 1181 -1 0.93 Ring finger protein 4 RNF4 Hs.66394 AA055863 0.2884 1181 1 1 Cytoskeleton-associated protein 4 CKAP4 Hs.74368 R48434 0.2811 1183 1 0.8 ESTs ESTs Hs.25560 W88660 0.2038 1184 1 1 DKFZP586F1524 protein DKFZP586F152 Hs.241543 R61777 0.2155 1184 1 0.87 Hypothetical protein MGC14421 MGC14421 Hs.334713 H51386 0.2215 1184 1 0.93 KIAA0202 protein KIAA0202 Hs.80712 AA101835 0.2468 1184 -1 0.87 - - Hs.374524 R38502 0.412 1184 1 0.87 Hypothetical protein FLJ13154 FLJ13154 Hs.25303 H88464 0.2096 1185 -1 0.93 KIAA0560 gene product KIAA0560 Hs.129952 AA043767 0.2811 1185 -1 0.93 Runt-related transcription factor 1 (acute myeloid leukemia 1; aml1 oncogene) RUNX1 Hs.129914 AA133284 0.3032 1185 1 0.93 Hypothetical protein FLJ40452 FLJ40452 Hs.339834 AA036871 0.2811 1187 1 1 DnaJ (Hsp40) homolog, subfamily A, member 2 DNAJA2 Hs.21189 T96983 0.2403 1189 1 0.93 Cerebroside (3'-phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase CST Hs.17958 R17452 0.2403 1189 -1 1 ATPase, Class II, type 9B ATP9B Hs.91471 H26130 0.2602 1190 1 0.93 Hypothetical protein PRO1580 PRO1580 Hs.270863 R54308 0.3265 1192 -1 0.93 SLIT-ROBO Rho GTPase-activating protein 2 SRGAP2 Hs.5003 AA148637 0.2534 1193 -1 0.93 Neurofascin NFASC Hs.13349 N23137 0.274 1194 -1 0.93 M-phase phosphoprotein 9 MPHOSPH9 Hs.351230 R00834 0.2884 1194 1 0.73 SLIT-ROBO Rho GTPase-activating protein 1 SRGAP1 Hs.18995 W87502 0.2038 1195 -1 1 - - Hs.356201 N74625 0.2276 1195 -1 0.87 - -- H17934 0.267 1195 1 1 Hypothetical protein MGC11287 similar to ribosomal protein S6 kinase , MGC11287 Hs.194286 R18357 0.2215 1196 1 0.9 KIAA1045 protein KIAA1045 Hs.7989 AA010396 0.267 1198 -1 0.93 - - Hs.58210 AA039428 0.2468 1199 -1 0.87 - -- R09933 0.1981 1201 1 1 - - Hs.355762 N24364 0.267 1201 -1 1 Hypothetical protein FLJ13154 FLJ13154 Hs.25303 R51031 0.1981 1202 1 1 - - Hs.349283 N92448 0.2403 1203 -1 0.93 Transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) TCF3 Hs.101047 T98615 0.2468 1204 1 0.93 Mitogen-activated protein kinase kinase kinase 10 MAP3K10 Hs.30223 H43176 0.3109 1204 1 0.87 Calcium homeostasis endoplasmic reticulum protein CHERP Hs.6430 H27559 0.2339 1205 1 0.87 Conserved gene telomeric to alpha globin cluster CGTHBA Hs.19699 H82142 0.1766 1206 -1 0.93 PC326 protein PC326 Hs.279882 N22229 0.2096 1206 -1 0.93 Protein phosphatase 1, catalytic subunit, gamma isoform PPP1CC Hs.79081 W42426 0.3265 1206 1 0.7 Iron-responsive element binding protein 2 IREB2 Hs.370324 R81939 0.1569 1207 1 0.87 - - Hs.13396 H04597 0.1981 1207 1 1 Inner membrane protein, mitochondrial (mitofilin) IMMT Hs.78504 H11052 0.2155 1207 1 0.93 Kinesin family member 3C KIF3C Hs.21611 R25990 0.2215 1207 1 0.87 Telomeric repeat binding factor (NIMA-interacting) 1 TERF1 Hs.194562 AA055314 0.2811 1208 -1 0.8 RAB14, member RAS oncogene family RAB14 Hs.5807 H01504 0.274 1209 1 0.87 - -- W51986 0.3345 1210 1 0.73 - -- W19663 0.2811 1211 1 0.7 KIAA0103 gene product KIAA0103 Hs.154387 W37491 0.2403 1212 -1 0.8 Biliverdin reductase B (flavin reductase (NADPH)) BLVRB Hs.76289 H89827 0.2468 1212 1 0.93 RAS p21 protein activator (GTPase activating protein) 3 (Ins(1,3,4,5)P4-binding protein) GAP1IP4BP Hs.119274 N22132 0.2602 1212 -1 1 - - Hs.310359 W02089 0.2534 1213 1 0.83 Hypothetical protein PRO1843 PRO1843 Hs.283330 AA057856 0.2958 1213 1 0.93 ESTs ESTs Hs.63344 N48161 0.1872 1214 -1 0.93 Upstream transcription factor 2, c-fos interacting USF2 Hs.93649 H08432 0.2811 1214 1 0.83 RNA, U transporter 1 RNUT1 Hs.21577 N36898 0.267 1216 -1 0.93 Similar to rat nuclear ubiquitous casein kinase 2 NUCKS Hs.118064 W73506 0.2403 1217 -1 0.87 Activated RNA polymerase II transcription cofactor 4 PC4 Hs.349506 H57835 0.2534 1217 -1 0.83 Hypothetical protein LOC51240 LOC51240 Hs.7870 N90523 0.2038 1218 1 1 Methionyl-tRNA formyltransferase, mitochondrial MtFMT Hs.54627 R34842 0.2339 1218 -1 1 ESTs ESTs Hs.24185 R25019 0.267 1219 1 1 ESTs ESTs Hs.21364 AA011688 0.2958 1220 -1 0.87 ATP-dependant interferon responsive ADIR Hs.26267 W40227 0.3186 1220 -1 0.73 Nucleobindin 2 NUCB2 Hs.3164 AA011595 0.3186 1220 1 0.7 Zinc finger protein 38 ZNF38 Hs.20082 R55277 0.2155 1221 1 0.93 KIAA1143 protein KIAA1143 Hs.173042 R74477 0.2215 1222 1 1 Microtubule-associated proteins 1A/1B light chain 3 MAP1A/1BLC3 Hs.121849 AA131747 0.2468 1222 1 0.87 Scribble SCRIB Hs.239784 AA148906 0.2468 1223 -1 1 Tumor rejection antigen (gp96) 1 TRA1 Hs.82689 H16254 0.3592 1223 1 0.6 Pannexin 1 PANX1 Hs.30985 AA036635 0.2155 1224 1 1 - - Hs.168450 R88980 0.2602 1225 1 0.87 - - Hs.285165 N77925 0.2038 1227 -1 0.93 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa NDUFA1 Hs.74823 H50923 0.2339 1227 1 0.87 KIAA0747 protein KIAA0747 Hs.8309 R92833 0.2096 1228 1 1 - - Hs.285519 N62617 0.2602 1228 -1 0.87 Hypothetical protein CL640 CL640 Hs.44563 N51466 0.3508 1230 1 0.8 - -- AA058398 0.2884 1231 1 1 - - Hs.6670 R42555 0.3032 1232 1 1 KIAA0494 gene product KIAA0494 Hs.62515 R50698 0.3426 1232 1 0.8 KIAA1938 protein KIAA1938 Hs.25734 R15336 0.3763 1232 1 0.67 KIAA0673 protein KIAA0673 Hs.106487 AA203387 0.3763 1234 -1 0.93 Trophinin associated protein (tastin) TROAP Hs.171955 R31383 0.2958 1235 1 0.73 Hypothetical protein FLJ31131 FLJ31131 Hs.23853 T78200 0.2602 1237 1 0.8 Hypothetical protein HSPC213 HSPC213 Hs.170219 R52844 0.2534 1238 -1 0.87 - - Hs.356786 R59109 0.3508 1238 1 0.8 A kinase (PRKA) anchor protein (yotiao) 9 AKAP9 Hs.58103 T86807 0.2276 1240 1 0.93 Serine/threonine kinase 19 STK19 Hs.444 N46171 0.2534 1241 -1 0.87 Hypothetical protein FLJ32001 FLJ32001 Hs.288742 H84793 0.2038 1242 1 1 - -- H29171 0.2811 1242 -1 1 DKFZP564A2416 protein DKFZP564A241 Hs.5297 H26012 0.2958 1244 -1 0.8 - - Hs.102558 N29139 0.2155 1245 -1 1 V-jun sarcoma virus 17 oncogene homolog (avian) JUN Hs.78465 AA027815 0.3426 1245 1 0.8 KIAA1311 protein KIAA1311 Hs.61441 R93684 0.3508 1245 1 0.73 Hypothetical protein My014 MY014 Hs.67619 AA056513 0.2096 1246 -1 1 Glutaredoxin 2 GLRX2 Hs.5054 T78280 0.3426 1246 1 0.93 Histone acetyltransferase 1 HAT1 Hs.13340 R31858 0.2096 1247 1 0.87 Kaiso ZNF-kaiso Hs.143604 N51794 0.274 1247 -1 1 Transforming growth factor, beta-induced, 68kDa TGFBI Hs.118787 AA036778 0.3109 1247 -1 0.8 - -- N72505 0.2215 1249 1 0.87 Hypothetical protein MGC5508 MGC5508 Hs.13662 W02900 0.2339 1251 -1 0.87 Cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile) CYP1B1 Hs.154654 R69571 0.3032 1252 1 0.8 CDA14 LOC51290 Hs.26813 H21785 0.2811 1253 1 0.87 Zinc finger protein 91 homolog (mouse) ZFP91 Hs.46366 H45307 0.2811 1253 1 0.87 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 DYRK4 Hs.17154 AA210890 0.2339 1254 -1 1 - -- T80951 0.274 1254 1 0.8 Replication protein A1, 70kDa RPA1 Hs.84318 R81830 0.3508 1257 1 0.4 Zinc finger protein 217 ZNF217 Hs.155040 W15360 0.1766 1259 -1 0.93 Epidermal growth factor receptor pathway substrate 8-related protein 1 EPS8R1 Hs.28907 R74114 0.2403 1261 -1 0.93 - - Hs.285833 N43952 0.2534 1261 1 0.8 - - Hs.236443 H85447 0.2276 1262 -1 0.87 - -- H22064 0.274 1262 1 0.87 PHD zinc finger transcription factor PF1 Hs.135890 AA192730 0.3345 1262 -1 0.8 - -- AA010668 0.2215 1263 -1 0.87 Protein tyrosine phosphatase, receptor type, C-associated protein PTPRCAP Hs.155975 H10223 0.2468 1263 -1 0.8 - - Hs.63368 AA043201 0.2468 1263 1 0.93 - - Hs.179891 N59242 0.3109 1263 -1 0.73 Hypothetical protein HH114 HH114 Hs.48348 N29496 0.2403 1265 1 1 ESTs ESTs Hs.44041 N29422 0.2811 1265 1 0.8 Matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) MMP2 Hs.111301 R52958 0.3032 1265 1 0.73 Calcium channel, voltage-dependent, gamma subunit 4 CACNG4 Hs.331904 R86741 0.3265 1265 1 0.73 HRD1 protein HRD1 Hs.334819 R60357 0.2468 1266 1 0.87 Alanyl-tRNA synthetase AARS Hs.75102 H71225 0.2096 1267 1 1 KIAA1673 KIAA1673 Hs.301444 H18988 0.2215 1267 -1 0.93 Hypothetical protein FLJ12242 FLJ12242 Hs.94810 H52616 0.2884 1268 -1 1 Beta-amyloid binding protein precursor BBP Hs.333541 AA053322 0.2958 1268 -1 0.87 - -- N24229 0.3345 1268 -1 0.8 Polypyrimidine tract binding protein 1 PTBP1 Hs.172550 AA046481 0.1981 1269 -1 0.93 Chloride channel 6 CLCN6 Hs.211614 N32620 0.2215 1270 -1 0.87 CGI-36 protein LOC51078 Hs.182986 AA130098 0.3763 1271 -1 0.73 - - Hs.44829 N75042 0.2276 1272 -1 0.87 V-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa light polypeptide gene enhancer in B-ceRELA Hs.75569 W03928 0.2468 1273 -1 0.93 Ribosomal protein S8 RPS8 Hs.151604 N79531 0.2534 1274 1 1 Hypothetical protein MGC2714 MGC2714 Hs.74284 AA054468 0.3677 1274 -1 0.67 - - Hs.356385 AA057871 0.2155 1275 -1 0.93 DNA-damage-inducible transcript 3 DDIT3 Hs.337761 H96259 0.2155 1275 -1 0.87 Similar to putative transmembrane protein; homolog of yeast Golgi membrane protein Yif1p (Yip1p-interacting factor)LOC90522 Hs.334725 H15848 0.2534 1275 -1 0.87 - - Hs.31388 N63833 0.1872 1276 1 1 Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID) GNS Hs.334534 T72626 0.2403 1276 1 0.87 Hypothetical protein DJ971N18.2 DJ971N18.2 Hs.169358 N94608 0.3265 1276 -1 0.6 Interferon gamma receptor 2 (interferon gamma transducer 1) IFNGR2 Hs.177559 W91979 0.2534 1277 -1 0.93 24-dehydrocholesterol reductase DHCR24 Hs.75616 AA036798 0.3508 1277 -1 0.63 - - Hs.339024 AA059131 0.2602 1278 -1 0.93 BTB (POZ) domain containing 1 BTBD1 Hs.21332 T67217 0.3032 1278 -1 0.8 Hypothetical protein MGC3207 MGC3207 Hs.372737 N93458 0.2468 1279 1 0.93 Ubiquinol-cytochrome c reductase core protein II UQCRC2 Hs.173554 H56534 0.3265 1280 -1 0.87 - -- N31486 0.2602 1281 -1 0.87 Hypothetical protein FLJ37562 FLJ37562 Hs.356734 R63808 0.2403 1282 1 0.87 TSPY-like TSPYL Hs.278479 H23211 0.2403 1282 1 1 Hypothetical protein MGC3077 MGC3077 Hs.288649 N42273 0.3265 1282 1 0.73 Signal-induced proliferation-associated gene 1 SIPA1 Hs.7019 W32666 0.274 1283 -1 0.8 TNFRSF1A-associated via death domain TRADD Hs.89862 T97531 0.3265 1283 1 0.93 - -- AA026902 0.4029 1283 -1 0.6 GDP-fucose transporter 1 FLJ11320 Hs.12211 T85094 0.274 1284 1 0.87 Hypothetical protein FLJ20725 FLJ20725 Hs.15467 AA026852 0.2468 1285 1 0.87 Chromosome 20 open reading frame 67 C20orf67 Hs.272814 W39284 0.267 1285 -1 0.87 Pumilio homolog 1 (Drosophila) PUM1 Hs.153834 AA150909 0.274 1286 -1 0.67 - -- T66763 0.2884 1287 -1 0.8 Hypothetical protein MGC4276 similar to CG8198 MGC4276 Hs.177776 AA150315 0.2958 1288 -1 0.87 Chromosome 5 open reading frame 3 C5orf3 Hs.166551 W15155 0.2038 1289 -1 1 - -- H14058 0.2403 1290 1 0.93 Similar to HYPOTHETICAL 43.1 KD TRP-ASP REPEATS CONTAINING PROTEIN K04G11.4 IN CHROMOSOME XLOC197336 Hs.12705 N53940 0.274 1290 -1 1 Hypothetical protein MGC20481 MGC20481 Hs.324127 H83024 0.2884 1290 1 0.87 Phosphatidylethanolamine N-methyltransferase PEMT Hs.15192 T85009 0.3109 1290 -1 0.87 Hypothetical protein FLJ32203 FLJ32203 Hs.351706 W87527 0.1872 1291 -1 1 Hypothetical protein PNAS-131 PNAS-131 Hs.37883 R38964 0.2339 1292 1 1 - -- H20945 0.2534 1292 -1 0.87 - - Hs.379958 AA010958 0.2602 1292 -1 0.87 Myogenic factor 6 (herculin) MYF6 Hs.35937 AA126385 0.3109 1292 1 0.93 Hypothetical protein BC010736 LOC92609 Hs.355819 N20508 0.3032 1293 1 0.73 Fidgetin FIGN Hs.274281 R18742 0.2602 1294 1 0.93 KIAA1896 protein KIAA1896 Hs.5476 T52348 0.274 1294 -1 0.8 Hypothetical protein FLJ40629 FLJ40629 Hs.99807 H51316 0.3032 1294 1 0.67 Sestrin 2 SES2 Hs.8026 H51270 0.2468 1296 1 0.67 Ubiquitously transcribed tetratricopeptide repeat gene, X chromosome UTX Hs.13980 H59677 0.4496 1296 -1 0.53 Hypothetical protein FLJ13909 FLJ13909 Hs.288672 N63014 0.2534 1298 -1 1 Poly (ADP-ribose) glycohydrolase PARG Hs.91390 AA043061 0.3032 1298 -1 0.93 - - Hs.352417 T84447 0.1766 1299 1 1 - -- H85554 0.3109 1299 1 0.8 V-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog KRAS2 Hs.351221 R59926 0.2534 1303 1 0.87 Paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein) PACE Hs.59242 AA010875 0.3186 1304 -1 0.6 Proteasome (prosome, macropain) subunit, alpha type, 1 PSMA1 Hs.82159 N95807 0.2958 1305 1 0.87 Insulin-like growth factor binding protein 4 IGFBP4 Hs.1516 R25125 0.385 1307 -1 0.67 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa NDUFC2 Hs.193313 W23575 0.1872 1308 -1 0.93 Phosphofructokinase, platelet PFKP Hs.99910 AA210725 0.2534 1308 1 1 ESTs ESTs Hs.365595 R72425 0.2811 1308 1 0.93 HLA-B associated transcript 1 BAT1 Hs.55296 N34328 0.2884 1308 -1 0.93 KIAA1641 protein KIAA1641 Hs.44566 H95221 0.2884 1309 1 0.8 Hypothetical protein MGC12972 MGC12972 Hs.13972 N73885 0.2811 1311 -1 0.87 CDA02 protein CDA02 Hs.332404 N33831 0.1926 1312 1 1 Glutathione peroxidase 4 (phospholipid hydroperoxidase) GPX4 Hs.2706 H80533 0.3186 1312 1 0.6 Interleukin 1 receptor accessory protein IL1RAP Hs.173880 AA031576 0.2339 1313 -1 0.9 - - Hs.143812 T95126 0.3592 1313 1 0.87 - -- N67708 0.2958 1314 -1 0.8 Hypothetical protein FLJ20644 FLJ20644 Hs.49376 R34225 0.2958 1314 1 0.87 KIAA0998 protein KIAA0998 Hs.131525 T86593 0.2534 1315 1 0.93 ESTs ESTs Hs.16222 AA137220 0.2534 1315 1 0.8 - - Hs.83286 W51779 0.2602 1315 1 0.93 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 SMARCE1 Hs.332848 AA040295 0.3265 1316 -1 0.8 Formin homology 2 domain containing 1 FHOD1 Hs.95231 R98462 0.274 1317 -1 0.93 Likely ortholog of mouse Abl-philin 2 APH2 Hs.76662 N47654 0.3186 1317 -1 0.87 KIAA0140 gene product KIAA0140 Hs.156016 N95293 0.2403 1318 -1 1 SPPL2b SPPL2B Hs.284161 R34925 0.3186 1318 1 0.73 Phospholipase D1, phophatidylcholine-specific PLD1 Hs.82587 H70682 0.2155 1319 1 0.83 Propionyl Coenzyme A carboxylase, alpha polypeptide PCCA Hs.80741 N28292 0.2811 1319 -1 0.87 Sec23-interacting protein p125 P125 Hs.300208 N92858 0.3265 1320 -1 0.93 U6 snRNA-associated Sm-like protein LSM4 Hs.76719 T79625 0.274 1321 1 0.87 ESTs ESTs Hs.14064 N75519 0.274 1322 1 0.87 - - Hs.367854 H18113 0.3186 1322 1 0.8 - - Hs.379038 N36953 0.1981 1323 -1 1 Deoxycytidine kinase DCK Hs.709 N91929 0.2534 1323 1 0.93 Hypothetical protein FLJ12799 FLJ12799 Hs.22549 H11384 0.3508 1323 -1 0.67 - - Hs.352554 AA024415 0.385 1323 -1 0.67 Keratin 1 (epidermolytic hyperkeratosis) KRT1 Hs.80828 AA053007 0.4212 1323 1 0.8 Putative receptor protein PMI Hs.15196 AA213541 0.2811 1324 1 0.87 Ninein (GSK3B interacting protein) NIN Hs.44054 R00402 0.3508 1324 1 0.83 - - Hs.380859 R70785 0.2602 1325 1 0.87 Chromosome 8 open reading frame 2 C8orf2 Hs.125849 AA059125 0.412 1326 -1 0.73 Filamin B, beta (actin binding protein 278) FLNB Hs.81008 H16663 0.2468 1327 1 0.87 HSPC049 protein HSPC049 Hs.172622 N76256 0.2602 1327 -1 0.87 Tubulin, gamma complex associated protein 3 TUBGCP3 Hs.9884 N94625 0.2884 1327 -1 0.93 Protein x 013 AD-020 Hs.82933 AA010349 0.2276 1328 1 0.87 Slingshot 1 SSH1 Hs.60377 H25157 0.2534 1328 1 1 - -- AA029802 0.3109 1328 1 0.73 High density lipoprotein binding protein (vigilin) HDLBP Hs.177516 W38730 0.4891 1328 -1 0.47 Poly(rC) binding protein 2 PCBP2 Hs.63525 R12051 0.2403 1330 -1 1 - - Hs.264915 W90379 0.2811 1330 -1 0.87 - -- R68381 0.2602 1331 1 0.93 - -- AA029050 0.267 1331 -1 1 - -- W02280 0.3186 1331 -1 0.67 - - Hs.374582 N27544 0.2534 1334 -1 1 Cell division cycle 27 CDC27 Hs.172405 H63197 0.2958 1334 1 0.77 KIAA0251 protein KIAA0251 Hs.343566 H44375 0.2534 1336 1 0.87 Regulatory factor X-associated ankyrin-containing protein RFXANK Hs.296776 W17221 0.3592 1336 1 0.87 Hypothetical protein MGC2217 MGC2217 Hs.323164 N33439 0.4691 1336 -1 0.6 Eukaryotic translation elongation factor 2 EEF2 Hs.75309 H06279 0.2403 1338 1 0.9 Hypothetical protein DKFZp762M136 DKFZp762M136Hs.351747 AA156864 0.3345 1338 1 0.8 Hypothetical protein IMAGE3455200 IMAGE3455200 Hs.324844 H12660 0.2403 1340 1 0.9 Sarcolemma associated protein SLMAP Hs.4007 N50403 0.267 1340 -1 0.87 Nucleosome assembly protein 1-like 1 NAP1L1 Hs.302649 R71158 0.2811 1341 1 0.87 Catenin (cadherin-associated protein), delta 1 CTNND1 Hs.166011 N91920 0.3426 1342 -1 0.73 - -- T86121 0.3677 1342 -1 0.87 ESTs ESTs Hs.191445 T86315 0.2468 1343 1 1 Ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin) RNASE2 Hs.728 W81465 0.267 1344 -1 1 Mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase MGAT1 Hs.151513 H16646 0.3109 1345 1 0.8 Hypothetical protein PP591 PP591 Hs.118666 H04610 0.3265 1345 1 0.73 Splicing factor 3a, subunit 1, 120kDa SF3A1 Hs.334691 R71650 0.2276 1346 1 0.87 MUM2 protein MUM2 Hs.24379 H77636 0.3186 1346 -1 0.73 CD68 antigen CD68 Hs.246381 N93056 0.2403 1347 -1 1 Mitochondrial ribosomal protein L14 MRPL14 Hs.343579 H21780 0.267 1347 1 0.87 Craniofacial development protein 1 CFDP1 Hs.296460 N/A2 0.3109 1347 1 0.73 - -- N43008 0.3265 1347 -1 0.87 Nuclear antigen Sp100 SP100 Hs.77617 N28734 0.3763 1348 1 0.87 Ring finger protein (C3H2C3 type) 6 RNF6 Hs.32597 N89606 0.274 1349 -1 0.93 Mitochondrial ribosomal protein S36 MRPS36 Hs.41182 N99927 0.2811 1349 -1 0.87 Beta-1,4 mannosyltransferase HMT-1 Hs.44592 H01598 0.1665 1350 1 1 Translocating chain-associating membrane protein TRAM Hs.4147 AA045130 0.2884 1351 1 0.93 Hypothetical protein FLJ10761 FLJ10761 Hs.343154 AA032065 0.2096 1352 -1 1 Hypothetical protein BC002942 BC002942 Hs.150540 AA045904 0.2403 1352 1 0.8 6-pyruvoyltetrahydropterin synthase PTS Hs.366 R60986 0.3426 1353 -1 0.8 - - Hs.348282 H85213 0.3109 1354 1 0.87 - - Hs.30909 W67427 0.2339 1355 1 1 Prolylcarboxypeptidase (angiotensinase C) PRCP Hs.75693 T88721 0.2602 1355 1 0.93 Epithelial membrane protein 2 EMP2 Hs.29191 W31584 0.3186 1355 -1 0.93 Hypothetical protein MGC3251 MGC3251 Hs.13467 H79855 0.3677 1355 -1 0.73 Translational inhibitor protein p14.5 UK114 Hs.18426 H86793 0.3032 1356 1 0.8 - - Hs.81376 AA099685 0.3265 1356 1 0.8 Progesterone-induced blocking factor 1 PIBF1 Hs.43913 W90281 0.44 1356 -1 0.47 Sprouty homolog 2 (Drosophila) SPRY2 Hs.18676 H28453 0.2038 1357 1 0.87 Hypothetical protein MGC4840 MGC4840 Hs.301872 H02889 0.3345 1357 1 0.73 Inositol(myo)-1(or 4)-monophosphatase 1 IMPA1 Hs.171776 AA047412 0.3763 1357 -1 0.67 Zinc finger protein 23 (KOX 16) ZNF23 Hs.55606 H05011 0.2468 1358 1 1 - -- N43819 0.2534 1358 -1 0.93 KIAA0036 gene product KIAA0036 Hs.169387 H71737 0.2811 1358 1 0.8 - -- AA054731 0.412 1358 1 0.6 Hypothetical protein BC014942 LOC89941 Hs.21497 R83448 0.1981 1359 1 0.93 - - Hs.331666 H16789 0.2884 1361 1 0.93 CGI-152 protein CGI-152 Hs.9275 R18841 0.267 1363 1 1 Neurotrimin HNT Hs.288433 AA129720 0.274 1365 -1 0.93 - - Hs.286241 R80979 0.2602 1366 1 0.8 Mitogen-activated protein kinase kinase kinase 11 MAP3K11 Hs.89449 AA046321 0.3508 1366 -1 0.87 Utrophin (homologous to dystrophin) UTRN Hs.286161 N95578 0.1981 1367 -1 0.93 - - Hs.5855 R48937 0.5734 1367 -1 0.4 - - Hs.334606 N34679 0.267 1368 -1 0.93 - - Hs.9042 R43033 0.3426 1368 -1 0.87 - - Hs.374352 H52714 0.3763 1368 1 0.73 Ubinuclein 1 UBN1 Hs.21479 T94859 0.2958 1370 1 1 Ring finger protein 10 RNF10 Hs.5094 AA056558 0.2602 1371 -1 0.87 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608 T65437 0.3677 1371 1 0.8 R3H domain (binds single-stranded nucleic acids) containing R3HDM Hs.268053 R92012 0.2958 1372 1 0.87 Death-associated protein DAP Hs.75189 T98946 0.2534 1374 -1 1 Hypothetical protein FLJ12707 FLJ12707 Hs.16157 T56959 0.2958 1374 -1 1 Hypothetical protein FLJ12525 FLJ12525 Hs.321618 W37346 0.3426 1374 -1 0.67 DIPB protein HSA249128 Hs.14512 R22413 0.2403 1376 1 0.73 Protein phosphatase 1, regulatory (inhibitor) subunit 14B PPP1R14B Hs.100623 AA055170 0.3426 1376 -1 0.87 - - Hs.265891 W15457 0.3508 1377 -1 0.67 HSPC067 protein HSPC067 Hs.279938 N95603 0.3265 1379 -1 0.8 Excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum g ERCC3 Hs.77929 N67477 0.3426 1379 -1 0.93 - - Hs.281561 R63806 0.3032 1381 -1 0.8 Likely ortholog of mouse heat shock protein, 70 kDa 4 LOC51182 Hs.44581 H13832 0.4306 1381 1 0.67 Hypothetical protein FLJ10404 FLJ10404 Hs.111279 N74404 0.2339 1382 -1 0.87 - - Hs.38516 R46284 0.2534 1383 1 0.8 Lipase, hormone-sensitive LIPE Hs.95351 N51128 0.2602 1383 1 0.87 Inositol hexaphosphate kinase 2 IHPK2 Hs.323432 H57367 0.274 1383 1 0.83 - - Hs.335274 T81338 0.2468 1385 1 0.93 Trans-golgi network protein 2 TGOLN2 Hs.14894 AA036809 0.3109 1386 -1 0.8 - - Hs.188826 R12879 0.3109 1386 1 0.93 KIAA1336 protein KIAA1336 Hs.145365 H02290 0.2468 1387 1 1 SEC10-like 1 (S. cerevisiae) SEC10L1 Hs.29494 H62252 0.3345 1388 1 0.93 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 ALS2CR2 Hs.5771 H80753 0.3508 1388 -1 0.93 Chromodomain helicase DNA binding protein 1 CHD1 Hs.22670 R22236 0.3763 1388 -1 0.6 KIAA0336 gene product KIAA0336 Hs.278671 H80258 0.2468 1389 -1 0.93 - - Hs.41352 AA203338 0.3032 1389 -1 0.87 Hypothetical SBBI03 protein SBB103 Hs.153639 T94898 0.2884 1390 -1 0.87 Hypothetical protein SP192 SP192 Hs.169854 N51465 0.2038 1391 1 1 ESTs ESTs Hs.46476 AA115514 0.3939 1393 -1 0.8 MAX interacting protein 1 MXI1 Hs.118630 N27866 0.4791 1393 -1 0.6 Pp21 homolog LOC51186 Hs.15984 AA039246 0.2038 1394 -1 1 Transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) TLE2 Hs.332173 R50526 0.267 1394 1 0.87 - -- R50558 0.2958 1394 -1 0.87 Transposon-derived Buster1 transposase-like protein LOC58486 Hs.25726 R18790 0.3345 1395 1 0.8 - -- R54424 0.3426 1396 1 0.87 Glutamate dehydrogenase 1 GLUD1 Hs.77508 H37983 0.2958 1397 1 0.87 Sphingomyelin phosphodiesterase 1, acid lysosomal (acid sphingomyelinase) SMPD1 Hs.77813 N21227 0.2602 1398 -1 1 Brain protein I3 BRI3 Hs.75922 R26005 0.2884 1400 1 0.8 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa NDUFB7 Hs.661 AA131280 0.3032 1400 1 0.87 B-cell CLL/lymphoma 6 (zinc finger protein 51) BCL6 Hs.155024 H99570 0.3265 1400 1 0.8 ESTs ESTs Hs.337736 W55924 0.3426 1401 -1 0.87 - - Hs.35962 R66029 0.3109 1402 1 0.77 Bromodomain adjacent to zinc finger domain, 1A BAZ1A Hs.8858 H58340 0.3345 1402 1 0.6 RNA binding motif protein 10 RBM10 Hs.154583 AA043774 0.44 1402 -1 0.8 Programmed cell death 5 PDCD5 Hs.166468 H78385 0.5199 1402 1 0.57 Huntingtin interacting protein 2 HIP2 Hs.155485 T88813 0.274 1403 1 0.93 Hypothetical protein PRO1855 PRO1855 Hs.283558 AA045048 0.2534 1404 1 1 Sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytopSEMA5B Hs.61384 H89477 0.2811 1404 -1 1 Cyclin D3 CCND3 Hs.83173 AA122364 0.2958 1404 -1 0.83 Receptor tyrosine kinase-like orphan receptor 2 ROR2 Hs.155585 N74699 0.2534 1405 -1 0.93 Malonyl-CoA decarboxylase MLYCD Hs.150748 H87386 0.2096 1406 1 1 Hypothetical protein FLJ11362 FLJ11362 Hs.8929 H03878 0.3763 1406 1 0.8 Eukaryotic translation initiation factor 4 gamma, 2 EIF4G2 Hs.183684 R88505 0.3345 1407 1 0.73 Serine arginine-rich pre-mRNA splicing factor SR-A1 SR-A1 Hs.103521 R55896 0.3677 1408 -1 0.73 - -- R59415 0.3508 1409 1 0.6 - -- W04736 0.2602 1410 1 0.93 Hypothetical protein MGC40107 MGC40107 Hs.94316 R74573 0.267 1410 1 0.87 Male-specific lethal 3-like 1 (Drosophila) MSL3L1 Hs.88764 R88122 0.2811 1410 -1 0.87 Pericentriolar material 1 PCM1 Hs.75737 N20843 0.3592 1410 -1 0.87 - -- R94499 0.44 1410 1 0.6 Guanine nucleotide binding protein (G protein), beta 5 GNB5 Hs.155090 N99001 0.3032 1411 1 0.87 BCL2-associated athanogene 2 BAG2 Hs.55220 R32376 0.3345 1411 1 0.67 Syntaxin 3A STX3A Hs.82240 R41834 0.2215 1413 1 1 KIAA1116 protein KIAA1116 Hs.227602 AA054080 0.3939 1414 1 0.8 Zinc finger protein 36, C3H type, homolog (mouse) ZFP36 Hs.343586 R73484 0.5199 1414 1 0.53 Similar to CG9886 gene product LOC132158 Hs.109414 N27178 0.2534 1416 1 1 T-box 3 (ulnar mammary syndrome) TBX3 Hs.267182 T97968 0.2884 1417 1 0.93 ESTs ESTs Hs.325159 AA055989 0.3345 1417 1 0.67 - - Hs.285050 AA056593 0.3677 1417 -1 0.73 KIAA0063 gene product KIAA0063 Hs.3094 AA054570 0.2215 1418 -1 0.93 Apolipoprotein E APOE Hs.169401 W93404 0.2602 1418 1 1 Mitotic spindle coiled-coil related protein DEEPEST Hs.16244 H01923 0.3032 1418 1 0.93 HSPC019 protein HSPC019 Hs.163724 R20374 0.4029 1419 -1 0.6 Chromatin assembly factor 1, subunit B (p60) CHAF1B Hs.75238 R37843 0.2811 1421 1 0.93 Mannosidase, alpha, class 1A, member 1 MAN1A1 Hs.25253 AA043196 0.274 1422 1 0.93 Hypothetical protein FLJ10450 FLJ10450 Hs.267604 T71262 0.385 1422 -1 0.9 Neuron navigator 2 NAV2 Hs.23467 AA053145 0.3265 1423 -1 0.87 Coronin, actin binding protein, 1C CORO1C Hs.17377 R69062 0.3592 1423 1 0.87 Lipidosin BG1 Hs.277543 R92869 0.6641 1425 -1 0.4 - - Hs.356340 N20900 0.4212 1427 -1 0.47 ESTs ESTs Hs.32163 H61387 0.274 1428 -1 0.87 Reticulon 4 receptor RTN4R Hs.30868 N58514 0.3032 1428 -1 0.8 Mitochondrial Acyl-CoA Thioesterase MT-ACT48 Hs.18625 R13813 0.2215 1429 1 0.93 Growth factor receptor-bound protein 2 GRB2 Hs.381152 R37680 0.274 1429 1 1 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1 ADPRTL1 Hs.77225 W15594 0.3677 1429 -1 0.67 Hypothetical protein FLJ20811 FLJ20811 Hs.83530 R32834 0.412 1429 1 0.73 CLLL7 protein FLJ10716 Hs.24129 R25217 0.3426 1430 -1 0.87 Surfeit 6 SURF6 Hs.274430 N25620 0.3186 1431 -1 0.8 Midline 1 (Opitz/BBB syndrome) MID1 Hs.27695 R32270 0.3265 1431 1 0.9 Epithelial membrane protein 2 EMP2 Hs.29191 N75350 0.2096 1432 -1 0.93 Gastrin-releasing peptide GRP Hs.1473 W47031 0.2468 1433 -1 0.87 Hypothetical protein LOC51241 LOC51241 Hs.171566 T39578 0.2155 1434 -1 1 Mitochondrial ribosomal protein S18C MRPS18C Hs.3385 AA028124 0.2339 1435 -1 0.93 - - Hs.61472 N30724 0.44 1435 1 0.47 - - Hs.350364 T96990 0.3939 1436 -1 0.67 Ubiquitination factor E4B (UFD2 homolog, yeast) UBE4B Hs.24594 AA203496 0.4496 1436 1 0.5 - - Hs.20818 R23917 0.3265 1437 -1 0.8 Three prime repair exonuclease 1 TREX1 Hs.278408 H16888 0.44 1437 -1 0.67 Protein-L-isoaspartate (D-aspartate) O-methyltransferase PCMT1 Hs.79137 AA036953 0.385 1438 -1 0.67 Growth arrest and DNA-damage-inducible, alpha GADD45A Hs.80409 N35002 0.2155 1439 -1 1 Dom-3 homolog Z (C. elegans) DOM3Z Hs.153299 AA005168 0.2884 1439 1 0.87 Zinc finger protein 7 (KOX 4, clone HF.16) ZNF7 Hs.2076 AA101713 0.4306 1439 1 0.73 - - Hs.19215 AA142965 0.4496 1439 1 0.47 Protein kinase C binding protein 1 PRKCBP1 Hs.75871 N58114 0.3508 1441 -1 0.8 E2F transcription factor 4, p107/p130-binding E2F4 Hs.108371 AA114891 0.3508 1441 -1 0.8 Syndecan 2 (heparan sulfate proteoglycan 1, cell surface-associated, fibroglycan) SDC2 Hs.1501 H88485 0.4593 1441 -1 0.73 - - Hs.108806 R65766 0.3265 1443 -1 0.93 SEC22 vesicle trafficking protein-like 1 (S. cerevisiae) SEC22L1 Hs.50785 N31931 0.3592 1443 -1 0.67 - -- AA037517 0.3592 1445 -1 0.73 Chromosome 20 open reading frame 13 C20orf13 Hs.88367 R79688 0.2958 1446 1 0.93 - -- AA046075 0.3265 1446 -1 0.93 - - Hs.88845 T75394 0.3265 1447 -1 1 Eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa EIF2B3 Hs.283627 W45178 0.3345 1447 -1 0.87 DIP13 beta DIP13B Hs.107882 AA045241 0.2215 1448 -1 1 Hypothetical protein FLJ12118 FLJ12118 Hs.381043 H16519 0.2958 1448 -1 0.8 Dolichyl-diphosphooligosaccharide-protein glycosyltransferase DDOST Hs.34789 AA128271 0.3426 1448 -1 0.83 Regulatory factor X, 5 (influences HLA class II expression) RFX5 Hs.166891 H15122 0.4496 1448 -1 0.43 Sex comb on midleg homolog 1 SCMH1 Hs.57475 R19114 0.3032 1449 1 0.73 ESTs ESTs Hs.22634 H71745 0.4212 1449 1 0.7 Proteasome (prosome, macropain) 26S subunit, ATPase, 4 PSMC4 Hs.211594 R01140 0.2602 1451 1 0.93 Heat shock 90kDa protein 1, alpha HSPCA Hs.289088 H50945 0.3345 1451 1 0.93 Proteasome (prosome, macropain) subunit, beta type, 5 PSMB5 Hs.78596 N66473 0.4593 1451 -1 0.53 - - Hs.249247 H02832 0.267 1452 -1 1 Hypothetical protein FLJ23476 FLJ23476 Hs.46736 T81285 0.3032 1452 1 0.93 Phosphofructokinase, liver PFKL Hs.155455 N50375 0.3763 1452 -1 0.6 Activated RNA polymerase II transcription cofactor 4 PC4 Hs.349506 R10734 0.4212 1452 1 0.6 - -- N79532 0.3345 1453 -1 0.93 - - Hs.378235 N79517 0.3032 1455 -1 0.87 Fibrinogen, gamma polypeptide FGG Hs.75431 N75516 0.3763 1455 1 0.67 KIAA1096 protein KIAA1096 Hs.69559 R39199 0.4593 1455 -1 0.4 Notch homolog 2 (Drosophila) NOTCH2 Hs.8121 N45664 0.2958 1456 -1 0.67 Putative Rab5 GDP/GTP exchange factor homologue RABEX5 Hs.187660 N93335 0.3032 1457 1 0.87 DKFZP566C243 protein DKFZP566C243Hs.107747 R24964 0.3508 1457 1 0.87 ESTs ESTs Hs.23766 R43107 0.4496 1457 1 0.53 Hypothetical protein FLJ10450 FLJ10450 Hs.267604 R83815 0.2403 1458 -1 1 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919 W81586 0.2339 1459 -1 0.93 Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog FGR Hs.1422 W78859 0.3677 1459 1 0.73 Emopamil binding related protein, delta8-delta7 sterol isomerase related protein EBRP Hs.298490 R20594 0.3265 1461 1 0.87 Glutathione S-transferase M4 GSTM4 Hs.348387 H56686 0.385 1464 1 0.6 Serine/arginine repetitive matrix 1 SRRM1 Hs.18192 W44956 0.267 1465 1 1 2,4-dienoyl CoA reductase 1, mitochondrial DECR1 Hs.81548 AA043297 0.385 1465 -1 0.73 Vacuolar protein sorting 45A (yeast) VPS45A Hs.6650 H43746 0.3592 1466 -1 0.73 Hypothetical protein DKFZp761F0118 DKFZp761F0118Hs.6685 N29775 0.3677 1466 1 0.77 Small fragment nuclease DKFZP566E144 Hs.7527 AA005109 0.4029 1467 1 0.7 Oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) OGDH Hs.168669 R39701 0.3265 1468 1 0.67 - -- N22081 0.3508 1468 -1 0.87 PC4 and SFRS1 interacting protein 2 PSIP2 Hs.82110 H09093 0.3763 1470 1 0.8 Gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) GGH Hs.78619 W60709 0.2811 1471 1 1 C-terminal modulator protein CTMP Hs.293691 AA053903 0.2276 1473 -1 0.93 KIAA0826 protein KIAA0826 Hs.169600 H48501 0.2958 1473 1 0.93 SCN Circadian Oscillatory Protein (SCOP) SCOP Hs.38176 T79037 0.3032 1473 1 0.93 - -- H51834 0.2958 1474 -1 0.93 Tetratricopeptide repeat domain 1 TTC1 Hs.7733 R23473 0.2884 1475 1 0.87 Hypothetical protein FLJ20624 FLJ20624 Hs.52256 H50875 0.3186 1475 -1 1 Hepatocyte nuclear factor 3, gamma HNF3G Hs.36137 N75841 0.3677 1476 -1 0.87 H1 histone family, member 2 H1F2 Hs.7644 H53969 0.2468 1477 1 1 Clone FLB5214 LOC51219 Hs.5486 N74995 0.2811 1477 -1 0.9 RAB35, member RAS oncogene family RAB35 Hs.94308 N95400 0.3032 1477 -1 0.93 DKFZP564G2022 protein DKFZP564G202Hs.16492 T89586 0.3508 1480 1 0.67 - -- R19063 0.5844 1481 1 0.43 - -- H21648 0.385 1482 1 0.73 - - Hs.31834 AA040087 0.2811 1483 -1 1 Collagen, type IV, alpha 3 (Goodpasture antigen) binding protein COL4A3BP Hs.21276 W04542 0.3109 1484 -1 0.87 Hepatocellular carcinoma-associated protein HCA4 HCA4 Hs.94011 H16689 0.3186 1484 -1 0.8 RNA binding motif protein 8A RBM8A Hs.10283 N69904 0.3939 1484 -1 0.73 Nuclear receptor coactivator 5 NCOA5 Hs.288140 H38361 0.4029 1485 1 0.73 Vacuolar protein sorting 16 (yeast) VPS16 Hs.302441 R62540 0.3265 1486 -1 0.8 ATPase, Cu++ transporting, beta polypeptide (Wilson disease) ATP7B Hs.84999 AA161069 0.3677 1486 -1 0.87 E1B-55kDa-associated protein 5 E1B-AP5 Hs.155218 H38322 0.541 1487 1 0.33 SET binding factor 1 SBF1 Hs.112049 AA156433 0.2811 1488 -1 0.87 ESTs ESTs Hs.103864 AA132068 0.3763 1490 -1 0.67 - - Hs.352381 R87919 0.2403 1491 1 1 KIAA0370 protein KIAA0370 Hs.70500 H05011 0.3345 1492 1 0.8 - -- H89995 0.3677 1492 -1 0.87 - -- N49728 0.2958 1493 1 0.87 KIAA0916 protein KIAA0916 Hs.151411 AA120840 0.3763 1494 -1 0.67 ESTs ESTs Hs.323473 R46208 0.4891 1494 1 0.57 PL6 protein PL6 Hs.91566 W69156 0.4212 1495 1 0.67 KIAA0095 gene product KIAA0095 Hs.155314 N31849 0.3345 1496 1 0.93 - - Hs.282895 N31589 0.3592 1496 -1 0.67 Type I sigma receptor SR-BP1 Hs.24447 AA194139 0.2534 1497 -1 1 C-Mpl binding protein LOC113251 Hs.26613 AA033787 0.2884 1497 -1 0.87 G protein-coupled receptor 108 GPR108 Hs.167641 N78857 0.3109 1498 1 0.93 - - Hs.82171 N25253 0.3265 1498 -1 0.73 Chromosome 5 open reading frame 8 C5orf8 Hs.75864 R06442 0.3508 1499 1 0.73 TP53 target gene 1 TP53TG1 Hs.274329 H67560 0.2403 1500 -1 1 Chaperonin containing TCP1, subunit 8 (theta) CCT8 Hs.15071 N42803 0.3032 1500 -1 0.73 - - Hs.356063 H55916 0.3345 1500 -1 0.8 Peptidylprolyl isomerase F (cyclophilin F) PPIF Hs.173125 N80289 0.2534 1501 -1 0.87 ORM1-like 2 (S. cerevisiae) ORMDL2 Hs.13144 N47737 0.2534 1501 -1 1 ESTs ESTs Hs.41272 R20590 0.2884 1501 -1 0.8 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ABCC4 Hs.139336 N20259 0.3426 1501 -1 0.8 Hypothetical protein MGC2840 similar to a putative glucosyltransferase MGC2840 Hs.155356 R13117 0.6409 1501 1 0.43 - - Hs.348516 N62283 0.2884 1502 1 0.87 Translocating chain-associating membrane protein TRAM Hs.4147 N64621 0.3109 1503 -1 0.8 Regulator of G-protein signalling 19 interacting protein 1 RGS19IP1 Hs.6454 R72445 0.2602 1504 -1 0.87 Sarcospan (Kras oncogene-associated gene) SSPN Hs.183428 AA033710 0.3508 1505 -1 0.93 - - Hs.351928 H57284 0.2602 1507 -1 0.8 Neural precursor cell expressed, developmentally down-regulated 5 NEDD5 Hs.155595 AA063580 0.4029 1508 -1 0.57 TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa TAF7 Hs.155188 R69288 0.5734 1508 1 0.4 ESTs ESTs Hs.268693 R17839 0.2811 1509 1 0.93 Wolf-Hirschhorn syndrome candidate 2 WHSC2 Hs.21771 R84964 0.2602 1510 -1 0.93 Hypothetical protein FLJ22127 FLJ22127 Hs.59457 AA151396 0.267 1510 -1 0.93 Poly(A) binding protein, nuclear 1 PABPN1 Hs.117176 N99930 0.3426 1510 -1 0.67 BDG-29 proten BDG-29 Hs.81505 AA136882 0.4496 1510 -1 0.67 Activin A receptor, type I ACVR1 Hs.150402 N92594 0.4593 1510 1 0.67 S-adenosylmethionine decarboxylase 1 AMD1 Hs.262476 AA102111 0.385 1511 -1 0.7 Collagen, type XV, alpha 1 COL15A1 Hs.83164 W58375 0.3109 1512 -1 0.8 Solute carrier family 2 (facilitated glucose transporter), member 1 SLC2A1 Hs.169902 T78883 0.2602 1514 1 1 ESTs ESTs Hs.268596 H56572 0.4029 1514 1 0.8 Proteasome activator 200 kDa PA200 Hs.112396 N29439 0.3032 1515 -1 0.93 Sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) SGCD Hs.151899 N78582 0.4212 1515 -1 0.8 Protein kinase, AMP-activated, beta 2 non-catalytic subunit PRKAB2 Hs.50732 H20847 0.2276 1516 -1 1 KIAA0923 protein KIAA0923 Hs.22587 AA063424 0.3265 1516 -1 1 DKFZP586D0623 protein DKFZP586D062Hs.44468 H15642 0.3592 1516 1 0.73 - -- AA044180 0.3508 1517 -1 0.6 - - Hs.373497 W56402 0.385 1518 1 0.67 Musashi homolog 2 (Drosophila) MSI2 Hs.173179 R98516 0.385 1518 1 0.67 H2B histone family, member G H2BFG Hs.182137 R34439 0.4029 1518 1 0.87 - - Hs.290270 R17728 0.3186 1519 1 0.87 Molybdenum cofactor synthesis 3 MOCS3 Hs.159410 H77659 0.3345 1519 1 0.87 Tubulin, gamma 1 TUBG1 Hs.21635 AA151412 0.3032 1520 -1 1 - -- R39287 0.385 1520 1 0.87 Melanin-concentrating hormone receptor 1 interacting zinc-finger protein MIZIP Hs.128096 H75530 0.5199 1520 1 0.53 V-crk sarcoma virus CT10 oncogene homolog (avian) CRK Hs.343220 N29438 0.3032 1521 -1 0.93 Mitochondrial ribosomal protein L46 MRPL46 Hs.278328 R67235 0.3186 1521 1 0.87 HLA-B associated transcript 1 BAT1 Hs.55296 N20310 0.3345 1521 -1 0.93 - -- R50259 0.3763 1521 1 0.73 Protein kinase C-like 1 PRKCL1 Hs.2499 T81540 0.4791 1523 -1 0.53 Nucleoporin 62kDa NUP62 Hs.9877 N31736 0.2403 1524 -1 1 Hypothetical protein FLJ25211 FLJ25211 Hs.44269 H58642 0.3345 1524 1 0.87 Hypothetical protein FLJ23499 FLJ23499 Hs.17546 T81946 0.4593 1525 -1 0.6 - -- R72606 0.3763 1527 -1 0.8 Hypothetical protein FLJ20457 FLJ20457 Hs.29276 T95014 0.3939 1527 -1 0.73 Serine/threonine kinase 4 STK4 Hs.35140 H06274 0.4306 1527 1 0.67 Hypothetical protein MGC2508 MGC2508 Hs.11110 AA053901 0.4993 1527 -1 0.53 - - Hs.60740 R96472 0.3508 1528 -1 0.9 Hypothetical protein FLJ10276 FLJ10276 Hs.333149 AA203625 0.3592 1528 -1 0.73 Vacuolar protein sorting 4A (yeast) VPS4A Hs.234839 R24574 0.3592 1528 1 0.8 Chromosome 7 open reading frame 14 C7orf14 Hs.84790 H93264 0.274 1529 -1 1 - - Hs.283378 N72916 0.2811 1529 -1 1 Ubiquitin specific protease 12 USP12 Hs.42400 R38345 0.3677 1529 1 0.73 Transcriptional intermediary factor 1 TIF1 Hs.183858 R34626 0.7114 1529 -1 0.33 ESTs ESTs Hs.6795 AA004355 0.2534 1531 1 0.93 Mitochondrial ribosomal protein S31 MRPS31 Hs.154655 AA063161 0.3109 1531 1 0.87 - - Hs.181767 N21653 0.2811 1533 1 0.93 Synovial sarcoma translocation, chromosome 18 SS18 Hs.153221 H52061 0.3032 1533 1 0.87 Hypothetical protein FLJ22313 FLJ22313 Hs.30211 T81080 0.4029 1533 1 0.73 - -- N69431 0.3032 1534 -1 0.93 Hypothetical protein FLJ20699 FLJ20699 Hs.15125 N46199 0.3345 1534 1 0.87 Hypothetical protein DKFZp761N0624 DKFZp761N062 Hs.21893 R51348 0.3592 1534 1 0.87 - -- H18767 0.3592 1534 -1 0.57 - -- W86753 0.3265 1535 -1 0.93 Chemokine (C-X-C motif) ligand 16 CXCL16 Hs.82407 H77460 0.3508 1535 1 0.83 Lymphocyte adaptor protein LNK Hs.13131 R33946 0.412 1535 1 0.8 Quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase (carboxylating)) QPRT Hs.8935 H10026 0.3032 1536 1 0.8 Zinc finger protein 193 ZNF193 Hs.96448 R22188 0.3186 1536 1 0.87 - - Hs.356392 W85883 0.3939 1536 -1 0.67 Hypothetical protein FLJ10847 FLJ10847 Hs.48403 R34648 0.4212 1536 -1 0.6 Cell adhesion molecule with homology to L1CAM (close homolog of L1) CHL1 Hs.210863 W87404 0.2884 1537 1 0.93 Hypothetical protein FLJ10715 FLJ10715 Hs.58974 N21353 0.385 1537 -1 0.87 - -- N39320 0.5844 1539 -1 0.47 DKFZP564I052 protein DKFZP564I052 Hs.5364 R71145 0.4791 1540 -1 0.8 KIAA1577 protein KIAA1577 Hs.13913 H88566 0.3763 1542 -1 0.67 - -- H04220 0.3265 1543 1 0.87 - -- T85855 0.385 1544 1 0.8 Hypothetical protein FLJ10209 FLJ10209 Hs.58589 AA120761 0.2534 1548 1 0.93 E74-like factor 1 (ets domain transcription factor) ELF1 Hs.154365 H08969 0.3345 1548 1 0.8 Hypothetical protein FLJ12529 FLJ12529 Hs.169100 AA203544 0.3508 1548 -1 0.87 Ubiquitin-activating enzyme E1-like UBE1L Hs.16695 AA058318 0.3508 1548 1 0.73 Plastin 3 (T isoform) PLS3 Hs.4114 R60393 0.385 1548 -1 0.67 Makorin, ring finger protein, 2 MKRN2 Hs.279474 AA043249 0.2339 1550 1 1 ESTs ESTs Hs.275224 AA041350 0.4029 1550 -1 0.8 - - Hs.57847 T58690 0.3592 1551 -1 0.87 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39 DDX39 Hs.311609 R14063 0.4306 1551 1 0.8 Hypothetical protein DKFZp586M1819 DKFZp586M181Hs.355753 H84157 0.4791 1551 1 0.53 Bobby sox homolog (Drosophila) BBX Hs.35380 W46239 0.267 1552 1 0.87 Sprouty homolog 4 (Drosophila) SPRY4 Hs.381153 AA001139 0.4029 1552 -1 0.87 Zinc finger protein 274 ZNF274 Hs.83761 R14112 0.4212 1552 1 0.6 Cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1 CYP1A1 Hs.72912 AA045637 0.412 1553 -1 0.73 Ubiquinol-cytochrome c reductase (6.4kD) subunit UQCR Hs.8372 R83637 0.4496 1553 1 0.6 KIAA1204 protein KIAA1204 Hs.300670 AA057398 0.4212 1554 -1 0.63 - -- N59818 0.2884 1555 -1 0.8 Endocrine regulator HRIHFB2436 Hs.48433 R20231 0.3939 1555 1 0.87 Raptor raptor Hs.20677 R61634 0.3032 1556 1 0.93 Hypothetical protein PRO1855 PRO1855 Hs.283558 R35308 0.2958 1557 -1 0.93 HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae) HRMT1L1 Hs.235887 R68364 0.3032 1557 -1 1 - -- AA115202 0.3265 1557 -1 0.8 - - Hs.136061 R52949 0.2958 1558 1 0.87 - - Hs.25978 R17350 0.3032 1558 1 0.8 KIAA1387 protein KIAA1387 Hs.301434 R32925 0.2155 1559 1 1 - -- R83037 0.3265 1559 1 0.93 Hypothetical protein FLJ20008 FLJ20008 Hs.14235 N42979 0.2403 1560 -1 1 Sialyltransferase STHM Hs.288215 T95061 0.3265 1560 1 0.8 Matrix metalloproteinase 19 MMP19 Hs.154057 N93807 0.2811 1561 -1 0.8 - EST Hs.144224 T79317 0.412 1561 -1 0.73 ESTs ESTs Hs.302245 N42285 0.4212 1561 1 0.63 Lysosomal-associated membrane protein 1 LAMP1 Hs.150101 T86841 0.3345 1562 -1 0.93 - -- R39286 0.4993 1562 1 0.43 Citron (rho-interacting, serine/threonine kinase 21) CIT Hs.15767 N59347 0.5517 1563 1 0.53 Hypothetical protein MGC9344 MGC9344 Hs.84131 W73595 0.3109 1564 -1 0.93 Spondin 2, extracellular matrix protein SPON2 Hs.288126 W31684 0.3592 1564 -1 0.87 Hypothetical protein FLJ34969 FLJ34969 Hs.373580 W67895 0.2403 1565 -1 1 Small EDRK-rich factor 1A (telomeric) SERF1A Hs.32567 W94646 0.3763 1565 -1 0.87 Integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) ITGAE Hs.851 AA099154 0.412 1566 -1 0.67 Cell division cycle 34 CDC34 Hs.76932 T94585 0.2958 1567 -1 0.87 - - Hs.116691 N90076 0.2468 1569 1 0.87 Exostoses (multiple)-like 2 EXTL2 Hs.61152 AA037624 0.3032 1569 1 0.93 Hypothetical protein MGC5242 MGC5242 Hs.77365 H70975 0.3426 1569 -1 0.8 - -- R64592 0.3508 1569 1 0.8 - -- N79524 0.5517 1569 -1 0.47 Zinc finger protein, subfamily 2A (FYVE domain containing), 1 ZNFN2A1 Hs.20047 H13889 0.2958 1574 -1 1 - - Hs.259347 H05378 0.3186 1576 -1 0.73 Down syndrome critical region gene 3 DSCR3 Hs.26146 R14308 0.3345 1576 1 0.93 - - Hs.107242 AA099226 0.4306 1577 -1 0.53 - - Hs.356377 R24577 0.3939 1578 -1 0.8 Arginine-glutamic acid dipeptide (RE) repeats RERE Hs.194369 T85465 0.267 1579 1 1 ESTs ESTs Hs.268613 T75200 0.3186 1579 1 0.87 Hypothetical protein FLJ14566 FLJ14566 Hs.12313 R18621 0.2958 1581 -1 0.93 - -- R32829 0.3032 1581 1 0.87 KIAA1327 protein KIAA1327 Hs.106204 T84135 0.3592 1581 1 0.93 Cytochrome b5 outer mitochondrial membrane precursor CYB5-M Hs.381218 R64299 0.2884 1582 1 0.93 ESTs ESTs Hs.28507 T77389 0.3032 1582 -1 0.93 Leiomodin 1 (smooth muscle) LMOD1 Hs.79386 T71625 0.3592 1582 1 0.87 - -- N25228 0.4496 1582 1 0.67 Heparan sulfate 2-O-sulfotransferase 1 HS2ST1 Hs.169939 R72275 0.5199 1582 1 0.53 Dolichyl-p-mannose:Man7GlcNAc2-PP-dolichyl mannosyltransferase ALG12 Hs.77575 N27544 0.5517 1582 -1 0.33 Cell division cycle 27 CDC27 Hs.172405 R47758 0.4496 1583 -1 0.53 Hypothetical protein MGC2721 MGC2721 Hs.76084 H09104 0.4891 1583 1 0.73 Syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic component) SNTA1 Hs.31121 AA045266 0.3265 1585 -1 0.8 Thymopoietin TMPO Hs.11355 N59677 0.3265 1585 -1 0.9 Proteasome (prosome, macropain) subunit, alpha type, 7 PSMA7 Hs.233952 T90893 0.44 1586 -1 0.6 Rab geranylgeranyltransferase, beta subunit RABGGTB Hs.78948 W68697 0.2958 1587 -1 0.87 Hypothetical protein FLJ10998 FLJ10998 Hs.78110 R98517 0.4212 1587 -1 0.67 H1 histone family, member 2 H1F2 Hs.7644 H11708 0.4306 1587 1 0.73 Mitogen-activated protein kinase kinase 4 MAP2K4 Hs.75217 N66246 0.3109 1589 -1 0.93 Activating transcription factor 6 ATF6 Hs.5813 R71176 0.4029 1589 -1 0.83 Slingshot 3 SSH-3 Hs.29173 R80700 0.3677 1593 -1 0.87 - - Hs.25218 H84220 0.3032 1595 1 1 MIC2 like 1 MIC2L1 Hs.169388 W37617 0.3508 1595 -1 0.93 Transmembrane 7 superfamily member 1 (upregulated in kidney) TM7SF1 Hs.15791 H20342 0.6294 1595 1 0.67 - - Hs.173699 AA044646 0.6409 1595 1 0.4 HSPC126 protein HSPC126 Hs.181112 AA115948 0.3109 1596 -1 0.83 Collagen, type V, alpha 2 COL5A2 Hs.82985 N32560 0.4691 1596 -1 0.67 Forkhead box M1 FOXM1 Hs.239 AA043293 0.412 1597 -1 0.87 Hypothetical protein DT1P1A10 DT1P1A10 Hs.178207 W37533 0.4212 1598 -1 0.67 Hexokinase 1 HK1 Hs.118625 R81337 0.3032 1599 1 0.87 Colon carcinoma related protein LOC51159 Hs.30343 W02781 0.3939 1599 1 0.67 Chromosome 12 open reading frame 4 C12orf4 Hs.296198 H88577 0.3032 1601 -1 0.87 Heterogeneous nuclear ribonucleoprotein H1 (H) HNRPH1 Hs.245710 N25756 0.385 1601 -1 0.63 - -- H75344 0.4791 1601 -1 0.6 ESTs ESTs Hs.167614 H18154 0.3508 1603 1 0.8 RAB5B, member RAS oncogene family RAB5B Hs.77690 T97533 0.6876 1604 -1 0.47 ESTs ESTs Hs.193125 N64693 0.3345 1606 -1 0.8 ESTs ESTs Hs.132918 H45410 0.5625 1607 -1 0.67 Uveal autoantigen with coiled-coil domains and ankyrin repeats UACA Hs.49753 R71614 0.2811 1608 1 0.93 - - Hs.233354 H17513 0.3032 1608 1 0.93 Heat shock 70kDa protein 1-like HSPA1L Hs.80288 H39778 0.3763 1608 1 0.67 Hypothetical protein MGC11134 MGC11134 Hs.326586 N69014 0.3939 1608 1 0.6 SRY (sex determining region Y)-box 12 SOX12 Hs.43627 AA128582 0.4791 1610 -1 0.57 Translocase of inner mitochondrial membrane 44 homolog (yeast) TIMM44 Hs.123178 H25201 0.3508 1613 1 0.8 - -- N33086 0.44 1613 1 0.73 - -- R70779 0.3426 1614 1 0.87 - - Hs.352579 W88760 0.7722 1614 1 0.27 Calcium/calmodulin-dependent protein kinase (CaM kinase) II delta CAMK2D Hs.111460 W55890 0.4212 1615 -1 0.67 RNA processing factor 1 RPF1 Hs.287863 W21078 0.3939 1618 -1 0.73 Exosome component Rrp46 RRP46 Hs.283741 N90836 0.5199 1618 -1 0.47 Fragile X mental retardation 1 FMR1 Hs.89764 N75204 0.3345 1619 1 0.87 - - Hs.107410 H29484 0.3939 1619 1 0.87 Sjogren syndrome antigen B (autoantigen La) SSB Hs.83715 N29018 0.4029 1619 -1 0.87 - -- AA147647 0.3763 1621 1 0.63 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318 W87755 0.4029 1621 -1 0.87 ESTs ESTs Hs.269571 H84204 0.3345 1622 1 0.73 Protein phosphatase 1, catalytic subunit, beta isoform PPP1CB Hs.21537 H13694 0.385 1622 1 0.73 Sec15B protein SEC15B Hs.44175 R12039 0.2339 1623 1 0.87 Chromosome 21 open reading frame 108 C21orf108 Hs.18759 R27762 0.3592 1623 1 0.53 CGI-141 protein LOC51026 Hs.62275 N33169 0.4496 1623 1 0.73 GPAA1P anchor attachment protein 1 homolog (yeast) GPAA1 Hs.4742 W42543 0.5955 1623 -1 0.27 Hexosaminidase A (alpha polypeptide) HEXA Hs.119403 W74536 0.2276 1624 1 0.8 Advanced glycosylation end product-specific receptor AGER Hs.184 AA203681 0.3592 1624 1 0.73 ESTs ESTs Hs.293589 N73861 0.3592 1625 1 0.8 - -- N92376 0.3677 1625 -1 0.77 Hypothetical protein MGC23918 MGC23918 Hs.43773 AA040149 0.4891 1625 1 0.47 - - Hs.348989 T70324 0.4791 1626 -1 0.6 - - Hs.13179 AA040790 0.3508 1630 -1 0.6 - - Hs.356395 R61132 0.4891 1630 -1 0.67 KIAA0943 protein Apg4B Hs.352535 R20737 0.4993 1630 1 0.6 CDC23 (cell division cycle 23, yeast, homolog) CDC23 Hs.153546 W58007 0.5734 1630 1 0.6 KIAA0222 gene product KIAA0222 Hs.48450 N70291 0.3032 1634 -1 0.77 Apolipoprotein A-II APOA2 Hs.237658 AA193482 0.3186 1634 -1 0.8 Hypothetical protein FLJ12287 similar to semaphorins FLJ12287 Hs.7634 R32216 0.3592 1634 1 0.93 P53-induced protein PIGPC1 PIGPC1 Hs.303125 R76215 0.5625 1635 1 0.57 - - Hs.182723 AA121308 0.3677 1636 -1 0.87 TRNA isopentenylpyrophosphate transferase IPT Hs.356554 AA131584 0.3763 1636 1 0.83 DKFZP564O0463 protein DKFZP564O046Hs.273344 H53071 0.3508 1637 1 0.87 Phosphatidylserine decarboxylase PISD Hs.8128 AA148416 0.4691 1637 -1 0.47 Hypothetical protein FLJ14917 FLJ14917 Hs.154706 H10406 0.5517 1637 -1 0.4 Profilin 2 PFN2 Hs.91747 H38584 0.3109 1638 1 0.87 - -- W49707 0.44 1638 -1 0.6 Steroid receptor RNA activator 1 SRA1 Hs.32587 H27211 0.4496 1639 -1 0.73 Splicing factor 3a, subunit 2, 66kDa SF3A2 Hs.115232 AA044737 0.541 1639 -1 0.57 Flotillin 2 FLOT2 Hs.184488 T69784 0.3677 1640 1 0.8 Fragile X mental retardation, autosomal homolog 2 FXR2 Hs.52788 T79589 0.4593 1641 1 0.63 Transmembrane protease, serine 4 TMPRSS4 Hs.63325 W04602 0.4791 1641 -1 0.67 Hypothetical protein FLJ11807 FLJ11807 Hs.285813 AA044382 0.6067 1641 1 0.43 YY1 transcription factor YY1 Hs.97496 AA213820 0.3186 1642 1 0.93 - - Hs.256533 H29534 0.44 1642 -1 0.73 ESTs ESTs Hs.22248 W85813 0.4496 1642 1 0.53 Cleavage and polyadenylation specific factor 1, 160kDa CPSF1 Hs.83727 AA045469 0.3592 1643 1 0.87 Hypothetical protein FLJ20186 FLJ20186 Hs.62771 R12948 0.5304 1643 1 0.6 NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa NDUFV1 Hs.7744 AA036810 0.3677 1644 -1 0.8 LIM domains containing 1 LIMD1 Hs.48469 N39086 0.618 1644 1 0.43 Zinc finger protein AF020591 Hs.142634 AA055333 0.274 1646 -1 0.87 CCAAT/enhancer binding protein (C/EBP), gamma CEBPG Hs.2227 T97206 0.3677 1646 1 0.6 Hypothetical protein FLJ10747 FLJ10747 Hs.189782 N41933 0.385 1647 -1 0.8 KIAA0409 protein KIAA0409 Hs.5158 W04197 0.6294 1648 1 0.53 ESTs ESTs Hs.380239 W68273 0.412 1649 -1 0.67 CGI-18 protein LOC51008 Hs.121599 AA128278 0.3592 1650 1 0.8 KIAA0326 protein KIAA0326 Hs.301094 AA005395 0.3763 1650 -1 0.87 - - Hs.187564 H27593 0.4593 1651 -1 0.73 Socius SOC Hs.145061 R38155 0.3186 1652 1 0.9 - - Hs.351029 N52015 0.4212 1652 -1 0.67 ADP-ribosylation factor 4 ARF4 Hs.75290 AA142986 0.3426 1653 -1 0.67 Hypothetical protein FLJ11294 FLJ11294 Hs.107000 N47551 0.4029 1653 -1 0.63 - -- AA054552 0.3186 1655 -1 1 Chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) CXCL1 Hs.789 R73223 0.3677 1655 1 0.6 TGFB1-induced anti-apoptotic factor 1 TIAF1 Hs.75822 AA120759 0.3763 1656 -1 0.73 DnaJ (Hsp40) homolog, subfamily B, member 5 DNAJB5 Hs.237506 T84669 0.3939 1657 1 0.8 HP1-BP74 HP1-BP74 Hs.142442 AA150500 0.3426 1659 -1 0.87 Interferon stimulated gene 20kDa ISG20 Hs.183487 H77996 0.3677 1659 -1 0.8 KIAA1463 protein KIAA1463 Hs.21104 AA149177 0.3032 1660 -1 0.67 Autoantigen RCD-8 Hs.75682 W86803 0.3592 1660 1 0.77 Exostoses (multiple) 2 EXT2 Hs.75334 T81304 0.385 1660 -1 0.87 Similar to cyclin-E binding protein 1 (H. sapiens) MGC14386 Hs.14870 N35507 0.4306 1660 1 0.53 Oxysterol binding protein OSBP Hs.24734 AA121513 0.4029 1661 -1 0.73 KIAA0084 protein KIAA0084 Hs.79123 AA128311 0.4891 1661 -1 0.73 Peripheral myelin protein 22 PMP22 Hs.103724 AA131590 0.8849 1661 1 0.13 DiGeorge syndrome critical region gene 6-like DGCR6L Hs.347285 W87783 0.3186 1662 -1 0.87 REV1-like (yeast) REV1L Hs.110347 R02816 0.3508 1662 1 0.73 KIAA0790 protein KIAA0790 Hs.12002 AA148608 0.3763 1662 -1 0.67 - -- H81063 0.4593 1662 1 0.6 Citrate synthase CS Hs.239760 AA036758 0.274 1663 -1 0.93 S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) S100A4 Hs.81256 N42335 0.3508 1663 -1 0.87 Hypothetical protein FLJ20452 FLJ20452 Hs.351327 W40304 0.6294 1664 1 0.4 Apoptosis inhibitor 5 API5 Hs.227913 R60081 0.274 1665 1 1 - -- W84735 0.4791 1665 -1 0.6 Protein inhibitor of activated STAT3 PIAS3 Hs.76578 W74466 0.4496 1666 -1 0.73 Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) KRT10 Hs.99936 H07938 0.2811 1667 1 0.87 Hypothetical protein FLJ21044 similar to Rbig1 FLJ21044 Hs.25477 T80488 0.3345 1668 1 0.83 Suppressor of Ty 6 homolog (S. cerevisiae) SUPT6H Hs.12303 AA130235 0.3592 1670 1 0.9 Optic atrophy 1 (autosomal dominant) OPA1 Hs.147946 R56622 0.3763 1670 1 0.73 ESTs ESTs Hs.274728 R69611 0.3939 1670 -1 0.8 Karyopherin alpha 6 (importin alpha 7) KPNA6 Hs.301553 H37804 0.7477 1670 1 0.17 Glucose-6-phosphatase, transport (glucose-6-phosphate) protein 1 G6PT1 Hs.132760 H20147 0.3186 1671 1 1 Chromosome 20 open reading frame 154 C20orf154 Hs.88959 AA121547 0.412 1671 -1 0.67 IMP (inosine monophosphate) dehydrogenase 2 IMPDH2 Hs.75432 H67348 0.3426 1674 -1 0.8 - - Hs.61976 R51281 0.3939 1675 1 0.73 Anaphase-promoting complex 1; meiotic checkpoint regulator MCPR Hs.40137 R35167 0.4791 1675 -1 0.67 BAI1-associated protein 2 BAIAP2 Hs.7936 AA042830 0.4993 1675 -1 0.73 Lymphocyte-specific protein 1 LSP1 Hs.56729 AA033813 0.4691 1677 -1 0.6 Chromatin assembly factor 1, subunit A (p150) CHAF1A Hs.79018 H26570 0.385 1678 -1 0.77 V-akt murine thymoma viral oncogene homolog 2 AKT2 Hs.326445 W05406 0.385 1679 -1 0.87 Phosphatidylinositol glycan, class K PIGK Hs.62187 N90061 0.3592 1680 -1 0.8 Sulfotransferase, estrogen-preferring STE Hs.54576 R13125 0.4029 1680 1 0.67 Similar to CG4995 gene product LOC153328 Hs.129539 T87787 0.618 1680 1 0.53 Crumbs homolog 1 (Drosophila) CRB1 Hs.169745 N20172 0.2958 1681 -1 0.93 Tumor protein p53 binding protein, 2 TP53BP2 Hs.44585 H14087 0.3508 1681 -1 0.83 LDL receptor adaptor protein ARH Hs.184482 R76349 0.541 1682 1 0.67 Ran binding protein 11 LOC51194 Hs.13109 R42777 0.3508 1683 1 0.8 - - Hs.22216 N92276 0.3763 1683 1 0.73 Chromosome 4 open reading frame 1 C4orf1 Hs.270956 W68408 0.4212 1683 -1 0.8 24-dehydrocholesterol reductase DHCR24 Hs.75616 W15429 0.3109 1686 -1 0.83 - - Hs.102951 H80740 0.3426 1687 1 1 Phosphofructokinase, muscle PFKM Hs.75160 R87411 0.274 1690 1 0.87 Growth arrest-specific 7 GAS7 Hs.226133 R44852 0.3592 1690 -1 0.87 ESTs ESTs Hs.3737 N31725 0.3677 1690 -1 0.8 TRAF family member-associated NFKB activator TANK Hs.146847 AA029012 0.4593 1690 1 0.73 SMA3 SMA3 Hs.289061 AA054119 0.6524 1690 1 0.47 - - Hs.31835 AA029564 0.2884 1691 -1 1 Component of oligomeric golgi complex 2 COG2 Hs.82399 AA045672 0.3345 1691 -1 0.93 LIM domain protein RIL Hs.79691 W31480 0.5734 1692 -1 0.53 Coiled-coil protein BICD2 BICD2 Hs.330988 N90939 0.4029 1694 1 0.73 Major histocompatibility complex, class II, DR alpha HLA-DRA Hs.76807 R23871 0.4212 1694 1 0.6 Poly(rC) binding protein 1 PCBP1 Hs.2853 R77690 0.3939 1695 1 0.67 Epidermal growth factor receptor pathway substrate 8-related protein 1 EPS8R1 Hs.28907 W02086 0.6524 1695 -1 0.3 Sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) SMPD2 Hs.55235 T94382 0.4593 1696 -1 0.73 - -- N36861 0.3345 1697 -1 0.8 ESTs ESTs Hs.42344 W52113 0.3592 1697 -1 0.8 - - Hs.106510 N64399 0.412 1697 1 0.8 Oxysterol binding protein-like 1A OSBPL1A Hs.252716 AA142968 0.6294 1698 -1 0.4 NS1-associated protein 1 NSAP1 Hs.46801 AA029530 0.44 1699 -1 0.6 Hypothetical protein FLJ20005 FLJ20005 Hs.184634 W78711 0.44 1699 -1 0.47 - - Hs.110069 R83313 0.3763 1700 1 0.9 Polymerase (RNA) II (DNA directed) polypeptide A, 220kDa POLR2A Hs.171880 W68622 0.44 1700 1 0.73 Coatomer protein complex, subunit alpha COPA Hs.75887 N59616 0.6524 1700 1 0.2 Hypothetical protein FLJ11274 FLJ11274 Hs.18104 W68588 0.3592 1701 -1 0.87 Collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant and recessive) COL7A1 Hs.1640 N41517 0.4593 1701 1 0.67 Aminoacylase 1 ACY1 Hs.334707 R14363 0.5517 1701 1 0.4 Histone deacetylase 5 HDAC5 Hs.9028 N80149 0.8596 1701 -1 0.13 - - Hs.323017 AA135667 0.44 1702 1 0.67 Early development regulator 2 (polyhomeotic 2 homolog) EDR2 Hs.165263 W48584 0.2534 1703 1 0.93 Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II P4HA2 Hs.3622 R61879 0.3109 1703 -1 0.93 - -- H24894 0.4691 1703 -1 0.73 - -- R25698 0.5844 1704 1 0.6 - -- AA029590 0.3939 1705 -1 0.73 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) NHP2L1 Hs.182255 N34887 0.541 1706 1 0.4 Ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, Angelman syndrome) UBE3A Hs.180686 H03425 0.3939 1707 -1 0.87 Alpha-1-microglobulin/bikunin precursor AMBP Hs.76177 H78287 0.3592 1709 -1 0.9 Myosin ID MYO1D Hs.39871 AA128825 0.4691 1709 -1 0.67 Arylsulfatase B ARSB Hs.1256 H28105 0.4993 1709 1 0.47 Small nuclear ribonucleoprotein polypeptide N SNRPN Hs.48375 R06577 0.3265 1710 1 0.87 Deltex homolog 2 (Drosophila) DTX2 Hs.89135 H98718 0.3939 1710 -1 0.8 - - Hs.12460 N52232 0.4496 1710 -1 0.73 NEDD8 ultimate buster-1 LOC51667 Hs.279780 W69323 0.3508 1711 -1 0.93 - -- W23819 0.3592 1712 -1 0.73 Hypothetical protein FLJ11305 FLJ11305 Hs.7049 AA053311 0.44 1712 -1 0.67 KIAA0233 gene product KIAA0233 Hs.79077 R72787 0.4791 1712 1 0.6 Immunoglobulin heavy constant mu IGHM Hs.153261 W31443 0.3265 1713 -1 0.77 Hypothetical protein MGC14433 MGC14433 Hs.83572 N27463 0.3265 1715 -1 0.9 CCAAT-box-binding transcription factor CBF2 Hs.184760 AA114905 0.5096 1715 -1 0.67 Sperm associated antigen 7 SPAG7 Hs.90436 AA151232 0.5955 1715 -1 0.37 Hypothetical protein MGC15677 MGC15677 Hs.71941 W38731 0.385 1716 -1 0.87 - -- W92898 0.4306 1716 -1 0.53 RAE1 RNA export 1 homolog (S. pombe) RAE1 Hs.196209 N92995 0.2811 1717 -1 1 Monocytic leukemia zinc finger protein-related factor MORF Hs.27590 R66076 0.4306 1717 -1 0.6 Hypothetical protein FLJ20038 FLJ20038 Hs.72071 T86708 0.4593 1717 1 0.6 Solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group) SLC4A1 Hs.185923 H11615 0.4593 1717 -1 0.6 Zinc finger, DHHC domain containing 4 ZDHHC4 Hs.5268 W04515 0.3763 1718 -1 0.8 Syntaphilin SNPH Hs.323833 H20379 0.4029 1718 1 0.8 Breakpoint cluster region protein, uterine leiomyoma, 2 BCRP2 Hs.284294 H98614 0.3345 1719 -1 0.93 Zinc finger homeobox 1b ZFHX1B Hs.34871 N80280 0.3186 1720 -1 0.77 Actinin, alpha 2 ACTN2 Hs.83672 W35370 0.4306 1720 -1 0.93 Nuclear domain 10 protein NDP52 Hs.154230 R87806 0.4791 1720 -1 0.67 ESTs ESTs Hs.356099 R11257 0.4891 1721 1 0.6 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569 H21214 0.44 1722 1 0.73 NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) NDUFS7 Hs.211914 AA043506 0.5844 1722 -1 0.53 CCAAT/enhancer binding protein (C/EBP), delta CEBPD Hs.76722 W90073 0.3939 1723 1 0.93 Sel-1 suppressor of lin-12-like (C. elegans) SEL1L Hs.181300 H16830 0.5304 1723 1 0.33 Hypothetical protein FLJ10374 FLJ10374 Hs.21811 W24831 0.3032 1724 1 1 Dermatopontin DPT Hs.80552 AA045083 0.4496 1724 1 0.6 - - Hs.289047 T97307 0.541 1724 1 0.43 - -- W45565 0.5734 1724 -1 0.4 Vacuolar protein sorting protein 18 VPS18 Hs.23876 R14543 0.5844 1724 1 0.47 KIAA1500 protein KIAA1500 Hs.15420 R74281 0.3508 1725 1 0.93 Protein phosphatase 4 (formerly X), catalytic subunit PPP4C Hs.2903 N50326 0.4496 1725 1 0.73 Hypothetical protein MGC16063 MGC16063 Hs.288544 H72617 0.4593 1725 1 0.6 Hypothetical protein FLJ13150 FLJ13150 Hs.169728 H52753 0.4212 1726 -1 0.67 - - Hs.21213 R24727 0.44 1726 1 0.73 Phosphatidylserine receptor PSR Hs.72660 H82518 0.4212 1728 1 0.8 Ribokinase RBSK Hs.11916 R70783 0.8469 1731 -1 0.1 BCL2-like 2 BCL2L2 Hs.75244 H01162 0.5517 1732 1 0.5 Hypothetical protein FLJ23251 FLJ23251 Hs.170737 T87161 0.44 1733 1 0.6 ESTs ESTs Hs.16335 AA004951 0.4496 1733 -1 0.6 DKFZP434C212 protein DKFZP434C212Hs.172069 R39195 0.3508 1734 -1 0.8 Junctional adhesion molecule 1 JAM1 Hs.12284 R62721 0.5625 1734 1 0.6 Small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) SCYE1 Hs.333513 R31945 0.2884 1735 -1 1 Chondroitin sulfate proteoglycan 6 (bamacan) CSPG6 Hs.24485 R77520 0.4029 1735 1 0.93 Mannose-P-dolichol utilization defect 1 MPDU1 Hs.6710 N34859 0.4306 1735 1 0.8 Histone deacetylase 10 HDAC10 Hs.26593 H24891 0.3592 1736 -1 0.87 - - Hs.293663 AA213820 0.4593 1736 -1 0.7 - - Hs.256533 H11052 0.7477 1737 1 0.27 Kinesin family member 3C KIF3C Hs.21611 R12960 0.6524 1738 1 0.53 KIAA1110 protein KIAA1110 Hs.22479 N71959 0.3592 1739 -1 0.8 Hypothetical protein MGC13204 MGC13204 Hs.157148 N70859 0.4212 1739 -1 0.8 Exportin 1 (CRM1 homolog, yeast) XPO1 Hs.79090 H84617 0.3763 1741 -1 0.87 P300/CBP-associated factor PCAF Hs.199061 AA039643 0.412 1741 -1 0.87 Endothelial-derived gene 1 EG1 Hs.380864 R22673 0.4993 1741 1 0.53 Chromosome 16 open reading frame 5 C16orf5 Hs.7765 AA047380 0.3939 1742 -1 0.73 Like-glycosyltransferase LARGE Hs.25220 T80249 0.4891 1742 1 0.53 Carnitine deficiency-associated gene expressed in ventricle 1 CDV-1 Hs.333120 T97640 0.4212 1744 1 0.87 - -- H49584 0.5304 1744 -1 0.67 KIAA0962 protein KIAA0962 Hs.9059 R35199 0.412 1747 -1 0.67 Hypothetical protein FLJ21080 FLJ21080 Hs.8109 N49211 0.4691 1747 -1 0.6 HEMK homolog 7kb HEMK Hs.46907 R21579 0.6524 1747 1 0.33 GTP binding protein 1 GTPBP1 Hs.283677 H50978 0.3032 1748 1 0.87 ATP-binding cassette, sub-family D (ALD), member 4 ABCD4 Hs.94395 AA149828 0.3939 1748 -1 0.93 Gm117 gm117 Hs.26226 W05126 0.4496 1748 -1 0.8 - - Hs.18949 H01638 0.4306 1749 1 0.67 Hypothetical protein FLJ23518 FLJ23518 Hs.112250 W93284 0.618 1749 -1 0.27 Transcription elongation factor A (SII), 3 TCEA3 Hs.94952 AA190714 0.3345 1750 1 0.93 Cytoskeleton associated protein 2 CKAP2 Hs.24641 N54827 0.3186 1752 -1 0.93 KIAA0471 gene product KIAA0471 Hs.242271 AA043507 0.8976 1752 -1 0.03 Kinesin-like 5 (mitotic kinesin-like protein 1) KNSL5 Hs.270845 R53443 0.385 1753 -1 0.73 ESTs ESTs Hs.23691 W58500 0.3939 1753 -1 0.6 DNA segment on chromosome X (unique) 9928 expressed sequence DXS9928E Hs.54277 R50868 0.3939 1753 1 0.8 Hypothetical protein FLJ23861 FLJ23861 Hs.380669 T93661 0.3426 1754 1 0.8 Endogenous retroviral family W, env(C7), member 1 (syncytin) ERVWE1 Hs.373811 H72703 0.3592 1755 1 0.87 Chromosome 11 open reading frame 10 C11orf10 Hs.90918 W31293 0.3763 1755 -1 0.67 Hypothetical protein FLJ10631 FLJ10631 Hs.238944 N70152 0.412 1755 -1 0.53 CGI-99 protein LOC51637 Hs.110803 W86341 0.5955 1755 -1 0.47 Hypothetical protein BC006130 LOC93622 Hs.6815 N72553 0.385 1756 1 0.87 Calmodulin 3 (phosphorylase kinase, delta) CALM3 Hs.334330 N92308 0.412 1756 -1 0.8 Protein phosphatase 1, regulatory (inhibitor) subunit 16A PPP1R16A Hs.12185 AA132039 0.5199 1757 -1 0.53 - - Hs.43266 R64172 0.6409 1758 -1 0.47 ESTs ESTs Hs.260100 N25636 0.4791 1759 1 0.73 Esterase D/formylglutathione hydrolase ESD Hs.82193 W92121 0.3508 1760 1 0.8 KIAA0618 gene product KIAA0618 Hs.295112 R43282 0.385 1760 1 0.83 Leucine zipper, putative tumor suppressor 1 LZTS1 Hs.93605 AA032250 0.412 1761 -1 0.73 - - Hs.15806 AA043736 0.9103 1761 0 0 Actinin, alpha 1 ACTN1 Hs.119000 T84043 0.3345 1762 -1 0.8 Chromosome 1 open reading frame 6 C1orf6 Hs.283739 T76961 0.541 1762 1 0.73 ESTs ESTs Hs.268586 T89662 0.541 1763 1 0.33 - - Hs.268617 R31509 0.385 1764 -1 0.93 Arfaptin 1 HSU52521 Hs.301064 H02590 0.4306 1764 1 0.73 - -- N30559 0.4691 1764 -1 0.8 - -- H00222 0.4791 1764 -1 0.77 XPA binding protein 1; putative ATP(GTP)-binding protein NTPBP Hs.18259 R02682 0.5096 1765 1 0.73 Double-stranded RNA-binding zinc finger protein JAZ JAZ Hs.181012 R59970 0.44 1767 1 0.8 GABA(A) receptor-associated protein like 1 GABARAPL1 Hs.336429 R83247 0.44 1767 1 0.6 Galactosidase, beta 1 GLB1 Hs.79222 AA040638 0.4791 1767 -1 0.8 KIAA1554 protein KIAA1554 Hs.17767 R06564 0.3763 1768 -1 0.93 Galactose-4-epimerase, UDP- GALE Hs.76057 R48933 0.4593 1768 -1 0.73 Polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa POLR2J Hs.80475 AA054300 0.4891 1768 1 0.73 Kelch-like 4 (Drosophila) KLHL4 Hs.49075 H63543 0.5199 1769 -1 0.43 FK506 binding protein 12-rapamycin associated protein 1 FRAP1 Hs.338207 T97692 0.6641 1769 -1 0.47 Nicotinamide nucleotide transhydrogenase NNT Hs.18136 N77879 0.4029 1770 1 0.73 WD-repeat protein HAN11 Hs.288283 N47087 0.8344 1770 -1 0.17 Polymerase (RNA) II (DNA directed) polypeptide C, 33kDa POLR2C Hs.79402 R71436 0.3677 1772 -1 0.93 - - Hs.6236 H43658 0.3677 1773 -1 0.73 Gene overexpressed in astrocytoma GOA Hs.293660 H19387 0.412 1773 1 0.93 Malic enzyme 2, NAD(+)-dependent, mitochondrial ME2 Hs.75342 H61334 0.8849 1773 -1 0.13 RNA binding protein S1, serine-rich domain RNPS1 Hs.75104 R52028 0.3939 1775 1 0.67 Protein tyrosine phosphatase, non-receptor type 23 PTPN23 Hs.25524 R82668 0.3592 1776 1 0.8 Hypothetical protein MGC2577 MGC2577 Hs.30114 H82521 0.4791 1777 -1 0.43 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c'' ATP6V0B Hs.7476 R79279 0.5199 1778 1 0.67 Zinc finger protein 226 ZNF226 Hs.145956 AA116099 0.3426 1779 1 1 Melanoma antigen, family D, 2 MAGED2 Hs.4943 R37394 0.3763 1779 1 0.67 Hypothetical protein MGC3123 MGC3123 Hs.288600 N98883 0.5304 1779 1 0.57 General transcription factor IIA, 1, 19/37kDa GTF2A1 Hs.299542 T91994 0.3763 1780 1 0.8 - - Hs.188626 R47985 0.4791 1780 1 0.73 - - Hs.378970 N33201 0.5199 1780 -1 0.47 Cullin 4B CUL4B Hs.155976 H11588 0.6067 1781 1 0.47 Bromodomain containing 2 BRD2 Hs.75243 H28667 0.2958 1782 1 0.8 Sterile alpha motif and leucine zipper containing kinase AZK ZAK Hs.115175 R20347 0.3426 1782 -1 0.87 Hypothetical protein FLJ22386 FLJ22386 Hs.22795 T66788 0.5734 1782 -1 0.43 Component of oligomeric golgi complex 4 COG4 Hs.108779 AA203403 0.44 1784 -1 0.73 Hypothetical protein MGC13064 MGC13064 Hs.333524 H17141 0.4791 1784 -1 0.67 KIAA0376 protein KIAA0376 Hs.4791 N68960 0.44 1785 1 0.83 Mitochondrial ribosomal protein L45 MRPL45 Hs.19347 W90706 0.385 1786 -1 0.63 Chromosome 20 open reading frame 119 C20orf119 Hs.372714 R85053 0.4306 1786 1 0.53 Glucosidase, beta; acid (includes glucosylceramidase) GBA Hs.282997 T79902 0.4993 1786 1 0.6 - - Hs.376652 T53316 0.5304 1786 1 0.53 Proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) PSME3 Hs.152978 H51684 0.3939 1788 1 0.8 PDZ domain protein (Drosophila inaD-like) INADL Hs.321197 H66118 0.5625 1788 1 0.37 - - Hs.285520 T89040 0.3677 1789 1 0.73 CDw92 antigen CDW92 Hs.179902 W40367 0.44 1791 1 0.73 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899 N68522 0.4691 1791 -1 0.73 Transforming growth factor, beta 3 TGFB3 Hs.2025 AA152026 0.4891 1791 -1 0.6 - - Hs.323527 N69389 0.4496 1792 -1 0.67 Nerve injury gene 283 NIN283 Hs.320834 N74019 0.3032 1793 -1 0.93 KIAA0265 protein KIAA0265 Hs.192966 H20195 0.4212 1793 1 0.67 Chromosome 12 open reading frame 10 C12orf10 Hs.15760 R56392 0.4891 1793 1 0.67 Discoidin domain receptor family, member 1 DDR1 Hs.75562 R84556 0.4891 1793 1 0.73 WD repeat domain 10 WDR10 Hs.70202 H78069 0.4891 1794 1 0.43 For protein disulfide isomerase-related PDIR Hs.76901 W31430 0.4496 1795 -1 0.67 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen) MCP Hs.83532 H83019 0.3426 1796 1 0.93 Ribosomal protein S27 (metallopanstimulin 1) RPS27 Hs.195453 H06474 0.6641 1797 -1 0.4 Fatty acid desaturase 3 FADS3 Hs.21765 H43854 0.7355 1797 -1 0.4 A disintegrin and metalloproteinase domain 11 ADAM11 Hs.6088 R32753 0.3426 1798 1 0.67 Hypothetical protein FLJ12541 similar to Stra6 FLJ12541 Hs.24553 AA034128 0.3592 1798 -1 1 - -- AA005152 0.4029 1798 1 0.8 - - Hs.356494 N23380 0.541 1798 -1 0.53 Hypothetical protein MGC33602 MGC33602 Hs.274415 AA132067 0.385 1799 1 0.8 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 SMARCC2 Hs.236030 W40235 0.3508 1800 1 0.83 Heat shock 105kD HSP105B Hs.36927 H58957 0.3592 1800 1 1 Myeloid cell leukemia sequence 1 (BCL2-related) MCL1 Hs.86386 H69632 0.4891 1800 1 0.53 Slingshot 1 SSH1 Hs.60377 H51915 0.3677 1801 -1 0.87 - - Hs.180372 N49742 0.4691 1801 -1 0.8 Nuclear receptor subfamily 1, group D, member 2 NR1D2 Hs.37288 AA053736 0.6409 1801 -1 0.33 Hypothetical protein FLJ23375 FLJ23375 Hs.285996 N25073 0.4496 1802 -1 0.67 - EST Hs.322020 W46682 0.3677 1803 -1 0.73 ESTs ESTs Hs.21475 H17690 0.3592 1804 -1 0.87 APG12 autophagy 12-like (S. cerevisiae) APG12L Hs.264482 R18779 0.3592 1804 -1 0.93 - -- R66080 0.4306 1805 -1 0.73 KIAA1530 protein KIAA1530 Hs.191268 N33193 0.44 1805 -1 0.67 Glioma-amplified sequence-41 GAS41 Hs.4029 H45117 0.5199 1805 1 0.6 KIAA0140 gene product KIAA0140 Hs.156016 AA039869 0.7969 1805 -1 0.4 Charot-Leyden crystal protein CLC Hs.889 H44437 0.3265 1806 1 0.87 - - Hs.324342 AA195455 0.7599 1808 1 0.13 Stanniocalcin 2 STC2 Hs.155223 T84583 0.3345 1809 1 0.87 KIAA0195 gene product KIAA0195 Hs.301132 H50940 0.3763 1809 1 0.93 Nef-associated factor 1 NAF1 Hs.109281 H43482 0.3763 1809 1 0.67 Valyl-tRNA synthetase 2 VARS2 Hs.159637 AA150244 0.3592 1810 1 0.83 Aspartylglucosaminidase AGA Hs.207776 H12368 0.4593 1810 1 0.6 Mucolipin 1 MCOLN1 Hs.12909 AA047466 0.4593 1812 -1 0.6 RUN and FYVE domain-containing 1 RUFY1 Hs.289064 W93121 0.541 1812 -1 0.6 KIAA0355 gene product KIAA0355 Hs.186840 T81553 0.6641 1813 1 0.27 - -- H17405 0.4212 1816 1 0.87 KIAA0435 gene product KIAA0435 Hs.31438 W19134 0.4791 1816 1 0.67 DKFZP564F0522 protein DKFZP564F052 Hs.23060 AA101984 0.5844 1816 1 0.6 G-protein coupled receptor RE2 Hs.301642 W47043 0.6995 1816 1 0.4 Cyclin-dependent kinase 5 CDK5 Hs.166071 AA044730 0.9103 1816 1 0.07 FLJ23277 protein FLJ23277 Hs.334477 R21859 0.3508 1817 1 0.8 Microfibrillar-associated protein 2 MFAP2 Hs.83551 R51845 0.3763 1817 1 0.8 Cyclin-dependent kinase 8 CDK8 Hs.25283 N78568 0.44 1817 -1 0.8 - - Hs.288671 W90523 0.4691 1817 -1 0.6 Hypothetical protein FLJ20211 FLJ20211 Hs.311100 H97372 0.5517 1817 1 0.6 Integrin, beta 5 ITGB5 Hs.149846 N36697 0.3345 1818 -1 0.93 ESTs ESTs Hs.41322 H09771 0.412 1818 1 0.73 - -- R72851 0.3508 1819 1 0.87 Phosphatidylinositol glycan, class S PIGS Hs.347950 H01212 0.4891 1820 -1 0.73 Dynein, cytoplasmic, light intermediate polypeptide 1 DNCLI1 Hs.266483 H53410 0.385 1821 -1 0.8 Polymerase (DNA-directed), delta 4 POLD4 Hs.82520 T84454 0.4593 1821 1 0.67 COP9 subunit 6 (MOV34 homolog, 34 kD) MOV34-34KD Hs.15591 AA213820 0.4593 1821 1 0.73 - - Hs.256533 AA037128 0.5625 1821 1 0.47 Cisplatin resistance related protein CRR9p CRR9 Hs.323769 R15335 0.4691 1822 1 0.67 Importin 4 FLJ23338 Hs.61790 H40649 0.5955 1822 1 0.4 Hypothetical protein FLJ20628 FLJ20628 Hs.32356 H85873 0.385 1823 1 0.83 SUMO-1 activating enzyme subunit 2 UBA2 Hs.4311 H99068 0.5844 1824 1 0.4 - - Hs.101810 AA149240 0.5096 1825 -1 0.53 Similar to DNA-directed RNA polymerase I (135 kDa) Rpo1-2 Hs.86337 AA055269 0.4891 1826 1 0.53 - - Hs.41269 H89293 0.3426 1828 -1 0.93 - - Hs.108646 AA037624 0.3763 1828 1 0.93 Hypothetical protein MGC5242 MGC5242 Hs.77365 AA031503 0.4791 1828 -1 0.53 CGI-20 protein LOC51608 Hs.107387 N32967 0.4891 1829 -1 0.6 KIAA0678 protein KIAA0678 Hs.12707 N58341 0.4993 1829 1 0.63 Mitochondrial ribosomal protein L22 MRPL22 Hs.41007 T83371 0.6067 1829 -1 0.4 - - Hs.296979 AA047410 0.6758 1829 -1 0.47 Tafazzin (cardiomyopathy, dilated 3A (X-linked); endocardial fibroelastosis 2; Barth syndrome) TAZ Hs.79021 H83357 0.4496 1830 -1 0.67 Hypothetical protein BC012008 LOC144467 Hs.348374 W61013 0.4496 1831 -1 0.6 V-abl Abelson murine leukemia viral oncogene homolog 1 ABL1 Hs.146355 AA127045 0.4791 1831 1 0.73 Hypothetical protein BC009331 LOC92305 Hs.337772 T80727 0.4029 1832 -1 0.8 Protease, serine, 25 PRSS25 Hs.115721 T83106 0.618 1832 -1 0.5 Chemokine-like factor 1 CKLF1 Hs.15159 H23225 0.3763 1833 1 0.87 Protein kinase C, epsilon PRKCE Hs.211592 AA121538 0.4691 1833 1 0.8 Homer, neuronal immediate early gene, 3 HOMER-3 Hs.166146 AA007570 0.5304 1833 -1 0.53 KIAA0682 gene product KIAA0682 Hs.7482 N25190 0.3939 1834 -1 0.87 Glutathione peroxidase 1 GPX1 Hs.76686 N74870 0.3032 1835 -1 0.87 Ring-box 1 RBX1 Hs.279919 N76056 0.44 1836 -1 0.8 ARP1 actin-related protein 1 homolog B, centractin beta (yeast) ACTR1B Hs.2477 W31103 0.4593 1836 -1 0.73 Bromodomain containing 2 BRD2 Hs.75243 T80857 0.5199 1836 -1 0.47 - -- R76096 0.618 1837 -1 0.33 Hypothetical protein FLJ20502 FLJ20502 Hs.23956 AA133959 0.6524 1837 -1 0.33 Brain-specific protein p25 alpha p25 Hs.29353 AA043178 0.3109 1840 1 0.93 Mitogen-activated protein kinase 3 MAPK3 Hs.861 AA099731 0.4593 1840 -1 0.8 Follicular lymphoma variant translocation 1 FVT1 Hs.74050 N70097 0.4212 1841 1 0.53 - -- H75270 0.541 1841 -1 0.6 Hypothetical protein FLJ14743 FLJ14743 Hs.169577 AA203467 0.541 1842 1 0.47 - -- T51260 0.3677 1843 -1 0.87 Hexosaminidase A (alpha polypeptide) HEXA Hs.119403 R52448 0.3508 1844 1 0.9 Synovial sarcoma translocation, chromosome 18 SS18 Hs.153221 N71709 0.4496 1845 1 0.67 DC11 protein DC11 Hs.42785 AA150731 0.412 1846 -1 0.67 - - Hs.374418 R07486 0.4691 1846 1 0.6 ESTs ESTs Hs.18920 AA136473 0.9743 1846 1 0.1 - - Hs.46609 R74157 0.3763 1847 1 0.73 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876 H44188 0.5199 1848 1 0.5 - -- H75274 0.4691 1849 -1 0.67 Solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 Hs.323878 N31735 0.5625 1849 -1 0.6 Hypothetical protein FLJ20671 FLJ20671 Hs.180201 AA007414 0.4496 1850 1 0.6 Copper metabolism gene MURR1 MURR1 Hs.339669 W24575 0.4212 1852 1 0.8 WW domain binding protein 1 WBP1 Hs.375564 AA037862 0.5517 1854 -1 0.53 Nucleotide-sugar transporter similar to C. elegans sqv-7 SQV7L Hs.90078 AA115581 0.385 1855 1 0.8 Phosphoglycerate kinase 1 PGK1 Hs.78771 AA034330 0.412 1855 1 0.83 - -- W81033 0.5517 1855 -1 0.67 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 SULT1A3 Hs.274614 W88726 0.5625 1855 -1 0.67 Metaxin 1 MTX1 Hs.247551 H79184 0.5955 1855 -1 0.47 Hypothetical protein FLJ14981 FLJ14981 Hs.76925 N68626 0.6876 1855 -1 0.4 Splicing factor 1 SF1 Hs.180677 W47347 0.412 1857 -1 0.8 Hypothetical protein FLJ11198 FLJ11198 Hs.91251 N26710 0.44 1857 -1 0.73 Hypothetical protein BC011593 LOC112495 Hs.344097 AA203622 0.4306 1858 1 0.73 - -- N62381 0.3426 1861 -1 0.87 Fring LOC117584 Hs.172694 N24303 0.4212 1861 -1 0.87 - -- AA035066 0.4496 1861 1 0.67 Hypothetical protein MGC4268 MGC4268 Hs.22708 H08185 0.4593 1861 -1 0.53 Hypothetical protein BC004409 LOC92170 Hs.301693 H91623 0.4593 1861 -1 0.73 - -- R68212 0.4691 1861 1 0.53 - -- AA101823 0.5199 1861 1 0.73 Elastin microfibril interface located protein EMILIN Hs.63348 N36282 0.3186 1863 -1 1 ESTs ESTs Hs.356537 N93402 0.4691 1863 1 0.73 Guanine nucleotide binding protein-like 1 GNL1 Hs.83147 AA101710 0.7234 1863 -1 0.13 - - Hs.12396 W32377 0.3265 1864 1 1 Methylmalonyl Coenzyme A mutase MUT Hs.155212 R39304 0.3426 1865 1 0.87 Ephrin-B2 EFNB2 Hs.30942 R08328 0.4306 1865 1 0.67 Nucleoporin 133kDa NUP133 Hs.12457 R47801 0.6409 1865 -1 0.53 Protein inhibitor of activated STAT3 PIAS3 Hs.76578 H60501 0.5625 1866 -1 0.67 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 MLLT4 Hs.100469 T75262 0.5625 1866 1 0.53 - -- R19153 0.44 1868 -1 0.57 - - Hs.356751 AA033687 0.5844 1868 1 0.67 STAT induced STAT inhibitor-2 STATI2 Hs.110776 R91365 0.618 1868 1 0.4 G protein-coupled receptor kinase-interactor 2 GIT2 Hs.57734 W33139 0.7114 1868 -1 0.4 Hypothetical protein dJ122O8.2 DJ122O8.2 Hs.268115 R42554 0.4496 1869 1 0.73 T-box, brain, 1 TBR1 Hs.210862 N91767 0.541 1869 -1 0.53 Twisted gastrulation TSG Hs.247302 R21825 0.7477 1869 1 0.47 - - Hs.23272 R44307 0.3763 1871 1 0.83 Neurabin II LOC84687 Hs.110095 T80433 0.4306 1872 -1 0.73 HSKM-B protein HSKM-B Hs.66170 H12149 0.4212 1873 1 0.6 MAX dimerization protein 4 MAD4 Hs.102402 AA099555 0.5734 1874 -1 0.4 Hypothetical protein FLJ12666 FLJ12666 Hs.23767 AA152304 0.8976 1874 -1 0.27 ADP-ribosylation factor 3 ARF3 Hs.119177 N90407 0.5734 1875 -1 0.47 Ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate) EMS1 Hs.119257 H67165 0.3677 1877 1 0.8 Nitric oxide synthase 2A (inducible, hepatocytes) NOS2A Hs.193788 T78345 0.618 1877 1 0.6 - - Hs.269116 R07576 0.3265 1878 1 0.87 L(3)mbt-like (Drosophila) L3MBTL Hs.119021 AA152294 0.3939 1878 -1 0.73 Presenilin 2 (Alzheimer disease 4) PSEN2 Hs.25363 N50540 0.4029 1880 1 0.93 - - Hs.346742 R20723 0.4496 1880 1 0.73 ESTs ESTs Hs.374490 H67893 0.4496 1882 -1 0.8 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 SULT1A1 Hs.142 T95735 0.4496 1884 1 0.63 Phosphatidylinositol-4-phosphate 5-kinase, type I, alpha PIP5K1A Hs.149255 H03273 0.5625 1885 -1 0.5 PEST-containing nuclear protein PCNP Hs.283728 H52789 0.4791 1886 1 0.73 DKFZP434P106 protein DKFZP434P106 Hs.236522 H61357 0.385 1887 1 0.73 Tumor protein p53 (Li-Fraumeni syndrome) TP53 Hs.1846 N93055 0.385 1888 1 0.87 Interferon, gamma-inducible protein 30 IFI30 Hs.14623 AA150898 0.412 1888 1 0.8 FK506 binding protein 9, 63 kDa FKBP9 Hs.302749 AA043766 0.6294 1888 1 0.4 - -- R45200 0.3265 1889 1 1 YME1-like 1 (S. cerevisiae) YME1L1 Hs.206521 R23189 0.3592 1889 -1 0.87 ESTs ESTs Hs.172610 R89847 0.412 1889 -1 0.93 ESTs ESTs Hs.175979 W47014 0.3592 1890 1 0.87 Ts translation elongation factor, mitochondrial TSFM Hs.340959 AA213887 0.385 1890 1 0.87 Hypothetical protein FLJ21908 FLJ21908 Hs.26750 H86173 0.3939 1890 1 0.93 - -- H79385 0.4496 1890 -1 0.6 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B APOBEC3B Hs.226307 T39368 0.4496 1891 -1 0.67 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 SLC7A4 Hs.197116 H69511 0.5096 1891 1 0.67 Hypothetical protein FLJ38975 FLJ38975 Hs.27769 H85791 0.4691 1892 1 0.83 - - Hs.380059 N74712 0.8849 1892 -1 0.07 Similar to RIKEN cDNA 3110001D03 gene (M. musculus) MGC4730 Hs.7517 T77130 0.2958 1893 -1 1 ESTs ESTs Hs.268606 H84616 0.4891 1893 1 0.6 Hypothetical protein MGC18216 MGC18216 Hs.104679 AA101783 0.5625 1893 -1 0.4 ESTs ESTs Hs.22380 H16773 0.3939 1894 -1 0.93 - - Hs.12245 AA040629 0.4212 1894 -1 0.8 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 MLLT6 Hs.349196 R52847 0.541 1894 1 0.6 - -- R02573 0.4496 1895 1 0.73 Similar to yeast Upf3, variant A UPF3A Hs.274412 H68599 0.4993 1895 -1 0.43 Hypothetical protein MGC15737 MGC15737 Hs.39122 AA044433 0.5955 1895 -1 0.47 - - Hs.279607 H10430 0.618 1895 1 0.27 Hypothetical protein FLJ21939 similar to 5-azacytidine induced gene 2 FLJ21939 Hs.164478 R34257 0.3763 1897 -1 1 Hepatocyte growth factor-regulated tyrosine kinase substrate HGS Hs.24756 AA069532 0.3939 1897 1 0.87 - - Hs.287955 R72133 0.5517 1897 -1 0.4 - - Hs.5957 AA047581 0.4212 1898 1 0.67 Peroxiredoxin 5 PRDX5 Hs.31731 W58640 0.4496 1898 -1 0.73 SECIS binding protein 2 SBP2 Hs.288141 W31714 0.412 1899 -1 0.8 - - Hs.122656 T54683 0.5199 1899 -1 0.53 DNA helicase homolog PIF1 PIF1 Hs.112160 R50487 0.4212 1900 -1 0.87 - - Hs.25717 H05539 0.4496 1901 1 0.8 Uncharacterized bone marrow protein BM046 BM046 Hs.177812 N63482 0.4891 1902 1 0.67 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262 H44192 0.5625 1902 1 0.47 Nischarin NISCH Hs.26285 R76103 0.3032 1903 -1 0.93 - - Hs.367898 AA056394 0.4993 1903 1 0.6 Carbonic anhydrase IX CA9 Hs.63287 R23374 0.618 1903 1 0.47 Hypothetical protein FLJ10462 FLJ10462 Hs.100895 R20808 0.4993 1904 1 0.6 POP7 (processing of precursor, S. cerevisiae) homolog RPP20 Hs.18747 R21171 0.412 1905 1 0.87 Electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II) ETFA Hs.169919 W56565 0.4306 1905 -1 0.8 - - Hs.56185 H52953 0.8344 1906 1 0.17 Hypothetical protein MGC20255 MGC20255 Hs.334775 AA037284 0.8596 1906 -1 0.07 Adenine phosphoribosyltransferase APRT Hs.28914 R47829 0.5625 1907 -1 0.33 CD37 antigen CD37 Hs.153053 AA004492 0.6995 1907 -1 0.2 Cytochrome P450 monooxygenase CYP-M Hs.352566 H64625 0.7355 1909 -1 0.4 Coproporphyrinogen oxidase (coproporphyria, harderoporphyria) CPO Hs.89866 AA005020 0.9103 1909 1 0.2 Protein tyrosine phosphatase, non-receptor type 1 PTPN1 Hs.155894 N51951 0.44 1910 1 0.7 - -- H19953 0.5199 1910 1 0.6 - - Hs.220963 R86233 0.4593 1912 1 0.73 Serum/glucocorticoid regulated kinase SGK Hs.296323 H16602 0.4791 1912 1 0.8 - - Hs.356087 N66243 0.4029 1913 -1 0.73 ESTs ESTs Hs.26575 H14473 0.7599 1913 -1 0.4 Tetracycline transporter-like protein TETRAN Hs.157145 W04705 0.6409 1914 -1 0.37 Hypothetical protein DKFZp667B1218 DKFZp667B1218Hs.151293 AA052907 0.6409 1914 -1 0.5 Hypothetical protein DKFZP434G0310 DKFZP434G031Hs.334836 AA054498 0.7114 1915 -1 0.27 Hypothetical protein DKFZp566J2046 DKFZP566J2046Hs.322482 AA001748 0.4029 1916 -1 0.8 Hypothetical protein FLJ11286 FLJ11286 Hs.12151 R46554 0.4306 1916 -1 0.73 KIAA0930 protein KIAA0930 Hs.13255 AA134115 0.8093 1916 -1 0.33 Sphingosine-1-phosphate lyase 1 SGPL1 Hs.186613 H14891 0.4691 1917 1 0.47 Kinesin family member 3B KIF3B Hs.301206 R25792 0.6876 1917 1 0.33 Malic enzyme 2, NAD(+)-dependent, mitochondrial ME2 Hs.75342 R11669 0.4891 1918 1 0.67 Hypothetical protein LOC56912 LOC56912 Hs.334360 H78351 0.4993 1918 -1 0.53 - -- R39441 0.6067 1918 -1 0.47 - -- R87739 0.4993 1922 -1 0.67 Transmembrane protein 1 TMEM1 Hs.94479 N45225 0.5734 1923 1 0.47 Vesicle transport-related protein RA410 Hs.27023 H75346 0.4891 1924 -1 0.8 ESTs ESTs Hs.294014 N22158 0.5304 1924 -1 0.4 - - Hs.283072 R94457 0.3939 1925 1 0.73 Guanine monphosphate synthetase GMPS Hs.5398 AA044084 0.44 1925 1 0.8 Chromosome 12 open reading frame 5 C12orf5 Hs.24792 H15247 0.44 1926 1 0.73 Lipase A, lysosomal acid, cholesterol esterase (Wolman disease) LIPA Hs.85226 H17047 0.5955 1926 1 0.4 Zinc finger protein 133 (clone pHZ-13) ZNF133 Hs.78434 N92372 0.5304 1927 1 0.6 Peroxiredoxin 4 PRDX4 Hs.83383 AA047101 0.6641 1927 -1 0.43 Chromosome 5 open reading frame 6 C5orf6 Hs.102469 R75874 0.4496 1929 1 0.73 KIAA1932 protein KIAA1932 Hs.306121 R61690 0.5955 1930 1 0.5 Chondroitin sulfate proteoglycan 4 (melanoma-associated) CSPG4 Hs.9004 W15599 0.4691 1931 -1 0.73 BCL2/adenovirus E1B 19kDa interacting protein 3 BNIP3 Hs.79428 R76214 0.4891 1931 1 0.8 Protocadherin 16 dachsous-like (Drosophila) PCDH16 Hs.9658 AA156795 0.4993 1931 1 0.53 ESTs ESTs Hs.62772 T77424 0.4993 1932 1 0.57 FOXJ2 forkhead factor FHX Hs.120844 N93517 0.5096 1932 1 0.73 - - Hs.67317 R28325 0.7234 1932 1 0.33 Hypothetical protein MGC10500 MGC10500 Hs.271599 R59315 0.4029 1936 -1 0.8 Polymerase (DNA directed), delta 3 POLD3 Hs.82502 N71104 0.4496 1936 1 0.73 - - Hs.46506 N30288 0.4496 1936 -1 0.67 Prefoldin 2 PFDN2 Hs.298229 H15268 0.4593 1936 -1 0.67 Nectin-like protein 1 NECL1 Hs.6164 AA053325 0.8218 1938 -1 0.2 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 ATP6V1G1 Hs.90336 R73278 0.3426 1939 1 0.87 Intercellular adhesion molecule 3 ICAM3 Hs.99995 W47502 0.7722 1939 1 0.33 Alpha glucosidase II alpha subunit G2AN Hs.76847 R20820 0.3592 1940 1 0.8 ESTs ESTs Hs.171487 H24136 0.4993 1940 -1 0.67 - -- N30140 0.4691 1942 -1 0.8 Protein kinase, AMP-activated, gamma 1 non-catalytic subunit PRKAG1 Hs.3136 H53304 0.4029 1943 1 0.83 - - Hs.117530 R23136 0.5199 1943 -1 0.63 Solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 SLC11A2 Hs.57435 H29063 0.6876 1944 -1 0.37 Arginyl aminopeptidase (aminopeptidase B)-like 1 RNPEPL1 Hs.5345 W39400 0.5096 1947 -1 0.8 Matrix metalloproteinase 11 (stromelysin 3) MMP11 Hs.155324 R96053 0.7845 1947 1 0.2 Hypothetical protein LOC51320 LOC51320 Hs.12830 AA039598 0.5096 1948 -1 0.53 Ribosomal protein S6 kinase, 90kDa, polypeptide 1 RPS6KA1 Hs.149957 W02772 0.5096 1948 -1 0.6 Hypothetical protein FLJ23749 FLJ23749 Hs.180178 AA029852 0.618 1948 1 0.47 Hypothetical protein FLJ20259 FLJ20259 Hs.9956 H95137 0.4306 1949 -1 0.8 Map kinase phosphatase-like protein MK-STYX LOC51657 Hs.11615 R54993 0.6067 1949 1 0.47 Chromosome 20 open reading frame 167 C20orf167 Hs.26213 H88208 0.4029 1950 -1 0.8 Suppressor of var1, 3-like 1 (S. cerevisiae) SUPV3L1 Hs.106469 W78793 0.4791 1950 1 0.6 Epidermal growth factor receptor pathway substrate 8 EPS8 Hs.2132 H16558 0.4691 1951 -1 0.67 Myosin VA (heavy polypeptide 12, myoxin) MYO5A Hs.170157 N/A1 0.7355 1951 1 0.4 - -- AA005328 0.4691 1952 -1 0.8 V-ski sarcoma viral oncogene homolog (avian) SKI Hs.2969 AA046951 0.5096 1952 1 0.7 Insulinoma-associated protein IA-6 INSM2 Hs.62813 H98666 0.44 1954 -1 0.77 Procollagen (type III) N-endopeptidase PCOLN3 Hs.183138 H82747 0.5199 1954 1 0.53 ESTs ESTs Hs.295855 AA045670 0.4993 1955 -1 0.7 Cell division cycle 34 CDC34 Hs.76932 H10877 0.5199 1956 -1 0.67 Ankyrin repeat and SOCS box-containing 1 ASB1 Hs.153489 H29620 0.5517 1956 1 0.4 Chromosome 6 open reading frame 33 C6orf33 Hs.239388 W16434 0.618 1956 -1 0.47 Testis expressed sequence 27 TEX27 Hs.6120 R86854 0.4993 1957 1 0.6 Chromosome 11 open reading frame 14 C11orf14 Hs.32017 W58243 0.4496 1958 1 0.6 - - Hs.134158 AA130080 0.4496 1958 -1 0.73 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 PSMD12 Hs.4295 W20491 0.4891 1958 -1 0.67 TAR (HIV) RNA binding protein 2 TARBP2 Hs.326 H65687 0.6524 1958 1 0.57 Hypothetical protein FLJ23263 FLJ23263 Hs.288716 R75956 0.4791 1960 1 0.47 Chromosome 22 open reading frame 2 C22orf2 Hs.227637 N66086 0.3763 1961 -1 0.8 - - Hs.350534 H44002 0.3939 1961 1 0.8 - -- T54522 0.6409 1962 1 0.33 Breast cancer metastasis-suppressor 1 BRMS1 Hs.100426 W63774 0.4212 1963 -1 0.73 H2A histone family, member X H2AFX Hs.147097 R80587 0.541 1963 1 0.6 Protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform PPP2R2A Hs.179574 N23296 0.4791 1964 1 0.8 Dynein, cytoplasmic, intermediate polypeptide 2 DNCI2 Hs.66881 W51953 0.5199 1964 1 0.67 Tenascin XB TNXB Hs.169886 N76065 0.5304 1964 1 0.6 Mitochondrial ribosomal protein S35 MRPS35 Hs.10724 N27569 0.3677 1965 1 0.97 - - Hs.218707 T87593 0.5625 1965 -1 0.8 ESTs ESTs Hs.111805 H22698 1 1965 1 0.17 General transcription factor IIB GTF2B Hs.258561 R64704 0.385 1966 1 0.93 Placental protein 13-like protein PPL13 Hs.24236 R00553 0.4691 1966 -1 0.7 - - Hs.270347 N66247 0.5096 1966 1 0.67 - - Hs.6390 N75375 0.541 1966 -1 0.67 - -- AA203245 0.3677 1967 -1 0.8 - -- T92962 0.4891 1968 1 0.6 CD81 antigen (target of antiproliferative antibody 1) CD81 Hs.54457 N71166 0.4993 1968 -1 0.53 Phosphatidylinositol glycan, class Q PIGQ Hs.18079 N34875 0.8976 1968 -1 0.03 Hypothetical protein FLJ20373 FLJ20373 Hs.6631 T83961 0.541 1969 1 0.6 - -- W72939 0.5625 1969 -1 0.4 KIAA0097 gene product KIAA0097 Hs.76989 N91237 0.5625 1969 -1 0.6 Chloride intracellular channel 2 CLIC2 Hs.54570 H93330 0.412 1971 -1 0.87 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 1 SLC9A3R1 Hs.184276 W46363 0.618 1971 -1 0.4 Host cell factor homolog LCP Hs.20597 H78277 0.7969 1971 -1 0.33 Hypothetical protein DKFZp761D0211 DKFZP761D021Hs.322456 N47851 0.4593 1972 -1 0.73 - -- R05370 0.5734 1972 1 0.4 - - Hs.233290 H84316 0.6524 1972 -1 0.23 Neuroligin 3 NLGN3 Hs.47320 T79597 0.6294 1973 1 0.47 - -- H10448 0.5096 1974 1 0.6 Cytochrome b5 reductase 1 (B5R.1) LOC51706 Hs.289113 AA022903 0.6294 1974 1 0.4 Laminin, gamma 1 (formerly LAMB2) LAMC1 Hs.214982 AA136799 0.5096 1975 -1 0.47 Growth arrest and DNA-damage-inducible, alpha GADD45A Hs.80409 R72685 0.3939 1976 1 0.87 Similar to vaccinia virus HindIII K4L ORF HU-K4 Hs.74573 W23595 0.412 1976 -1 0.93 HDCMA18P protein HDCMA18P Hs.278635 R33249 0.3763 1977 1 0.87 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 B4GALT3 Hs.321231 R20019 0.6294 1977 -1 0.53 - -- H62026 0.5096 1978 1 0.6 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428 R22724 0.6294 1978 1 0.33 Hypothetical protein BC011840 LOC93343 Hs.106597 W88557 0.5096 1980 -1 0.77 TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa TAF10 Hs.89657 T65557 0.5625 1980 1 0.6 Dual specificity phosphatase 6 DUSP6 Hs.180383 R19166 0.4791 1981 -1 0.73 ESTs ESTs Hs.91401 AA069570 0.7114 1981 1 0.13 Heat shock 27kDa protein 1 HSPB1 Hs.76067 T77709 0.6409 1982 -1 0.4 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105) NFKB1 Hs.83428 T83736 0.3939 1983 1 0.8 Hypothetical protein FLJ31121 FLJ31121 Hs.350194 H81916 0.5955 1983 -1 0.6 Transcription termination factor, RNA polymerase II TTF2 Hs.142157 H82880 0.7234 1983 1 0.27 Peptidylprolyl isomerase A (cyclophilin A) PPIA Hs.342389 R69858 0.7845 1983 -1 0.07 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide YWHAH Hs.349530 AA213820 0.4306 1984 1 0.8 - - Hs.256533 R36505 0.4593 1984 1 0.8 ESTs ESTs Hs.271945 R15444 0.4691 1984 -1 0.53 - - Hs.69476 N34766 0.4993 1984 -1 0.67 Mannosidase, alpha, class 2A, member 2 MAN2A2 Hs.295605 R25303 0.541 1984 -1 0.6 Hypothetical protein MGC10940 MGC10940 Hs.47986 R70771 0.5199 1985 -1 0.67 Ubiquitin specific protease 11 USP11 Hs.171501 H79770 0.4593 1986 -1 0.67 Ret finger protein RFP Hs.142653 AA053306 0.5096 1986 -1 0.6 Polyglutamine binding protein 1 PQBP1 Hs.30570 N78617 0.6409 1987 -1 0.3 Phosphodiesterase 5A, cGMP-specific PDE5A Hs.139271 R89118 0.4691 1988 1 0.67 Alpha-fetoprotein AFP Hs.155421 R35372 0.5096 1988 1 0.53 Tetracycline transporter-like protein TETRAN Hs.157145 H16647 0.5096 1988 -1 0.67 Solute carrier family 27 (fatty acid transporter), member 4 SLC27A4 Hs.248953 R44372 0.5199 1988 1 0.87 KIAA1322 protein KIAA1322 Hs.72242 R55690 0.5844 1988 1 0.73 Ninein (GSK3B interacting protein) NIN Hs.44054 N73756 0.5304 1989 1 0.6 KIAA0628 gene product KIAA0628 Hs.43133 AA037760 0.4593 1990 1 0.8 Hypothetical protein MGC1203 MGC1203 Hs.17987 R35019 0.5304 1990 1 0.67 - - Hs.24906 H69656 0.6524 1990 1 0.4 Nuclear prelamin A recognition factor NARF Hs.256526 R36697 0.6641 1990 1 0.47 START domain containing 3 STARD3 Hs.77628 W37211 0.5625 1991 -1 0.4 S100 calcium binding protein A13 S100A13 Hs.14331 W60229 0.5844 1991 1 0.47 Hypothetical protein FLJ20093 FLJ20093 Hs.172572 R24513 0.9359 1991 -1 0.07 Low density lipoprotein receptor-related protein 6 LRP6 Hs.23672 AA047471 0.6294 1992 1 0.4 Nucleolar protein GU2 GU2 Hs.7392 W91913 0.4306 1993 -1 0.87 SNARE protein Ykt6 YKT6 Hs.296244 H81266 0.5304 1995 -1 0.67 Retinol dehydrogenase 5 (11-cis and 9-cis) RDH5 Hs.172914 W86640 0.541 1995 -1 0.47 Receptor (TNFRSF)-interacting serine-threonine kinase 1 RIPK1 Hs.296327 R01226 0.8469 1995 1 0.4 - - Hs.348515 R70391 0.5625 1996 1 0.47 Ribonuclease/angiogenin inhibitor RNH Hs.75108 R83613 0.44 1997 -1 0.87 Cyclin G associated kinase GAK Hs.153227 R63034 0.4791 1997 -1 0.47 Zinc finger protein 185 (LIM domain) ZNF185 Hs.16622 AA056174 0.5844 1997 -1 0.53 KIAA0082 protein KIAA0082 Hs.154045 AA055968 0.7355 1998 -1 0.47 Synuclein, gamma (breast cancer-specific protein 1) SNCG Hs.349470 W90242 0.44 1999 1 0.67 Chromosome 14 open reading frame 1 C14orf1 Hs.15106 AA031411 0.4496 1999 1 0.73 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318 T88001 0.4891 1999 1 0.67 ESTs ESTs Hs.294105 H00874 0.4891 2000 1 0.73 - - Hs.295789 R45428 0.5625 2001 1 0.53 DnaJ (Hsp40) homolog, subfamily A, member 1 DNAJA1 Hs.94 AA210772 0.6294 2001 1 0.4 Hypothetical protein FLJ22611 FLJ22611 Hs.27774 AA028107 0.6524 2002 -1 0.33 HLA-B associated transcript 2 BAT2 Hs.25911 N69470 0.5625 2003 1 0.6 Hypothetical protein FLJ10569 FLJ10569 Hs.5105 R17445 0.5625 2004 1 0.4 Hypothetical protein MGC10854 MGC10854 Hs.22222 W90600 0.5625 2004 1 0.6 CGI-92 protein COQ4 Hs.20159 AA029895 0.7477 2004 1 0.2 Fibrillarin FBL Hs.99853 W88447 0.3508 2005 -1 0.9 Cell growth regulatory with ring finger domain CGR19 Hs.59106 T82265 0.3939 2005 1 1 Nudix (nucleoside diphosphate linked moiety X)-type motif 4 NUDT4 Hs.92381 AA029848 0.44 2005 1 0.67 Excision repair cross-complementing rodent repair deficiency, complementation group 5 ERCC5 Hs.48576 H15272 0.6294 2005 1 0.43 - - Hs.194478 N24811 0.6409 2005 1 0.33 Rho GTPase activating protein 5 ARHGAP5 Hs.267831 W47662 0.7722 2005 -1 0.53 Modulator recognition factor I MRF-1 Hs.920 R61363 0.5304 2006 -1 0.67 - - Hs.117530 H58459 0.5844 2007 1 0.53 Glycosyltransferase AD-017 AD-017 Hs.283737 H15461 0.5955 2007 1 0.4 - - Hs.323409 R77592 0.44 2008 1 0.67 Chromatin accessibility complex 1 CHRAC1 Hs.279704 R24277 0.5625 2008 -1 0.73 RAB40C, member RAS oncogene family RAB40C Hs.31408 R53547 0.5625 2009 1 0.47 Elongation factor for selenoprotein translation SELB Hs.6522 R25090 0.7114 2009 1 0.33 - -- H78789 0.3677 2010 -1 0.8 KIAA0241 protein KIAA0241 Hs.150275 AA040028 0.4593 2010 -1 0.67 Hypothetical protein BC014641 LOC129138 Hs.135259 R19007 0.9103 2010 1 0.2 Lysosomal apyrase-like protein 1 LALP1 Hs.22604 N69097 0.4791 2011 1 0.6 - -- W85877 0.385 2013 -1 0.93 PR/SET domain containing protein 07 SET07 Hs.111988 R28059 0.4691 2013 -1 0.8 Breast carcinoma amplified sequence 2 BCAS2 Hs.22960 N73898 0.5096 2014 1 0.67 - - Hs.220656 R22945 0.5955 2016 -1 0.53 Hypothetical protein FLJ14511 FLJ14511 Hs.40919 N64474 0.4212 2017 -1 0.8 Protein phosphatase 4, regulatory subunit 2 PPP4R2 Hs.356686 H63542 0.7477 2017 -1 0.27 Upstream binding protein 1 (LBP-1a) UBP1 Hs.28423 T97303 0.4891 2018 1 0.67 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773 N69412 1 2018 1 0.1 - -- T89503 0.4791 2019 1 0.8 Hypothetical protein FLJ14166 FLJ14166 Hs.14070 W40179 0.5625 2019 1 0.67 APEX nuclease (multifunctional DNA repair enzyme) APEX Hs.73722 T94105 0.8976 2019 -1 0.13 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 ABCC1 Hs.89433 N92911 0.4691 2020 -1 0.57 Hypothetical protein dJ473B4 DJ473B4 Hs.57549 W40265 0.7114 2020 -1 0.47 NEFA-interacting nuclear protein NIP30 NIP30 Hs.285017 T95687 0.3677 2021 -1 0.87 RAP1, GTP-GDP dissociation stimulator 1 RAP1GDS1 Hs.7940 AA036631 0.5517 2021 -1 0.53 Esophageal cancer related gene 4 protein ECRG4 Hs.43125 H99843 0.6409 2021 1 0.4 Quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase (carboxylating)) QPRT Hs.8935 N49027 0.3345 2022 -1 0.87 KIAA0460 protein KIAA0460 Hs.29956 N78331 0.385 2023 -1 0.87 Activator of basal transcription 1 ABT1 Hs.109428 R48805 0.4993 2023 -1 0.57 ESTs ESTs Hs.25577 T85994 0.3508 2024 -1 0.93 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa NDUFB4 Hs.227750 AA059052 0.541 2025 -1 0.53 ARP1 actin-related protein 1 homolog B, centractin beta (yeast) ACTR1B Hs.2477 N44136 0.541 2025 -1 0.47 Kinesin family member 1B KIF1B Hs.375193 H72512 0.3677 2026 1 0.73 HSPC023 protein HSPC023 Hs.279945 R96393 0.5517 2027 -1 0.53 ESTs ESTs Hs.184721 R76890 0.618 2027 1 0.6 KIAA1340 protein KIAA1340 Hs.51743 R34571 0.4993 2028 -1 0.53 Hypothetical protein FLJ20136 FLJ20136 Hs.24817 N71255 0.6758 2028 1 0.27 SAC2 suppressor of actin mutations 2-like (yeast) SACM2L Hs.169407 R78728 0.618 2029 1 0.6 Kelch-like 5 (Drosophila) KLHL5 Hs.272239 W90163 0.6294 2029 -1 0.33 RA-regulated nuclear matrix-associated protein RAMP Hs.126774 H26760 0.7477 2029 1 0.27 KIAA0375 gene product KIAA0375 Hs.26951 R38335 0.4306 2030 -1 0.73 Ribonuclease H2, large subunit RNASEH2A Hs.25292 R35559 0.4306 2030 -1 0.93 T-cell activation protein PGR1 Hs.285902 N75331 0.4791 2030 -1 0.67 - - Hs.50600 N20908 0.5304 2030 -1 0.47 Baculoviral IAP repeat-containing 6 (apollon) BIRC6 Hs.250646 R19011 0.5625 2031 -1 0.73 - -- H19443 0.7355 2033 1 0.2 MAP/microtubule affinity-regulating kinase 2 MARK2 Hs.157199 N67741 0.7969 2033 1 0.27 DKFZP586D0919 protein DKFZP586D091Hs.49378 H49954 0.6067 2034 1 0.4 Hypothetical protein FLJ23469 FLJ23469 Hs.103833 T72663 0.4306 2036 1 0.73 - -- W74647 0.4891 2037 -1 0.53 Melanoma inhibitory activity MIA Hs.279651 T86470 0.4306 2038 1 0.53 - -- H75843 0.7114 2039 -1 0.27 Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived); ribosomal protein S30 FAU Hs.177415 N21349 0.5304 2042 -1 0.67 Protein kinase, cAMP-dependent, catalytic, alpha PRKACA Hs.77271 W47099 0.4029 2043 -1 0.93 CGI-63 protein LOC51102 Hs.19513 H77938 0.5625 2043 1 0.67 Eukaryotic translation termination factor 1 ETF1 Hs.77324 AA044244 0.6067 2043 1 0.33 - - Hs.275038 T86360 0.9231 2043 -1 0.07 ESTs ESTs Hs.15266 H15020 0.3265 2045 -1 1 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) GCN1L1 Hs.75354 N94610 0.4691 2045 1 0.73 Hypothetical protein BC010734 LOC147632 Hs.48821 H83830 0.4029 2046 1 0.87 KIAA1096 protein KIAA1096 Hs.69559 H45525 0.4891 2046 -1 0.73 Ras homolog gene family, member G (rho G) ARHG Hs.75082 N64545 0.5844 2046 -1 0.6 Flightless I homolog (Drosophila) FLII Hs.83849 AA151400 0.9231 2046 -1 0.07 - - Hs.379188 H06635 0.541 2047 1 0.6 Integrin, alpha 6 ITGA6 Hs.227730 H93017 0.9615 2047 -1 0.03 Enoyl Coenzyme A hydratase 1, peroxisomal ECH1 Hs.196176 R14297 0.3508 2048 1 1 RAS-like, estrogen-regulated, growth-inhibitor RERG Hs.21594 H56735 0.3592 2048 1 0.93 Hypothetical protein FLJ13611 FLJ13611 Hs.282958 R48450 0.5096 2048 1 0.53 KIAA1055 protein KIAA1055 Hs.126084 H23019 0.7234 2048 1 0.33 - - Hs.28005 R18865 0.7599 2048 1 0.2 - -- AA011604 0.3763 2049 -1 0.73 - - Hs.278312 AA037862 0.4691 2049 -1 0.73 Nucleotide-sugar transporter similar to C. elegans sqv-7 SQV7L Hs.90078 N23302 0.5844 2049 1 0.53 Lysyl oxidase LOX Hs.102267 W40409 0.8344 2050 1 0.2 Lysyl-tRNA synthetase KARS Hs.3100 N63983 0.8849 2052 -1 0.07 O-linked mannose beta1,2-N-acetylglucosaminyltransferase FLJ20277 Hs.183860 R69935 0.6409 2055 1 0.47 - -- R34732 0.7477 2055 -1 0.2 Cadherin 8, type 2 CDH8 Hs.79133 H03214 0.8093 2055 -1 0.27 Hypothetical protein FLJ14681 FLJ14681 Hs.23317 R31300 0.44 2056 1 0.8 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 CDS1 Hs.152981 AA045331 0.4496 2056 -1 0.67 ADP-ribosylation factor 4-like ARF4L Hs.183153 N48309 0.5517 2056 1 0.6 Hypothetical protein MGC8721 MGC8721 Hs.279921 W03282 0.6876 2056 -1 0.47 Dihydrofolate reductase DHFR Hs.83765 R02669 0.4593 2057 1 0.8 Adaptor-related protein complex 3, beta 1 subunit AP3B1 Hs.155172 R20548 0.5199 2057 1 0.67 ESTs ESTs Hs.21119 R73881 0.8976 2057 1 0.17 ATP-binding cassette, sub-family D (ALD), member 3 ABCD3 Hs.76781 AA029275 0.412 2058 -1 0.8 HTPAP protein HTPAP Hs.169341 T82048 0.5517 2058 -1 0.53 Endothelial differentiation-related factor 1 EDF1 Hs.174050 AA053311 0.6294 2058 -1 0.47 KIAA0233 gene product KIAA0233 Hs.79077 H15158 0.7845 2059 -1 0.4 HSPC166 protein HSPC166 Hs.279836 N66546 0.5844 2060 -1 0.27 KIAA0355 gene product KIAA0355 Hs.186840 N93342 0.8218 2060 -1 0.17 BCL-6 interacting corepressor BCoR Hs.130732 W03758 0.4593 2061 -1 0.73 - - Hs.141278 W80729 0.5304 2061 -1 0.63 - -- AA128128 0.7845 2061 -1 0.27 V-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 YES1 Hs.194148 W91912 0.7477 2062 -1 0.4 G protein-coupled receptor kinase-interactor 2 GIT2 Hs.57734 AA136669 0.4029 2063 1 0.9 - - Hs.374535 N68511 0.3426 2064 -1 0.93 Hypothetical protein FLJ12085 FLJ12085 Hs.48827 H50774 0.8849 2064 1 0.07 Similar to S. cerevisiae Sec6p and R. norvegicus rsec6 SEC6 Hs.8088 AA044631 0.5096 2065 1 0.73 - -- R80770 0.5734 2065 1 0.67 Hypothetical protein C40 C40 Hs.30819 AA055329 0.7599 2065 -1 0.27 - - Hs.351561 T79588 0.4496 2067 1 0.67 CCR4-NOT transcription complex, subunit 3 CNOT3 Hs.343571 R77671 0.9743 2067 0 0 - - Hs.20787 W68344 0.5517 2068 -1 0.6 Chromosome 7 open reading frame 3 C7orf3 Hs.334540 AA039228 0.9487 2068 1 0.13 Farnesyltransferase, CAAX box, beta FNTB Hs.276 H15178 0.4306 2070 -1 0.73 - - Hs.352358 AA135644 0.4791 2070 -1 0.8 - - Hs.323511 H89883 0.5096 2070 -1 0.67 KIAA0102 gene product KIAA0102 Hs.77665 AA127218 0.5625 2070 1 0.67 ESTs ESTs Hs.71058 T74721 0.44 2071 -1 0.8 ZYG homolog ZYG Hs.29285 T58031 0.541 2073 1 0.63 - - Hs.344478 W70006 0.7722 2073 1 0.13 Cell division cycle 25B CDC25B Hs.153752 AA057495 0.4496 2074 -1 0.8 EGF-containing fibulin-like extracellular matrix protein 1 EFEMP1 Hs.76224 T81752 0.5625 2074 -1 0.57 Gemin 5 GEMIN5 Hs.25882 H19093 0.5517 2076 1 0.53 - - Hs.330310 N63996 0.618 2077 1 0.27 ESTs ESTs Hs.289083 N70759 0.4029 2078 -1 0.73 Zinc-finger protein DZIP1 DZIP1 Hs.60177 R88085 0.541 2078 1 0.53 Quiescin Q6 QSCN6 Hs.77266 AA010246 0.5955 2078 1 0.57 Hypothetical protein FLJ10890 FLJ10890 Hs.17283 R75983 0.7845 2078 1 0.47 Serologically defined colon cancer antigen 28 SDCCAG28 Hs.84700 AA031933 0.8218 2078 1 0.2 Estrogen-related receptor alpha ESRRA Hs.110849 N59459 0.9103 2079 1 0.13 Muscleblind-like protein MBLL39 MBLL39 Hs.283609 N/A1 0.4891 2080 -1 0.73 - -- AA040084 0.9743 2080 0 0 - - Hs.25144 T86348 0.44 2081 1 0.93 Glycine amidinotransferase (L-arginine:glycine amidinotransferase) GATM Hs.75335 AA210722 0.6294 2081 1 0.47 - - Hs.117920 W39690 0.5625 2082 1 0.67 Dickkopf homolog 1 (Xenopus laevis) DKK1 Hs.40499 N75518 0.5955 2082 1 0.4 Translocated promoter region (to activated MET oncogene) TPR Hs.169750 N28966 0.618 2082 -1 0.6 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262 AA059245 0.5955 2084 1 0.67 ESTs ESTs Hs.32713 R42028 0.5096 2085 -1 0.67 Nardilysin (N-arginine dibasic convertase) NRD1 Hs.4099 N35011 0.5096 2085 -1 0.67 - - Hs.20797 AA057305 0.412 2086 -1 0.87 - -- H02545 0.5517 2086 1 0.6 ESTs ESTs Hs.191170 R75598 0.6641 2086 -1 0.27 Neuroblastoma, suppression of tumorigenicity 1 NBL1 Hs.76307 R77518 0.44 2088 1 0.73 DKFZP434D1335 protein DKFZP434D133Hs.8258 R52816 0.5625 2088 1 0.53 Reticulon 3 RTN3 Hs.252831 N51733 0.618 2088 1 0.33 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 CTDP1 Hs.4076 W43007 0.7845 2089 1 0.13 Pregnancy specific beta-1-glycoprotein 5 PSG5 Hs.251850 H58438 0.7114 2090 -1 0.33 High-mobility group 20B HMG20B Hs.32317 H26021 0.4791 2091 1 0.8 - - Hs.136235 AA099404 0.5625 2091 -1 0.47 Hypothetical protein MGC22793 MGC22793 Hs.293937 H15851 0.4593 2092 1 0.8 Hypothetical protein FLJ31821 FLJ31821 Hs.351575 R60545 0.5844 2092 1 0.47 Similar to RIKEN cDNA 2610036L13 MGC16386 Hs.23044 R28095 0.8596 2092 1 0.27 Solute carrier family 12 (potassium/chloride transporters), member 4 SLC12A4 Hs.10094 H56543 0.6067 2093 1 0.47 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein MCM3AP Hs.168481 AA004506 0.6409 2093 1 0.4 LanC lantibiotic synthetase component C-like 2 (bacterial) LANCL2 Hs.134342 N74655 0.6524 2094 1 0.13 ESTs ESTs Hs.35064 R62751 0.412 2095 -1 0.8 Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro) SSA1 Hs.1042 N24115 0.6294 2095 -1 0.4 - - Hs.323780 R51840 0.6409 2095 1 0.6 - -- W32182 0.4496 2096 1 0.67 Hypothetical protein MGC2574 MGC2574 Hs.4253 N55329 0.4691 2097 -1 0.73 Anaphase-promoting complex subunit 7 APC7 Hs.52763 R25036 0.618 2097 1 0.6 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 NDST1 Hs.20894 N53948 0.7477 2097 -1 0.27 - - Hs.176686 AA058864 0.4496 2099 -1 0.73 Adenylosuccinate synthase ADSS Hs.90011 AA069424 0.6995 2099 -1 0.33 ESTs ESTs Hs.20573 AA115737 0.8218 2099 1 0.27 Solute carrier family 2 (facilitated glucose transporter), member 10 SLC2A10 Hs.305971 N41921 0.4212 2100 -1 0.8 - - Hs.33264 N34202 0.4306 2100 1 0.67 - - Hs.275732 AA098907 0.5734 2100 1 0.6 Aminolevulinate, delta-, synthase 1 ALAS1 Hs.78712 AA046915 0.6294 2100 -1 0.4 Eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa EIF3S5 Hs.7811 N22974 0.5625 2101 -1 0.27 Brain expressed, X-linked 1 BEX1 Hs.334370 N32327 0.6524 2101 1 0.4 Cleavage and polyadenylation specific factor 5, 25 kDa CPSF5 Hs.9605 R67271 0.7355 2101 1 0.3 Hypothetical protein FLJ13089 FLJ13089 Hs.285711 W69443 0.44 2102 1 0.73 High-mobility group nucleosome binding domain 1 HMGN1 Hs.251064 AA053850 0.7969 2102 -1 0.13 Nucleosome assembly protein 1-like 1 NAP1L1 Hs.302649 N71548 0.5199 2104 -1 0.67 CDC42 binding protein kinase beta (DMPK-like) CDC42BPB Hs.12908 R20384 0.5304 2105 1 0.6 Leucine carboxyl methyltransferase LCMT Hs.8054 R96766 0.5625 2105 1 0.33 Sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A SEMA6A Hs.263395 AA031836 0.5844 2105 -1 0.6 ESTs ESTs Hs.131714 R51914 0.5955 2107 -1 0.4 CGI-87 protein LOC51112 Hs.5008 R60261 0.7234 2107 1 0.2 Slingshot 2 SSH2 Hs.25127 W45561 0.8976 2107 -1 0.2 Centromere protein B, 80kDa CENPB Hs.85004 W47533 0.5734 2109 -1 0.5 A disintegrin and metalloproteinase domain 9 (meltrin gamma) ADAM9 Hs.2442 T75241 0.7355 2109 -1 0.27 Plasminogen activator, urokinase receptor PLAUR Hs.179657 H08236 0.4496 2110 1 0.93 KIAA1096 protein KIAA1096 Hs.69559 T79552 0.541 2110 1 0.4 ESTs ESTs Hs.14585 AA045760 0.618 2110 -1 0.4 Thyroid hormone receptor interactor 10 TRIP10 Hs.73999 R25275 0.5096 2112 1 0.6 ESTs ESTs Hs.356211 AA115291 0.7599 2113 -1 0.4 Epidermal growth factor receptor pathway substrate 15 EPS15 Hs.79095 T74240 0.4593 2114 1 0.6 Heat shock 70kDa protein 1B HSPA1B Hs.274402 H93344 0.5625 2114 -1 0.63 - - Hs.41877 AA099734 0.4791 2115 -1 0.87 Ribosomal protein L36a-like RPL36AL Hs.336628 R92111 0.6409 2115 -1 0.33 - -- R06046 0.7599 2115 -1 0.33 KIAA1143 protein KIAA1143 Hs.173042 AA046082 0.541 2118 -1 0.63 - -- H96054 0.618 2118 -1 0.47 Glia maturation factor, beta GMFB Hs.151413 R05817 0.5199 2119 1 0.67 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa NDUFA7 Hs.19561 H25699 0.5734 2119 1 0.73 Opa-interacting protein 2 OIP2 Hs.274170 H78385 0.4593 2120 -1 0.53 Huntingtin interacting protein 2 HIP2 Hs.155485 N69433 0.6294 2120 -1 0.33 KIAA0212 gene product KIAA0212 Hs.154332 H95277 0.4593 2121 1 0.67 - - Hs.16773 H38961 0.5517 2122 1 0.6 ADP-ribosylation factor 3 ARF3 Hs.119177 N68959 0.7114 2122 1 0.4 Adenylate cyclase 6 ADCY6 Hs.12373 H19488 0.618 2123 1 0.6 - - Hs.194081 N90171 0.7114 2125 -1 0.4 C-myc binding protein MYCBP Hs.78221 H30857 0.4993 2126 1 0.6 MutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) MLH1 Hs.57301 N98550 0.6995 2127 -1 0.53 TRAM-like protein KIAA0057 Hs.153954 H10461 0.385 2128 -1 0.67 Tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 TNKS2 Hs.280776 R80974 0.5734 2128 -1 0.47 WEE1+ homolog (S. pombe) WEE1 Hs.75188 N90030 0.4496 2129 1 0.73 - -- W90295 0.6409 2129 -1 0.33 Erbb2 interacting protein ERBB2IP Hs.8117 R88887 0.6758 2129 1 0.23 FLJ00005 protein FLJ00005 Hs.367690 T89676 0.6995 2130 1 0.2 Plasminogen activator, urokinase PLAU Hs.77274 AA036972 0.8596 2130 -1 0.33 Pre-mRNA splicing factor 17 PRP17 Hs.116674 N35908 0.7845 2131 -1 0.27 - - Hs.171553 R83875 0.5096 2132 -1 0.73 ATP-binding cassette, sub-family B (MDR/TAP), member 10 ABCB10 Hs.1710 W90777 0.7599 2132 -1 0.27 Interferon regulatory factor 2 IRF2 Hs.83795 R67624 0.6409 2133 1 0.33 Erythrocyte membrane protein band 4.1-like 1 EPB41L1 Hs.26395 N44874 0.4691 2134 1 0.6 Ubiquitin-protein isopeptide ligase (E3) KIAA0010 Hs.155287 H93850 0.9103 2134 1 0.2 Extracellular link domain containing 1 XLKD1 Hs.17917 R22904 0.5517 2135 -1 0.67 8D6 antigen 8D6A Hs.106196 R93572 0.5734 2135 -1 0.6 - -- AA127936 0.6524 2135 -1 0.53 Ubiquitin-conjugating enzyme E2 variant 1 UBE2V1 Hs.75875 R14138 0.6524 2135 1 0.23 - -- H06281 0.4891 2136 -1 0.6 Hypothetical protein FLJ10737 FLJ10737 Hs.261134 N30278 0.6758 2136 1 0.4 KIAA0872 protein KIAA0872 Hs.40109 N72504 0.8976 2137 1 0.2 Ferrochelatase (protoporphyria) FECH Hs.26 AA039927 0.5625 2138 -1 0.53 - - Hs.356843 N70221 0.6409 2138 -1 0.33 KIAA0500 protein KIAA0500 Hs.301478 T58682 0.7845 2138 -1 0.33 Chromosome 1 open reading frame 16 C1orf16 Hs.15087 AA037249 0.4691 2140 -1 0.8 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ATP5C1 Hs.155433 H79311 0.5304 2140 -1 0.57 - -- AA034977 0.618 2140 1 0.47 - -- AA147566 0.8469 2140 -1 0.27 - -- N36351 0.8596 2140 1 0.2 Connective tissue growth factor CTGF Hs.75511 T72619 0.9231 2140 -1 0.2 - - Hs.373588 AA034480 0.5734 2141 1 0.53 Mannose-6-phosphate receptor (cation dependent) M6PR Hs.75709 R87681 0.7114 2141 1 0.5 MUF1 protein MUF1 Hs.172210 W47525 0.5096 2142 -1 0.67 - - Hs.110771 AA054757 0.5517 2142 1 0.53 Zinc finger protein 226 ZNF226 Hs.145956 H44964 0.618 2145 1 0.33 FK506 binding protein 14, 22 kDa FKBP14 Hs.264636 H64559 0.7114 2145 1 0.27 - -- N27190 0.5625 2146 1 0.47 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) UCHL3 Hs.77917 AA010007 0.4691 2147 -1 0.8 - - Hs.222505 R07284 0.7234 2147 1 0.4 Hypothetical protein SP329 SP329 Hs.19928 H37821 0.5304 2148 1 0.53 - -- AA037306 0.7114 2148 1 0.53 - - Hs.169872 AA005304 0.541 2149 1 0.53 BTB (POZ) domain containing 3 BTBD3 Hs.7935 R77688 0.5517 2149 1 0.6 HSPC003 protein HSPC003 Hs.351629 AA029014 0.9103 2149 -1 0.13 ESTs ESTs Hs.58373 AA029857 0.6995 2150 -1 0.27 RAD1 homolog (S. pombe) RAD1 Hs.7179 H01255 0.6409 2151 1 0.33 Ceroid-lipofuscinosis, neuronal 5 CLN5 Hs.30213 H00517 0.5304 2153 -1 0.63 Chromosome 21 open reading frame 63 C21orf63 Hs.30156 H99841 0.9487 2153 0 0 V-ski sarcoma viral oncogene homolog (avian) SKI Hs.2969 N75060 0.4306 2154 1 0.87 Coatomer protein complex, subunit beta COPB Hs.3059 R52388 0.8218 2155 1 0.13 KIAA1363 protein KIAA1363 Hs.22941 AA053299 0.8469 2155 -1 0.33 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30, EL32 and G344) CD59 Hs.278573 N20641 0.4496 2156 1 0.8 Chromosome 5 open reading frame 5 C5orf5 Hs.82035 AA045404 0.541 2156 1 0.47 Squamous cell carcinoma antigen recognized by T cell SART2 Hs.58636 T97916 0.7114 2156 -1 0.53 ESTs ESTs Hs.191184 N52670 0.5517 2157 1 0.73 Likely ortholog of mouse exportin 4 XPO4 Hs.117102 AA005131 0.4691 2158 -1 0.67 - - Hs.37372 N93225 0.541 2158 1 0.73 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919 N80287 0.5844 2158 1 0.47 KIAA1357 protein KIAA1357 Hs.170162 AA056762 0.4593 2159 -1 0.8 - -- R54733 0.8596 2159 1 0.07 - - Hs.299119 H68528 0.6294 2160 -1 0.37 Hypothetical protein FLJ32499 FLJ32499 Hs.27475 N64620 0.4212 2162 -1 0.87 Ribosomal protein S6 kinase, 90kDa, polypeptide 2 RPS6KA2 Hs.301664 R72184 0.5199 2162 -1 0.47 Hypothetical protein FLJ10948 FLJ10948 Hs.9670 AA213820 0.5955 2162 1 0.33 - - Hs.256533 T79185 0.412 2163 1 0.8 - -- N25294 0.6294 2163 -1 0.4 Collagen, type XVI, alpha 1 COL16A1 Hs.26208 AA148720 0.8596 2164 -1 0.07 PTPL1-associated RhoGAP 1 PARG1 Hs.70983 AA053141 0.8722 2164 -1 0.13 CGI-31 protein LOC51075 Hs.279861 W69683 0.4593 2165 1 0.53 Nuclear factor (erythroid-derived 2)-like 1 NFE2L1 Hs.83469 H80175 0.5199 2165 1 0.8 Radixin RDX Hs.263671 H27730 0.4791 2166 1 0.87 Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform PPP2R1B Hs.108705 AA026748 0.8849 2166 -1 0.13 Phosphoinositide-3-kinase, class 2, alpha polypeptide PIK3C2A Hs.249235 AA101919 0.4891 2167 1 0.73 Phosphofructokinase, muscle PFKM Hs.75160 W07427 0.541 2167 -1 0.43 - - Hs.380100 H65158 0.5955 2167 -1 0.47 Tumor susceptibility gene 101 TSG101 Hs.118910 H05457 0.618 2168 1 0.4 - -- W91999 0.9615 2168 -1 0.17 Mitogen-activated protein kinase-activated protein kinase 5 MAPKAPK5 Hs.30327 W90594 0.4593 2169 -1 0.87 Hypothetical protein FLJ21174 FLJ21174 Hs.194329 H27334 0.5844 2169 1 0.4 Discoidin domain receptor family, member 1 DDR1 Hs.75562 AA033875 0.6067 2169 1 0.47 Similar to yeast Upf3, variant A UPF3A Hs.274412 AA128275 0.6067 2170 -1 0.47 - -- N77814 0.6758 2170 1 0.33 C-src tyrosine kinase CSK Hs.77793 R70894 0.7234 2170 -1 0.27 TGFB-induced factor (TALE family homeobox) TGIF Hs.90077 AA150894 0.5517 2171 -1 0.47 Guanine nucleotide binding protein 11 GNG11 Hs.83381 N92357 0.4791 2175 -1 0.8 - - Hs.311977 H23410 0.5955 2175 -1 0.53 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041 AA039454 0.7722 2175 -1 0.33 Split hand/foot malformation (ectrodactyly) type 3 SHFM3 Hs.24307 H00836 0.44 2176 1 0.87 A kinase (PRKA) anchor protein 2 AKAP2 Hs.42322 N78859 0.5199 2176 1 0.53 Myosin, light polypeptide 4, alkali; atrial, embryonic MYL4 Hs.356717 R36593 0.412 2177 -1 0.93 Hypothetical protein FLJ20445 FLJ20445 Hs.343748 R76434 0.8849 2177 1 0.13 Hypothetical protein FLJ31153 FLJ31153 Hs.350424 R80191 1 2178 0 0 Microtubule-associated protein, RP/EB family, member 3 MAPRE3 Hs.172740 R60395 0.4593 2179 -1 0.7 - - Hs.378718 R22218 0.5955 2179 1 0.53 Hypothetical protein FLJ10983 FLJ10983 Hs.23363 H52225 0.541 2180 -1 0.73 TGF beta receptor associated protein -1 TRAP-1 Hs.101766 R66397 0.7969 2181 1 0.27 KH domain containing, RNA binding, signal transduction associated 1 KHDRBS1 Hs.119537 R24223 0.7969 2181 1 0.13 Hypothetical protein FLJ21069 FLJ21069 Hs.341806 N92723 0.8344 2181 -1 0.37 ARF GTPase-activating protein MRIP2 Hs.356559 H42140 0.5734 2182 -1 0.6 - - Hs.12311 H12056 0.6067 2182 -1 0.47 - - Hs.95734 H92944 0.9743 2182 1 0.07 - -- H12745 0.7477 2183 1 0.13 Zinc finger protein 148 (pHZ-52) ZNF148 Hs.355866 H14478 0.5199 2184 1 0.6 Seven in absentia homolog 1 (Drosophila) SIAH1 Hs.295923 R62727 0.6641 2185 1 0.4 Ankyrin repeat, family A (RFXANK-like), 2 ANKRA2 Hs.239154 R47922 0.9872 2185 0 0 Hypothetical protein FLJ22341 FLJ22341 Hs.25485 R77735 0.4593 2187 1 0.87 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease) CLN2 Hs.20478 W03747 0.6409 2187 -1 0.4 TBC1 domain family, member 5 TBC1D5 Hs.115740 AA101861 0.9231 2189 -1 0.27 Heat shock transcription factor 4 HSF4 Hs.75486 R71002 0.6294 2190 1 0.47 ESTs ESTs Hs.10957 AA047157 0.4993 2191 1 0.7 Kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocyte antigen, antigen detected by monocKAI1 Hs.323949 W38744 0.5844 2191 1 0.63 Homeodomain interacting protein kinase 3 HIPK3 Hs.30148 H17401 0.5304 2192 1 0.67 Hypothetical protein HSPC232 HSPC232 Hs.281428 AA028907 0.5517 2192 1 0.73 - - Hs.34447 W68810 0.6067 2192 1 0.47 - - Hs.381134 H98809 0.7722 2192 -1 0.27 Poly(A) binding protein, cytoplasmic 1 PABPC1 Hs.172182 R78873 0.4306 2193 -1 0.73 ESTs ESTs Hs.29822 R79545 0.5304 2193 1 0.6 WD-repeat protein HAN11 Hs.288283 N95162 0.6067 2193 1 0.6 Cytochrome c oxidase subunit Va COX5A Hs.323834 T91710 0.6524 2193 -1 0.47 Intersectin 2 ITSN2 Hs.166184 AA035361 0.8976 2193 -1 0.2 Signal transducer and activator of transcription 1, 91kDa STAT1 Hs.21486 H95498 0.4691 2194 1 0.67 ESTs ESTs Hs.42041 N64388 0.8596 2194 -1 0.07 Nuclear receptor subfamily 4, group A, member 1 NR4A1 Hs.1119 AA047076 0.9487 2194 0 0 Cytochrome b5 reductase b5R.2 LOC51700 Hs.22142 R31356 0.7845 2195 1 0.2 RE1-silencing transcription factor REST Hs.227630 N44670 0.5304 2196 1 0.53 Growth arrest-specific 6 GAS6 Hs.78501 AA150973 0.4791 2197 1 0.73 Hypothetical protein MGC10812 MGC10812 Hs.4188 H18934 0.5517 2197 1 0.5 Ribosomal large subunit pseudouridine synthase C like RLUCL Hs.101742 R20008 0.7477 2197 -1 0.13 N-acetylglucosaminidase, alpha- (Sanfilippo disease IIIB) NAGLU Hs.50727 N36780 0.7722 2197 -1 0.13 Carbonyl reductase 1 CBR1 Hs.88778 H08451 0.7845 2197 -1 0.2 CDC-like kinase 1 CLK1 Hs.2083 R17999 0.4791 2198 1 0.73 Hypothetical protein FLJ20371 FLJ20371 Hs.267566 AA149233 0.5625 2198 -1 0.53 Prostaglandin E synthase PTGES Hs.146688 W24560 0.5304 2199 -1 0.67 Pleiomorphic adenoma gene-like 2 PLAGL2 Hs.154104 N21274 0.5199 2200 1 0.73 Nucleoporin 153kDa NUP153 Hs.211608 W74233 0.4791 2202 1 0.87 Related RAS viral (r-ras) oncogene homolog RRAS Hs.9651 H49312 0.5517 2202 1 0.6 Cytoplasmic linker 2 CYLN2 Hs.104717 R88696 0.618 2202 1 0.5 Sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltraSIAT7D Hs.3972 N68686 0.4691 2203 -1 0.87 Hypothetical protein FLJ10486 FLJ10486 Hs.173946 N39367 0.5734 2205 -1 0.47 Hypothetical protein FLJ20085 FLJ20085 Hs.118964 R43963 0.6409 2205 -1 0.53 Hypothetical protein DKFZp761A052 DKFZp761A052 Hs.184029 R06151 0.6641 2205 1 0.47 Anaphase promoting complex subunit 5 ANAPC5 Hs.7101 AA203444 0.541 2206 1 0.63 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) COPS5 Hs.198767 AA099075 0.7114 2206 -1 0.33 Single stranded DNA binding protein 3 SSBP3 Hs.266914 H53989 0.8344 2206 1 0.27 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 SMARCD2 Hs.250581 N79754 0.4212 2207 -1 0.87 ElaC homolog 1 (E. coli) ELAC1 Hs.47572 R00277 0.618 2207 1 0.33 GS15 LOC51272 Hs.300631 R06572 0.8596 2207 0 0 Hypothetical protein MGC2550 MGC2550 Hs.169575 N75008 0.8976 2207 1 0.2 DKFZP564K247 protein DKFZP564K247 Hs.7917 N66238 0.5199 2208 -1 0.73 Matrix metalloproteinase 19 MMP19 Hs.154057 R17784 0.8218 2208 -1 0.23 ESTs ESTs Hs.21757 H09054 0.4691 2209 -1 0.67 DNA (cytosine-5-)-methyltransferase 1 DNMT1 Hs.77462 R53574 0.541 2209 -1 0.73 Microtubule associated testis specific serine/threonine protein kinase MAST205 Hs.101474 H13517 0.9231 2209 1 0.07 ADP-ribosylation factor-like 5 ARL5 Hs.342849 AA037843 0.4691 2210 -1 0.73 Transmembrane 4 superfamily member tetraspan NET-7 NET-7 Hs.95583 N91931 0.6067 2210 -1 0.3 NME7 NME7 Hs.274479 N46097 0.4791 2211 1 0.8 Biphenyl hydrolase-like (serine hydrolase; breast epithelial mucin-associated antigen) BPHL Hs.351334 H99854 0.5517 2211 -1 0.53 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428 R54762 0.5844 2211 -1 0.53 - - Hs.58582 W74506 0.5844 2211 -1 0.67 Casein kinase 1, alpha 1 CSNK1A1 Hs.283738 H21130 0.5955 2211 -1 0.33 Ran GTPase activating protein 1 RANGAP1 Hs.183800 T84193 0.6876 2211 -1 0.33 - - Hs.290241 AA044588 0.5955 2212 -1 0.4 Hypothetical protein FLJ11171 FLJ11171 Hs.72782 H54691 0.618 2212 1 0.5 Rho guanine nucleotide exchange factor (GEF) 12 ARHGEF12 Hs.6582 N30177 0.618 2212 1 0.53 - - Hs.25892 H29536 0.8722 2212 -1 0.07 BBP-like protein 1 BLP1 Hs.7471 N91458 0.4691 2213 1 0.73 T-cell activation WD repeat protein TA-WDRP Hs.175596 R91253 0.5955 2213 1 0.4 ESTs ESTs Hs.34395 N91148 0.4993 2214 -1 0.73 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184 AA058474 0.5096 2214 -1 0.67 Hypothetical protein DKFZp586C1924 DKFZp586C192 Hs.108338 R31387 0.5517 2214 -1 0.6 - -- W81709 0.6524 2214 -1 0.4 Ornithine aminotransferase (gyrate atrophy) OAT Hs.75485 H04946 0.4593 2215 1 0.8 Cytochrome c oxidase subunit Va COX5A Hs.323834 H45501 0.4593 2215 1 0.8 Hypothetical protein MGC10558 MGC10558 Hs.119498 R13073 0.5096 2216 1 0.6 Dual specificity phosphatase 7 DUSP7 Hs.296938 N92996 0.6409 2217 1 0.37 Retinoblastoma binding protein 7 RBBP7 Hs.31314 W60673 0.4691 2218 -1 0.77 Hypothetical protein FLJ21868 FLJ21868 Hs.46829 N62934 0.7234 2218 1 0.33 ESTs ESTs Hs.348421 AA045736 0.7599 2218 -1 0.37 KIAA1966 protein KIAA1966 Hs.158184 AA135745 0.5734 2219 1 0.6 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma CAMK2G Hs.12436 R10564 0.9359 2219 0 0 Sentrin/SUMO-specific protease 3 SENP3 Hs.118926 H61812 0.5096 2220 -1 0.6 Cyclin-dependent kinase 4 CDK4 Hs.95577 H03709 0.9487 2220 1 0.07 Hypothetical protein RP4-622L5 RP4-622L5 Hs.272299 T90647 0.6876 2222 1 0.53 - - Hs.193649 N47660 0.7845 2222 -1 0.47 Cyclin-dependent kinase inhibitor 1B (p27, Kip1) CDKN1B Hs.238990 N73980 0.4306 2223 -1 0.8 Keratin 8 KRT8 Hs.242463 N20321 0.9487 2223 1 0.13 Translocase of outer mitochondrial membrane 40 homolog (yeast) TOMM40 Hs.30928 W57882 0.4593 2225 1 0.67 Pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 PLEKHA4 Hs.9469 H69334 0.4791 2225 -1 0.87 Pirin PIR Hs.279663 AA059148 0.618 2225 1 0.53 KIAA1199 protein KIAA1199 Hs.50081 R70930 0.6524 2225 1 0.53 Sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase) SIAT4C Hs.75268 AA098888 0.4993 2226 -1 0.53 Eukaryotic translation termination factor 1 ETF1 Hs.77324 AA042817 0.5199 2226 1 0.73 Calmodulin 2 (phosphorylase kinase, delta) CALM2 Hs.182278 AA063138 0.5199 2226 -1 0.67 - - Hs.356659 AA035378 0.541 2227 1 0.7 - - Hs.11700 H46019 0.5199 2228 1 0.67 Hypothetical protein FLJ10201 FLJ10201 Hs.318127 N33745 0.4691 2229 -1 0.73 KIAA0841 protein KIAA0841 Hs.7426 H88063 0.6758 2229 -1 0.2 Chromosome 1 open reading frame 9 C1orf9 Hs.108636 AA213556 0.9103 2229 -1 0.07 - -- T84264 0.6641 2231 1 0.43 RAP2B, member of RAS oncogene family RAP2B Hs.239527 N89687 0.9743 2231 1 0.07 - - Hs.351597 AA128013 0.7234 2233 -1 0.2 - - Hs.261335 N21532 0.7845 2233 -1 0.2 - EST Hs.331630 W07170 0.3939 2234 -1 1 Hepatitis B virus x interacting protein HBXIP Hs.80464 N90203 0.6524 2234 -1 0.23 Hypothetical protein FLJ22347 FLJ22347 Hs.106004 N59340 0.9872 2234 1 0.07 Progesterone-induced blocking factor 1 PIBF1 Hs.43913 N31469 0.9231 2235 -1 0.13 NCK-associated protein 1 NCKAP1 Hs.278411 R79393 0.412 2237 1 0.67 Hypothetical protein FLJ25785 FLJ25785 Hs.9070 AA004838 0.5955 2238 -1 0.53 SOCS box-containing WD protein SWiP-1 WSB1 Hs.187991 N73101 0.6409 2238 1 0.27 Solute carrier family 26 (sulfate transporter), member 2 SLC26A2 Hs.29981 H99625 0.7355 2240 1 0.33 Histone acetyltransferase HBOA Hs.21907 N30253 0.5844 2241 -1 0.53 - -- R13347 0.9615 2242 0 0 Kelch motif containing protein AB026190 Hs.106290 N51791 0.5734 2244 -1 0.73 Hypothetical protein FLJ20296 FLJ20296 Hs.6603 R40412 0.5199 2245 -1 0.63 Catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein) CTNND2 Hs.80220 H19826 0.8344 2246 -1 0.33 Hippocalcin-like 1 HPCAL1 Hs.3618 W39327 0.6995 2247 -1 0.2 LIM domain binding 1 LDB1 Hs.26002 W47105 0.4496 2248 -1 0.6 ELL-related RNA polymerase II, elongation factor ELL2 Hs.98124 W94116 0.4593 2248 -1 0.8 - - Hs.293656 H51004 0.5625 2249 -1 0.53 - -- W45719 0.7477 2250 -1 0.47 PAP-1 binding protein PAPA-1 Hs.7709 N52238 0.6067 2251 -1 0.53 Hypothetical protein FLJ20531 FLJ20531 Hs.23617 R54933 0.7355 2251 -1 0.33 Peptidase D PEPD Hs.73947 W84581 0.44 2252 -1 1 Hypothetical protein STRAIT11499 STRAIT11499 Hs.236556 R98077 0.5734 2252 1 0.67 Anti-oxidant protein 2 (non-selenium glutathione peroxidase, acidic calcium-independent phospholipase A2) AOP2 Hs.120 W01524 0.8093 2252 -1 0.33 Splicing factor, arginine/serine-rich 11 SFRS11 Hs.11482 N32669 0.4593 2253 -1 0.8 RPA-binding trans-activator RBT1 Hs.169138 W39129 0.6524 2253 1 0.27 Nucleobindin 1 NUCB1 Hs.172609 H95787 0.7234 2254 -1 0.33 - - Hs.108745 H61972 0.8093 2254 1 0.17 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) PIN4 Hs.11774 H53723 0.9103 2254 -1 0.2 Putative nucleotide binding protein, estradiol-induced E2IG3 Hs.279923 N93365 0.9872 2254 -1 0.13 Chromosome 21 open reading frame 2 C21orf2 Hs.153452 N36397 0.4306 2255 -1 0.93 CLIP-170-related protein CLIPR-59 Hs.7357 R07631 0.5955 2255 -1 0.63 ESTs ESTs Hs.268640 W60489 0.5517 2256 1 0.67 ESTs ESTs Hs.12253 AA127934 0.5734 2257 -1 0.6 Protein kinase, X-linked PRKX Hs.147996 H52698 0.8849 2257 1 0.33 Diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae) DPH2L2 Hs.324830 AA047407 0.6641 2258 -1 0.33 KIAA1600 protein KIAA1600 Hs.192619 AA029709 0.541 2260 -1 0.6 Syntaxin 18 STX18 Hs.13406 H38180 0.6067 2260 1 0.53 DKFZP434C212 protein DKFZP434C212Hs.172069 N98261 0.6409 2260 1 0.4 Guanine nucleotide binding protein (G protein), beta polypeptide 2 GNB2 Hs.91299 W89153 0.7355 2260 -1 0.2 GABA(A) receptor-associated protein-like 2 GABARAPL2 Hs.6518 R72865 0.7355 2260 -1 0.4 KIAA1285 protein KIAA1285 Hs.119175 N39229 0.3677 2261 1 1 Hypothetical protein A-211C6.1 LOC57149 Hs.28607 N20501 0.6409 2261 1 0.53 Bioref bioref Hs.5638 R56276 0.4891 2262 1 0.87 - -- R20026 0.5734 2262 -1 0.53 ESTs ESTs Hs.326475 W87936 0.618 2262 -1 0.43 ESTs ESTs Hs.14372 AA029959 0.9743 2262 1 0.07 Regulator of G-protein signalling 16 RGS16 Hs.183601 R20063 0.541 2263 1 0.6 Translocated promoter region (to activated MET oncogene) TPR Hs.169750 N53292 0.6409 2264 -1 0.6 - - Hs.374344 AA040886 0.8469 2264 1 0.07 ESTs ESTs Hs.11325 N91448 0.9743 2264 0 0 Protease, serine, 23 SPUVE Hs.25338 R77522 0.6409 2265 1 0.47 - - Hs.29643 AA007586 0.4593 2266 1 0.67 - - Hs.103441 N93367 0.5096 2266 1 0.67 Phosphorylase kinase, alpha 2 (liver) PHKA2 Hs.54941 N76910 0.5199 2266 -1 0.47 Ribosomal protein L23a pseudogene 7 RPL23AP7 Hs.247828 R48041 0.5625 2266 1 0.73 Glucosidase, alpha; acid (Pompe disease, glycogen storage disease type II) GAA Hs.1437 R86973 0.6294 2266 1 0.27 Hypothetical protein DKFZp434P0531 DKFZp434P053 Hs.284181 AA203694 0.6409 2266 1 0.4 Glucosidase, beta (bile acid) 2 GBA2 Hs.173422 R69813 0.7114 2266 1 0.27 Hypothetical protein MGC4707 MGC4707 Hs.291003 AA151197 0.4306 2267 1 0.8 Integrin, alpha 5 (fibronectin receptor, alpha polypeptide) ITGA5 Hs.149609 AA150729 0.4791 2267 -1 0.8 Nuclear receptor co-repressor 2 NCOR2 Hs.287994 T84624 0.5096 2267 1 0.63 Ets variant gene 6 (TEL oncogene) ETV6 Hs.169081 W52903 0.6876 2268 -1 0.33 Hypothetical protein HSPC177 HSPC177 Hs.36237 R24623 0.7234 2268 1 0.33 ATPase, H+ transporting, lysosomal interacting protein 2 ATP6IP2 Hs.183434 R62318 0.7355 2268 1 0.27 - - Hs.283402 W24852 0.8469 2268 -1 0.17 COX11 homolog, cytochrome c oxidase assembly protein (yeast) COX11 Hs.241515 R89716 0.5199 2269 1 0.73 - -- T78085 0.5517 2270 1 0.67 - - Hs.133407 R23251 0.5955 2270 1 0.53 Not56 (D. melanogaster)-like protein NOT56L Hs.153591 W03009 0.5844 2271 -1 0.53 KIAA0472 protein KIAA0472 Hs.6874 T78208 0.5625 2272 1 0.67 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742 N32281 0.6409 2272 1 0.47 DKFZP586G011 protein LAP1B Hs.234265 T76974 0.9487 2272 1 0.1 Protein x 0004 LOC51184 Hs.284164 H99886 0.541 2273 1 0.53 Nuclear receptor subfamily 4, group A, member 3 NR4A3 Hs.80561 T89038 0.5734 2273 1 0.53 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206 H86785 0.6758 2273 1 0.47 KIAA0874 protein KIAA0874 Hs.27973 AA134754 0.9743 2273 -1 0.13 BCL2-associated athanogene 3 BAG3 Hs.15259 H68373 0.5096 2274 1 0.6 Transcription factor CP2 TFCP2 Hs.154970 H18495 0.5844 2274 1 0.6 ESTs ESTs Hs.8053 N67802 0.618 2275 -1 0.7 KIAA0871 protein KIAA0871 Hs.7972 AA045373 0.6409 2275 1 0.6 Transcription elongation factor A (SII)-like 1 TCEAL1 Hs.95243 T87890 0.8093 2275 1 0.47 Hypothetical protein FLJ20772 FLJ20772 Hs.9925 H96032 0.8344 2275 1 0.27 Hypothetical protein MGC11102 MGC11102 Hs.42129 R36523 0.8344 2275 1 0.07 Neuropilin 2 NRP2 Hs.17778 AA046451 0.9487 2275 1 0.07 - - Hs.165200 T82117 0.4993 2276 1 0.67 ESTs ESTs Hs.191196 N79725 0.6876 2276 1 0.5 Mitochondrial translational initiation factor 2 MTIF2 Hs.149894 AA047100 0.8093 2276 -1 0.13 Hypothetical protein FLJ22584 FLJ22584 Hs.343551 N63007 0.6067 2277 -1 0.53 Dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit DPM1 Hs.5085 AA043545 0.7599 2277 -1 0.33 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2 PLOD2 Hs.41270 AA099688 0.5199 2278 1 0.67 Melanoma differentiation associated protein-5 MDA5 Hs.293591 H78279 0.8469 2279 1 0.2 - - Hs.295789 N40437 0.6641 2280 -1 0.33 S-adenosylhomocysteine hydrolase-like 1 AHCYL1 Hs.4113 AA031852 0.9231 2280 1 0.2 Synaptophysin-like protein SYPL Hs.80919 AA031356 0.5304 2281 -1 0.73 Hypothetical protein MGC14288 MGC14288 Hs.181073 N54932 0.5304 2281 -1 0.6 Hypothetical protein FLJ22875 FLJ22875 Hs.111222 R45681 0.9743 2281 1 0.07 TRAF and TNF receptor-associated protein AD022 Hs.46847 R65826 0.6294 2282 -1 0.4 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 ALS2CR3 Hs.154248 N80318 0.7234 2283 -1 0.33 - - Hs.42834 N91368 0.6409 2284 1 0.6 ALL1-fused gene from chromosome 1q AF1Q Hs.75823 AA009587 0.7722 2285 -1 0.33 Hypothetical protein MGC13183 MGC13183 Hs.59791 H00903 0.6758 2286 1 0.47 SWAP-70 protein SWAP70 Hs.153026 AA151625 0.4691 2287 1 0.6 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742 N58742 0.5304 2287 1 0.8 - -- R98094 0.4496 2289 1 0.73 2,3-bisphosphoglycerate mutase BPGM Hs.198365 N/A2 0.618 2289 1 0.6 - -- H29572 0.8093 2289 -1 0.23 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318 H90520 0.8218 2289 -1 0.13 Hypothetical protein MGC4643 MGC4643 Hs.226434 W45590 0.5517 2290 1 0.6 Old astrocyte specifically induced substance OASIS Hs.13456 N48159 0.4496 2291 1 0.73 CGI-148 protein LOC51030 Hs.6776 N89705 0.618 2291 -1 0.53 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428 R11158 0.7234 2291 1 0.47 Nuclear localization signal deleted in velocardiofacial syndrome NLVCF Hs.19500 R73076 0.8093 2291 1 0.27 - - Hs.356356 R88993 0.4993 2292 -1 0.87 Vesicle trafficking protein SEC22C Hs.12942 H68976 0.5096 2292 1 0.93 - - Hs.375009 T97612 0.7477 2292 1 0.37 ESTs ESTs Hs.272066 R63880 0.5304 2293 1 0.73 ESTs ESTs Hs.176220 N34764 0.5844 2293 -1 0.37 - - Hs.245537 R79187 0.7599 2293 -1 0.27 KIAA0101 gene product KIAA0101 Hs.81892 AA039905 0.4891 2294 1 0.73 Myosin, heavy polypeptide 9, non-muscle MYH9 Hs.146550 H51325 0.5096 2294 1 0.8 Kinesin family member 13B KIF13B Hs.15711 H18581 0.5304 2294 1 0.73 CD164 antigen, sialomucin CD164 Hs.43910 H39034 0.6641 2294 -1 0.33 Hypothetical protein PRO1489 PRO1489 Hs.197922 W33160 0.5304 2295 1 0.57 Gene predicted from cDNA with a complete coding sequence KIAA0110 Hs.124 R11714 0.7114 2295 -1 0.4 ESTs ESTs Hs.295334 N95771 0.5304 2296 1 0.6 - - Hs.42173 AA136883 0.5844 2297 -1 0.47 Poly(rC) binding protein 1 PCBP1 Hs.2853 AA099373 0.6758 2297 1 0.27 Glycogen synthase 1 (muscle) GYS1 Hs.772 W03485 0.5304 2298 1 0.8 MAD, mothers against decapentaplegic homolog 5 (Drosophila) MADH5 Hs.37501 AA150253 0.5625 2298 -1 0.73 Similar to ecotropic viral integration site 5; Neuroblastoma stage 4S gene LOC115704 Hs.26870 R55573 0.6409 2298 1 0.47 - - Hs.249365 AA001116 0.6876 2298 1 0.4 Peroxisomal farnesylated protein PXF Hs.168670 AA136693 0.5517 2299 1 0.57 Homolog of C. elegans smu-1 SMU-1 Hs.193128 R34762 0.4593 2301 1 0.87 - - Hs.380911 N81095 0.6067 2301 -1 0.6 High-mobility group box 3 HMGB3 Hs.19114 H24175 0.6641 2301 1 0.47 Adaptor-related protein complex 1, mu 1 subunit AP1M1 Hs.3832 W42620 0.5199 2302 1 0.67 RAB5B, member RAS oncogene family RAB5B Hs.77690 H46579 0.5955 2302 -1 0.63 - - Hs.141269 AA150275 0.7114 2302 1 0.27 - - Hs.355877 N25135 0.8469 2302 -1 0.27 Suppression of tumorigenicity 7 like ST7L Hs.293483 N30715 0.541 2303 -1 0.87 ATP binding protein associated with cell differentiation APACD Hs.153884 R16169 0.5625 2303 1 0.6 Stromal cell-derived factor 2 SDF2 Hs.118684 H40074 0.5625 2303 1 0.53 ESTs ESTs Hs.21475 W52156 0.6409 2303 -1 0.4 Oxytocin receptor OXTR Hs.2820 AA134744 0.5625 2304 -1 0.53 TERF1 (TRF1)-interacting nuclear factor 2 TINF2 Hs.7797 N32733 0.618 2304 1 0.47 - -- R34021 0.5734 2305 -1 0.53 High-mobility group nucleosome binding domain 1 HMGN1 Hs.251064 H66591 0.5517 2306 -1 0.53 - - Hs.376349 W56877 0.8976 2307 1 0.17 Up-regulated in liver cancer 1 UPLC1 Hs.44579 AA058393 0.6641 2308 -1 0.4 - - Hs.40369 R23664 0.9359 2308 0 0 Colon carcinoma related protein LOC51159 Hs.30343 N44634 0.5517 2309 -1 0.7 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ATP5C1 Hs.155433 H92449 0.5844 2309 1 0.47 TRIAD3 protein TRIAD3 Hs.86228 AA147653 0.7234 2309 1 0.5 Plastin 3 (T isoform) PLS3 Hs.4114 N24445 0.8722 2309 -1 0.07 Synovial sarcoma, X breakpoint 4 SSX4 Hs.278632 N52336 0.5844 2310 -1 0.67 Aryl-hydrocarbon receptor nuclear translocator 2 ARNT2 Hs.6111 R62983 0.6524 2310 1 0.47 - - Hs.82276 H23264 0.5734 2311 1 0.53 - - Hs.13781 T87888 0.7599 2311 -1 0.4 KIAA1046 protein KIAA1046 Hs.89519 H82166 0.4993 2312 -1 0.73 Sorting nexin 17 SNX17 Hs.278569 N/A2 0.7114 2312 1 0.4 - -- W04635 0.618 2313 1 0.47 Sorbin and SH3 domain containing 1 SORBS1 Hs.108924 N71996 0.9872 2313 1 0.07 Macrophage myristoylated alanine-rich C kinase substrate MACMARCKS Hs.75061 N59622 0.5199 2315 1 0.53 Integral membrane protein 2A ITM2A Hs.17109 W58007 0.6067 2315 1 0.53 KIAA0222 gene product KIAA0222 Hs.48450 N39932 0.6758 2315 -1 0.4 Small protein effector 1 of Cdc42 SPEC1 Hs.22065 W90343 0.5625 2316 -1 0.73 - - Hs.231637 AA001104 0.6758 2318 1 0.33 Regulator of G-protein signalling 3 RGS3 Hs.82294 H14471 0.44 2319 1 0.87 MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae) MCM6 Hs.155462 AA043886 0.5199 2319 -1 0.77 Dystrobrevin binding protein 1 DTNBP1 Hs.43481 W86390 0.6758 2319 1 0.4 Hermansky-Pudlak syndrome 4 HPS4 Hs.6657 R53519 0.8093 2319 -1 0.17 Golgi associated, gamma adaptin ear containing, ARF binding protein 2 GGA2 Hs.155546 H89832 0.4891 2321 -1 0.8 Centromere protein F, 350/400ka (mitosin) CENPF Hs.77204 W31628 0.9103 2321 -1 0.17 - - Hs.118258 AA032211 0.6067 2322 -1 0.53 ESTs ESTs Hs.118493 W35335 0.6524 2322 -1 0.4 - -- R18833 0.6641 2323 1 0.2 - - Hs.268709 W38465 0.5199 2324 -1 0.6 Developmentally regulated GTP binding protein 2 DRG2 Hs.78582 N79530 0.6067 2324 -1 0.47 Clathrin, heavy polypeptide (Hc) CLTC Hs.178710 R65635 0.6294 2324 -1 0.53 - - Hs.130352 H10452 0.6995 2327 1 0.47 Insulin-like growth factor 1 receptor IGF1R Hs.239176 AA044139 0.7114 2328 1 0.37 Hypothetical protein MGC4645 MGC4645 Hs.332381 H99520 0.5517 2329 -1 0.37 Sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase) SIAT4C Hs.75268 R76085 0.6758 2329 -1 0.27 Cytokine-inducible kinase CNK Hs.153640 AA056734 0.8849 2329 1 0.1 KIAA1110 protein KIAA1110 Hs.22479 W79682 0.7599 2330 1 0.13 ORF LOC51035 Hs.351296 T99087 0.5844 2331 1 0.7 5-methyltetrahydrofolate-homocysteine methyltransferase MTR Hs.82283 R24969 0.8218 2331 -1 0.3 Gamma-aminobutyric acid (GABA) A receptor, beta 1 GABRB1 Hs.89768 N35505 0.6524 2332 -1 0.33 Ras homolog gene family, member E ARHE Hs.6838 N38762 0.6294 2333 -1 0.47 Lymphoid enhancer-binding factor 1 LEF1 Hs.44865 N81046 0.6641 2333 -1 0.47 - -- T70285 0.9359 2333 1 0.07 - - Hs.271940 R37087 0.9359 2333 0 0 Similar to S. cerevisiae Sec6p and R. norvegicus rsec6 SEC6 Hs.8088 H45110 0.9487 2333 0 0 Immediate early response 5 IER5 Hs.15725 H43652 0.5517 2335 1 0.67 Conserved gene telomeric to alpha globin cluster CGTHBA Hs.19699 H77990 0.5955 2335 1 0.6 - - Hs.28113 R66182 0.7234 2336 1 0.5 Reticulocalbin 2, EF-hand calcium binding domain RCN2 Hs.79088 W35163 0.8344 2336 1 0.27 Neuron navigator 2 NAV2 Hs.23467 N62942 0.5304 2337 -1 0.8 Putative membrane protein LOC54499 Hs.93832 H79853 0.5517 2338 -1 0.67 - - Hs.14355 R79614 0.7845 2338 -1 0.27 KIAA0256 gene product KIAA0256 Hs.118978 N39088 0.9103 2338 -1 0.1 - - Hs.356387 R21462 0.4891 2339 -1 0.87 Rho-GTPase activating protein 10 ARHGAP10 Hs.11611 R16987 0.6067 2339 1 0.47 Secretory protein SEC8 SEC8 Hs.107394 H11043 0.9487 2339 1 0.07 Kinesin family member 3B KIF3B Hs.301206 H42133 0.5199 2340 -1 0.87 Retinal short-chain dehydrogenase/reductase retSDR2 LOC51170 Hs.12150 N93294 0.5844 2340 1 0.67 KIAA0076 gene product KIAA0076 Hs.51039 R14788 0.6067 2341 1 0.57 - - Hs.293815 R68288 0.5955 2342 -1 0.53 - -- R40457 0.5955 2342 1 0.53 - -- AA045796 0.8218 2342 1 0.27 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 SMARCB1 Hs.159971 T97294 0.5517 2343 -1 0.6 BCL2-associated athanogene BAG1 Hs.41714 H98830 0.541 2344 -1 0.73 Glucosamine-6-phosphate isomerase GNPI Hs.278500 N24941 0.5096 2346 -1 0.67 - - Hs.20274 R34387 0.7114 2346 1 0.47 Fatty acid amide hydrolase FAAH Hs.288828 AA020869 0.6294 2348 1 0.47 Heterogeneous nuclear ribonucleoprotein C (C1/C2) HNRPC Hs.182447 N39092 0.9615 2348 1 0.27 ESTs ESTs Hs.44940 AA058463 0.5734 2349 1 0.6 - -- T97966 0.5304 2351 1 0.8 - -- AA002041 0.7355 2351 -1 0.4 Zinc finger protein 262 ZNF262 Hs.150390 AA047136 0.9743 2351 0 0 - - Hs.355559 H48733 0.5955 2352 -1 0.53 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583 AA134825 0.6524 2352 -1 0.33 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 SLC7A6 Hs.10315 N67453 0.7114 2352 -1 0.33 Cyclin-dependent kinase inhibitor 1A (p21, Cip1) CDKN1A Hs.179665 H49219 0.7845 2352 1 0.17 Muscleblind-like (Drosophila) MBNL Hs.28578 H02626 0.5096 2353 1 0.63 Annexin A6 ANXA6 Hs.118796 R72158 0.541 2353 1 0.53 - -- N63947 0.5844 2353 1 0.6 Hypothetical protein FLJ21940 FLJ21940 Hs.104916 N99984 1 2354 -1 0.03 Hypothetical protein FLJ36666 FLJ36666 Hs.7604 H90408 0.5517 2355 -1 0.73 Hypothetical protein FLJ13910 FLJ13910 Hs.75277 R52317 0.5844 2355 -1 0.6 Ras-like without CAAX 2 RIT2 Hs.47626 H04791 0.7477 2355 -1 0.33 ESTs ESTs Hs.26490 R20749 0.618 2356 1 0.53 - -- AA210782 0.8093 2356 -1 0.03 Signal transducer and activator of transcription 6, interleukin-4 induced STAT6 Hs.181015 AA136694 0.5096 2358 1 0.73 KIAA0229 protein KIAA0229 Hs.20060 AA045847 0.5096 2358 1 0.73 - - Hs.188361 N59378 0.8469 2358 1 0.1 ESTs ESTs Hs.48372 R09962 0.9231 2358 1 0.2 Hypothetical protein MGC2463 MGC2463 Hs.323634 AA053851 0.6876 2359 -1 0.2 ESTs ESTs Hs.63063 H67809 0.7477 2360 -1 0.33 U3 snoRNP-associated 55-kDa protein U3-55K Hs.153768 R68652 0.7477 2360 1 0.2 Adducin 1 (alpha) ADD1 Hs.183706 R77960 0.7845 2360 -1 0.2 Ubiquitin specific protease 4 (proto-oncogene) USP4 Hs.77500 N40830 0.9231 2360 1 0.13 Hypothetical protein FLJ25436 FLJ25436 Hs.29706 AA031347 0.541 2361 -1 0.67 - - Hs.355548 N30548 0.5734 2361 -1 0.67 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 SLC25A4 Hs.2043 H10350 0.618 2361 -1 0.53 Replication factor C (activator 1) 5, 36.5kDa RFC5 Hs.171075 R80664 0.6758 2362 -1 0.47 Phosphoinositide-binding protein SR1 FENS-1 Hs.44743 AA150246 0.6758 2362 1 0.4 Protein kinase Njmu-R1 NJMU-R1 Hs.9800 R20140 0.8469 2362 1 0.07 Mitofusin 1 MFN1 Hs.197877 R47773 0.541 2363 1 0.67 Gene with multiple splice variants near HD locus on 4p16.3 RES4-22 Hs.325987 W23579 0.5955 2364 -1 0.43 ATP-dependent RNA helicase MGC2835 Hs.70582 W92120 0.618 2364 1 0.67 Splicing factor, arginine/serine-rich, 46kD SRP46 Hs.155160 N72982 0.6641 2366 1 0.47 Calpastatin CAST Hs.359682 N51836 0.5625 2367 -1 0.67 - - Hs.50547 N69552 0.6067 2367 -1 0.47 Similar to MOB-LAK LOC148932 Hs.97927 N68107 0.5096 2368 1 0.8 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899 W52509 0.5734 2368 -1 0.67 Likely ortholog of yeast ARV1 ARV1 Hs.23360 W84339 0.5844 2368 -1 0.8 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 ATP5J Hs.73851 N36401 0.6067 2368 1 0.4 Rad50-interacting protein 1 FLJ11785 Hs.44625 H14485 0.8976 2368 -1 0.2 Phosphatidylinositol-4-phosphate 5-kinase, type II, beta PIP5K2B Hs.6335 N62372 0.44 2369 1 0.9 Polynucleotide phosphorylase-like PNPASE Hs.356503 AA142983 0.5096 2369 -1 0.6 Chloride intracellular channel 4 CLIC4 Hs.25035 N93442 0.6294 2369 1 0.4 - -- N44886 0.5517 2370 1 0.73 MGC4170 protein MGC4170 Hs.7041 AA137059 0.7477 2370 -1 0.33 Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) ATRX Hs.96264 AA047408 0.5517 2371 1 0.47 Family with sequence similarity 3, member A FAM3A Hs.289108 AA053325 0.6524 2371 -1 0.47 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 ATP6V1G1 Hs.90336 T78498 0.6995 2372 1 0.47 Hypothetical protein FLJ22569 FLJ22569 Hs.234355 N25927 0.7722 2372 -1 0.33 - - Hs.374362 R52397 0.6641 2373 1 0.5 Pumilio homolog 1 (Drosophila) PUM1 Hs.153834 R28061 0.7599 2373 1 0.33 - - Hs.14846 H04784 0.9359 2373 -1 0.13 RE1-silencing transcription factor REST Hs.227630 AA203242 0.5844 2375 1 0.53 Ankyrin repeat and SOCS box-containing 13 ASB13 Hs.99603 AA043764 0.7114 2376 1 0.47 Putative nucleic acid binding protein RY-1 RY1 Hs.54649 AA002088 0.9487 2376 1 0.03 Pregnancy specific beta-1-glycoprotein 6 PSG6 Hs.252097 R67585 0.9743 2376 1 0.07 ESTs ESTs Hs.268748 R14822 0.6641 2377 1 0.6 RAN binding protein 1 RANBP1 Hs.24763 R32384 0.6876 2377 1 0.4 Deoxyribonuclease I-like 1 DNASE1L1 Hs.77091 N75031 0.4496 2378 -1 0.93 GDP dissociation inhibitor 2 GDI2 Hs.56845 AA057300 0.6294 2378 1 0.53 Quinoid dihydropteridine reductase QDPR Hs.75438 AA031859 0.9359 2378 1 0.2 Translocase of inner mitochondrial membrane 13 homolog (yeast) TIMM13 Hs.23410 W90375 0.4593 2379 1 0.87 ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H ATP6V1H Hs.19575 H29086 0.5734 2379 1 0.6 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300 AA044634 0.9743 2379 0 0 Sirtuin silent mating type information regulation 2 homolog 1 (S. cerevisiae) SIRT1 Hs.31176 R66676 0.6409 2380 -1 0.47 Ets variant gene 5 (ets-related molecule) ETV5 Hs.43697 T53682 0.9487 2380 0 0 Gene predicted from cDNA with a complete coding sequence KIAA0110 Hs.124 H19514 0.9359 2381 1 0.07 Frizzled homolog 10 (Drosophila) FZD10 Hs.31664 R60915 0.5096 2382 -1 0.8 Growth suppressor 1 GROS1 Hs.10114 T72589 0.8344 2382 1 0.13 Skeletal muscle and kidney enriched inositol phosphatase SKIP Hs.178347 AA053319 0.6876 2383 1 0.33 - - Hs.167700 R50511 0.6995 2383 -1 0.57 Hydroxysteroid (17-beta) dehydrogenase 1 HSD17B1 Hs.85279 R25219 0.7355 2383 -1 0.33 - - Hs.175652 R93707 0.9872 2383 0 0 Calmodulin 1 (phosphorylase kinase, delta) CALM1 Hs.177656 T75267 0.7722 2384 -1 0.2 FK506 binding protein 12-rapamycin associated protein 1 FRAP1 Hs.338207 AA045167 0.541 2385 -1 0.8 Hexokinase 2 HK2 Hs.198427 H88535 0.6876 2385 -1 0.6 - - Hs.153527 AA069568 0.6524 2387 1 0.73 CSRP2 binding protein CSRP2BP Hs.301532 R94724 0.6409 2388 -1 0.47 Phytanoyl-CoA hydroxylase (Refsum disease) PHYH Hs.172887 H46055 0.6758 2388 1 0.33 KIAA0725 protein KIAA0725 Hs.26450 AA033652 0.8722 2389 1 0.33 ATP-dependent RNA helicase MGC2835 Hs.70582 R91933 0.541 2390 1 0.53 C-Mpl binding protein LOC113251 Hs.26613 AA132083 0.9743 2390 1 0.07 Hypothetical protein BC007384 LOC90378 Hs.140309 AA046820 0.9103 2392 -1 0.07 - - Hs.345588 AA099441 0.6409 2393 1 0.53 Nucleobindin 1 NUCB1 Hs.172609 AA043893 0.6641 2393 -1 0.47 Neuroepithelial cell transforming gene 1 NET1 Hs.25155 R48773 0.6995 2393 1 0.33 Nucleosome assembly protein 1-like 4 NAP1L4 Hs.78103 N25598 0.6641 2394 -1 0.33 - - Hs.187908 R18625 0.8849 2394 1 0.17 Proteasome (prosome, macropain) 26S subunit, ATPase, 3 PSMC3 Hs.250758 T86146 0.6641 2395 1 0.33 ESTs ESTs Hs.16094 W33065 0.7599 2395 -1 0.23 - - Hs.381204 N24877 0.7969 2395 1 0.13 Ubiquitin specific protease 8 USP8 Hs.152818 N72176 0.8469 2395 1 0.07 KIAA1046 protein KIAA1046 Hs.89519 R91908 0.7722 2396 -1 0.3 Transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) TLE1 Hs.28935 N59346 0.6409 2397 1 0.53 Protein tyrosine phosphatase, non-receptor type 12 PTPN12 Hs.62 W56434 0.5304 2398 -1 0.7 ESTs ESTs Hs.201608 H58462 0.618 2399 -1 0.57 Nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs) NOLA3 Hs.14317 N47468 0.7969 2399 -1 0.33 Zinc finger protein 281 ZNF281 Hs.59757 H66836 0.5304 2401 1 0.8 - - Hs.224967 AA033680 0.5734 2401 1 0.63 Hypothetical protein FLJ31657 FLJ31657 Hs.5518 W47073 0.6524 2401 1 0.33 Solute carrier family 20 (phosphate transporter), member 1 SLC20A1 Hs.78452 H27414 0.5844 2402 -1 0.6 Ring finger protein 20 RNF20 Hs.168095 N25619 0.5955 2402 1 0.53 ESTs ESTs Hs.269036 H38062 0.6067 2402 1 0.4 - -- R50031 0.6409 2402 -1 0.47 KIAA0602 protein KIAA0602 Hs.37656 AA203636 0.7969 2402 1 0.27 - - Hs.132355 T92153 0.4993 2403 1 0.8 - -- H84221 0.7599 2403 -1 0.2 High-glucose-regulated protein 8 HGRG8 Hs.20993 R91950 0.6409 2404 -1 0.53 Cytochrome b-5 CYB5 Hs.83834 R69570 0.9487 2404 -1 0.27 Oxysterol binding protein-like 3 OSBPL3 Hs.197955 N26104 0.5517 2405 -1 0.67 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl traOGT Hs.100293 R56270 0.5517 2406 1 0.6 - - Hs.4817 H23029 0.6641 2406 1 0.4 Protein inhibitor of activated STAT X PIASX-BETA Hs.111323 T86626 0.8093 2406 -1 0.37 Connector enhancer of KSR-like (Drosophila kinase suppressor of ras) CNK1 Hs.16232 R23132 0.8344 2406 -1 0.23 Cullin 1 CUL1 Hs.14541 N29648 0.5955 2407 1 0.57 CD164 antigen, sialomucin CD164 Hs.43910 AA007449 0.6067 2407 1 0.63 Spastic ataxia of Charlevoix-Saguenay (sacsin) SACS Hs.159492 H22871 0.7599 2407 -1 0.33 Peptidase D PEPD Hs.73947 AA203452 0.7722 2407 -1 0.33 - -- W23776 0.8469 2407 1 0.07 ENOS interacting protein NOSIP Hs.7236 AA047447 0.9103 2407 1 0.27 - - Hs.201060 AA115529 0.6876 2408 -1 0.43 - - Hs.134202 H50941 0.7114 2408 1 0.33 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583 R14285 0.5734 2409 1 0.47 - - Hs.100261 R48603 0.5734 2409 -1 0.6 - -- R06415 0.4691 2410 1 0.87 Friedreich ataxia FRDA Hs.95998 N23988 0.8344 2410 1 0.27 RAB13, member RAS oncogene family RAB13 Hs.151536 T84103 0.8722 2410 -1 0.07 - - Hs.377850 N79378 0.6758 2411 -1 0.47 ESTs ESTs Hs.126688 H08650 0.6067 2412 -1 0.47 Egl nine homolog 1 (C. elegans) EGLN1 Hs.6523 R67381 0.6995 2412 -1 0.4 - - Hs.330716 R37898 0.4891 2413 1 0.67 Interleukin 1 receptor accessory protein IL1RAP Hs.173880 AA010048 0.5955 2413 1 0.53 Hypothetical protein FLJ11301 FLJ11301 Hs.301724 H52696 0.7477 2414 1 0.27 Hypothetical protein FLJ10101 FLJ10101 Hs.334802 H26657 0.6641 2415 -1 0.6 Smcx homolog, X chromosome (mouse) SMCX Hs.283429 AA039528 0.6758 2415 -1 0.4 - - Hs.37858 T83198 0.7234 2415 1 0.47 Putative receptor protein PMI Hs.15196 R62468 0.7599 2415 1 0.27 Small nuclear RNA activating complex, polypeptide 2, 45kDa SNAPC2 Hs.78403 H51540 0.9487 2415 -1 0.07 Hypothetical protein FLJ14641 FLJ14641 Hs.245326 W85777 0.5304 2416 1 0.6 Kaptin (actin binding protein) KPTN Hs.25441 H18810 0.5517 2416 -1 0.67 - - Hs.9961 H50924 0.6641 2416 1 0.53 Hypothetical protein FLJ14800 FLJ14800 Hs.62119 AA045171 0.7234 2416 -1 0.47 - - Hs.25930 H05018 0.9872 2416 1 0.1 Hypothetical protein FLJ10379 FLJ10379 Hs.14229 AA029810 0.9872 2416 0 0 - - Hs.79531 R80226 0.5304 2417 1 0.53 ESTs ESTs Hs.105636 R80601 0.6067 2419 1 0.53 Zinc finger protein 294 ZNF294 Hs.288773 H20849 0.618 2419 1 0.53 Deformed epidermal autoregulatory factor 1 (Drosophila) DEAF1 Hs.6574 N64500 0.6758 2419 -1 0.5 IDN3 protein IDN3 Hs.225767 H09452 0.8469 2419 -1 0.13 Hypothetical protein MGC13007 MGC13007 Hs.332382 R50785 0.9359 2419 0 0 Tubulin, gamma complex associated protein 6 TUBGCP6 Hs.336431 H49289 0.9615 2419 0 0 Actin, alpha 2, smooth muscle, aorta ACTA2 Hs.195851 W52072 0.5199 2420 1 0.6 Ribosomal protein L13 RPL13 Hs.180842 T77765 0.7599 2420 1 0.33 Nudix (nucleoside diphosphate linked moiety X)-type motif 2 NUDT2 Hs.14142 H16710 0.9872 2420 1 0.13 G protein-coupled receptor kinase 6 GPRK6 Hs.76297 R87343 0.6524 2421 -1 0.6 Ubiquitin-conjugating enzyme UBC3B UBC3B Hs.11184 N32331 0.7722 2421 1 0.23 Hypothetical protein FLJ14825 FLJ14825 Hs.334824 H16467 0.7114 2422 -1 0.33 Sorting nexin 11 SNX11 Hs.15827 R55337 0.7845 2422 1 0.23 - - Hs.310092 R26320 0.5955 2424 1 0.6 Filamin B, beta (actin binding protein 278) FLNB Hs.81008 T72638 0.5734 2425 -1 0.47 - - Hs.380756 H08342 0.8218 2425 -1 0.07 - -- H69321 0.5734 2426 -1 0.47 Interleukin 14 IL14 Hs.83004 N98333 1 2426 1 0.17 Ribosomal protein L7 RPL7 Hs.153 W04612 0.5734 2427 -1 0.53 JM5 protein JM5 Hs.21753 W04244 0.5844 2427 -1 0.73 ESTs ESTs Hs.49829 H96934 0.6876 2427 -1 0.33 ESTs ESTs Hs.136246 W72903 0.7355 2427 1 0.33 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin) DDX9 Hs.74578 N51117 0.5734 2428 -1 0.67 ESTs ESTs Hs.110028 T87547 0.5734 2428 -1 0.73 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 PSMD1 Hs.3887 W42442 0.5625 2429 -1 0.67 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184 H67177 0.5734 2429 1 0.5 - -- N40301 0.9103 2429 -1 0.2 Cytoskeleton associated protein 2 CKAP2 Hs.24641 H27352 0.9487 2429 -1 0.07 V-Ha-ras Harvey rat sarcoma viral oncogene homolog HRAS Hs.37003 W58270 0.6067 2430 1 0.47 Karyopherin beta 2b, transportin TRN2 Hs.278378 AA156866 0.6067 2431 1 0.7 Uncharacterized bone marrow protein BM045 BM045 Hs.8750 R02729 0.6524 2431 -1 0.47 Wolf-Hirschhorn syndrome candidate 1 WHSC1 Hs.110457 N46726 0.6758 2432 -1 0.33 KIAA0185 protein KIAA0185 Hs.239499 R01336 0.9872 2432 -1 0.07 - - Hs.19150 AA053984 0.7234 2433 -1 0.4 H2B histone family, member Q H2BFQ Hs.2178 W92625 0.8596 2433 1 0.27 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583 R49415 0.9231 2433 1 0.07 Hypothetical protein BC013576 LOC114928 Hs.348493 H20778 0.8722 2434 1 0.2 Pregnancy-induced growth inhibitor OKL38 Hs.31773 AA043926 0.9872 2434 1 0.13 Tumor necrosis factor receptor superfamily, member 1A TNFRSF1A Hs.159 H51993 0.6524 2435 1 0.33 Hypothetical protein MGC3260 MGC3260 Hs.15514 R79684 0.6995 2435 -1 0.4 KIAA1805 protein KIAA1805 Hs.294122 N95177 0.6067 2436 1 0.67 Replication factor C (activator 1) 1, 145kDa RFC1 Hs.166563 W40330 0.6758 2436 1 0.4 G1 to S phase transition 1 GSPT1 Hs.2707 AA131634 0.8849 2436 0 0 - - Hs.8172 N71478 0.8093 2437 -1 0.27 Glutamate dehydrogenase 1 GLUD1 Hs.77508 R08498 0.6876 2439 -1 0.33 - -- H69584 0.9359 2439 1 0.07 - -- W68491 0.6409 2440 -1 0.33 KIAA0892 protein KIAA0892 Hs.112751 R36127 0.5844 2441 -1 0.4 Filamin B, beta (actin binding protein 278) FLNB Hs.81008 W52940 0.5517 2442 1 0.8 MIL1 protein MIL1 Hs.10267 R73213 0.6641 2443 -1 0.27 RAB40B, member RAS oncogene family RAB40B Hs.302498 W39234 0.8722 2443 1 0.27 Mitochondrial ribosomal protein L16 MRPL16 Hs.5080 AA099397 0.8976 2443 -1 0.2 DEAD-box protein abstrakt ABS Hs.274317 H85459 0.5625 2444 -1 0.53 Sortilin 1 SORT1 Hs.351872 N26563 0.618 2444 -1 0.47 Second mitochondria-derived activator of caspase SMAC Hs.169611 AA053856 0.6876 2444 -1 0.47 - -- H21122 0.8093 2444 1 0.33 Scaffold attachment factor B SAFB Hs.23978 R00749 0.5517 2445 1 0.67 - - Hs.17240 R89136 0.8596 2445 -1 0.23 - -- H05551 0.8596 2445 -1 0.27 Hypothetical protein FLJ34231 FLJ34231 Hs.30503 N52230 0.4891 2446 1 0.8 Hypothetical protein H17 H17 Hs.16361 AA102103 0.5844 2447 1 0.53 Stromal antigen 2 STAG2 Hs.8217 AA203238 0.6067 2447 1 0.67 GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome) GLI3 Hs.72916 AA099606 0.9615 2447 -1 0.07 - - Hs.24143 N27205 0.9743 2447 -1 0.07 Hypothetical protein FLJ13855 FLJ13855 Hs.168232 W04510 0.5734 2448 -1 0.73 TCF3 (E2A) fusion partner (in childhood Leukemia) TFPT Hs.233765 H06950 0.6067 2448 -1 0.67 SMC4 structural maintenance of chromosomes 4-like 1 (yeast) SMC4L1 Hs.50758 AA026235 0.7355 2448 -1 0.33 - - Hs.31447 W03639 0.5734 2449 -1 0.6 Golgi autoantigen, golgin subfamily a, 2 GOLGA2 Hs.24049 H69509 0.541 2450 -1 0.67 ATP-binding cassette, sub-family B (MDR/TAP), member 10 ABCB10 Hs.1710 H93832 0.5955 2452 -1 0.47 Chromosome 20 open reading frame 16 C20orf16 Hs.92374 H99483 0.7599 2452 -1 0.27 - -- AA047156 0.8722 2452 -1 0.2 ESTs ESTs Hs.323484 N36861 0.9231 2452 1 0.1 ESTs ESTs Hs.42344 N68372 0.9359 2452 1 0.07 - -- AA152215 0.5955 2453 1 0.6 Tubulin-specific chaperone d TBCD Hs.12570 AA043638 0.7355 2454 -1 0.3 Crystallin, zeta (quinone reductase) CRYZ Hs.83114 AA203422 0.7722 2454 1 0.13 Splicing factor, arginine/serine-rich, 46kD SRP46 Hs.155160 H82069 0.5955 2455 -1 0.6 Nuclear cap binding protein subunit 2, 20kDa NCBP2 Hs.240770 W57806 0.6409 2455 -1 0.47 Unknown LOC51693 Hs.27445 AA053859 0.6876 2455 -1 0.47 U2 small nuclear ribonucleoprotein auxiliary factor (65kD) U2AF65 Hs.7655 W93973 0.9231 2455 -1 0.1 BCL2/adenovirus E1B 19kDa interacting protein 1 BNIP1 Hs.77572 AA115563 0.6524 2456 -1 0.53 Histidyl-tRNA synthetase-like HARSL Hs.278507 AA214455 0.7114 2457 -1 0.27 - -- T86617 0.8469 2457 -1 0.23 V-myb myeloblastosis viral oncogene homolog (avian)-like 2 MYBL2 Hs.179718 N24178 0.8849 2457 -1 0.2 ESTs ESTs Hs.293676 H97415 0.4993 2458 -1 0.87 TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa TAF6L Hs.131846 R05624 0.6409 2458 -1 0.47 - - Hs.293993 AA040160 0.4891 2459 -1 0.67 Hypothetical protein BC017335 LOC92715 Hs.292570 N93284 0.7599 2459 -1 0.33 Hypothetical protein MGC5627 MGC5627 Hs.237971 R56380 0.8218 2459 -1 0.3 - - Hs.356416 W49783 0.7845 2460 1 0.07 - - Hs.13328 AA054447 0.6641 2461 1 0.5 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318 AA040162 0.6758 2461 -1 0.4 Calnexin CANX Hs.155560 AA036785 0.8722 2462 -1 0.13 N-myristoyltransferase 2 NMT2 Hs.122647 N75330 0.618 2463 -1 0.6 Ac-like transposable element ALTE Hs.9933 R00701 0.6876 2463 -1 0.47 Abhydrolase domain containing 1 ABHD2 Hs.99364 R40685 0.9231 2463 -1 0.13 SAC1 suppressor of actin mutations 1-like (yeast) SACM1L Hs.5867 N26031 0.6409 2464 -1 0.6 ESTs ESTs Hs.43725 AA011707 0.6524 2465 -1 0.2 Ras homolog gene family, member U ARHU Hs.20252 AA029349 0.6876 2465 -1 0.47 - -- H63988 0.8976 2465 1 0.27 ESTs ESTs Hs.38264 R32787 0.5096 2466 1 0.8 - -- N23299 0.618 2466 -1 0.53 KIAA0212 gene product KIAA0212 Hs.154332 R27190 0.7355 2467 1 0.4 Placental growth factor, vascular endothelial growth factor-related protein PGF Hs.2894 H53141 0.5625 2468 1 0.57 ESTs ESTs Hs.268917 N70581 0.7114 2469 1 0.43 Centrin, EF-hand protein, 2 CETN2 Hs.82794 N64002 0.6067 2470 1 0.6 Rap guanine nucleotide exchange factor RA-GEF-2 Hs.174795 H69011 0.7355 2470 1 0.5 SKI-like SKIL Hs.38783 H49479 0.4593 2471 -1 0.67 CCR4-NOT transcription complex, subunit 8 CNOT8 Hs.26703 R72977 0.6409 2471 -1 0.57 RNA binding motif protein 8A RBM8A Hs.10283 R21092 0.6409 2471 -1 0.53 Carbonic anhydrase I CA1 Hs.23118 W58334 0.6758 2471 -1 0.3 Hydroxyacyl glutathione hydrolase HAGH Hs.155482 W07491 0.7234 2471 1 0.33 - - Hs.58633 N21505 0.5199 2472 -1 0.73 - - Hs.27048 H03342 0.6524 2473 -1 0.53 Hypothetical protein FLJ21939 similar to 5-azacytidine induced gene 2 FLJ21939 Hs.164478 N46615 0.6876 2473 -1 0.6 Similar to envelope protein LOC113386 Hs.132055 R12705 0.6067 2474 1 0.4 Thyroid hormone receptor interactor 13 TRIP13 Hs.6566 W52466 0.5517 2475 1 0.6 Carboxypeptidase A1 (pancreatic) CPA1 Hs.2879 N63013 0.6641 2475 -1 0.33 Hypothetical protein FLJ13194 FLJ13194 Hs.288932 W56037 0.4891 2477 -1 0.93 Ras homolog gene family, member H ARHH Hs.109918 T96942 0.5844 2478 -1 0.4 Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial ECHS1 Hs.76394 W39596 0.8218 2478 1 0.27 Aldehyde dehydrogenase 1 family, member A1 ALDH1A1 Hs.76392 H77998 0.6758 2479 -1 0.33 KIAA0310 gene product KIAA0310 Hs.5716 H09565 0.4993 2480 1 0.8 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide YWHAG Hs.25001 T81551 0.7722 2480 -1 0.27 - - Hs.380093 R36586 0.5734 2481 -1 0.57 Phosphatidylinositol (4,5) bisphosphate 5-phosphatase homolog; phosphatidylinositol polyphosphate 5-phosphatase PPI5PIV Hs.25156 H85860 0.7114 2481 1 0.37 - -- H64918 0.9743 2481 -1 0.03 Interferon-stimulated transcription factor 3, gamma 48kDa ISGF3G Hs.1706 W86364 0.44 2482 -1 0.87 ESTs ESTs Hs.58819 W60866 0.7355 2482 -1 0.33 - - Hs.57806 N66260 0.8344 2482 1 0.27 MUS81 endonuclease MUS81 Hs.288798 T66786 0.8469 2482 -1 0.07 ESTs ESTs Hs.12941 N58497 0.8849 2482 -1 0.2 Translocated promoter region (to activated MET oncogene) TPR Hs.169750 R80010 0.8976 2482 1 0.03 Nuclear matrix protein NXP-2 NXP-2 Hs.70359 H38592 0.9359 2482 -1 0.07 ESTs ESTs Hs.32840 H43498 0.4791 2483 -1 0.8 MAP/microtubule affinity-regulating kinase 1 MARK1 Hs.12808 AA150965 0.7969 2483 1 0.13 KIAA1921 protein KIAA1921 Hs.348392 W20441 0.7722 2484 1 0.17 KIAA0116 protein KIAA0116 Hs.182877 N77380 0.6876 2485 1 0.53 ESTs ESTs Hs.19918 AA047517 0.9231 2485 -1 0.07 VRK3 for vaccinia related kinase 3 LOC51231 Hs.98289 W88941 0.9743 2485 0 0 Microspherule protein 1 MCRS1 Hs.25313 AA041277 0.6524 2486 -1 0.43 - -- R34513 0.6641 2486 -1 0.53 KIAA1468 protein KIAA1468 Hs.23542 W79028 0.6758 2486 1 0.33 Ribulose-5-phosphate-3-epimerase RPE Hs.125845 N91882 0.6995 2486 1 0.4 Alpha2,3-sialyltransferase ST3GALVI Hs.34578 AA041282 0.7234 2487 -1 0.33 - -- H10070 0.7355 2487 -1 0.27 KIAA0169 protein KIAA0169 Hs.374382 AA134750 0.8722 2487 1 0.03 Hypothetical protein MGC10848 MGC10848 Hs.207443 H52728 0.8849 2487 -1 0.13 Tripartite motif-containing 35 TRIM35 Hs.137732 R19946 0.5844 2488 1 0.6 Stannin SNN Hs.76691 W61377 0.6524 2488 -1 0.33 Aminolevulinate, delta-, dehydratase ALAD Hs.1227 W86913 0.7599 2488 1 0.13 - -- H30017 0.7969 2488 1 0.33 Phosphoinositide-3-kinase, regulatory subunit, polypeptide 2 (p85 beta) PIK3R2 Hs.211586 AA099226 0.9359 2488 1 0.07 - - Hs.356377 AA009512 0.541 2489 -1 0.73 - -- R62341 0.7477 2489 1 0.47 Hypothetical protein FLJ35564 FLJ35564 Hs.374836 N46949 0.8722 2489 1 0.2 - -- R21391 0.6294 2490 1 0.6 Hypothetical protein DKFZp564D0478 DKFZP564D047Hs.321214 R34645 0.5517 2492 1 0.67 Kinesin family member 13A KIF13A Hs.146286 N30559 0.5734 2492 1 0.77 - -- W15224 0.6409 2492 1 0.4 KIAA0819 protein KIAA0819 Hs.301866 AA047454 0.7114 2492 -1 0.47 Zinc finger protein 76 (expressed in testis) ZNF76 Hs.29222 AA044942 0.9872 2492 1 0.17 Eukaryotic translation initiation factor 4 gamma, 1 EIF4G1 Hs.211568 R96178 0.4593 2494 -1 0.93 - -- N91541 0.6067 2494 1 0.4 Non-metastatic cells 1, protein (NM23A) expressed in NME1 Hs.118638 T65350 0.6294 2494 1 0.4 WD repeat domain 13 WDR13 Hs.12142 W24178 0.8093 2494 -1 0.3 IlvB (bacterial acetolactate synthase)-like ILVBL Hs.78880 H25618 0.8976 2494 -1 0.27 Hypothetical protein HSPC177 HSPC177 Hs.36237 AA150924 0.5844 2495 -1 0.67 Immunoglobulin (CD79A) binding protein 1 IGBP1 Hs.3631 T65558 0.9103 2495 -1 0.17 Angiotensin II receptor-associated protein AGTRAP Hs.12854 N36109 0.6294 2496 1 0.6 Macrophage myristoylated alanine-rich C kinase substrate MACMARCKS Hs.75061 H44693 0.6758 2496 1 0.67 Hypothetical protein FLJ25604 FLJ25604 Hs.220745 AA017362 0.8218 2496 -1 0.3 Glucose-6-phosphate dehydrogenase G6PD Hs.80206 H81760 0.9487 2496 -1 0.17 - - Hs.40289 T96894 0.9615 2496 1 0.07 ESTs ESTs Hs.181826 R13023 0.4496 2498 1 0.67 - -- AA152292 0.618 2498 1 0.67 Ovarian carcinoma immunoreactive antigen OCIA Hs.132071 R66378 0.7845 2498 -1 0.17 RAB9A, member RAS oncogene family RAB9A Hs.330994 R34172 0.6067 2499 1 0.53 - - Hs.22968 H53718 0.6641 2499 1 0.53 - -- N45309 0.6758 2499 1 0.37 Prenylcysteine lyase PCL1 Hs.278627 R61551 0.6294 2500 1 0.6 - - Hs.131798 N50342 0.5625 2501 1 0.67 KIAA0725 protein KIAA0725 Hs.26450 N95455 0.6876 2501 1 0.63 N-acetylgalactosaminidase, alpha- NAGA Hs.75372 H75861 0.6995 2501 1 0.47 Apoptotic chromatin condensation inducer in the nucleus ACN Hs.227133 AA042936 0.5844 2502 1 0.7 My015 My015 Hs.325531 R60330 0.6524 2502 1 0.4 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI) PLOD Hs.75093 W89140 0.5517 2503 -1 0.67 ESTs ESTs Hs.14691 H27907 0.6067 2503 -1 0.6 CDK5 regulatory subunit associated protein 2 CDK5RAP2 Hs.32360 AA195213 0.7234 2503 -1 0.27 RAB2, member RAS oncogene family RAB2 Hs.78305 R61381 0.7355 2503 1 0.4 Centromere protein B, 80kDa CENPB Hs.85004 N21529 0.9487 2503 1 0.2 - -- N27488 0.7114 2504 1 0.43 Sarcolemma associated protein SLMAP Hs.4007 N90234 0.7114 2505 -1 0.07 Glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) GCAT Hs.54609 AA044807 0.8093 2505 1 0.07 - -- H51648 0.6409 2506 1 0.53 Similar to RIKEN cDNA 4933424N09 gene MGC16943 Hs.248437 AA045139 0.7477 2506 -1 0.2 Hypothetical protein FLJ12592 FLJ12592 Hs.23100 R01695 0.4891 2507 -1 0.73 Dpy-30-like protein LOC84661 Hs.323401 T95573 0.9103 2507 -1 0.07 Nuclear antigen Sp100 SP100 Hs.77617 T71576 0.6409 2508 -1 0.4 Hypothetical protein MGC5309 MGC5309 Hs.13885 R60231 0.8976 2508 1 0.13 KIAA1255 protein KIAA1255 Hs.351633 N50632 0.6409 2510 -1 0.47 Leucine-rich and death domain containing LRDD Hs.123136 H00874 0.7355 2511 -1 0.4 - - Hs.295789 H41889 0.6409 2512 1 0.53 - - Hs.315270 H17403 0.7599 2512 -1 0.13 Hypothetical protein FLJ22318 FLJ22318 Hs.22753 H88020 0.8093 2512 -1 0.27 ESTs ESTs Hs.114271 R22203 0.7234 2513 -1 0.37 Hypothetical protein FLJ10330 FLJ10330 Hs.342307 AA147539 0.8469 2513 1 0.17 D-dopachrome tautomerase DDT Hs.180015 N57645 0.9615 2513 1 0.07 ESTs ESTs Hs.380509 AA055106 0.9872 2513 -1 0.17 Crystallin, zeta (quinone reductase)-like 1 CRYZL1 Hs.330208 T97327 0.7234 2514 1 0.33 ESTs ESTs Hs.18041 R54865 0.7845 2514 1 0.43 Hypothetical protein from EUROIMAGE 2021883 LOC56926 Hs.24983 N34234 0.7845 2514 1 0.27 Esterase D/formylglutathione hydrolase ESD Hs.82193 AA203115 0.6876 2515 -1 0.2 Organic cation transporter OKB1 OKB1 Hs.191996 N26046 1 2515 -1 0.07 Solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19 SLC25A19 Hs.16786 N29183 0.7355 2516 -1 0.47 - - Hs.289018 R77727 0.7722 2516 1 0.27 Nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs) NOLA2 Hs.23990 R99156 0.7845 2516 -1 0.23 P53-regulated DDA3 DDA3 Hs.77550 T95796 0.5955 2517 -1 0.6 Eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa EIF2B1 Hs.78592 N89894 0.618 2518 -1 0.4 - -- N57249 0.7355 2519 1 0.3 Proteasome (prosome, macropain) subunit, beta type, 5 PSMB5 Hs.78596 AA047678 0.7477 2519 -1 0.27 Death associated protein 3 DAP3 Hs.159627 N25562 0.7969 2519 -1 0.13 Protein tyrosine kinase 9 PTK9 Hs.82643 AA043760 0.9743 2519 -1 0.07 General transcription factor IIB GTF2B Hs.258561 H52236 0.6409 2520 -1 0.4 Adducin 1 (alpha) ADD1 Hs.183706 AA213442 0.6641 2520 1 0.47 ESTs ESTs Hs.148000 R63060 0.7234 2520 1 0.4 - -- W46278 0.8849 2521 1 0.2 T-cell activation protein phosphatase 2C TA-PP2C Hs.13854 AA126411 0.6524 2522 1 0.47 - - Hs.15806 AA135742 0.6758 2522 1 0.4 ESTs ESTs Hs.270798 R94867 0.5625 2523 1 0.53 Ring finger protein 1 RING1 Hs.35384 R39419 0.6758 2523 -1 0.53 - - Hs.351152 R18959 0.9487 2523 0 0 Hypothetical protein FLJ13111 FLJ13111 Hs.288382 N95812 0.7722 2525 1 0.4 Insulin-like growth factor binding protein 6 IGFBP6 Hs.274313 H98919 0.9487 2525 1 0.07 - -- T84763 0.9487 2525 1 0.13 - - Hs.284344 N94831 0.541 2526 -1 0.8 KIAA0013 gene product ARHGAP11A Hs.172652 W80994 0.5844 2527 -1 0.47 Nerve growth factor receptor (TNFRSF16) associated protein 1 NGFRAP1 Hs.381039 AA035343 0.6641 2527 1 0.33 - -- W24882 0.7477 2527 -1 0.3 Hypothetical protein FLJ35779 FLJ35779 Hs.374991 W67797 0.8218 2528 1 0.1 Laminin, alpha 5 LAMA5 Hs.11669 R36886 0.6067 2529 1 0.73 Chromosome 20 open reading frame 104 C20orf104 Hs.301055 H26561 0.7722 2529 -1 0.07 Serine/threonine kinase 11 interacting protein STK11IP Hs.22410 AA045366 0.9615 2530 0 0 Plastin 3 (T isoform) PLS3 Hs.4114 R17860 0.9743 2530 1 0.07 - - Hs.288361 AA036798 0.5844 2531 -1 0.8 - - Hs.339024 T75250 0.7599 2531 -1 0.3 COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) COPS7B Hs.114432 R47912 0.9231 2531 -1 0.27 - - Hs.17567 W93292 0.7355 2532 1 0.43 Mitochondrial carrier homolog 2 MTCH2 Hs.279609 AA035055 0.6409 2533 -1 0.47 - - Hs.374400 AA063044 0.6524 2533 1 0.47 Hypothetical protein MGC4840 MGC4840 Hs.301872 H75353 0.8722 2535 1 0.07 - -- T93605 0.5734 2536 -1 0.6 ESTs ESTs Hs.188627 AA129971 0.6294 2536 -1 0.4 - -- R93296 0.7114 2538 1 0.33 - -- R55787 0.8093 2538 1 0.27 KIAA1069 protein KIAA1069 Hs.193143 R46527 0.8344 2539 1 0.33 DKFZP434H132 protein DKFZP434H132Hs.17936 AA059128 0.9615 2539 1 0.13 H2A histone family, member Y H2AFY Hs.75258 H58225 0.5625 2541 -1 0.8 LIM and senescent cell antigen-like domains 1 LIMS1 Hs.112378 H75745 0.8469 2541 1 0.13 Calcium homeostasis endoplasmic reticulum protein CHERP Hs.6430 AA069527 1 2541 1 0.07 Tuftelin interacting protein 11 TFIP11 Hs.20225 AA039596 0.6067 2542 -1 0.53 Hypothetical protein FLJ21308 FLJ21308 Hs.29977 T85827 0.6524 2542 1 0.4 - -- R53645 0.6995 2542 1 0.53 - - Hs.378080 T69771 0.7722 2542 -1 0.27 Hypothetical protein FLJ12716 FLJ12716 Hs.5354 AA057144 0.8469 2542 -1 0.27 Slit homolog 3 (Drosophila) SLIT3 Hs.57929 AA046623 0.8596 2542 1 0.07 Hypothetical protein FLJ10377 FLJ10377 Hs.274263 N42162 0.5955 2543 -1 0.4 DC2 protein DC2 Hs.103180 H68441 0.7845 2543 -1 0.2 Hypothetical protein FLJ14054 FLJ14054 Hs.13528 H81680 0.6524 2544 1 0.33 Nucleolar protein ANKT ANKT Hs.279905 T89566 0.6995 2544 -1 0.27 ESTs ESTs Hs.16586 W02039 0.7969 2544 -1 0.47 Agouti signaling protein, nonagouti homolog (mouse) ASIP Hs.361642 N90249 0.8722 2544 1 0.2 Protein phosphatase 1, regulatory subunit 10 PPP1R10 Hs.106019 R72609 0.7114 2545 -1 0.4 - - Hs.5724 R72799 0.8849 2546 1 0.23 HpaII tiny fragments locus 9C HTF9C Hs.63609 T79789 0.7969 2547 -1 0.37 ESTs ESTs Hs.154701 N29880 0.6876 2548 1 0.33 Hypothetical protein DKFZp762O076 DKFZp762O076 Hs.21621 R82950 0.6409 2549 -1 0.53 DKFZP434N093 protein DKFZP434N093Hs.33363 W63553 0.6995 2549 1 0.4 Hypothetical protein BC001573 LOC134147 Hs.349344 R59471 0.8469 2549 1 0.13 Protein phosphatase 2A, regulatory subunit B' (PR 53) PPP2R4 Hs.236963 R83572 0.541 2550 -1 0.8 Hypothetical protein FLJ10154 FLJ10154 Hs.179972 H43455 0.6067 2550 1 0.47 Hypothetical protein PP2447 PP2447 Hs.33026 H50248 0.6067 2550 1 0.67 Prostate derived STE20-like kinase PSK PSK Hs.66141 W30745 0.8218 2550 -1 0.4 Hypothetical protein DJ159A19.3 DJ159A19.3 Hs.10700 H23344 0.7477 2551 1 0.33 - - Hs.356140 AA203110 0.5304 2552 -1 0.67 Androgen-induced basic leucine zipper AIBZIP Hs.372924 H09049 0.6409 2552 -1 0.47 Enolase 2, (gamma, neuronal) ENO2 Hs.146580 AA004997 0.8469 2552 -1 0.13 Thyroid hormone receptor-associated protein (100 kDa) TRAP100 Hs.23106 AA115345 0.9615 2553 1 0.13 Hypothetical protein DKFZp586F2423 DKFZP586F242 Hs.13659 R80595 0.7845 2554 1 0.37 - - Hs.177781 R50443 0.9231 2554 -1 0.1 - -- AA131322 0.5734 2555 -1 0.67 Tryptase beta 1 TPSB1 Hs.347933 AA069569 0.6876 2555 1 0.53 Lecuine-rich acidic protein-like protein LANP-L Hs.71331 R93500 0.7845 2556 1 0.4 - - Hs.34490 N77027 0.8344 2556 -1 0.13 - - Hs.279607 H81987 0.8218 2557 1 0.23 - - Hs.117907 AA035226 0.7355 2558 -1 0.33 KIAA1542 protein KIAA1542 Hs.130541 AA054758 0.9231 2558 -1 0.13 - -- H51348 0.618 2559 1 0.47 F-box only protein 25 FBXO25 Hs.81001 W03020 0.6641 2559 -1 0.4 Calpain 3, (p94) CAPN3 Hs.40300 H14840 0.7234 2559 -1 0.33 Hypothetical protein MGC2668 MGC2668 Hs.56851 R76719 0.8218 2559 -1 0.07 Microtubule-associated protein 1 light chain 3 alpha MAP1LC3A Hs.134707 T79536 0.5955 2560 1 0.53 - -- H00294 0.9231 2560 1 0.13 Hypothetical protein 628 LOC56270 Hs.181349 R14556 0.5734 2561 -1 0.87 - -- R17132 0.5844 2561 1 0.53 HSPC055 protein HSPC055 Hs.179898 R75740 0.7599 2561 -1 0.4 Hypothetical protein BC011880 LOC113444 Hs.27160 W21172 0.8093 2561 -1 0.3 Growth arrest-specific 11 GAS11 Hs.54877 H25911 0.8218 2561 -1 0.4 - -- R26327 0.9872 2561 1 0.03 - - Hs.374441 W23773 0.5955 2562 -1 0.67 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) BAP1 Hs.106674 W44390 0.6641 2562 1 0.33 GM2 ganglioside activator protein GM2A Hs.289082 H43564 0.5955 2563 -1 0.8 COX15 homolog, cytochrome c oxidase assembly protein (yeast) COX15 Hs.226581 AA026227 0.6758 2563 1 0.53 - -- N79578 0.7355 2563 1 0.27 ClpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coli) CLPP Hs.74362 N80064 0.8469 2564 -1 0.2 Mitochondrial ribosomal protein S6 MRPS6 Hs.6945 H44662 0.9487 2564 -1 0.07 Talin 1 TLN1 Hs.375001 H63353 0.9872 2564 -1 0.2 Hypothetical protein HSPC242 HSPC242 Hs.25199 R40588 0.6524 2565 1 0.4 - - Hs.21256 N23806 0.6876 2565 -1 0.53 Similar to envelope protein LOC113386 Hs.132055 N29497 0.8722 2565 1 0.33 - - Hs.43112 AA099608 1 2565 -1 0.1 - - Hs.7037 R31892 0.5625 2566 1 0.73 - -- N63584 0.7114 2566 1 0.33 Topoisomerase (DNA) II beta 180kDa TOP2B Hs.75248 AA101775 0.9103 2566 -1 0.2 Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) MCCC1 Hs.47649 AA114977 0.6409 2567 1 0.47 Glutaminyl-tRNA synthetase QARS Hs.79322 T86632 0.8469 2567 1 0.13 - -- AA001250 0.7114 2570 -1 0.4 - - Hs.118913 H14191 0.7845 2570 1 0.4 MMS19-like (MET18 homolog, S. cerevisiae) MMS19L Hs.288891 AA194092 0.9872 2570 0 0 Leukocyte-associated Ig-like receptor 1 LAIR1 Hs.115808 N71546 0.7599 2571 -1 0.27 Hypothetical protein FLJ20920 FLJ20920 Hs.288959 H70778 0.8849 2571 -1 0.27 Cell division cycle associated 4 CDCA4 Hs.34045 H90964 0.8849 2571 -1 0.17 Zinedin ZIN Hs.108665 R53477 0.6067 2572 -1 0.6 - - Hs.4283 AA001937 0.7355 2572 -1 0.2 ESTs ESTs Hs.59974 N49891 0.8849 2572 -1 0.2 Hypothetical protein FLJ20748 FLJ20748 Hs.91973 N69403 0.7722 2575 -1 0.2 - - Hs.48480 R19920 0.5955 2577 -1 0.7 KIAA1464 protein KIAA1464 Hs.6343 AA146850 0.8218 2577 1 0.13 - -- AA152298 0.7355 2578 1 0.4 KIAA0800 gene product KIAA0800 Hs.118738 AA011350 0.7722 2578 1 0.23 Similar to phosphoserine/threonine/tyrosine interaction protein; STNS (alternatively spliced intron of Styx) LOC122792 Hs.224818 N21144 0.7845 2578 -1 0.13 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184 AA150604 0.8093 2578 -1 0.3 Calmodulin 3 (phosphorylase kinase, delta) CALM3 Hs.334330 R24294 0.8218 2578 -1 0.13 Citron (rho-interacting, serine/threonine kinase 21) CIT Hs.15767 W58039 0.5734 2579 -1 0.63 Regulator of G-protein signalling 10 RGS10 Hs.82280 T92286 0.7477 2579 1 0.33 Ral guanine nucleotide exchange factor RalGPS1A RALGPS1A Hs.374518 AA039863 0.7234 2580 -1 0.47 Prolylcarboxypeptidase (angiotensinase C) PRCP Hs.75693 N99051 0.8469 2580 1 0.27 RNA binding motif, single stranded interacting protein 1 RBMS1 Hs.241567 N75343 0.8849 2580 -1 0.13 Polymerase (DNA directed), delta 2, regulatory subunit 50kDa POLD2 Hs.74598 R01093 0.5955 2581 1 0.53 Lymphocyte adaptor protein LNK Hs.13131 W37775 0.7477 2581 1 0.33 - -- AA053908 0.9359 2581 -1 0.07 - - Hs.59847 N46377 0.6995 2582 1 0.33 Beta-galactose-3-O-sulfotransferase, 4 GAL3ST-4 Hs.44856 AA035766 0.5199 2583 1 0.87 Spermidine/spermine N1-acetyltransferase SAT Hs.28491 H06742 0.6876 2583 1 0.6 Oxysterol binding protein-like 9 OSBPL9 Hs.21938 H69318 0.8093 2583 1 0.13 A disintegrin and metalloproteinase domain 10 ADAM10 Hs.172028 T72646 0.6067 2584 1 0.47 - -- AA039915 0.7477 2584 -1 0.27 Serum response factor (c-fos serum response element-binding transcription factor) SRF Hs.155321 N46534 0.8093 2585 1 0.27 Hypothetical protein FLJ10738 FLJ10738 Hs.5457 AA047337 0.8218 2585 1 0.17 TATA element modulatory factor 1 TMF1 Hs.267632 AA059073 0.618 2586 1 0.6 - -- AA135338 0.6995 2586 -1 0.4 ESTs ESTs Hs.132947 N74005 0.5517 2587 1 0.73 Bromodomain and PHD finger containing, 3 BRPF3 Hs.246795 N42424 0.6641 2587 -1 0.53 RAB3 GTPase-ACTIVATING PROTEIN RAB3GAP Hs.227881 W24084 0.5517 2588 -1 0.73 Major histocompatibility complex, class I, B HLA-B Hs.77961 AA131505 0.7114 2589 -1 0.47 HSPCO34 protein LOC51668 Hs.46967 H15905 0.541 2591 -1 0.8 KIAA0191 protein KIAA0191 Hs.12413 N70628 0.8344 2591 -1 0.2 Polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa POLR2K Hs.351475 R37666 0.9359 2591 1 0.27 Radical fringe homolog (Drosophila) RFNG Hs.12862 H27729 0.8344 2592 -1 0.2 AD038 LOC85026 Hs.22164 AA028141 0.6995 2593 -1 0.27 Pogo transposable element with ZNF domain POGZ Hs.107088 AA047792 0.7355 2593 -1 0.33 Regulator of G-protein signalling 1 RGS1 Hs.75256 W25045 0.8976 2593 1 0.13 General transcription factor IIIA GTF3A Hs.75113 R82340 0.6409 2595 1 0.6 Pyruvate dehydrogenase complex, lipoyl-containing component X; E3-binding protein PDX1 Hs.351622 T79657 0.7722 2595 1 0.27 ESTs ESTs Hs.14598 W23577 0.7114 2596 -1 0.47 Polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa POLR2J Hs.80475 AA044734 0.8849 2596 -1 0.33 ADP-ribosylation factor 3 ARF3 Hs.119177 H15988 0.6876 2597 1 0.43 - - Hs.27048 R62469 0.9615 2597 1 0.13 Cylindromatosis (turban tumor syndrome) CYLD Hs.18827 R65748 0.6876 2599 1 0.3 - -- N33136 0.8093 2600 1 0.03 Translin TSN Hs.75066 AA194219 0.9231 2600 0 0 - -- H23930 0.9872 2600 0 0 Lipin 1 LPIN1 Hs.81412 N32385 0.6995 2601 -1 0.53 Hypothetical protein FLJ14249 similar to HS1 binding protein 3 FLJ14249 Hs.125520 W93024 0.9359 2601 -1 0.07 - - Hs.373695 H20174 0.9487 2601 -1 0.2 Adenosine monophosphate deaminase 2 (isoform L) AMPD2 Hs.82927 T83724 0.8469 2602 -1 0.2 Growth arrest-specific 2 like 1 GAS2L1 Hs.322852 AA056554 0.9103 2602 -1 0.2 Cold shock domain protein A CSDA Hs.198726 T66839 0.9359 2602 0 0 Hypothetical protein FLJ11806 FLJ11806 Hs.323443 R25755 0.6524 2603 1 0.6 ESTs ESTs Hs.106131 W88496 0.6524 2603 -1 0.47 Zizimin1 zizimin1 Hs.8021 R64681 0.9231 2603 -1 0.2 SPPL3 SPPL3 Hs.21143 W57808 0.6995 2604 -1 0.4 H2A histone family, member J H2AFJ Hs.36727 R07644 0.6294 2605 1 0.63 RuvB-like 1 (E. coli) RUVBL1 Hs.272822 N43796 0.9103 2605 -1 0.07 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876 R80525 0.6876 2606 1 0.33 Nucleoporin Nup37 Nup37 Hs.5152 H60417 0.8849 2606 0 0 - - Hs.20000 H10415 0.6524 2607 -1 0.47 Likely ortholog of mouse Rw1 RW1 Hs.75912 R18698 0.8344 2607 1 0.27 Hypothetical protein DKFZp761B1514 DKFZp761B1514Hs.177537 N89829 0.9872 2607 -1 0.13 - - Hs.293653 T67153 0.6409 2608 1 0.53 Inner mitochondrial membrane peptidase 2 like IMMP2L Hs.89576 H91044 0.7114 2608 1 0.27 Mitogen-activated protein kinase phosphatase x MKPX Hs.29106 H94706 0.8218 2608 1 0.2 - - Hs.349150 N24920 0.9103 2608 -1 0.17 Angiogenin, ribonuclease, RNase A family, 5 ANG Hs.332764 N23942 0.6524 2610 -1 0.33 MEP50 protein MEP50 Hs.11039 H90219 0.6876 2610 -1 0.4 Inositol(myo)-1(or 4)-monophosphatase 1 IMPA1 Hs.171776 H47450 0.7845 2610 -1 0.27 - -- N36913 0.6409 2612 1 0.47 Hypothetical protein DKFZp762N1910 DKFZp762N191 Hs.321717 N70129 0.5955 2613 -1 0.6 - -- N47636 0.8849 2613 -1 0.27 Hypothetical protein DC42 DC42 Hs.72805 W78808 0.6758 2614 -1 0.53 AFG3 ATPase family gene 3-like 1 (yeast) AFG3L1 Hs.337620 R06463 0.6876 2614 1 0.53 Heat shock protein 75 TRAP1 Hs.182366 H81783 0.7114 2614 -1 0.37 ESTs ESTs Hs.40290 AA046245 0.7845 2614 -1 0.13 Osteoblast specific factor 2 (fasciclin I-like) OSF-2 Hs.136348 N21334 0.7722 2615 1 0.27 Abl-interactor 2 ABI-2 Hs.343575 R54961 0.8344 2615 1 0.27 PHD zinc finger protein XAP135 XAP135 Hs.7759 R38029 0.9359 2615 -1 0.13 Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A ANP32A Hs.285013 T47502 0.5955 2616 -1 0.57 PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein PCQAP Hs.8657 AA133495 0.7477 2616 1 0.47 Triggering receptor expressed on myeloid cells 2 TREM2 Hs.44234 W23753 0.7355 2617 1 0.17 Phosphoprotein enriched in astrocytes 15 PEA15 Hs.194673 N39216 0.5955 2619 1 0.73 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 CDS2 Hs.24812 H52694 0.7969 2619 -1 0.3 WAP four-disulfide core domain 1 WFDC1 Hs.36688 R47930 0.8849 2619 1 0.23 Hypothetical protein 669 LOC56267 Hs.180378 N77716 0.9743 2619 -1 0.13 Low molecular mass ubiquinone-binding protein (9.5kD) QP-C Hs.3709 R33011 0.541 2620 1 0.67 Suppressor of cytokine signaling 5 SOCS5 Hs.169836 W86198 0.6294 2620 -1 0.6 Yeast Sec31p homolog KIAA0905 Hs.70266 R15788 0.8218 2620 1 0.33 - -- N90754 0.8596 2620 -1 0.2 HP43.8KD protein HP43.8KD Hs.332841 T95296 0.618 2621 1 0.57 - -- N80703 0.6995 2621 -1 0.33 Chromosome 20 open reading frame 20 C20orf20 Hs.143954 H61827 0.7114 2621 -1 0.07 KIAA1882 protein MGC4737 Hs.157240 AA115477 0.6294 2622 1 0.67 General transcription factor IIF, polypeptide 1, 74kDa GTF2F1 Hs.68257 H14800 0.7234 2622 1 0.27 - -- H25007 0.5734 2624 1 0.73 - - Hs.188757 R94555 0.8469 2624 -1 0.17 Collagen, type IV, alpha 2 COL4A2 Hs.75617 R92201 0.9615 2625 1 0.13 Similar to RIKEN cDNA 1810055D05 LOC131118 Hs.349177 W57807 0.7234 2627 1 0.3 Xylosylprotein beta1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) B4GALT7 Hs.54702 W31152 0.8596 2627 -1 0.27 Hypothetical protein MGC33177 DMR Hs.55209 T97149 0.7969 2628 -1 0.2 KIAA1533 protein KIAA1533 Hs.83575 N73731 0.8344 2628 1 0.33 ESTs ESTs Hs.269183 H15212 0.44 2629 1 0.73 Transducer of ERBB2, 2 TOB2 Hs.4994 H08264 0.9103 2629 -1 0.03 Splicing factor 3b, subunit 4, 49kDa SF3B4 Hs.25797 AA005130 0.8596 2630 -1 0.2 Chromosome 7 open reading frame 2 C7orf2 Hs.107537 N35502 0.6409 2631 -1 0.4 Hypothetical protein FLJ22626 FLJ22626 Hs.5565 R36571 0.7355 2632 1 0.33 Neuroglobin NGB Hs.274363 N89889 0.6641 2633 -1 0.33 - -- T84053 0.8093 2633 -1 0.33 WAS protein family, member 2 WASF2 Hs.288908 W87414 0.541 2634 1 0.67 HLA-B associated transcript 1 BAT1 Hs.55296 W31052 0.6876 2635 1 0.4 Hypothetical protein FLJ12592 FLJ12592 Hs.23100 N35107 0.7114 2635 1 0.33 HSPC019 protein HSPC019 Hs.163724 N93437 0.7477 2635 -1 0.47 Paired immunoglobulin-like receptor beta PILR(BETA) Hs.349256 N46331 0.7599 2636 -1 0.27 KIAA0675 gene product KIAA0675 Hs.165662 AA026354 0.9487 2636 0 0 - -- W74528 0.9615 2636 -1 0.17 Calcium channel, voltage-dependent, beta 1 subunit CACNB1 Hs.635 R21449 0.5955 2637 -1 0.63 Heterogeneous nuclear ribonucleoprotein K HNRPK Hs.129548 AA035448 0.6409 2637 -1 0.53 - -- R99867 0.618 2638 1 0.53 G protein-binding protein CRFG CRFG Hs.215766 N21347 0.9872 2638 1 0.13 Hypothetical protein MGC31963 MGC31963 Hs.293984 R66021 0.6758 2639 -1 0.47 - - Hs.378493 R10692 0.7845 2639 -1 0.17 Hypothetical protein DKFZp762E1312 DKFZp762E1312Hs.104859 N91376 0.8849 2639 -1 0.27 KIAA0247 gene product KIAA0247 Hs.82426 N28519 0.9103 2640 1 0.13 Papillomavirus regulatory factor PRF-1 LOC55893 Hs.27410 R82447 0.6294 2641 -1 0.6 E3 ubiquitin ligase SMURF1 SMURF1 Hs.119120 H11041 0.7234 2641 1 0.2 Putative secreted protein ZSIG11 ZSIG11 Hs.279785 N53706 0.6067 2643 -1 0.47 Zinc finger protein ZNF-U69274 Hs.301956 H15055 0.6876 2644 -1 0.4 DNA segment, single copy probe LNS-CAI/LNS-CAII (deleted in polyposis D5S346 Hs.178112 N25320 0.7355 2645 -1 0.4 Ceroid-lipofuscinosis, neuronal 6, late infantile, variant CLN6 Hs.43654 H50403 0.5955 2646 1 0.57 Hypothetical protein FLJ20793 FLJ20793 Hs.96900 N68917 0.8596 2646 1 0.13 P53 regulated PA26 nuclear protein PA26 Hs.14125 AA054459 0.9359 2646 1 0.07 DKFZP564O1863 protein DKFZP564O186Hs.173074 T79577 0.7969 2647 -1 0.07 KIAA0653 protein, B7-like protein B7H2 Hs.14155 H19822 0.8596 2647 -1 0.1 Leucyl-tRNA synthetase, mitochondrial LARS2 Hs.2450 R60660 0.7599 2648 1 0.2 ESTs ESTs Hs.116828 H14054 0.8218 2648 1 0.27 Beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) B3GAT3 Hs.26492 R22308 0.9103 2649 -1 0.13 Nuclear phosphoprotein similar to S. cerevisiae PWP1 PWP1 Hs.172589 AA033662 0.9615 2649 1 0.13 Jun dimerization protein 2 JDP2 Hs.154095 N26998 0.6524 2650 -1 0.53 - - Hs.247240 R71903 0.7845 2650 1 0.4 Pygopus 2 PYGO2 Hs.356579 R88426 0.8469 2651 -1 0.27 Ran GTPase activating protein 1 RANGAP1 Hs.183800 R48777 0.8218 2653 -1 0.27 S100 calcium binding protein A1 S100A1 Hs.292707 R88135 0.8976 2653 -1 0.2 Ribonuclease P (30kD) RPP30 Hs.139120 H47934 0.6758 2654 1 0.53 Hypothetical protein MGC12760 MGC12760 Hs.333402 H77475 0.6409 2655 -1 0.53 - - Hs.13766 AA034296 0.6524 2657 -1 0.4 - - Hs.288613 N66544 0.6758 2657 -1 0.4 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 PSMD4 Hs.148495 R14784 0.6995 2657 1 0.37 ESTs ESTs Hs.268773 N67658 0.7114 2657 1 0.47 - - Hs.10949 H82876 0.7355 2658 1 0.4 ESTs ESTs Hs.374415 AA149810 0.9487 2658 0 0 Hypothetical protein MGC29463 MGC29463 Hs.6473 W33123 0.8469 2659 1 0.27 ADP-ribosylation factor-like 3 ARL3 Hs.182215 H99883 0.5955 2661 1 0.6 KIAA0828 protein KIAA0828 Hs.4984 H89743 0.618 2661 -1 0.53 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS Hs.93199 T85637 0.6409 2661 1 0.73 Hypothetical protein MGC10993 MGC10993 Hs.12199 H45196 0.5844 2663 1 0.8 Rho/rac guanine nucleotide exchange factor (GEF) 2 ARHGEF2 Hs.337774 T93907 0.618 2663 1 0.4 - -- AA098909 0.7969 2663 -1 0.23 KIAA0564 protein KIAA0564 Hs.151385 W31173 0.5955 2664 1 0.6 Hypothetical protein FLJ10326 FLJ10326 Hs.262823 N59843 0.6876 2664 -1 0.47 Hypothetical protein MGC2217 MGC2217 Hs.323164 AA150265 0.7969 2664 -1 0.3 Reticulocalbin 1, EF-hand calcium binding domain RCN1 Hs.167791 R80244 0.9103 2664 0 0 BTB and CNC homology 1, basic leucine zipper transcription factor 1 BACH1 Hs.154276 H26015 0.8344 2665 1 0.3 ESTs ESTs Hs.372352 N77915 0.9231 2666 -1 0.27 - -- R48321 0.6876 2667 -1 0.43 KIAA0450 gene product KIAA0450 Hs.170156 H42375 0.6995 2667 1 0.57 Hypothetical protein FLJ10211 FLJ10211 Hs.380134 R76960 0.7234 2667 1 0.4 Nei like 2 (E. coli) NEIL2 Hs.293818 T93888 0.9231 2667 1 0.1 - -- R38371 0.9359 2667 -1 0.07 - - Hs.9691 H90078 0.9743 2668 -1 0.07 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 ABCC5 Hs.108660 R13247 0.6641 2669 1 0.47 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262 W52943 0.7599 2669 -1 0.23 Dudulin 2 FLJ10829 Hs.57655 W32939 0.9743 2669 0 0 Zinc finger protein-like 1 ZFPL1 Hs.155165 H62445 0.618 2671 -1 0.67 - -- H45175 0.6409 2672 1 0.47 Zinc finger protein 36, C3H type-like 1 ZFP36L1 Hs.85155 R42549 0.8093 2672 1 0.27 Seizure related 6 homolog (mouse) SEZ6 Hs.21837 R05747 0.8469 2672 -1 0.33 Ust3 ust3 Hs.19102 AA028065 0.8722 2672 0 0 Zinc finger protein 36, C3H type-like 2 ZFP36L2 Hs.78909 R85333 0.618 2673 1 0.73 - - Hs.373513 R74405 0.6876 2673 1 0.47 - - Hs.185018 AA147618 0.9103 2673 -1 0.07 - - Hs.71848 AA069413 0.6995 2674 1 0.47 Hypothetical protein FLJ22709 FLJ22709 Hs.347130 R81509 0.8218 2674 1 0.13 Splicing factor, arginine/serine-rich 11 SFRS11 Hs.11482 AA146955 0.618 2675 -1 0.67 Hypothetical protein FLJ20519 FLJ20519 Hs.79457 H23263 0.9487 2675 1 0.03 Spir-1 protein Spir-1 Hs.16758 N48315 0.618 2676 -1 0.67 Hypothetical protein MGC2452 MGC2452 Hs.275711 N29771 0.7114 2676 1 0.53 Three prime repair exonuclease 2 TREX2 Hs.251398 R34109 0.7234 2676 1 0.33 Mitochondrial ribosomal protein L18 MRPL18 Hs.23038 H16242 0.8344 2676 1 0.33 Serologically defined colon cancer antigen 16 SDCCAG16 Hs.271926 N30606 0.6067 2677 1 0.5 Cyclin H CCNH Hs.514 T78071 0.6641 2677 1 0.53 Hypothetical protein DKFZp667M2411 DKFZp667M241Hs.190488 AA047760 0.6995 2677 -1 0.47 Phosphodiesterase 6G, cGMP-specific, rod, gamma PDE6G Hs.1857 N33230 0.7722 2677 1 0.5 High-mobility group 20A HMG20A Hs.69594 R97034 0.541 2678 -1 0.67 Serine hydroxymethyltransferase 1 (soluble) SHMT1 Hs.8889 R25517 0.8093 2678 1 0.33 - -- W52394 0.9743 2679 -1 0.17 Activating transcription factor 4 (tax-responsive enhancer element B67) ATF4 Hs.181243 N72694 0.6876 2680 1 0.3 - -- H47562 0.9359 2680 1 0.03 Mitochondrial ribosomal protein L11 MRPL11 Hs.152738 N63997 0.5625 2681 -1 0.7 - - Hs.373497 T77393 0.8849 2681 1 0.27 Hypothetical protein FLJ20297 FLJ20297 Hs.94491 AA115252 0.5734 2682 -1 0.67 ESTs ESTs Hs.28805 AA151307 0.9103 2682 1 0.07 Guanine nucleotide binding protein (G protein), beta polypeptide 2 GNB2 Hs.91299 N27136 0.9103 2682 1 0.03 Karyopherin alpha 3 (importin alpha 4) KPNA3 Hs.3886 R02725 0.9743 2682 0 0 Similar to TLH29 protein precursor LOC122509 Hs.19414 R85986 0.6524 2683 1 0.47 - -- R12118 0.8093 2683 -1 0.27 Heparan sulfate 6-O-sulfotransferase 1 HS6ST1 Hs.6363 H79411 0.8344 2684 0 0 CDC10 cell division cycle 10 homolog (S. cerevisiae) CDC10 Hs.184326 AA046006 0.9487 2684 -1 0.1 - - Hs.271541 AA011654 1 2684 -1 0.07 KIAA1458 protein KIAA1458 Hs.27263 AA053137 0.8596 2686 1 0.07 Nasopharyngeal carcinoma susceptibility protein LZ16 Hs.42390 H09083 0.9487 2686 0 0 TNF receptor-associated factor 2 TRAF2 Hs.373508 W46374 0.7599 2687 -1 0.27 - - Hs.24435 R64518 0.8596 2687 1 0.13 - - Hs.16979 W42414 0.7722 2688 1 0.47 MAD, mothers against decapentaplegic homolog 3 (Drosophila) MADH3 Hs.288261 H83414 0.5734 2689 1 0.8 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa NDUFB6 Hs.109646 W78920 0.5955 2689 -1 0.6 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569 R50785 0.6409 2689 1 0.4 Tubulin, gamma complex associated protein 6 TUBGCP6 Hs.336431 AA137081 0.9103 2689 -1 0.13 Adaptor-related protein complex 1, mu 1 subunit AP1M1 Hs.3832 H40871 0.5955 2690 1 0.73 Hypothetical protein MGC30022 MGC30022 Hs.179852 AA025089 0.6067 2690 -1 0.67 Voltage-dependent anion channel 1 VDAC1 Hs.149155 N63417 0.5517 2691 1 0.6 Beta-site APP-cleaving enzyme 2 BACE2 Hs.271411 H16567 0.6524 2691 -1 0.6 Hypothetical protein FLJ20195 FLJ20195 Hs.286261 H82877 0.8344 2691 1 0.2 Testes development-related NYD-SP21 NYD-SP21 Hs.28514 H16544 0.8596 2691 1 0.13 Autocrine motility factor receptor AMFR Hs.80731 W16436 0.6758 2692 -1 0.4 Protein kinase (cAMP-dependent, catalytic) inhibitor gamma PKIG Hs.3407 H57134 0.8218 2693 -1 0.27 - -- AA029240 0.9743 2694 1 0.2 Ligase III, DNA, ATP-dependent LIG3 Hs.100299 H49229 0.8218 2695 -1 0.27 Hypothetical protein FLJ20040 FLJ20040 Hs.61960 W78857 0.6524 2696 1 0.47 - - Hs.339722 R64104 0.9103 2696 1 0.2 - -- R66559 1 2696 -1 0.1 Nuclear receptor binding factor-2 NRBF-2 Hs.27181 N48062 1 2696 -1 0.07 - - Hs.13809 N54967 0.6995 2697 1 0.33 Hypothetical protein BM-002 BM-002 Hs.367646 R10991 0.8849 2697 0 0 MAD2 mitotic arrest deficient-like 1 (yeast) MAD2L1 Hs.79078 N48174 0.8469 2699 0 0 KIAA0332 protein KIAA0332 Hs.7976 N51711 0.618 2700 1 0.63 Hypothetical protein DKFZp761D0614 DKFZp761D061 Hs.25320 N75806 0.9231 2701 -1 0.07 ESTs ESTs Hs.109697 T79631 0.9359 2701 1 0.07 ESTs ESTs Hs.374458 R18171 0.7355 2702 -1 0.3 Shroom-related protein ShrmL Hs.278628 W23711 0.7355 2703 1 0.4 Core-binding factor, runt domain, alpha subunit 2; translocated to, 2 CBFA2T2 Hs.153934 H08387 0.8469 2703 1 0.2 Ubiquitin specific protease 3 USP3 Hs.251636 R00205 0.8976 2703 1 0.13 KIAA0595 protein KIAA0595 Hs.146957 N70615 0.9743 2703 0 0 RAB40A, member RAS oncogene family RAB40A Hs.27453 H10327 0.5517 2704 -1 0.67 - - Hs.374418 R45617 0.6758 2704 1 0.6 DNA segment, single copy probe LNS-CAI/LNS-CAII (deleted in polyposis D5S346 Hs.178112 H88042 0.7355 2704 -1 0.2 - -- R22600 0.8093 2704 1 0.13 Testis enhanced gene transcript (BAX inhibitor 1) TEGT Hs.74637 R88526 0.7114 2705 1 0.43 Scotin SCOTIN Hs.24220 W92517 0.6876 2706 -1 0.47 Actin binding LIM protein 1 ABLIM1 Hs.158203 AA127641 0.7234 2706 -1 0.47 ESTs ESTs Hs.193657 H79753 0.8722 2707 1 0.27 Death-associated protein DAP Hs.75189 W01227 0.6294 2708 1 0.47 Hepatoma-derived growth factor (high-mobility group protein 1-like) HDGF Hs.89525 AA054690 0.7355 2710 -1 0.47 Epithelial protein lost in neoplasm beta EPLIN Hs.10706 N31020 0.9359 2710 -1 0.07 KIAA0102 gene product KIAA0102 Hs.77665 N35485 0.8218 2711 1 0.4 MAD1 mitotic arrest deficient-like 1 (yeast) MAD1L1 Hs.7345 R49920 0.8722 2713 -1 0.27 Pilin-like transcription factor PILB Hs.279754 H21078 0.9231 2714 -1 0.2 Makorin, ring finger protein, 2 MKRN2 Hs.279474 H53894 0.9743 2714 -1 0.07 Cyclin D-type binding-protein 1 CCNDBP1 Hs.36794 N24593 0.9743 2714 -1 0.13 - - Hs.170538 AA116112 0.9743 2716 0 0 Mitochondrial ribosomal protein L39 MRPL39 Hs.167130 N32770 0.6758 2717 -1 0.47 Likely ortholog of mouse metal response element binding transcription factor 2 M96 Hs.31016 N63640 0.7477 2718 -1 0.4 - - Hs.39911 H73724 0.9487 2718 -1 0.2 Cyclin-dependent kinase 6 CDK6 Hs.38481 AA135928 0.7355 2719 -1 0.4 Frequenin homolog (Drosophila) FREQ Hs.301760 N93559 0.5844 2721 1 0.53 Tyrosine kinase 2 TYK2 Hs.75516 H59174 0.6995 2721 1 0.47 Hypothetical protein MGC19556 MGC19556 Hs.334787 W32156 0.7599 2721 1 0.47 Hypothetical protein MGC3329 MGC3329 Hs.25005 N69471 0.9359 2722 0 0 Protein phosphatase 1, regulatory (inhibitor) subunit 11 PPP1R11 Hs.82887 W60890 0.6758 2723 1 0.63 RAB2, member RAS oncogene family RAB2 Hs.78305 AA115748 0.7477 2724 1 0.47 Interferon-related developmental regulator 1 IFRD1 Hs.7879 W03106 0.7845 2724 -1 0.2 Mitogen-activated protein kinase kinase kinase kinase 5 MAP4K5 Hs.246970 H45128 0.9615 2724 1 0.07 - - Hs.293441 R99528 0.541 2725 1 0.67 UDP-glucuronate decarboxylase 1 UXS1 Hs.288158 T86070 0.8722 2727 1 0.17 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300 H91088 0.9359 2727 -1 0.17 - -- H78466 0.7234 2729 -1 0.4 Chromosome 4 open reading frame 1 C4orf1 Hs.270956 H10406 0.8218 2729 -1 0.13 Profilin 2 PFN2 Hs.91747 N30436 0.8849 2730 1 0.43 - - Hs.11556 AA130374 0.6409 2732 -1 0.67 - -- AA036978 0.8849 2732 -1 0.07 Chromosome 20 open reading frame 27 C20orf27 Hs.274422 N40633 0.5625 2733 -1 0.8 AD031 protein AD031 Hs.44004 AA043987 0.6995 2733 1 0.53 Parvin, alpha PARVA Hs.44077 N93576 0.7599 2733 -1 0.2 Hypothetical protein MGC2477 MGC2477 Hs.9061 T97814 0.8344 2734 1 0.33 Arrestin, beta 2 ARRB2 Hs.18142 R61384 0.5955 2738 -1 0.53 ATPase, Cu++ transporting, alpha polypeptide (Menkes syndrome) ATP7A Hs.606 AA047424 0.8849 2738 -1 0.2 - -- H67332 0.9743 2738 1 0.13 GTP binding protein 1 GTPBP1 Hs.283677 W15154 0.9487 2739 -1 0.4 - -- H39829 0.6758 2740 1 0.47 Protein kinase C-like 1 PRKCL1 Hs.2499 H73128 0.9872 2740 1 0.07 Integrin, beta 5 ITGB5 Hs.149846 AA037207 0.7845 2741 -1 0.33 KIAA1668 protein KIAA1668 Hs.8535 W23818 0.8093 2742 1 0.4 Nm23-phosphorylated unknown substrate MGC15437 Hs.55067 R19138 0.9359 2742 1 0.13 Activated p21cdc42Hs kinase ACK1 Hs.153937 H93919 0.6067 2743 -1 0.67 Glutamate-cysteine ligase, catalytic subunit GCLC Hs.151393 T51718 0.7234 2744 -1 0.33 Hypothetical protein FLJ13263 FLJ13263 Hs.288768 N89673 0.9615 2744 0 0 Peroxisome proliferative activated receptor, gamma, coactivator 1 PPARGC1 Hs.198468 AA136884 0.6067 2745 -1 0.57 Hypothetical protein FLJ21924 FLJ21924 Hs.143509 N52493 0.7234 2745 1 0.6 Hypothetical protein FLJ21432 FLJ21432 Hs.334854 N32330 0.7599 2745 1 0.3 DAZ associated protein 2 DAZAP2 Hs.75416 R72173 0.8218 2745 1 0.4 - -- W37843 0.5096 2746 1 0.67 Vacuolar protein sorting 11 (yeast) VPS11 Hs.234282 H00619 0.6409 2746 1 0.47 - - Hs.349261 N50674 0.9743 2746 1 0.07 - - Hs.311051 R52005 0.6995 2747 -1 0.47 Retinoblastoma-associated factor 600 RBAF600 Hs.297641 AA147503 0.8093 2747 -1 0.27 Homolog of yeast ribosome biogenesis regulatory protein RRS1 RRS1 Hs.71827 W72029 0.6876 2748 1 0.57 E2F transcription factor 1 E2F1 Hs.96055 AA130140 0.8093 2748 -1 0.2 SnRNP assembly defective 1 homolog SAD1 Hs.12820 N36071 0.8722 2748 -1 0.27 - - Hs.28890 H04790 0.8722 2748 -1 0.17 KIAA1855 protein KIAA1855 Hs.343820 R18812 0.9487 2748 1 0.2 Reticulon 1 RTN1 Hs.99947 H29672 0.8722 2750 -1 0.2 Protein arginine N-methyltransferase 6 PRMT6 Hs.26006 H38928 0.5844 2751 1 0.53 DKFZP566B183 protein DKFZP566B183 Hs.12305 T66873 0.6524 2751 -1 0.6 26S proteasome-associated pad1 homolog POH1 Hs.178761 AA045286 0.7477 2751 -1 0.37 Hypothetical protein FLJ10206 FLJ10206 Hs.55014 R45115 0.9359 2752 -1 0.13 Thyroid hormone receptor interactor 12 TRIP12 Hs.138617 AA044181 0.6758 2753 -1 0.47 Enabled homolog (Drosophila) ENAH Hs.14838 W06830 0.8596 2753 -1 0.2 MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) MCM5 Hs.77171 T52361 0.8976 2753 1 0.07 DKFZP434P1750 protein DKFZP434P175 Hs.7274 N62356 0.7969 2755 1 0.27 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa EIF2S1 Hs.151777 AA027065 0.8093 2755 -1 0.4 LIS1-interacting protein NUDE1, rat homolog NUDE1 Hs.263925 N45518 0.9359 2755 -1 0.07 NCK-associated protein 1 NCKAP1 Hs.278411 W87505 0.7599 2757 1 0.27 CGI-62 protein LOC51101 Hs.118821 T91049 0.9872 2757 0 0 - -- H00227 0.5955 2758 1 0.73 YY1 associated protein YAP Hs.18851 T96994 0.8218 2759 1 0.33 - - Hs.17240 N28653 0.8469 2760 -1 0.23 Cornichon-like CNIL Hs.201673 AA011676 0.7114 2761 1 0.13 G protein-coupled receptor 44 GPR44 Hs.299567 AA149278 0.9103 2761 -1 0.2 D15F37 (pseudogene) MN7 Hs.286132 N72077 0.5625 2762 1 0.67 - - Hs.196716 H91631 0.6876 2762 1 0.27 Hypothetical protein MGC15416 MGC15416 Hs.41514 AA040920 0.8218 2764 1 0.43 Chromosome 3p21.1 gene sequence HUMAGCGB Hs.84162 N73287 0.9743 2764 -1 0.07 Death-associated protein 6 DAXX Hs.336916 AA039602 0.7969 2768 1 0.13 Hypothetical protein HSPC216 HSPC216 Hs.13525 AA147535 0.8344 2768 -1 0.33 Retinoic acid induced 1 RAI1 Hs.110953 T83097 0.8218 2770 -1 0.27 Hypothetical protein 384D8_6 384D8-2 Hs.180903 R76797 0.8722 2770 1 0.2 Ubiquitin specific protease 21 USP21 Hs.8015 N/A1 0.8849 2770 1 0.2 - -- N66548 0.6409 2771 1 0.6 Stearoyl-CoA desaturase (delta-9-desaturase) SCD Hs.119597 N35773 0.7355 2772 -1 0.27 Laminin, beta 1 LAMB1 Hs.82124 N68307 0.8344 2772 -1 0.07 - - Hs.381077 T81697 0.8596 2772 1 0.2 DKFZP434M154 protein DKFZP434M154Hs.154680 R52852 0.8722 2772 1 0.13 - - Hs.355780 T47536 0.9231 2772 -1 0.13 Hypothetical protein MGC16924 MGC16924 Hs.85752 W58007 0.9359 2772 -1 0.27 KIAA0222 gene product KIAA0222 Hs.48450 R17562 0.9359 2772 1 0.07 - - Hs.239666 R54944 0.6409 2773 -1 0.53 Interleukin 18 binding protein IL18BP Hs.325978 H25541 0.9359 2773 1 0.07 STRIN protein STRIN Hs.180403 R50524 0.9487 2774 -1 0.2 Ferritin, heavy polypeptide 1 FTH1 Hs.62954 N58885 0.6524 2775 1 0.47 - -- W04300 0.8344 2775 -1 0.27 Similar to hypothetical protein MGC13138 LOC146542 Hs.301463 AA028143 0.7599 2778 1 0.5 Hypothetical protein FLJ22329 FLJ22329 Hs.367653 H29296 0.7234 2779 -1 0.37 Development and differentiation enhancing factor 2 DDEF2 Hs.12802 W95000 0.8218 2780 -1 0.4 Cell division cycle 25C CDC25C Hs.656 W03130 0.8093 2781 -1 0.27 ESTs ESTs Hs.118191 R27192 0.6641 2783 1 0.53 Putative intramembrane cleaving protease SPPL2A Hs.28980 N56656 0.9231 2783 1 0.13 Highly charged protein D13S106E Hs.151236 N20225 0.8093 2784 -1 0.2 Polymerase (RNA) II (DNA directed) polypeptide A, 220kDa POLR2A Hs.171880 W92307 0.8093 2784 -1 0.2 Interleukin enhancer binding factor 2, 45kDa ILF2 Hs.75117 T85305 0.9103 2785 -1 0.13 - -- N73706 0.8469 2786 -1 0.2 ESTs ESTs Hs.177366 N92284 0.6876 2787 1 0.53 Phospholipid transfer protein PLTP Hs.283007 R35343 0.9359 2787 -1 0.03 Hypothetical protein BC016683 LOC139231 Hs.24968 AA010018 0.6876 2788 1 0.27 Hypothetical protein FLJ22353 FLJ22353 Hs.22157 N43952 0.7114 2788 -1 0.27 - - Hs.236443 N20054 0.7355 2788 -1 0.3 - - Hs.20325 R31924 0.8344 2788 -1 0.2 Hepatoma-derived growth factor (high-mobility group protein 1-like) HDGF Hs.89525 H58066 0.9487 2788 -1 0.07 HSPC037 protein LOC51659 Hs.108196 N47180 0.9872 2789 -1 0.07 Membrane interacting protein of RGS16 MIR16 Hs.107014 W52111 0.6294 2790 1 0.67 - -- R79550 0.7355 2790 1 0.4 Lysosomal-associated protein transmembrane 4 alpha LAPTM4A Hs.111894 AA041284 0.8722 2790 -1 0.27 GDP dissociation inhibitor 1 GDI1 Hs.74576 AA037618 0.9743 2790 1 0.1 - - Hs.109731 AA045253 0.541 2792 1 0.67 ESTs ESTs Hs.161566 T87589 0.6876 2792 1 0.6 Coagulation factor VIII-associated (intronic transcript) F8A Hs.83363 AA156866 0.7969 2792 1 0.27 Uncharacterized bone marrow protein BM045 BM045 Hs.8750 W85875 0.7477 2794 1 0.47 CHMP1.5 protein CHMP1.5 Hs.380932 W87701 0.5844 2795 1 0.73 KIAA0981 protein KIAA0981 Hs.158135 W56563 0.9487 2795 1 0.03 Mitochondrial ribosomal protein S28 MRPS28 Hs.55097 N70558 0.6758 2796 -1 0.4 Potassium inwardly-rectifying channel, subfamily J, member 8 KCNJ8 Hs.102308 AA213820 0.6758 2796 1 0.6 - - Hs.256533 T97275 0.6876 2796 -1 0.33 Histone H2A.F/Z variant H2AV Hs.301005 AA034006 0.9872 2796 -1 0.07 ESTs ESTs Hs.133537 AA150683 0.9231 2797 0 0 Hypothetical protein FLJ10849 FLJ10849 Hs.8768 AA115115 0.7722 2798 1 0.33 Pyruvate dehydrogenase (lipoamide) beta PDHB Hs.979 H12016 0.8849 2798 1 0.27 Hypothetical protein FLJ21839 FLJ21839 Hs.348708 R55733 0.8469 2799 -1 0.27 - - Hs.26454 H50029 0.8596 2799 1 0.13 Ubiquitin-conjugating enzyme E2 variant 1 UBE2V1 Hs.75875 T83125 0.9615 2801 -1 0.1 - -- AA046861 0.7234 2802 1 0.33 Procollagen C-endopeptidase enhancer PCOLCE Hs.202097 R50087 0.9872 2802 0 0 GREB1 protein GREB1 Hs.193914 R08828 0.6524 2804 -1 0.6 Pyruvate kinase, liver and RBC PKLR Hs.95990 AA054497 0.8093 2804 0 0 AND-1 protein AND-1 Hs.72160 T84334 0.8469 2804 1 0.27 Thymidine kinase 2, mitochondrial TK2 Hs.274701 AA056650 0.7599 2805 1 0.27 - - Hs.380129 AA142943 0.7234 2806 -1 0.4 Docking protein 1, 62kDa (downstream of tyrosine kinase 1) DOK1 Hs.103854 R80193 0.6294 2808 1 0.53 Zinc finger protein 261 ZNF261 Hs.9568 N75316 0.8469 2808 -1 0.13 DKFZP727C091 protein DKFZP727C091Hs.43141 R20006 0.7355 2809 1 0.4 ESTs ESTs Hs.12899 H81249 0.8849 2809 1 0.17 - -- AA057261 0.6524 2810 -1 0.4 KIAA0240 protein KIAA0240 Hs.196275 H12628 0.6641 2811 1 0.47 KIAA1237 protein KIAA1237 Hs.10491 H37900 0.7355 2811 1 0.53 Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant) RHO Hs.247565 AA131823 0.7969 2811 -1 0.27 - - Hs.272198 H18946 0.8344 2811 1 0.27 Leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 LILRB2 Hs.22405 R13172 0.6995 2812 1 0.37 Nuclear receptor co-repressor 1 NCOR1 Hs.144904 H13238 0.8976 2812 1 0.2 B-cell CLL/lymphoma 3 BCL3 Hs.31210 R22985 0.7599 2815 -1 0.33 RCD1 required for cell differentiation1 homolog (S. pombe) RQCD1 Hs.293687 N73289 0.8976 2815 1 0.13 - -- H51489 0.9615 2815 -1 0.2 Plexin B3 PLXNB3 Hs.380742 T81049 0.6995 2816 -1 0.6 Ubinuclein 1 UBN1 Hs.21479 R50656 0.7969 2816 1 0.33 Protein phosphatase 1, regulatory (inhibitor) subunit 12C PPP1R12C Hs.235975 N33054 0.6876 2817 -1 0.23 - - Hs.339654 H03490 0.8722 2817 -1 0.27 Hypothetical protein FLJ10563 FLJ10563 Hs.265960 R98556 0.9615 2818 -1 0.03 Cytochrome b-5 CYB5 Hs.83834 N47247 0.7845 2819 -1 0.33 - -- AA057856 0.8722 2819 -1 0.1 ESTs ESTs Hs.63344 R11847 0.6409 2820 1 0.87 - -- R22957 0.6641 2820 1 0.47 Hypothetical protein PP1628 PP1628 Hs.7159 N57515 0.6876 2821 1 0.47 - - Hs.46627 AA040149 0.7355 2821 1 0.33 - - Hs.348989 H47418 0.6995 2824 -1 0.47 - -- R69789 0.8469 2824 -1 0.07 Hypothetical protein MGC4701 MGC4701 Hs.116771 W05039 0.6995 2825 1 0.2 HLA class II region expressed gene KE2 HKE2 Hs.356468 AA069532 0.7722 2825 -1 0.27 - - Hs.287955 R98467 0.8722 2825 1 0.13 Hypothetical protein FLJ14668 FLJ14668 Hs.334644 W90103 0.6876 2826 -1 0.67 Heterogeneous nuclear ribonucleoprotein A1 HNRPA1 Hs.249495 AA156867 0.8093 2826 1 0.23 WW domain-containing protein 1 WWP1 Hs.355977 H06932 0.8093 2827 -1 0.13 Mitochondrial ribosomal protein L20 MRPL20 Hs.182698 H18310 0.9231 2827 1 0.07 Ecotropic viral integration site 5 EVI5 Hs.179747 R61624 0.7599 2828 1 0.53 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35 DDX35 Hs.7174 T66845 0.7969 2828 1 0.47 Tax interaction protein 1 TIP-1 Hs.12956 H50385 0.8344 2828 1 0.27 Calsenilin, presenilin binding protein, EF hand transcription factor CSEN Hs.13228 H26401 0.6409 2829 1 0.67 Serine/arginine repetitive matrix 2 SRRM2 Hs.197114 N26050 0.7599 2829 -1 0.5 Polymyositis/scleroderma autoantigen 1, 75kDa PMSCL1 Hs.91728 H50621 0.9487 2830 -1 0.03 - - Hs.71523 N74558 0.7599 2831 -1 0.53 Suppression of tumorigenicity 7 ST7 Hs.5814 N51083 0.7234 2832 1 0.4 Hypothetical protein FLJ11159 FLJ11159 Hs.27021 R67127 0.8469 2833 1 0.2 Hypothetical protein FLJ12666 FLJ12666 Hs.23767 AA126874 0.9487 2833 0 0 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide YWHAH Hs.349530 N33237 0.6876 2835 1 0.43 Processing of precursors 1 POP1 Hs.170114 W01923 0.7477 2835 1 0.47 A kinase (PRKA) anchor protein 2 AKAP2 Hs.42322 R55296 0.7969 2836 1 0.47 Promyelocytic leukemia PML Hs.89633 AA010929 0.9743 2836 -1 0.03 N-methylpurine-DNA glycosylase MPG Hs.79396 W58638 0.9872 2836 1 0.13 - -- AA053216 0.8596 2837 -1 0.07 Zinc finger protein 363 ZNF363 Hs.48297 AA055757 0.5955 2838 -1 0.67 Cysteine and glycine-rich protein 2 CSRP2 Hs.10526 H96198 0.6758 2839 -1 0.47 Heterogeneous nuclear ribonucleoprotein H1 (H) HNRPH1 Hs.245710 N90919 0.7845 2839 -1 0.4 - -- W51783 0.8849 2840 0 0 Argininosuccinate lyase ASL Hs.61258 T99307 0.7355 2842 -1 0.5 Zinc finger protein 384 ZNF384 Hs.103315 N21520 0.9743 2842 1 0.07 Hypothetical protein BC008632 LOC90632 Hs.31917 R23635 0.7114 2843 -1 0.43 - -- H51376 0.8722 2843 1 0.33 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 PSMD11 Hs.90744 H43546 0.8976 2843 1 0.2 ESTs ESTs Hs.30258 W94575 0.8976 2845 -1 0.1 Cathepsin H CTSH Hs.288181 AA035135 0.6758 2846 1 0.3 - -- W72933 0.8976 2846 -1 0.2 Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor) SFRS1 Hs.73737 R95735 0.7355 2847 -1 0.47 Hypothetical protein FLJ25804 FLJ25804 Hs.373547 H57851 0.7599 2847 1 0.27 Homo sapiens, clone MGC:29471 IMAGE:4329216, mRNA, complete cds RAB24 Hs.16258 H09667 0.7234 2848 1 0.43 - -- H12586 0.9359 2848 -1 0.07 Nuclear cap binding protein subunit 1, 80kDa NCBP1 Hs.89563 AA203304 0.9872 2849 -1 0.2 CGI-130 protein LOC51020 Hs.32826 AA045081 0.7355 2851 1 0.43 Hypothetical protein FLJ21742 FLJ21742 Hs.306809 AA064765 0.8976 2851 -1 0.23 Chromosome 11 hypothetical protein ORF3 LOC56851 Hs.4245 N57339 0.7114 2852 1 0.27 Hypothetical protein FLJ11240 FLJ11240 Hs.339833 N44917 0.9743 2853 -1 0.03 - - Hs.324504 N94435 0.5734 2855 1 0.83 LYST-interacting protein LIP8 LIP8 Hs.348012 R65812 0.8469 2855 -1 0.2 Enabled homolog (Drosophila) ENAH Hs.14838 N66159 0.5844 2856 1 0.73 Cytochrome c oxidase subunit VIc COX6C Hs.351875 W39250 0.7234 2856 1 0.53 Hairy homolog (Drosophila) HRY Hs.250666 N26062 0.7234 2856 1 0.4 WD40 protein Ciao1 CIAO1 Hs.12109 R12657 0.9103 2856 1 0.07 Platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa PAFAH1B3 Hs.6793 R20746 0.9359 2856 -1 0.1 Chloride channel 7 CLCN7 Hs.80768 N29672 0.8218 2857 -1 0.33 V-fos FBJ murine osteosarcoma viral oncogene homolog FOS Hs.25647 N93133 0.8344 2857 1 0.2 Promyelocytic leukemia PML Hs.89633 N78868 0.7969 2858 -1 0.27 KIAA1049 protein KIAA1049 Hs.227835 AA193555 0.8218 2858 1 0.33 - - Hs.365589 N36089 0.8849 2858 -1 0.07 Yes-associated protein 1, 65kDa YAP1 Hs.84520 T83773 0.8218 2859 -1 0.2 Hypothetical protein HSPC216 HSPC216 Hs.13525 H93830 0.9231 2859 -1 0.13 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 ATP5G1 Hs.80986 AA036785 0.6995 2860 -1 0.3 N-myristoyltransferase 2 NMT2 Hs.122647 R88064 0.7234 2860 1 0.4 Transcription factor-like 1 TCFL1 Hs.2430 N21286 0.8596 2860 -1 0.33 - -- R06175 0.8093 2861 -1 0.47 BCL2/adenovirus E1B 19kDa interacting protein 3 BNIP3 Hs.79428 R36140 0.5734 2862 -1 0.73 - -- AA149634 0.8218 2863 1 0.33 - - Hs.182545 T93849 0.8976 2864 -1 0.13 Zinc finger protein 185 (LIM domain) ZNF185 Hs.16622 AA149232 0.7114 2865 -1 0.53 - - Hs.103411 AA055185 0.8849 2866 -1 0.27 Splicing factor, arginine/serine-rich 4 SFRS4 Hs.76122 W39328 0.7845 2867 -1 0.33 Hypothetical transmembrane protein SBBI54 SBBI54 Hs.116708 T83291 0.8849 2867 1 0.07 ESTs ESTs Hs.220624 N90643 0.7234 2868 1 0.33 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen) MCP Hs.83532 N24957 0.8218 2868 -1 0.13 Chromosome 21 open reading frame 6 C21orf6 Hs.34136 R89801 0.7599 2870 1 0.33 Hypothetical protein BC001584 LOC124245 Hs.93670 W02088 0.7722 2870 1 0.33 - -- H49993 0.8469 2871 1 0.13 Neuron navigator 2 NAV2 Hs.23467 T51710 0.9487 2871 -1 0.23 Endoglin (Osler-Rendu-Weber syndrome 1) ENG Hs.76753 H87240 0.9487 2874 1 0.13 Neural precursor cell expressed, developmentally down-regulated 8 NEDD8 Hs.75512 R71155 0.9615 2874 0 0 RalA binding protein 1 RALBP1 Hs.75447 H45746 0.6995 2875 -1 0.47 - -- W40184 0.8849 2875 1 0.3 Solute carrier family 25 (mitochondrial carrier, Aralar), member 12 SLC25A12 Hs.179866 N50057 0.8976 2875 -1 0.13 Cytokine induced protein 29 kDa CIP29 Hs.63908 AA039862 0.8976 2875 1 0.13 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein MCM3AP Hs.168481 R90757 0.9231 2875 -1 0.1 Likely ortholog of mouse rabphilin 3A RPH3A Hs.21239 N22715 0.9615 2875 0 0 Glutathione peroxidase 4 (phospholipid hydroperoxidase) GPX4 Hs.2706 R71264 0.7114 2876 -1 0.53 - - Hs.16798 R17859 0.7969 2876 1 0.2 DKFZP434C131 protein DKFZP434C131Hs.7978 W78946 0.8722 2876 1 0.17 Electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II) ETFA Hs.169919 W47132 0.8849 2876 -1 0.07 Amyotrophic lateral sclerosis 2 (juvenile) ALS2 Hs.27669 N20261 0.9872 2876 -1 0.13 - - Hs.26418 R18594 0.8722 2877 -1 0.33 Hypothetical protein MGC2817 MGC2817 Hs.159406 AA149643 0.9103 2877 1 0.07 Egl nine homolog 1 (C. elegans) EGLN1 Hs.6523 H95396 0.6995 2878 1 0.53 Elongation factor-2 kinase EEF2K Hs.259855 H87107 0.8344 2879 -1 0.37 Ring finger protein 5 RNF5 Hs.216354 R71048 0.6641 2880 1 0.6 Glycolipid transfer protein GLTP Hs.381256 H47578 0.6524 2881 -1 0.47 Ring finger protein 34 RNF34 Hs.316809 AA101787 0.6641 2881 1 0.53 Hypothetical protein FLJ20442 FLJ20442 Hs.55505 R25268 0.8976 2882 1 0.27 Uracil-DNA glycosylase UNG Hs.78853 N20844 0.9872 2882 1 0.07 Heat shock 70kDa protein 1A HSPA1A Hs.8997 N30286 0.6995 2883 -1 0.53 DKFZP564A043 protein DKFZP564A043 Hs.271623 R47739 0.8093 2883 -1 0.13 KIAA1332 protein KIAA1332 Hs.62767 R22272 0.6294 2884 1 0.73 ESTs ESTs Hs.355658 H11639 0.8596 2884 1 0.33 SH2-B homolog SH2B Hs.15744 AA136692 0.7845 2885 1 0.33 Transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) TLE3 Hs.287362 R01143 0.9872 2885 1 0.07 Solute carrier family 35 (UDP-galactose transporter), member 2 SLC35A2 Hs.21899 R70183 0.8218 2887 1 0.13 Nuclear receptor coactivator 6 interacting protein NCOA6IP Hs.179909 H14586 0.9231 2887 0 0 - -- T83745 0.9487 2887 1 0.13 Polymerase (RNA) II (DNA directed) polypeptide D POLR2D Hs.194638 W80603 0.8093 2889 -1 0.47 - - Hs.380051 R80399 0.8849 2889 1 0.27 Dishevelled, dsh homolog 3 (Drosophila) DVL3 Hs.174044 AA134572 0.6995 2890 -1 0.53 - -- AA001326 0.7845 2890 -1 0.2 Ariadne homolog 2 (Drosophila) ARIH2 Hs.241558 AA142976 0.9743 2890 -1 0.1 - - Hs.177781 N54249 0.9487 2891 -1 0.2 - -- R79034 0.7599 2893 -1 0.43 - - Hs.79204 AA028907 0.9231 2893 1 0.07 - - Hs.34447 W90498 0.7234 2894 -1 0.53 Sjogren syndrome antigen B (autoantigen La) SSB Hs.83715 R54439 0.7477 2895 -1 0.4 ESTs ESTs Hs.26119 N59805 0.9231 2898 -1 0.07 Cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa CSTF1 Hs.172865 R18971 0.6995 2899 1 0.4 Hypothetical protein DKFZp586I021 DKFZp586I021 Hs.181077 R76505 0.8976 2899 1 0.2 - - Hs.325825 AA037661 0.7477 2901 -1 0.6 - -- H11855 0.8093 2902 -1 0.27 ELK1, member of ETS oncogene family ELK1 Hs.181128 H66467 0.8218 2902 -1 0.27 F-box only protein 8 FBXO8 Hs.76917 AA045318 0.6641 2903 -1 0.7 Holocytochrome c synthase (cytochrome c heme-lyase) HCCS Hs.211571 H30899 0.8093 2903 1 0.37 - -- N91912 0.6294 2904 1 0.6 Phospholipase A2, group XII PLA2G12 Hs.25206 N33087 0.6641 2904 1 0.47 Myosin regulatory light chain interacting protein MIR Hs.20072 AA045732 0.7722 2904 1 0.2 LOC147184 LOC147184 Hs.13740 T84134 0.9103 2904 1 0.07 Hydroxymethylbilane synthase HMBS Hs.82609 N49737 0.9487 2904 -1 0.1 DKFZp434K114 protein DKFZp434K114 Hs.6107 N36881 0.9231 2906 -1 0.3 Hypothetical protein FLJ38968 FLJ38968 Hs.356496 H96724 0.618 2907 1 0.73 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) DAB2 Hs.81988 AA121546 0.7969 2907 1 0.13 Hypothetical protein PRO0971 PRO0971 Hs.152316 R71483 0.6409 2908 1 0.6 Transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) TFAP2A Hs.334334 N95764 0.8469 2908 1 0.33 Chromosome 20 open reading frame 77 C20orf77 Hs.27192 AA034388 0.8344 2909 1 0.33 Sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphor SEMA4B Hs.9598 N62067 0.9487 2909 -1 0.03 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742 N41539 0.9743 2910 1 0.13 Sp1 transcription factor SP1 Hs.2021 N26672 0.7722 2911 1 0.33 CD83 antigen (activated B lymphocytes, immunoglobulin superfamily) CD83 Hs.79197 AA115560 0.8093 2911 -1 0.17 - - Hs.63368 N20098 0.8722 2911 1 0.07 CD151 antigen CD151 Hs.75564 N62554 0.9487 2911 -1 0.07 Hypothetical protein FLJ39514 FLJ39514 Hs.48565 N69121 0.9231 2912 0 0 HSPC159 protein HSPC159 Hs.372208 R96346 0.9487 2912 1 0.17 - - Hs.374127 AA043812 0.8344 2913 -1 0.27 Sentrin/SUMO-specific protease SENP1 Hs.66450 R45007 0.9231 2913 -1 0.23 Adaptor-related protein complex 3, delta 1 subunit AP3D1 Hs.75056 T96991 0.9103 2914 -1 0.13 Thioredoxin reductase 1 TXNRD1 Hs.13046 R56894 0.8218 2915 -1 0.2 ESTs ESTs Hs.26010 R51985 0.7599 2916 1 0.27 Uncharacterized hypothalamus protein HT008 HT008 Hs.16206 W84774 1 2916 -1 0.07 - - Hs.17643 N21080 0.7599 2917 -1 0.2 PAX transcription activation domain interacting protein 1 like PAXIP1L Hs.173854 R96651 0.8596 2917 -1 0.2 ATX1 antioxidant protein 1 homolog (yeast) ATOX1 Hs.279910 N29418 0.8976 2917 1 0.07 - - Hs.44024 W56823 0.6995 2918 -1 0.33 Paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein) PACE Hs.59242 AA004891 0.7355 2920 1 0.53 Ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) UBE2H Hs.372758 N30185 0.8849 2920 1 0.07 Hypothetical protein FLJ11252 FLJ11252 Hs.23495 H79188 0.7599 2922 -1 0.33 Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum DERCC2 Hs.99987 T92329 0.7599 2925 -1 0.07 - - Hs.193969 T99317 0.8469 2926 -1 0.2 - - Hs.5250 R18757 0.8596 2926 -1 0.33 - - Hs.13702 H90824 0.9615 2926 1 0.03 Sec23 homolog A (S. cerevisiae) SEC23A Hs.272927 H65168 0.9615 2926 -1 0.33 Solute carrier family 12 (sodium/potassium/chloride transporters), member 2 SLC12A2 Hs.110736 R16206 1 2926 1 0.13 - -- AA054551 0.7845 2928 1 0.37 - -- AA047406 0.9615 2930 1 0.07 Translocase of outer mitochondrial membrane 70 homolog A (yeast) TOMM70A Hs.21198 W85779 0.6876 2932 -1 0.6 Zinc finger protein 133 (clone pHZ-13) ZNF133 Hs.78434 AA040123 0.8849 2932 1 0.27 Solute carrier family 27 (fatty acid transporter), member 4 SLC27A4 Hs.248953 N25873 0.9359 2933 1 0.07 Chromosome 20 open reading frame 36 C20orf36 Hs.184628 AA001216 0.7722 2934 1 0.2 Paxillin PXN Hs.102497 R86031 0.9231 2934 -1 0.07 Hypothetical protein FLJ22060 FLJ22060 Hs.29403 N51785 0.9615 2934 0 0 - - Hs.380911 AA039738 0.8218 2935 -1 0.33 KIAA0697 protein KIAA0697 Hs.12329 W21604 0.7969 2936 1 0.33 Novel putative protein similar to YIL091C yeast hypothetical 84 kD protein from SGA1-KTR7 DJ434O14.5 Hs.194754 N24561 0.9743 2936 -1 0.13 - - Hs.290880 T92003 0.8722 2937 -1 0.33 - -- N39446 0.8093 2938 -1 0.33 E1A binding protein p300 EP300 Hs.25272 T87532 0.9487 2938 -1 0.1 ESTs ESTs Hs.10739 H20790 0.7477 2939 1 0.2 - - Hs.352590 AA069271 0.6067 2940 -1 0.7 IK cytokine, down-regulator of HLA II IK Hs.8024 AA045281 0.8722 2940 1 0.17 Phosphoprotein associated with glycosphingolipid-enriched microdomains PAG Hs.266175 AA135332 0.7722 2941 -1 0.33 ESTs ESTs Hs.71608 R67214 0.8218 2941 -1 0.17 MAD, mothers against decapentaplegic homolog 4 (Drosophila) MADH4 Hs.75862 R28340 0.9615 2941 -1 0.07 MYC-associated zinc finger protein (purine-binding transcription factor) MAZ Hs.7647 R72784 0.8976 2943 1 0.33 Cysteinyl-tRNA synthetase CARS Hs.159604 H40716 0.7114 2944 1 0.67 ESTs ESTs Hs.121518 AA029551 0.7599 2944 -1 0.47 ESTs ESTs Hs.61373 W68734 0.9231 2945 1 0.2 Uncharacterized hematopoietic stem/progenitor cells protein MDS028 MDS028 Hs.29647 AA194896 0.9231 2945 1 0.2 Peroxisomal membrane protein 3, 35kDa (Zellweger syndrome) PXMP3 Hs.180612 H62739 0.7845 2946 1 0.5 - - Hs.14824 R20853 0.8722 2946 -1 0.23 KIAA1320 protein KIAA1320 Hs.117414 R88266 0.9231 2946 -1 0.07 Glutamate receptor, ionotropic, N-methyl D-aspartate 1 GRIN1 Hs.105 AA194047 0.7114 2948 1 0.47 Mitogen-activated protein kinase kinase 7 MAP2K7 Hs.110299 R39875 1 2948 0 0 - -- AA045734 0.6876 2950 1 0.6 GS15 LOC51272 Hs.300631 R22511 0.7355 2950 -1 0.4 LAG1 longevity assurance homolog 2 (S. cerevisiae) LASS2 Hs.285976 H87111 0.7845 2952 1 0.3 Hypothetical protein FLJ11011 FLJ11011 Hs.21275 N44758 0.8093 2954 -1 0.33 KIAA1036 protein KIAA1036 Hs.155182 AA151305 0.9872 2954 1 0.07 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569 H75644 0.8596 2956 -1 0.17 Hypothetical protein BC016005 LOC129642 Hs.356547 AA047130 0.9743 2957 -1 0.07 - -- N58356 0.9743 2957 -1 0.13 HSPC009 protein HSPC009 Hs.16059 AA026571 0.6995 2958 -1 0.47 Hypothetical protein FLJ21415 FLJ21415 Hs.120170 H28503 0.6995 2958 1 0.5 - -- AA011675 0.8849 2958 1 0.23 Adaptor-related protein complex 1, sigma 1 subunit AP1S1 Hs.57600 T84975 0.9872 2958 -1 0.03 TRAF4 associated factor 1 FLJ14502 Hs.181466 T86612 0.9743 2959 -1 0.07 ESTs ESTs Hs.16228 N48306 0.8976 2960 -1 0.2 PC4 and SFRS1 interacting protein 2 PSIP2 Hs.82110 AA010162 0.6876 2961 -1 0.53 Frizzled homolog 1 (Drosophila) FZD1 Hs.94234 AA035519 0.7355 2961 -1 0.33 Chromosome 2 open reading frame 3 C2orf3 Hs.184175 N71041 0.8976 2961 1 0.2 RNA polymerase I 16 kDa subunit LOC51082 Hs.106127 T81175 0.7845 2962 1 0.33 - - Hs.355957 W56002 0.7969 2962 0 0 Acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiolase) ACAA1 Hs.166160 R74460 0.7722 2963 1 0.47 CGI-45 protein LOC51094 Hs.5298 H23260 0.6409 2964 1 0.67 NDRG family member 3 NDRG3 Hs.355855 N62518 0.8849 2964 1 0.07 CD22 antigen CD22 Hs.171763 W90588 0.9872 2964 1 0.07 Synaptogyrin 1 SYNGR1 Hs.6139 H41939 0.8093 2966 1 0.33 Discoidin domain receptor family, member 1 DDR1 Hs.75562 R25121 0.8976 2966 -1 0.23 Uncharacterized hypothalamus protein HCDASE LOC55862 Hs.239218 H01569 0.8976 2968 1 0.13 ESTs ESTs Hs.30237 AA053136 0.8722 2970 -1 0.27 KIAA1982 protein KIAA1982 Hs.22969 N76293 0.9103 2970 1 0.27 Diaphanous homolog 1 (Drosophila) DIAPH1 Hs.26584 W78864 0.9872 2970 -1 0.2 Mouse Mammary Turmor Virus Receptor homolog 1 MTVR1 Hs.18686 H77388 0.8344 2971 -1 0.33 - - Hs.356560 AA047077 1 2971 -1 0.27 Amylase, alpha 2B; pancreatic AMY2B Hs.335493 H89087 0.8218 2973 1 0.13 - -- H83499 0.9359 2974 -1 0.4 Endothelin converting enzyme 1 ECE1 Hs.288203 AA033871 0.9487 2974 1 0.03 Methionine adenosyltransferase II, alpha MAT2A Hs.77502 T96595 0.9872 2975 1 0.07 ESTs ESTs Hs.302270 R92361 0.9359 2976 1 0.07 ESTs ESTs Hs.34576 H39075 0.9231 2978 1 0.17 Calcium/calmodulin-dependent protein kinase kinase 2, beta CAMKK2 Hs.108708 AA045470 0.8849 2980 1 0.27 Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) KRT10 Hs.99936 N45602 0.7114 2981 -1 0.4 - - Hs.250824 R12426 0.8093 2981 1 0.27 - -- N70267 0.7477 2982 -1 0.33 Integral membrane protein 2B ITM2B Hs.239625 H49485 0.7114 2983 -1 0.57 Cytochrome c oxidase subunit VIIb COX7B Hs.75752 T95320 0.8344 2985 1 0.27 ESTs ESTs Hs.90953 R99052 0.7845 2986 -1 0.33 Biliverdin reductase B (flavin reductase (NADPH)) BLVRB Hs.76289 N69648 0.9872 2986 -1 0.07 - - Hs.269135 W92124 0.9359 2987 1 0.2 Hypothetical protein MGC12981 MGC12981 Hs.104203 R11709 0.8093 2988 -1 0.23 Fatty-acid-Coenzyme A ligase, long-chain 6 FACL6 Hs.14945 W47372 0.9743 2989 -1 0.1 Zinc finger protein 36, C3H type-like 2 ZFP36L2 Hs.78909 H02835 0.8344 2990 1 0.13 G1 to S phase transition 1 GSPT1 Hs.2707 H49493 0.7722 2991 -1 0.07 - -- AA047053 0.8976 2991 -1 0.03 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 ATP6V1B2 Hs.1697 H62940 0.8596 2992 1 0.33 - -- N24725 0.5844 2993 1 0.87 Small nuclear ribonucleoprotein polypeptide B'' SNRPB2 Hs.82575 R02110 0.7234 2994 1 0.53 XPMC2 protein LOC57109 Hs.235376 H59207 0.9103 2994 1 0.2 SudD suppressor of bimD6 homolog (A. nidulans) SUDD Hs.209061 N36412 0.8596 2995 -1 0.13 Dynein, cytoplasmic, light intermediate polypeptide 2 DNCLI2 Hs.194625 W94862 0.9487 2995 1 0.07 Adenosine deaminase, RNA-specific ADAR Hs.7957 R54646 0.7114 2996 -1 0.53 F-box and leucine-rich repeat protein 6 FBXL6 Hs.12271 AA011565 0.9359 2996 1 0.13 Squamous cell carcinoma antigen recognised by T cells 3 SART3 Hs.116875 R76996 0.7355 2997 -1 0.5 Lamin B receptor LBR Hs.152931 N40607 0.7477 2998 -1 0.33 Alpha2,3-sialyltransferase ST3GALVI Hs.34578 R16440 0.7969 2998 -1 0.33 AD024 protein AD024 Hs.21137 T83266 0.7355 3000 1 0.43 Tetraspan 3 TSPAN-3 Hs.100090 W85949 0.8976 3000 1 0.07 - - Hs.339808 N48314 0.8976 3000 -1 0.07 Hermansky-Pudlak syndrome 4 HPS4 Hs.6657 H19104 0.7722 3001 1 0.3 - - Hs.23406 R10029 0.7845 3001 1 0.4 ESTs ESTs Hs.20516 AA136788 0.9487 3001 0 0 - -- N48895 0.7114 3002 -1 0.53 F-box DNA helicase 1 FBH1 Hs.6193 N63284 0.6524 3005 -1 0.6 Putative protein O-mannosyltransferase POMT2 Hs.132989 H20004 0.8469 3005 -1 0.27 WD repeat domain 8 WDR8 Hs.31714 H11243 0.8469 3007 1 0.4 Bromodomain containing 1 BRD1 Hs.127950 R45475 0.8469 3007 1 0.13 Phosphodiesterase 8B PDE8B Hs.78106 N39255 0.6876 3009 1 0.6 Butyrophilin, subfamily 3, member A2 BTN3A2 Hs.87497 AA005268 0.6876 3011 -1 0.6 Chromosome 21 open reading frame 91 C21orf91 Hs.49391 AA131302 0.7477 3011 -1 0.47 - - Hs.71404 H50895 0.7599 3011 1 0.6 Microtubule-associated protein 4 MAP4 Hs.239298 AA005195 0.8093 3011 1 0.13 Serine/threonine kinase 36 (fused homolog, Drosophila) STK36 Hs.26996 AA045063 0.8344 3013 -1 0.07 Presenilin 2 (Alzheimer disease 4) PSEN2 Hs.25363 R93490 0.8469 3013 1 0.2 Cleavage and polyadenylation specific factor 4, 30kDa CPSF4 Hs.6351 W68077 0.8218 3014 1 0.47 Single-stranded DNA binding protein SSBP1 Hs.923 R63807 0.7722 3015 1 0.4 CGI-85 protein CGI-85 Hs.267448 AA034995 0.6294 3016 1 0.53 ESTs ESTs Hs.293819 R38638 0.8849 3016 1 0.27 - - Hs.5064 W93811 0.9231 3016 -1 0.07 Killer cell lectin-like receptor subfamily B, member 1 KLRB1 Hs.169824 W17370 0.7845 3018 1 0.4 Mitochondrial elongation factor G EFG1 Hs.274543 R93735 0.8093 3019 -1 0.33 ESTs ESTs Hs.35193 W05091 0.8344 3019 -1 0.33 Wilms' tumour 1-associating protein WTAP Hs.119 R59179 0.7599 3020 1 0.43 Nucleolar protein 3 (apoptosis repressor with CARD domain) NOL3 Hs.278439 R95136 0.7599 3023 1 0.5 - -- T83467 0.9872 3023 -1 0.13 Inositol 1,4,5-trisphosphate 3-kinase B ITPKB Hs.78877 N29558 0.7845 3024 -1 0.4 - - Hs.293865 R01798 0.7845 3026 1 0.27 LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 Hs.19074 N42817 0.6995 3028 -1 0.4 Cytochrome c oxidase subunit VIc COX6C Hs.351875 R09452 0.7355 3028 -1 0.53 Hypothetical protein FLJ10460 FLJ10460 Hs.14347 N59563 0.8218 3028 1 0.07 Cyclin D-type binding-protein 1 CCNDBP1 Hs.36794 H10407 0.8722 3029 1 0.27 KIAA0515 protein KIAA0515 Hs.108945 AA026250 0.8469 3031 1 0.27 - -- R71120 0.7234 3032 -1 0.33 KIAA0831 protein KIAA0831 Hs.103000 R28033 0.9231 3032 -1 0.2 Protein tyrosine phosphatase, non-receptor type 18 (brain-derived) PTPN18 Hs.278597 H80498 0.9743 3032 -1 0.2 KIAA0286 protein KIAA0286 Hs.14912 W16435 0.7114 3034 -1 0.37 PXR2b protein PXR2b Hs.46780 W45538 0.8849 3034 1 0.27 KIAA0062 protein KIAA0062 Hs.89868 H18558 0.6758 3036 1 0.47 Transcription factor A, mitochondrial TFAM Hs.75133 H28623 0.5517 3037 1 0.87 Cellular repressor of E1A-stimulated genes CREG Hs.5710 N68460 0.7845 3037 1 0.2 - - Hs.27038 AA040028 0.8093 3038 1 0.47 Hypothetical protein BC014641 LOC129138 Hs.135259 T74462 0.7969 3040 1 0.33 Transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) TAP1 Hs.352018 AA045741 0.7477 3041 1 0.47 Hypothetical protein FLJ14251 FLJ14251 Hs.281462 R96334 0.8469 3041 1 0.4 - -- R55942 0.9231 3043 -1 0.03 - - Hs.4267 H03230 0.9615 3043 -1 0.1 - -- AA039246 0.7477 3046 1 0.37 Transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) TLE2 Hs.332173 R88035 0.8596 3046 1 0.07 Centrosomal protein 2 CEP2 Hs.27910 AA099589 0.9615 3047 1 0.13 GDP dissociation inhibitor 2 GDI2 Hs.56845 AA004785 0.8849 3053 -1 0.2 Annexin A5 ANXA5 Hs.300711 R97943 0.6758 3054 1 0.73 Zinc finger protein 26 (KOX 20) ZNF26 Hs.26432 R14266 0.9872 3055 -1 0.03 - -- T87298 0.9231 3056 -1 0.27 - -- W05762 0.8596 3057 -1 0.17 Hypothetical protein MGC24447 MGC24447 Hs.353161 R17223 0.9359 3057 -1 0.13 - -- AA099910 1 3057 1 0.07 Glutamyl aminopeptidase (aminopeptidase A) ENPEP Hs.291 T93794 0.7969 3058 -1 0.1 - -- H19718 0.8344 3058 -1 0.23 Glutamate receptor, ionotrophic, AMPA 4 GRIA4 Hs.163697 R51286 0.7599 3059 -1 0.2 Integrin cytoplasmic domain-associated protein 1 ICAP-1A Hs.173274 R79455 0.8469 3063 -1 0.2 Activating transcription factor 1 ATF1 Hs.36908 N63501 0.7477 3065 -1 0.47 YY1 transcription factor YY1 Hs.97496 N93147 0.9103 3065 -1 0.33 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 2 MLLT2 Hs.114765 AA069444 0.9615 3066 0 0 Dicer1, Dcr-1 homolog (Drosophila) DICER1 Hs.87889 H66409 0.9743 3067 -1 0.13 ESTs ESTs Hs.108275 W85878 0.8218 3068 -1 0.4 Transcription factor 19 (SC1) TCF19 Hs.249184 W87377 0.9231 3068 -1 0.3 DNA segment, numerous copies, expressed probes (GS1 gene) DXF68S1E Hs.78991 R46282 0.7355 3069 -1 0.4 - -- H82739 0.9487 3070 0 0 - - Hs.40411 H30821 0.8344 3073 1 0.2 SUMO-1-specific protease SUSP1 Hs.27197 H26525 0.7234 3075 1 0.37 LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 Hs.19074 H58724 0.7477 3078 1 0.4 - - Hs.374462 AA136159 0.8722 3078 1 0.07 Microsomal glutathione S-transferase 1 MGST1 Hs.355733 R50205 0.7477 3079 -1 0.53 - -- N36659 0.8976 3085 1 0.13 Neuron navigator 1 NAV1 Hs.6298 N45646 0.8218 3087 -1 0.27 - -- W85892 0.7114 3088 1 0.47 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) BTAF1 Hs.180930 H89628 0.6758 3090 -1 0.73 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive) SLC9A1 Hs.170222 W38743 0.7355 3090 -1 0.27 Olfactomedin 2 OLFM2 Hs.169743 H50914 0.8722 3090 -1 0.33 Endothelin converting enzyme 1 ECE1 Hs.288203 H29623 0.8976 3091 1 0.13 Bullous pemphigoid antigen 1, 230/240kDa BPAG1 Hs.198689 AA035325 0.7845 3092 1 0.27 Insulin receptor substrate 2 IRS2 Hs.143648 N93577 0.9103 3092 -1 0.13 Hypothetical protein HSPC251 HSPC251 Hs.54971 T79632 0.7234 3094 1 0.5 ESTs ESTs Hs.189716 H61388 0.8218 3095 1 0.23 Fragile X mental retardation, autosomal homolog 1 FXR1 Hs.82712 AA069421 0.9872 3096 -1 0.03 - -- AA137064 0.7355 3097 1 0.47 Cerebral cell adhesion molecule LOC51148 Hs.23954 W16753 0.618 3098 -1 0.7 - - Hs.198552 T50061 0.9743 3099 0 0 - -- R25543 0.9103 3101 1 0.13 - - Hs.23133 H75387 0.8976 3102 1 0.23 - -- AA136976 0.8722 3106 1 0.2 KIAA1023 protein KIAA1023 Hs.21361 T83953 0.8722 3106 1 0.17 Similar to arginyl-tRNA synthetase LOC57038 Hs.15395 N44176 0.7969 3109 1 0.2 Hypothetical protein MGC2865 MGC2865 Hs.94814 R67239 0.9103 3109 0 0 Bromodomain adjacent to zinc finger domain, 2A BAZ2A Hs.277401 N90240 0.7969 3110 -1 0.3 Spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2) SCA2 Hs.76253 N29574 0.8849 3110 -1 0.17 Rag D protein RAGD Hs.238679 N64639 0.7234 3111 -1 0.27 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) DUSP3 Hs.181046 H52254 0.8218 3111 1 0.13 - - Hs.356708 AA055190 0.8722 3111 1 0.27 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15 DDX15 Hs.5683 H85625 0.9487 3111 1 0.2 Checkpoint suppressor 1 CHES1 Hs.211773 N31674 0.9872 3112 -1 0.03 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 ALS2CR3 Hs.154248 AA131782 0.7114 3113 1 0.37 - - Hs.182314 AA046822 0.7969 3113 -1 0.4 ESTs ESTs Hs.61272 R61688 0.8344 3113 1 0.27 ATP-binding cassette, sub-family A (ABC1), member 2 ABCA2 Hs.94806 H15341 0.8596 3114 1 0.2 Phosphoribosyl pyrophosphate synthetase 2 PRPS2 Hs.2910 T80020 0.7234 3115 1 0.47 Microtubule-associated protein 4 MAP4 Hs.239298 R90939 0.8344 3115 1 0.37 ESTs ESTs Hs.34180 W33060 0.8093 3116 -1 0.4 Sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase) SIAT4B Hs.343628 W31151 0.9487 3116 1 0.07 DNA segment on chromosome X and Y (unique) 155 expressed sequence DXYS155E Hs.21595 AA134770 0.8849 3118 1 0.13 Zinc finger protein 24 (KOX 17) ZNF24 Hs.183593 H65280 0.8596 3121 1 0.27 ESTs ESTs Hs.38348 N27137 0.7234 3124 -1 0.6 Catechol-O-methyltransferase COMT Hs.240013 N54731 0.7234 3125 -1 0.47 Protein kinase C and casein kinase substrate in neurons 2 PACSIN2 Hs.18842 H67335 0.8722 3125 1 0.27 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa NDUFA10 Hs.198271 AA041346 0.6758 3127 -1 0.63 M-phase phosphoprotein 6 MPHOSPH6 Hs.152720 T93603 0.7599 3127 1 0.4 Tumor protein D52-like 1 TPD52L1 Hs.16611 H19984 0.7969 3128 1 0.4 Stromal membrane-associated protein SMAP1 Hs.373517 N70264 0.9487 3129 1 0.07 Phosphatidylcholine transfer protein PCTP Hs.285218 AA099036 0.8093 3130 1 0.2 Astrotactin 2 ASTN2 Hs.30898 W31553 0.9103 3130 -1 0.13 Choline kinase-like CHKL Hs.154886 W45316 0.7114 3132 1 0.4 XPMC2 protein LOC57109 Hs.235376 W70217 0.9487 3133 0 0 Catechol-O-methyltransferase COMT Hs.240013 H21758 0.7355 3134 -1 0.4 - - Hs.375003 AA043235 0.7234 3138 1 0.33 Novel putative protein similar to YIL091C yeast hypothetical 84 kD protein from SGA1-KTR7 DJ434O14.5 Hs.194754 R13742 0.7599 3138 1 0.4 - -- AA193346 0.7355 3139 -1 0.53 Phosphatidylinositol glycan, class S PIGS Hs.347950 H62319 0.8469 3139 -1 0.13 - - Hs.133526 AA126383 0.9103 3145 1 0.33 Neuropilin 2 NRP2 Hs.17778 W69209 0.9231 3146 1 0.2 Phosphatidylinositol glycan, class H PIGH Hs.177 R32813 0.6995 3147 -1 0.4 Hypothetical protein MGC2668 MGC2668 Hs.56851 R91278 0.9231 3147 -1 0.13 - -- N46251 0.7969 3148 1 0.2 Phafin 2 FLJ13187 Hs.29724 N32508 0.9103 3148 -1 0.17 G-protein gamma-12 subunit LOC55970 Hs.8107 R05881 0.8849 3149 1 0.07 KIAA0971 protein KIAA0971 Hs.84429 W04797 0.8469 3150 -1 0.2 Dystrobrevin binding protein 1 DTNBP1 Hs.43481 H89361 0.8722 3150 -1 0.13 Mesoderm development candidate 1 MESDC1 Hs.290356 W88446 0.9359 3153 1 0.2 Natural killer-tumor recognition sequence NKTR Hs.241493 W92260 0.6876 3154 1 0.5 RAB11A, member RAS oncogene family RAB11A Hs.75618 H85608 0.7969 3154 1 0.27 Protein phosphatase 1, regulatory (inhibitor) subunit 2 PPP1R2 Hs.267819 N69956 0.9231 3154 -1 0.27 - - Hs.148676 H88030 0.7845 3157 -1 0.17 Splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) SFRS10 Hs.30035 T71616 0.9615 3158 0 0 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa EIF2S1 Hs.151777 AA026113 0.6524 3159 -1 0.67 Hypothetical protein FLJ10252 FLJ10252 Hs.53913 N55327 0.8596 3159 -1 0.4 Geminin, DNA replication inhibitor GMNN Hs.234896 N90291 0.9359 3160 0 0 DKFZP564J0863 protein DKFZP564J0863Hs.333403 R70132 0.8218 3161 -1 0.3 - - Hs.378751 AA029861 0.8849 3163 1 0.07 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein) BECN1 Hs.12272 W49616 0.9103 3164 -1 0.2 Villin 2 (ezrin) VIL2 Hs.155191 N57339 0.6758 3170 -1 0.57 Hypothetical protein FLJ11240 FLJ11240 Hs.339833 W90099 0.7114 3173 1 0.53 Neuroepithelial cell transforming gene 1 NET1 Hs.25155 T99195 0.8344 3174 1 0.47 - - Hs.18593 R72114 0.8722 3174 -1 0.27 Melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) MC1R Hs.380388 AA027125 0.9359 3175 -1 0.03 Hypothetical protein FLJ10385 FLJ10385 Hs.30922 AA029484 0.9487 3175 1 0.13 DKFZP727M111 protein DKFZP727M111Hs.4849 AA114872 0.9743 3176 1 0.03 Aconitase 1, soluble ACO1 Hs.154721 N59525 0.8596 3177 -1 0.33 CDC16 cell division cycle 16 homolog (S. cerevisiae) CDC16 Hs.1592 AA041283 0.9231 3180 -1 0.27 Unc-51-like kinase 1 (C. elegans) ULK1 Hs.47061 R18905 0.8218 3181 1 0.3 Centaurin, delta 1 CENTD1 Hs.22572 AA043739 0.8596 3182 1 0.4 - - Hs.96513 R12692 0.8596 3185 1 0.2 Sterol-C4-methyl oxidase-like SC4MOL Hs.239926 N94263 1 3186 0 0 Thyroid hormone receptor interactor 10 TRIP10 Hs.73999 AA037833 1 3187 0 0 Hypothetical protein MGC20496 MGC20496 Hs.12106 W47349 0.7355 3188 -1 0.47 KIAA0592 protein KIAA0592 Hs.13273 N92358 0.7845 3195 -1 0.07 Hypothetical protein FLJ22029 FLJ22029 Hs.285243 H07882 0.8596 3195 -1 0.2 KIAA0586 gene product KIAA0586 Hs.77724 T86363 0.7355 3196 1 0.43 - -- R49516 0.8344 3199 -1 0.13 ESTs ESTs Hs.6653 AA156458 0.8596 3199 -1 0.03 Spastic paraplegia 7, paraplegin (pure and complicated autosomal recessive) SPG7 Hs.296847 R08892 0.9103 3199 0 0 Hypothetical protein MGC4692 MGC4692 Hs.13561 N95539 0.6995 3201 1 0.6 Hypothetical protein BC001563 LOC123016 Hs.55158 W46869 0.8469 3202 -1 0.13 - - Hs.356699 H42051 0.7477 3203 -1 0.57 Early growth response 1 EGR1 Hs.326035 R88822 0.9487 3203 -1 0.07 - - Hs.26249 R93692 0.8722 3208 -1 0.07 Vaccinia related kinase 2 VRK2 Hs.82771 W07077 0.8849 3209 1 0.27 Hematopoietic PBX-interacting protein HPIP Hs.8068 R47941 0.9359 3209 1 0.03 Hypothetical protein BC018453 LOC129531 Hs.14222 W89013 0.9103 3210 1 0.17 Tripartite motif-containing 26 TRIM26 Hs.1287 N23528 0.8218 3212 1 0.47 Arginyl aminopeptidase (aminopeptidase B) RNPEP Hs.283667 R78346 0.7599 3214 -1 0.27 - -- R12233 0.7722 3214 -1 0.33 NY-REN-24 antigen LOC58509 Hs.128425 R13232 0.9743 3216 1 0.07 Hypothetical protein MGC5601 MGC5601 Hs.64211 R21804 0.7114 3217 -1 0.57 - -- W38337 0.8344 3217 -1 0.47 - -- T79503 0.9231 3217 -1 0.2 - -- N42535 0.6876 3221 1 0.53 Hypothetical protein BC008647 LOC91875 Hs.102480 H09552 0.8596 3222 1 0.33 Hypothetical protein FLJ20272 FLJ20272 Hs.26090 H77668 0.9487 3224 1 0.07 Aryl hydrocarbon receptor AHR Hs.170087 N48661 1 3224 -1 0.07 KIAA1604 protein KIAA1604 Hs.209464 W15364 0.9359 3226 -1 0.2 B-cell CLL/lymphoma 7A BCL7A Hs.211563 H99877 0.9743 3227 1 0.03 - - Hs.380785 H47565 0.9872 3232 1 0.07 NS1-binding protein NS1-BP Hs.197298 R12961 0.9872 3233 1 0.2 Hypothetical protein DKFZp434B044 DKFZP434B044 Hs.262958 AA045109 0.9615 3234 -1 0.27 Chromosome 7 open reading frame 11 C7orf11 Hs.66666 N36138 0.8849 3235 1 0.13 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899 R41603 0.9103 3235 1 0.33 Secretogranin II (chromogranin C) SCG2 Hs.75426 T48696 0.7234 3242 -1 0.47 Putative nuclear protein ORF1-FL49 ORF1-FL49 Hs.323512 W45086 0.6995 3243 -1 0.33 Multidrug resistance-associated protein 7 SIMRP7 Hs.55879 H80179 0.9231 3247 1 0.1 DKFZP586N0721 protein DKFZP586N072Hs.99843 H69302 0.7845 3249 -1 0.33 Cyclin-dependent kinase (CDC2-like) 10 CDK10 Hs.77313 H09314 0.9359 3250 -1 0.03 Protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform PPP2CA Hs.91773 H98717 0.6876 3252 -1 0.33 Small nuclear ribonucleoprotein polypeptide C SNRPC Hs.1063 T94446 1 3252 0 0 Protein tyrosine phosphatase, non-receptor type substrate 1 PTPNS1 Hs.156114 AA069400 0.8849 3253 1 0.13 Hypothetical protein MGC10974 MGC10974 Hs.111099 N99946 0.7969 3256 -1 0.3 Mesoderm development candidate 2 MESDC2 Hs.78871 N34169 0.7969 3256 -1 0.47 Neurofibromin 2 (bilateral acoustic neuroma) NF2 Hs.902 N30186 0.8596 3256 0 0 Hypothetical protein FLJ21615 FLJ21615 Hs.44159 AA039526 0.9103 3256 1 0.17 Rabconnectin-3 RC3 Hs.13264 AA042813 0.7599 3257 -1 0.27 Olfactory receptor, family 7, subfamily E, member 38 pseudogene OR7E38P Hs.120017 T47567 0.9487 3257 0 0 - -- N56703 0.7722 3258 -1 0.37 CGI-145 protein LOC51028 Hs.146324 AA134876 0.7969 3262 1 0.3 - - Hs.71523 R68008 0.7969 3263 -1 0.27 Fucosidase, alpha-L- 1, tissue FUCA1 Hs.576 AA047443 0.9231 3263 1 0.2 LIM domain containing preferred translocation partner in lipoma LPP Hs.180398 H88088 0.9359 3263 1 0.17 Serine/threonine kinase 3 (STE20 homolog, yeast) STK3 Hs.166684 H12862 0.7477 3265 -1 0.47 Protein inhibitor of activated STAT protein PIASy PIASY Hs.105779 H70040 0.9743 3265 0 0 TIGA1 TIGA1 Hs.12082 W44398 0.9615 3267 -1 0.07 Function unknown protein 1 FLJ10648 Hs.379758 H20185 0.7845 3268 1 0.33 Hypothetical protein CAB56184 CAB56184 Hs.241575 N64112 0.8344 3269 -1 0.33 CAAX box 1 CXX1 Hs.250708 N24096 0.9743 3273 -1 0.07 - -- T72401 0.7355 3275 -1 0.53 Chromosome 8 open reading frame 4 C8orf4 Hs.283683 AA044645 0.9872 3277 1 0.1 Hypothetical protein FLJ21127 FLJ21127 Hs.351440 H00173 0.8218 3279 -1 0.33 SH3-domain GRB2-like endophilin B2 SH3GLB2 Hs.30002 N73088 0.9872 3279 1 0.03 Ataxin 2 related protein A2LP Hs.43509 N31840 0.7599 3282 1 0.33 - - Hs.206710 T79456 0.8976 3285 -1 0.27 - -- W47153 0.9359 3287 -1 0.1 Polymerase I and transcript release factor PTRF Hs.29759 N99506 0.9103 3289 -1 0.13 Rag D protein RAGD Hs.238679 R31243 0.8722 3293 1 0.33 Multiple endocrine neoplasia I MEN1 Hs.240443 H01172 0.8976 3295 1 0.2 Golgi reassembly stacking protein 2, 55kDa GORASP2 Hs.6880 N29455 0.9743 3301 0 0 - -- AA029575 0.8976 3307 1 0.07 KIAA0697 protein KIAA0697 Hs.12329 H28583 0.7845 3309 1 0.53 - - Hs.31396 R14521 0.6995 3316 -1 0.6 Spectrin SH3 domain binding protein 1 SSH3BP1 Hs.24752 N25817 0.7114 3316 -1 0.53 Spermidine/spermine N1-acetyltransferase SAT Hs.28491 R83176 0.8469 3317 -1 0.2 Hypothetical protein FLJ11753 FLJ11753 Hs.62348 R08418 0.618 3319 -1 0.73 KIAA0674 protein KIAA0674 Hs.14799 R73991 0.8722 3320 1 0.27 KIAA1160 protein KIAA1160 Hs.33122 AA028185 0.9359 3323 1 0.1 Sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase) SPR Hs.301540 W86967 0.8596 3325 1 0.1 KIAA1450 protein KIAA1450 Hs.83243 W86915 0.8469 3326 1 0.13 PHD protein Jade-1 Jade-1 Hs.238246 AA150384 0.8093 3327 -1 0.33 KIAA0144 gene product KIAA0144 Hs.8127 N71529 0.8722 3327 1 0.27 - - Hs.183779 AA129848 0.8849 3327 1 0.2 Exosome component Rrp41 FLJ20591 Hs.343589 H85464 0.8596 3328 -1 0.23 Deleted in split-hand/split-foot 1 region DSS1 Hs.333495 R55009 0.9872 3336 1 0.07 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 GNAI2 Hs.77269 N80932 0.9615 3338 1 0.07 - -- N46186 0.8344 3343 -1 0.27 Clone FLB4739 LOC51218 Hs.294083 N75497 0.8976 3344 1 0.27 RAB1A, member RAS oncogene family RAB1A Hs.3642 N80021 0.9743 3345 -1 0.03 Origin recognition complex, subunit 4-like (yeast) ORC4L Hs.55055 H90564 0.9615 3346 -1 0.13 - - Hs.41423 H61134 0.8093 3347 1 0.27 Solute carrier family 6 (neurotransmitter transporter, creatine), member 8 SLC6A8 Hs.187958 W89149 0.9487 3349 -1 0.2 - -- N31738 0.7722 3351 1 0.47 Hypothetical protein MGC20262 MGC20262 Hs.351871 W90593 0.9487 3354 -1 0.1 Ubiquitin-like 4 UBL4 Hs.76480 AA001813 0.8976 3355 -1 0.27 KIAA0052 protein KIAA0052 Hs.278608 R21970 0.7477 3362 -1 0.47 General transcription factor IIH, polypeptide 2, 44kDa GTF2H2 Hs.191356 Supporting Table 4 - Mann-Whitney P-values for the NRAS classification and for all 5041 quality filtered genes.

Mann-Whitney P-value: The P-value from the NRAS status analysis using 60 samples (the sample with an NRAS deletion was excluded from the analysis). = genes also present in the BRAFMann-Whitney genelist atP <0.01 *for sequence verification of Clone ID's on chip, please refer to the manufacter's website http:/www.microarrays.ca/support/glists.html Original Mann- Original Original Gene Clone ID Whitney Original Gene Name* Unigene Symbol* on Chip* P-value cluster* R60317* 0.000416 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase cDLD Hs.74635 W31471* 0.000525 Hypothetical protein DKFZp547A023 DKFZp547A023 Hs.23921 H12076* 0.000525 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase cDLD Hs.74635 W88806* 0.00066 Uroporphyrinogen III synthase (congenital erythropoietic porphyria) UROS Hs.75593 T83153* 0.001033 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase cDLD Hs.74635 N74698 0.001484 ESTs ESTs Hs.114536 N48742 0.00171 Hypothetical protein FLJ12788 FLJ12788 Hs.20242 AA034917* 0.002261 Chaperonin containing TCP1, subunit 3 (gamma) CCT3 Hs.1708 R45681 0.002422 TRAF and TNF receptor-associated protein AD022 Hs.46847 W42423* 0.002594 Cyclin-dependent kinase 2 CDK2 Hs.19192 H78795* 0.00297 Heart and neural crest derivatives expressed 2 HAND2 Hs.36029 T66745 0.00297 Mitochondrial glutamate carrier 1 GC1 Hs.99486 R25990 0.003177 Telomeric repeat binding factor (NIMA-interacting) 1 TERF1 Hs.194562 W67797* 0.00363 Laminin, alpha 5 LAMA5 Hs.11669 H08027 0.00363 - - Hs.288963 T91050* 0.00363 KIAA1586 protein KIAA1586 Hs.180663 AA029847 0.003877 Cyclin fold protein 1 CFP1 Hs.6820 AA128825 0.003877 Arylsulfatase B ARSB Hs.1256 AA058632 0.003877 Kinesin family member 1B KIF1B Hs.375193 W60492 0.004419 Amino-terminal enhancer of split AES Hs.244 W04736 0.004715 Hypothetical protein MGC40107 MGC40107 Hs.94316 W46396* 0.004715 Dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenaDLAT Hs.115285 AA029775 0.005029 Lung cancer candidate FUS1 Hs.8186 R68168 0.005029 MRNA decapping enzyme DCPS Hs.279900 R52017 0.005029 Uncharacterized bone marrow protein BM036 BM036 Hs.7731 R01529 0.005029 Interferon (alpha, beta and omega) receptor 2 IFNAR2 Hs.86958 R27996* 0.005714 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773 R93361* 0.006482 - -- T79507 0.0069 Erythropoietin receptor EPOR Hs.127826 T80625* 0.0069 Prohibitin PHB Hs.75323 W58440 0.0069 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 B4GALT1 Hs.198248 R34801 0.0069 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 1TAF2 Hs.122752 H25840 0.007808 V-crk sarcoma virus CT10 oncogene homolog (avian) CRK Hs.343220 R06281* 0.007808 KIAA0349 protein KIAA0349 Hs.15303 N/A2* 0.007808 - -- H85870* 0.007808 - -- H87044 0.008302 Translocase of inner mitochondrial membrane 22 homolog (yeast) TIMM22 Hs.87595 N90242 0.008302 Glyoxylate reductase/hydroxypyruvate reductase GRHPR Hs.155742 AA099341* 0.008823 Golgi-specific brefeldin A resistance factor 1 GBF1 Hs.155499 H58331 0.008823 Glucose regulated protein, 58kDa GRP58 Hs.289101 R49336* 0.008823 SKI-interacting protein SNW1 Hs.79008 W42674 0.008823 FK506 binding protein 14, 22 kDa FKBP14 Hs.264636 R56010 0.008823 HIRA interacting protein 3 HIRIP3 Hs.26484 N56712 0.009373 PWP2 periodic tryptophan protein homolog (yeast) PWP2H Hs.79380 R19317* 0.009373 - -- H03098 0.009373 - -- AA136073 0.009953 Hypothetical protein FLJ36888 FLJ36888 Hs.103845 W58640 0.009953 SECIS binding protein 2 SBP2 Hs.288141 R76298 0.010566 Heat shock transcription factor 1 HSF1 Hs.1499 R54764 0.010566 KIAA1295 protein KIAA1295 Hs.26204 R98866 0.010566 Proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule m PRG2 Hs.99962 AA043510 0.011212 Nm23-phosphorylated unknown substrate MGC15437 Hs.55067 R42536 0.011212 Dachshund homolog (Drosophila) DACH Hs.63931 H87204 0.011892 Cyclin-dependent kinase 5 CDK5 Hs.166071 AA193317 0.011892 - - Hs.356786 H15638 0.012609 Solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11SLC25A11 Hs.184877 R52086 0.012609 Hypothetical protein FLJ31657 FLJ31657 Hs.5518 H57791 0.012609 - -- N72115 0.012609 Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) CDKN2C Hs.4854 R54062 0.012609 Crn, crooked neck-like 1 (Drosophila) CRNKL1 Hs.268281 R53336 0.012609 Ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding proteRAC3 Hs.45002 H28872 0.012609 Aspartyl-tRNA synthetase DARS Hs.80758 H46056 0.013364 Radixin RDX Hs.263671 H45103 0.014158 Attractin ATRN Hs.194019 T99761 0.014158 Programmed cell death 8 (apoptosis-inducing factor) PDCD8 Hs.18720 H08441 0.014158 Protein tyrosine phosphatase, receptor type, A PTPRA Hs.26045 H01504 0.014994 - -- N29673 0.014994 Hypoxia up-regulated 1 HYOU1 Hs.277704 H64252 0.014994 Acyl-Coenzyme A dehydrogenase family, member 8 ACAD8 Hs.14791 R08328 0.015873 Nucleoporin 133kDa NUP133 Hs.12457 AA028144 0.015873 BCS1-like (yeast) BCS1L Hs.150922 H03208 0.015873 Mitotic control protein dis3 homolog DIS3 Hs.323346 W02274 0.016797 - -- H70044 0.016797 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma CAMK2G Hs.12436 H57853 0.016797 CGI-43 protein LOC51622 Hs.289112 AA005389 0.017768 DKFZP727G051 protein DKFZP727G051 Hs.119960 H59065 0.017768 - -- W88821 0.017768 - - Hs.288924 N80145 0.018788 ESTs ESTs Hs.50873 W02772 0.018788 Hypothetical protein FLJ23749 FLJ23749 Hs.180178 AA056378 0.018788 Alveolar soft part sarcoma chromosome region, candidate 1 ASPSCR1 Hs.298351 W20391 0.018788 Kinesin-like 2 KNSL2 Hs.20830 H04804 0.018788 ESTs ESTs Hs.374236 W87530 0.018788 Hypothetical protein FLJ32919 FLJ32919 Hs.293224 R68948 0.018788 Calumenin CALU Hs.7753 R22893 0.019858 Synaptosomal-associated protein, 23kDa SNAP23 Hs.184376 W03395 0.019858 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 ELOVL1 Hs.25597 R79632 0.019858 Family with sequence similarity 3, member C FAM3C Hs.29882 AA047468 0.019858 - - Hs.127824 N79584 0.019858 CK2 interacting protein 1; HQ0024c protein CKIP-1 Hs.173380 H20531 0.020982 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 B3GALT4 Hs.21495 AA058623 0.020982 Proteasome (prosome, macropain) subunit, beta type, 1 PSMB1 Hs.75748 R80585 0.020982 CD2-associated protein CD2AP Hs.374340 R43738 0.020982 UDP-glucose ceramide glucosyltransferase-like 2 UGCGL2 Hs.22983 H96308 0.02216 - - Hs.58210 W19663 0.02216 KIAA0103 gene product KIAA0103 Hs.154387 H44964 0.02216 FK506 binding protein 14, 22 kDa FKBP14 Hs.264636 W46792 0.02216 Transcription factor Dp-2 (E2F dimerization partner 2) TFDP2 Hs.19131 H17025 0.02216 Phosphotidylinositol transfer protein, beta PITPNB Hs.7370 AA101859 0.023396 Endosulfine alpha ENSA Hs.111680 H72283 0.023396 KIAA0265 protein KIAA0265 Hs.192966 T82149 0.023396 - - Hs.252873 AA149232 0.023396 - - Hs.103411 R65863 0.023396 Ring finger protein 13 RNF13 Hs.6900 H15697 0.023396 Propionyl Coenzyme A carboxylase, beta polypeptide PCCB Hs.63788 AA028145 0.023396 Tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflamTIMP3 Hs.245188 AA001333 0.024691 Fusion, derived from t(12;16) malignant liposarcoma FUS Hs.99969 H30637 0.024691 ESTs ESTs Hs.27362 R01627 0.024691 Major histocompatibility complex, class II, DQ beta 1 HLA-DQB1 Hs.73931 AA114976 0.024691 Tenascin XB TNXB Hs.169886 AA128472 0.024691 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypepGNAI3 Hs.73799 W68614 0.024691 DnaJ (Hsp40) homolog, subfamily B, member 12 DNAJB12 Hs.7960 N22841 0.024691 Hypothetical protein MGC17943 MGC17943 Hs.106390 H16449 0.024691 Staufen, RNA binding protein (Drosophila) STAU Hs.6113 R44861 0.026048 Hypothetical protein FLJ10637 FLJ10637 Hs.22595 AA043503 0.026048 Down-regulator of transcription 1, TBP-binding (negative cofactor 2) DR1 Hs.16697 H11233 0.026048 CGI-203 protein CGI-203 Hs.184860 W91979 0.026048 24-dehydrocholesterol reductase DHCR24 Hs.75616 N63962 0.026048 Component of oligomeric golgi complex 5 COG5 Hs.239631 AA046615 0.026048 Interleukin 2 receptor, beta IL2RB Hs.75596 H30227 0.027468 Putative mitochondrial solute carrier MRS3/4 Hs.326104 N34758 0.027468 Chromosome 2 open reading frame 6 C2orf6 Hs.196437 N66208 0.027468 Protein phosphatase 1, regulatory (inhibitor) subunit 8 PPP1R8 Hs.356590 H29620 0.027468 Chromosome 6 open reading frame 33 C6orf33 Hs.239388 R33452 0.027468 Protein O-fucosyltransferase 1 POFUT1 Hs.178292 H44523 0.027468 KIAA0370 protein KIAA0370 Hs.70500 AA055948 0.027468 Rho-associated, coiled-coil containing protein kinase 2 ROCK2 Hs.58617 N44485 0.028955 - - Hs.13809 N33577 0.028955 - - Hs.24359 W74601 0.028955 Phosphotidylinositol transfer protein PITPN Hs.79709 R69581 0.028955 PRO1914 protein PRO1914 Hs.5327 W42634 0.028955 Fibroblast activation protein, alpha FAP Hs.418 H38584 0.028955 - -- N51027 0.028955 Hypothetical protein FLJ10420 FLJ10420 Hs.289087 AA047569 0.030511 Hypothetical protein FLJ10597 FLJ10597 Hs.90375 R55180 0.030511 Muskelin 1, intracellular mediator containing kelch motifs MKLN1 Hs.288791 AA151211 0.030511 Bone morphogenetic protein 1 BMP1 Hs.1274 R52949 0.030511 - - Hs.25978 H20379 0.030511 Breakpoint cluster region protein, uterine leiomyoma, 2 BCRP2 Hs.284294 AA055938 0.030511 Laminin, alpha 4 LAMA4 Hs.78672 AA161069 0.030511 E1B-55kDa-associated protein 5 E1B-AP5 Hs.155218 R23374 0.032138 Hypothetical protein FLJ10462 FLJ10462 Hs.100895 H02889 0.032138 Inositol(myo)-1(or 4)-monophosphatase 1 IMPA1 Hs.171776 R52301 0.032138 - - Hs.302182 N93443 0.032138 Ubiquitin protein ligase UBE3B Hs.17639 H68373 0.032138 Transcription factor CP2 TFCP2 Hs.154970 N50369 0.032138 Nijmegen breakage syndrome 1 (nibrin) NBS1 Hs.25812 R54089 0.032138 Solute carrier family 19 (folate transporter), member 1 SLC19A1 Hs.84190 H14291 0.032138 Amyloid beta (A4) precursor-like protein 1 APLP1 Hs.74565 AA142987 0.032138 DKFZP586I111 protein DKFZP586I111 Hs.227429 R28281 0.032138 - -- R13936 0.033839 Deoxyhypusine synthase DHPS Hs.79064 H10355 0.033839 Transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) TCEB2 Hs.172772 N44132 0.033839 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919 AA136060 0.033839 Hypothetical protein MGC16202 MGC16202 Hs.246914 R02822 0.033839 - - Hs.243901 T99676 0.033839 Hypothetical protein MGC40405 MGC40405 Hs.193482 N41035 0.033839 - - Hs.378848 W42446 0.033839 NICE-5 protein HSA243666 Hs.337078 N41921 0.035616 - - Hs.33264 N99127 0.035616 Hypothetical protein MGC5540 MGC5540 Hs.267400 R91819 0.035616 Phosphoinositide-3-kinase, regulatory subunit, polypeptide 2 (p85 beta) PIK3R2 Hs.211586 R20373 0.035616 Transmembrane trafficking protein TMP21 Hs.74137 AA047382 0.035616 Clathrin, light polypeptide (Lcb) CLTB Hs.380749 R55182 0.035616 - - Hs.374526 N54855 0.035616 ESTs ESTs Hs.269340 R55959 0.035616 KIAA1091 protein KIAA1091 Hs.26797 W52888 0.035616 Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1 SERPINB1 Hs.183583 N93458 0.037472 Ubiquinol-cytochrome c reductase core protein II UQCRC2 Hs.173554 N93218 0.037472 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919 T84046 0.037472 - - Hs.372951 H23246 0.037472 Hypothetical protein FLJ13433 FLJ13433 Hs.23259 H18868 0.037472 Ribonucleotide reductase M2 B (TP53 inducible) RRM2B Hs.94262 N59182 0.037472 - - Hs.311002 W60763 0.037472 Thyroid hormone receptor-associated protein, 240 kDa subunit TRAP240 Hs.11861 R32834 0.037472 CLLL7 protein FLJ10716 Hs.24129 R61759 0.037472 - - Hs.8078 H28105 0.037472 Small nuclear ribonucleoprotein polypeptide N SNRPN Hs.48375 N79531 0.037472 Hypothetical protein MGC2714 MGC2714 Hs.74284 AA059276 0.03941 Hypothetical protein MGC13010 MGC13010 Hs.332040 R45198 0.03941 Hypothetical protein CDA08 CDA08 Hs.23047 AA004355 0.03941 Mitochondrial ribosomal protein S31 MRPS31 Hs.154655 H97357 0.03941 - - Hs.227699 T96379 0.03941 Protein phosphatase 2, regulatory subunit B (B56), delta isoform PPP2R5D Hs.118244 AA041262 0.03941 KIAA1228 protein KIAA1228 Hs.306867 R52958 0.03941 Calcium channel, voltage-dependent, gamma subunit 4 CACNG4 Hs.331904 N36349 0.03941 ESTs ESTs Hs.374577 AA136615 0.03941 V-yes-1 Yamaguchi sarcoma viral related oncogene homolog LYN Hs.80887 H99068 0.03941 - - Hs.101810 T80951 0.03941 Replication protein A1, 70kDa RPA1 Hs.84318 N98296 0.03941 Hypothetical protein FLJ10808 FLJ10808 Hs.59838 T97640 0.041432 - -- AA136060 0.041432 Hypothetical protein MGC16202 MGC16202 Hs.246914 H41751 0.041432 General transcription factor IIF, polypeptide 1, 74kDa GTF2F1 Hs.68257 N70020 0.041432 - - Hs.272034 T97034 0.041432 KIAA0877 protein KIAA0877 Hs.11217 H62189 0.041432 Elongator protein 2 ELP2 Hs.8739 N71552 0.041432 Hypothetical protein DKFZp434D1428 DKFZp434D1428 Hs.321775 N63825 0.041432 Ras homolog gene family, member G (rho G) ARHG Hs.75082 T81712 0.041432 Defensin, alpha 1, myeloid-related sequence DEFA1 Hs.274463 W45178 0.043542 DIP13 beta DIP13B Hs.107882 R70784 0.043542 MCT-1 protein MCT-1 Hs.102696 R88098 0.043542 Myosin IC MYO1C Hs.286226 AA133960 0.043542 Ubiquitin-conjugating enzyme E2A (RAD6 homolog) UBE2A Hs.80612 N20579 0.043542 Proteasome (prosome, macropain) 26S subunit, ATPase, 2 PSMC2 Hs.61153 N73284 0.043542 KIAA1089 protein KIAA1089 Hs.4990 AA039447 0.043542 Suppressor of fused homolog (Drosophila) SUFU Hs.21431 R84453 0.043542 DKFZP586F1524 protein DKFZP586F1524 Hs.241543 R60241 0.043542 Hypothetical protein FLJ21908 FLJ21908 Hs.26750 W87615 0.043542 Isoprenylcysteine carboxyl methyltransferase ICMT Hs.183212 H09093 0.043542 Gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) GGH Hs.78619 R23132 0.043542 Cullin 1 CUL1 Hs.14541 N25614 0.043542 - - Hs.270725 AA001144 0.045741 Similar to RIKEN cDNA 5730528L13 gene MGC17337 Hs.78531 W63752 0.045741 DnaJ (Hsp40) homolog, subfmaily B, member 1 DNAJB1 Hs.82646 T81806 0.045741 - -- H03409 0.045741 Alg5, S. cerevisiae, homolog of ALG5 Hs.227933 R01105 0.045741 ATP-binding cassette, sub-family E (OABP), member 1 ABCE1 Hs.12013 AA101823 0.045741 Elastin microfibril interface located protein EMILIN Hs.63348 R63546 0.045741 KIAA1728 protein KIAA1728 Hs.252748 R60451 0.045741 N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase LOC51172 Hs.21334 W78867 0.045741 Agrin AGRN Hs.273330 W61184 0.045741 ATPase, Class VI, type 11B ATP11B Hs.75478 H38160 0.045741 Hypothetical protein FLJ10769 FLJ10769 Hs.8083 AA150891 0.045741 SET domain-containing protein 7 SET7 Hs.78521 H87272 0.045741 RAB2, member RAS oncogene family RAB2 Hs.78305 R00170 0.045741 Bifunctional apoptosis regulator BFAR Hs.168159 W93272 0.045741 Diphosphate dimethylallyl diphosphate isomerase 2 IDI2 Hs.9270 N64618 0.045741 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) BUB3 Hs.40323 R19946 0.048033 Stannin SNN Hs.76691 N21545 0.048033 KIAA1033 protein KIAA1033 Hs.12144 AA150896 0.048033 Hypothetical protein MGC13090 MGC13090 Hs.333389 W68453 0.048033 Hypothetical protein FLJ10468 FLJ10468 Hs.48855 H29672 0.048033 Protein arginine N-methyltransferase 6 PRMT6 Hs.26006 R34648 0.048033 Cell adhesion molecule with homology to L1CAM (close homolog of L1) CHL1 Hs.210863 H79622 0.048033 ESTs ESTs Hs.13751 H62026 0.048033 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428 R37087 0.048033 Similar to S. cerevisiae Sec6p and R. norvegicus rsec6 SEC6 Hs.8088 R13127 0.048033 Suppressor of potassium transport defect 3 SKD3 Hs.21263 N21648 0.050421 MpV17 transgene, murine homolog, glomerulosclerosis MPV17 Hs.75659 N27828 0.050421 Sentrin/SUMO-specific protease SENP7 Hs.30443 R31858 0.050421 Kaiso ZNF-kaiso Hs.143604 H13698 0.050421 CGI-83 protein LOC51110 Hs.118554 N79042 0.050421 - -- R79439 0.050421 ADP-ribosylation factor-like 1 ARL1 Hs.242894 AA031950 0.050421 Hypothetical protein FLJ22688 FLJ22688 Hs.288800 AA046359 0.050421 Protein predicted by clone 23882 HSU79303 Hs.82482 T77239 0.050421 - -- H38541 0.050421 CCR4-NOT transcription complex, subunit 3 CNOT3 Hs.343571 R56756 0.050421 Hypothetical protein FLJ20422 FLJ20422 Hs.26570 W88468 0.050421 Hypothetical protein MGC20781 MGC20781 Hs.237536 N63044 0.052908 Hypothetical protein FLJ20048 FLJ20048 Hs.116470 W93121 0.052908 KIAA0355 gene product KIAA0355 Hs.186840 AA059052 0.052908 ARP1 actin-related protein 1 homolog B, centractin beta (yeast) ACTR1B Hs.2477 W03386 0.052908 - - Hs.29808 R34632 0.052908 Zinc finger, DHHC domain containing 6 ZDHHC6 Hs.22353 H19181 0.052908 Ureidopropionase, beta UPB1 Hs.126926 AA099692 0.052908 Epsilon-tubulin LOC51175 Hs.34851 R91050 0.052908 Endoplasmic reticulum resident protein 44 kDa ERp44 Hs.154023 R59415 0.052908 - -- R33031 0.052908 Adaptor-related protein complex 3, sigma 2 subunit AP3S2 Hs.154782 R76088 0.052908 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) UCHL3 Hs.77917 H00297 0.052908 CGI-100 protein LOC50999 Hs.348996 H17078 0.052908 Core-binding factor, runt domain, alpha subunit 2; translocated to, 2 CBFA2T2 Hs.153934 N58012 0.052908 - -- R62721 0.052908 Small inducible cytokine subfamily E, member 1 (endothelial monocyte-activati SCYE1 Hs.333513 AA148416 0.052908 Hypothetical protein FLJ14917 FLJ14917 Hs.154706 T77388 0.052908 Hypothetical protein FLJ38045 FLJ38045 Hs.170226 R91793 0.052908 ESTs ESTs Hs.369100 N93130 0.052908 Glutamate-cysteine ligase, modifier subunit GCLM Hs.89709 N20259 0.052908 Hypothetical protein MGC2840 similar to a putative glucosyltransferase MGC2840 Hs.155356 H16834 0.055497 Amyloid beta (A4) precursor protein-binding, family A, member 2 binding protei APBA2BP Hs.324104 AA121306 0.055497 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 KDELR1 Hs.78040 AA132083 0.055497 Hypothetical protein BC007384 LOC90378 Hs.140309 AA131255 0.055497 AD24 protein AD24 Hs.74899 N38855 0.055497 Enhancer of invasion 10 HEI10 Hs.107003 R17665 0.055497 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) COPS5 Hs.198767 W68408 0.055497 24-dehydrocholesterol reductase DHCR24 Hs.75616 N29496 0.055497 ESTs ESTs Hs.44041 H66700 0.055497 Hypothetical protein FLJ20758 FLJ20758 Hs.274248 N78968 0.055497 Diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth f DTR Hs.799 AA041401 0.055497 ESTs ESTs Hs.57967 H70682 0.055497 Propionyl Coenzyme A carboxylase, alpha polypeptide PCCA Hs.80741 AA135452 0.05819 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041 N78845 0.05819 Hypothetical protein FLJ20542 FLJ20542 Hs.6449 N46185 0.05819 ESTs ESTs Hs.165084 H90879 0.05819 Hypothetical protein MGC8974 MGC8974 Hs.40094 H90534 0.05819 Adaptor-related protein complex 4, beta 1 subunit AP4B1 Hs.28298 AA039649 0.05819 Hypothetical protein FLJ10743 FLJ10743 Hs.3376 R62540 0.05819 ATPase, Cu++ transporting, beta polypeptide (Wilson disease) ATP7B Hs.84999 AA033545 0.05819 TIA1 cytotoxic granule-associated RNA binding protein-like 1 TIAL1 Hs.182741 T85141 0.05819 Golgi coiled coil 1 GCC1 Hs.4783 H63197 0.05819 KIAA0251 protein KIAA0251 Hs.343566 N39233 0.05819 - - Hs.44976 W68490 0.05819 TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated fact TAF9L Hs.171723 R26222 0.05819 - - Hs.379149 R77690 0.060991 Epidermal growth factor receptor pathway substrate 8-related protein 1 EPS8R1 Hs.28907 AA044429 0.060991 Tho2 THO2 Hs.16411 AA059311 0.060991 Collagen, type VI, alpha 2 COL6A2 Hs.159263 N72916 0.060991 Ubiquitin specific protease 12 USP12 Hs.42400 AA011515 0.060991 KIAA0451 gene product KIAA0451 Hs.18586 R34925 0.060991 Phospholipase D1, phophatidylcholine-specific PLD1 Hs.82587 H19093 0.060991 - - Hs.330310 H78941 0.060991 Thioesterase, adipose associated THEA Hs.234786 R62973 0.060991 Hypothetical protein MGC4796 MGC4796 Hs.21396 W31441 0.060991 UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase GNE Hs.5920 W44535 0.060991 Neurochondrin NCDN Hs.94653 W85901 0.060991 Eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa EIF2S2 Hs.12163 T99083 0.060991 CSE1 chromosome segregation 1-like (yeast) CSE1L Hs.90073 W31524 0.060991 - - Hs.95262 R71560 0.063903 - -- AA039246 0.063903 Transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) TLE2 Hs.332173 W32156 0.063903 Hypothetical protein MGC3329 MGC3329 Hs.25005 AA142937 0.063903 Claudin 10 CLDN10 Hs.26126 R38922 0.063903 High-mobility group protein 2-like 1 HMG2L1 Hs.92260 H69320 0.063903 Vesicle docking protein p115 P115 Hs.325948 H84793 0.063903 - -- N51855 0.063903 ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2 ADPRTL2 Hs.24284 H04610 0.063903 Splicing factor 3a, subunit 1, 120kDa SF3A1 Hs.334691 T81080 0.063903 - -- N34884 0.063903 NIF3 NGG1 interacting factor 3-like 1 (S. pombe) NIF3L1 Hs.21943 N73741 0.063903 Hypothetical protein DKFZp761P1121 DKFZp761P1121 Hs.350243 N93962 0.066928 Mitochondrial ribosomal protein L43 MRPL43 Hs.151945 N90788 0.066928 Annexin A4 ANXA4 Hs.77840 N59231 0.066928 Pyruvate carboxylase PC Hs.89890 N66251 0.066928 - -- H90247 0.066928 - - Hs.356089 R53566 0.066928 - - Hs.184779 AA056090 0.066928 - -- T79937 0.066928 Cutaneous T-cell lymphoma tumor antigen se70-2 SE70-2 Hs.39140 R51121 0.066928 KIAA1880 protein KIAA1880 Hs.100256 AA135740 0.066928 ESTs ESTs Hs.135270 AA056695 0.066928 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608 R34696 0.066928 - -- T96901 0.066928 - -- N63458 0.066928 Sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase) SIAT6 Hs.48793 R14667 0.070071 Zinc finger protein of the cerebellum 4 ZIC4 Hs.326796 R45618 0.070071 Hypothetical protein FLJ20498 FLJ20498 Hs.97925 R76215 0.070071 - - Hs.182723 H44888 0.070071 - - Hs.57483 AA099137 0.070071 Clathrin, light polypeptide (Lca) CLTA Hs.104143 W37210 0.070071 Hypothetical protein MGC40361 MGC40361 Hs.284170 N23517 0.070071 Heterogeneous nuclear ribonucleoprotein F HNRPF Hs.808 R32829 0.070071 KIAA1327 protein KIAA1327 Hs.106204 AA033605 0.070071 CD2 antigen (cytoplasmic tail) binding protein 2 CD2BP2 Hs.202677 R93621 0.070071 Eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa EIF2S2 Hs.12163 T83255 0.070071 Zinc finger protein 106 ZFP106 Hs.15220 R69571 0.070071 CDA14 LOC51290 Hs.26813 AA001141 0.070071 Heparan sulfate proteoglycan 2 (perlecan) HSPG2 Hs.211573 AA056755 0.070071 Peroxisomal proliferator-activated receptor A interacting complex 285 PRIC285 Hs.151714 W81586 0.070071 Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog FGR Hs.1422 N76056 0.073333 ARP1 actin-related protein 1 homolog B, centractin beta (yeast) ACTR1B Hs.2477 H87736 0.073333 - -- H95186 0.073333 - - Hs.378739 R93685 0.073333 Werner helicase interacting protein WHIP Hs.236828 W90083 0.073333 Hypothetical protein BC013587 LOC219738 Hs.94943 H79507 0.073333 - -- R36452 0.073333 ESTs ESTs Hs.300817 R60159 0.073333 Topoisomerase (DNA) I TOP1 Hs.317 N28014 0.073333 BRCA1 associated protein BRAP Hs.122764 AA147003 0.073333 - - Hs.356291 R76897 0.073333 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) UBE2D3 Hs.118797 R51991 0.073333 Similar to ubiquitin binding protein UBPH Hs.3459 R25036 0.073333 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 NDST1 Hs.20894 T99677 0.073333 CGI-105 protein LOC51011 Hs.279932 AA150728 0.073333 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3 ADPRTL3 Hs.271742 R37665 0.073333 Pescadillo homolog 1, containing BRCT domain (zebrafish) PES1 Hs.13501 R62636 0.073333 ESTs ESTs Hs.107060 N55329 0.073333 Anaphase-promoting complex subunit 7 APC7 Hs.52763 R99213 0.076719 Diacylglycerol O-acyltransferase homolog 1 (mouse) DGAT1 Hs.288627 H95383 0.076719 Death effector domain containing DEDD Hs.169681 R50640 0.076719 DKFZP564C186 protein DKFZP564C186 Hs.134200 H95311 0.076719 - - Hs.13431 R36089 0.076719 Nuclear receptor subfamily 2, group F, member 6 NR2F6 Hs.239752 N28293 0.076719 Autism-related protein 1 KIAA0442 Hs.32168 H53827 0.076719 ESTs ESTs Hs.36822 AA137082 0.076719 - - Hs.351869 R18145 0.076719 ESTs ESTs Hs.22381 R13232 0.076719 Hypothetical protein MGC5601 MGC5601 Hs.64211 W15337 0.076719 ESTs ESTs Hs.297784 R35798 0.076719 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ABCC4 Hs.139336 W04706 0.076719 Hypothetical protein FLJ10300 FLJ10300 Hs.42233 AA099381 0.076719 COX15 homolog, cytochrome c oxidase assembly protein (yeast) COX15 Hs.226581 H30017 0.076719 Phosphoinositide-3-kinase, regulatory subunit, polypeptide 2 (p85 beta) PIK3R2 Hs.211586 AA115939 0.076719 Capping protein (actin filament) muscle Z-line, alpha 2 CAPZA2 Hs.75546 N36070 0.080231 Hypothetical protein DKFZp564A176 DKFZp564A176 Hs.322844 H89739 0.080231 ESTs ESTs Hs.114280 T69771 0.080231 Hypothetical protein FLJ12716 FLJ12716 Hs.5354 N51836 0.080231 - - Hs.50547 W61360 0.080231 Hypothetical protein MGC15563 MGC15563 Hs.64552 T66879 0.080231 Hypothetical protein LOC54103 LOC54103 Hs.12969 R59926 0.080231 Paired basic amino acid cleaving enzyme (furin, membrane associated receptoPACE Hs.59242 R20749 0.080231 - -- N73986 0.080231 ESTs ESTs Hs.50408 R35167 0.080231 BAI1-associated protein 2 BAIAP2 Hs.7936 H49062 0.080231 Hypothetical protein FLJ22056 FLJ22056 Hs.24956 N43952 0.080231 - - Hs.236443 AA031411 0.080231 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318 N53295 0.080231 Ribosomal protein L39-like RPL39L Hs.132748 H12056 0.080231 - - Hs.95734 H50517 0.080231 Gamma-aminobutyric acid (GABA) B receptor, 1 GABBR1 Hs.167017 N21289 0.080231 Melanoma cell adhesion molecule MCAM Hs.211579 R76085 0.080231 Cytokine-inducible kinase CNK Hs.153640 H37983 0.080231 Sphingomyelin phosphodiesterase 1, acid lysosomal (acid sphingomyelinase) SMPD1 Hs.77813 N44152 0.080231 Hypothetical protein HSPC196 HSPC196 Hs.22546 W76572 0.083873 Nudix (nucleoside diphosphate linked moiety X)-type motif 1 NUDT1 Hs.388 AA101835 0.083873 - - Hs.374524 AA131584 0.083873 DKFZP564O0463 protein DKFZP564O0463 Hs.273344 N89775 0.083873 - - Hs.379753 R48805 0.083873 ESTs ESTs Hs.25577 AA150894 0.083873 Guanine nucleotide binding protein 11 GNG11 Hs.83381 R19063 0.083873 - -- N52646 0.083873 KIAA0144 gene product KIAA0144 Hs.8127 N90947 0.083873 - -- H20850 0.083873 Thioredoxin 2 TXN2 Hs.211929 AA194129 0.083873 Hypothetical protein FLJ13102 FLJ13102 Hs.225160 H28168 0.083873 Centaurin, gamma 3 CENTG3 Hs.286084 H20726 0.083873 Casein kinase 2, beta polypeptide CSNK2B Hs.165843 W47644 0.083873 Transmembrane 4 superfamily member 7 TM4SF7 Hs.26518 T50083 0.083873 ESTs ESTs Hs.22247 W58432 0.083873 Microtubule-associated protein 4 MAP4 Hs.239298 R83313 0.083873 Polymerase (RNA) II (DNA directed) polypeptide A, 220kDa POLR2A Hs.171880 R70694 0.083873 ESTs ESTs Hs.29126 N75350 0.083873 Gastrin-releasing peptide GRP Hs.1473 H56543 0.083873 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated proMCM3AP Hs.168481 N45541 0.083873 Adenosine kinase ADK Hs.94382 AA047101 0.083873 Chromosome 5 open reading frame 6 C5orf6 Hs.102469 H38504 0.087647 DKFZP566I1024 protein DKFZP566I1024 Hs.279696 R70167 0.087647 Hypothetical protein MDS025 MDS025 Hs.154938 N25611 0.087647 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ACTR1A Hs.153961 N20908 0.087647 Baculoviral IAP repeat-containing 6 (apollon) BIRC6 Hs.250646 N75042 0.087647 V-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa li RELA Hs.75569 W48561 0.087647 - -- H05096 0.087647 ESTs ESTs Hs.138417 AA149810 0.087647 Hypothetical protein MGC29463 MGC29463 Hs.6473 W47128 0.087647 Cyclin-dependent kinase 9 (CDC2-related kinase) CDK9 Hs.150423 R31115 0.087647 Polymerase (RNA) mitochondrial (DNA directed) POLRMT Hs.153880 R37498 0.087647 V-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protRALB Hs.348024 AA043906 0.087647 ESTs ESTs Hs.367688 H01638 0.087647 Hypothetical protein FLJ23518 FLJ23518 Hs.112250 R27100 0.087647 Hypothetical protein FLJ10826 FLJ10826 Hs.24809 N45674 0.087647 KIAA0759 protein KIAA0759 Hs.7285 R87411 0.087647 Growth arrest-specific 7 GAS7 Hs.226133 N21353 0.087647 - -- N46097 0.087647 Biphenyl hydrolase-like (serine hydrolase; breast epithelial mucin-associated a BPHL Hs.351334 R06463 0.087647 Heat shock protein 75 TRAP1 Hs.182366 T79066 0.087647 Hypothetical protein FLJ10460 FLJ10460 Hs.14347 W86900 0.087647 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 B4GALT2 Hs.206713 T88726 0.087647 Hypothetical protein FLJ20313 FLJ20313 Hs.126721 N46505 0.087647 Hypothetical protein FLJ13273 FLJ13273 Hs.126119 AA054518 0.087647 Sm protein F LSM6 Hs.42438 T83725 0.087647 KIAA1255 protein KIAA1255 Hs.351633 R81509 0.087647 Splicing factor, arginine/serine-rich 11 SFRS11 Hs.11482 N41672 0.087647 Adenylyl cyclase-associated protein CAP Hs.104125 W78880 0.087647 Hypothetical protein MGC14697 MGC14697 Hs.171625 N79538 0.091557 - - Hs.380093 R39286 0.091557 Citron (rho-interacting, serine/threonine kinase 21) CIT Hs.15767 R56028 0.091557 - - Hs.293407 R96161 0.091557 - -- R17720 0.091557 ESTs ESTs Hs.13287 W84735 0.091557 Protein inhibitor of activated STAT3 PIAS3 Hs.76578 AA011556 0.091557 - - Hs.49136 AA147647 0.091557 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318 W04515 0.091557 Syntaphilin SNPH Hs.323833 AA041349 0.091557 Macrophage erythroblast attacher MAEA Hs.20815 N66214 0.091557 Aminopeptidase puromycin sensitive NPEPPS Hs.293007 T83371 0.091557 - - Hs.296979 R76958 0.091557 Muscleblind-like protein MBLL39 MBLL39 Hs.283609 T94447 0.091557 Cortical thymocyte receptor (X. laevis CTX) like CTXL Hs.112377 R20713 0.091557 - -- H10318 0.091557 HLA-B associated transcript 4 BAT4 Hs.247478 N62283 0.095606 Translocating chain-associating membrane protein TRAM Hs.4147 H26559 0.095606 TGFB1-induced anti-apoptotic factor 1 TIAF1 Hs.75822 N28568 0.095606 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773 W65276 0.095606 Hypothetical protein FLJ10900 FLJ10900 Hs.16277 R59224 0.095606 MBD2 (methyl-CpG-binding protein)-interacting zinc finger protein MIZF Hs.7987 T81553 0.095606 - -- R78627 0.095606 - - Hs.23240 R77994 0.095606 Zinc finger protein 313 ZNF313 Hs.10590 AA032037 0.095606 Ubiquitin-conjugating enzyme E2A (RAD6 homolog) UBE2A Hs.80612 H06584 0.095606 Tetratricopeptide repeat domain 3 TTC3 Hs.118174 H06739 0.095606 Collagen, type V, alpha 2 COL5A2 Hs.82985 W03282 0.095606 Dihydrofolate reductase DHFR Hs.83765 N91237 0.095606 Chloride intracellular channel 2 CLIC2 Hs.54570 AA035451 0.095606 - - Hs.295963 W35315 0.095606 - - Hs.381207 H61972 0.095606 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) PIN4 Hs.11774 AA054948 0.095606 - - Hs.61307 R80010 0.099798 Nuclear matrix protein NXP-2 NXP-2 Hs.70359 H60436 0.099798 Hypothetical protein FLJ10422 FLJ10422 Hs.267905 R55020 0.099798 - -- N93937 0.099798 Amyloid beta precursor protein (cytoplasmic tail) binding protein 2 APPBP2 Hs.84084 R01912 0.099798 Ubiquitin specific protease 7 (herpes virus-associated) USP7 Hs.78683 N30724 0.099798 - - Hs.350364 H98666 0.099798 Procollagen (type III) N-endopeptidase PCOLN3 Hs.183138 AA131302 0.099798 - - Hs.71404 H94763 0.099798 SH3-domain GRB2-like endophilin B1 SH3GLB1 Hs.136309 AA150604 0.099798 Calmodulin 3 (phosphorylase kinase, delta) CALM3 Hs.334330 R05282 0.099798 ESTs ESTs Hs.272116 R20006 0.099798 ESTs ESTs Hs.12899 N71709 0.099798 DC11 protein DC11 Hs.42785 R16127 0.099798 - - Hs.121575 W04611 0.099798 Hypothetical protein FLJ22794 FLJ22794 Hs.19525 W47619 0.099798 2'-5'-oligoadenylate synthetase 3, 100kDa OAS3 Hs.56009 R18948 0.099798 Cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa CRSP2 Hs.21586 H26012 0.099798 - - Hs.102558 AA029361 0.099798 - - Hs.31841 H58362 0.099798 Adaptor-related protein complex 2, beta 1 subunit AP2B1 Hs.74626 R36709 0.099798 Over-expressed breast tumor protein OBTP Hs.347297 H85577 0.099798 Hypothetical protein FLJ11273 FLJ11273 Hs.3542 AA010318 0.099798 Striatin, calmodulin binding protein STRN Hs.258538 AA203394 0.099798 ESTs ESTs Hs.365593 R59227 0.099798 KIAA0365 gene product KIAA0365 Hs.190452 R69953 0.099798 - - Hs.27552 R12025 0.099798 Bifunctional apoptosis regulator BFAR Hs.168159 N71166 0.099798 Phosphatidylinositol glycan, class Q PIGQ Hs.18079 H78351 0.104134 - -- T79604 0.104134 Hypothetical protein DKFZp434F2322 DKFZp434F2322 Hs.144633 T51260 0.104134 Hexosaminidase A (alpha polypeptide) HEXA Hs.119403 H14441 0.104134 - -- R64091 0.104134 ESTs ESTs Hs.28482 T79660 0.104134 - - Hs.14600 AA037763 0.104134 WAS protein family, member 2 WASF2 Hs.288908 H94541 0.104134 Chromosome 20 open reading frame 64 C20orf64 Hs.282990 H40649 0.104134 Hypothetical protein FLJ20628 FLJ20628 Hs.32356 N49880 0.104134 RAS p21 protein activator (GTPase activating protein) 1 RASA1 Hs.758 H29534 0.104134 ESTs ESTs Hs.22248 H18491 0.104134 - - Hs.268701 R07486 0.104134 ESTs ESTs Hs.18920 R48249 0.104134 - - Hs.301885 R06151 0.104134 Anaphase promoting complex subunit 5 ANAPC5 Hs.7101 AA011361 0.104134 Soc-2 suppressor of clear homolog (C. elegans) SHOC2 Hs.104315 N69540 0.104134 - - Hs.351310 H50240 0.104134 - - Hs.250879 N74427 0.104134 ESTs ESTs Hs.222413 N23976 0.104134 Dystroglycan 1 (dystrophin-associated glycoprotein 1) DAG1 Hs.76111 R32855 0.104134 - -- H68440 0.104134 Phosphatidylinositol-4-phosphate 5-kinase, type I, beta PIP5K1B Hs.78406 H13699 0.104134 ESTs ESTs Hs.171575 R60825 0.104134 Mitogen-activated protein kinase 9 MAPK9 Hs.246857 AA036810 0.108619 LIM domains containing 1 LIMD1 Hs.48469 T83937 0.108619 Hypothetical protein FLJ31638 FLJ31638 Hs.14832 R38809 0.108619 ESTs ESTs Hs.13420 N70500 0.108619 KIAA0842 protein KIAA0842 Hs.74569 N/A2 0.108619 - -- H93167 0.108619 KIAA0332 protein KIAA0332 Hs.7976 H01598 0.108619 Translocating chain-associating membrane protein TRAM Hs.4147 N99911 0.108619 SNARE associated protein snapin SNAPAP Hs.32018 T78059 0.108619 Protein associated with PRK1 AWP1 Hs.83954 N42335 0.108619 Hypothetical protein FLJ20452 FLJ20452 Hs.351327 T88721 0.108619 Epithelial membrane protein 2 EMP2 Hs.29191 R53574 0.108619 Microtubule associated testis specific serine/threonine protein kinase MAST205 Hs.101474 H26555 0.108619 Protein phosphatase 1, regulatory subunit 7 PPP1R7 Hs.36587 AA055989 0.108619 - - Hs.285050 AA069400 0.108619 Hypothetical protein MGC10974 MGC10974 Hs.111099 AA037600 0.108619 Chromosome condensation 1 CHC1 Hs.84746 N63319 0.108619 Protein tyrosine phosphatase, receptor type, A PTPRA Hs.26045 H70971 0.108619 - -- H44128 0.108619 Eukaryotic translation elongation factor 1 alpha 1 EEF1A1 Hs.181165 AA027986 0.108619 Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform PPP2CB Hs.80350 H48016 0.108619 - -- AA010396 0.108619 - - Hs.58210 N54827 0.108619 KIAA0471 gene product KIAA0471 Hs.242271 W91913 0.113255 SNARE protein Ykt6 YKT6 Hs.296244 H61357 0.113255 Tumor protein p53 (Li-Fraumeni syndrome) TP53 Hs.1846 N49623 0.113255 Hypothetical protein AL133206 LOC64744 Hs.7750 R42549 0.113255 Seizure related 6 homolog (mouse) SEZ6 Hs.21837 AA010355 0.113255 ESTs ESTs Hs.187568 H30821 0.113255 SUMO-1-specific protease SUSP1 Hs.27197 AA045207 0.113255 Actin related protein 2/3 complex, subunit 5, 16kDa ARPC5 Hs.82425 W03747 0.113255 TBC1 domain family, member 5 TBC1D5 Hs.115740 AA142983 0.113255 Chloride intracellular channel 4 CLIC4 Hs.25035 N42278 0.113255 ADP-ribosylation-like factor 6 interacting protein 2 ARL6IP2 Hs.27099 R54957 0.113255 - - Hs.356757 H83019 0.113255 Ribosomal protein S27 (metallopanstimulin 1) RPS27 Hs.195453 H99486 0.113255 LIM and SH3 protein 1 LASP1 Hs.334851 N39367 0.118046 Hypothetical protein FLJ20085 FLJ20085 Hs.118964 N52744 0.118046 HSPC043 protein HSPC043 Hs.46624 N80064 0.118046 Mitochondrial ribosomal protein S6 MRPS6 Hs.6945 N20541 0.118046 Cadherin 1, type 1, E-cadherin (epithelial) CDH1 Hs.194657 R59009 0.118046 KIAA0052 protein KIAA0052 Hs.278608 H19953 0.118046 - - Hs.220963 T67217 0.118046 Hypothetical protein MGC3207 MGC3207 Hs.372737 AA031913 0.118046 - - Hs.351573 N39229 0.118046 Hypothetical protein A-211C6.1 LOC57149 Hs.28607 AA203245 0.118046 - -- AA116112 0.118046 Mitochondrial ribosomal protein L39 MRPL39 Hs.167130 N20373 0.118046 - -- AA028107 0.118046 HLA-B associated transcript 2 BAT2 Hs.25911 R86231 0.118046 PC326 protein PC326 Hs.279882 N47346 0.118046 G-protein gamma-12 subunit LOC55970 Hs.8107 R12704 0.118046 - -- AA044632 0.118046 - -- R24816 0.118046 KIAA0056 protein KIAA0056 Hs.13421 R80587 0.118046 Protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoforPPP2R2A Hs.179574 W15360 0.118046 Epidermal growth factor receptor pathway substrate 8-related protein 1 EPS8R1 Hs.28907 W67895 0.118046 Small EDRK-rich factor 1A (telomeric) SERF1A Hs.32567 AA005154 0.118046 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNDDX9 Hs.74578 R72548 0.118046 Serine/threonine kinase 11 interacting protein STK11IP Hs.22410 N64474 0.118046 Protein phosphatase 4, regulatory subunit 2 PPP4R2 Hs.356686 AA129727 0.118046 RAB5C, member RAS oncogene family RAB5C Hs.479 W52156 0.118046 Oxytocin receptor OXTR Hs.2820 R52844 0.118046 - - Hs.356786 AA033874 0.118046 - - Hs.12035 R07295 0.122995 Sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1 SOAT1 Hs.14553 R52021 0.122995 - -- H53288 0.122995 BCL2-associated athanogene 4 BAG4 Hs.194726 N24676 0.122995 Chaperonin containing TCP1, subunit 4 (delta) CCT4 Hs.79150 R14321 0.122995 NEL-like 1 (chicken) NELL1 Hs.21602 H58642 0.122995 Hypothetical protein FLJ23499 FLJ23499 Hs.17546 AA043504 0.122995 Inositol polyphosphate phosphatase-like 1 INPPL1 Hs.75339 R76434 0.122995 Hypothetical protein FLJ31153 FLJ31153 Hs.350424 AA046915 0.122995 Eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa EIF3S5 Hs.7811 H78789 0.122995 KIAA0241 protein KIAA0241 Hs.150275 H18242 0.122995 Neighbor of A-kinase anchoring protein 95 NAKAP95 Hs.96200 R79616 0.122995 Thioredoxin domain containing TXNDC Hs.24766 H52225 0.122995 TGF beta receptor associated protein -1 TRAP-1 Hs.101766 W01227 0.122995 Hepatoma-derived growth factor (high-mobility group protein 1-like) HDGF Hs.89525 T85094 0.122995 Hypothetical protein FLJ20725 FLJ20725 Hs.15467 T84822 0.122995 TAR (HIV) RNA binding protein 1 TARBP1 Hs.151518 R76096 0.122995 Hypothetical protein FLJ20502 FLJ20502 Hs.23956 AA031501 0.122995 Adaptor-related protein complex 3, mu 1 subunit AP3M1 Hs.298442 H51373 0.122995 - -- R12879 0.122995 KIAA1336 protein KIAA1336 Hs.145365 W44318 0.122995 Mitogen-activated protein kinase 1 MAPK1 Hs.324473 H27344 0.128104 Hypothetical protein MGC5338 MGC5338 Hs.99598 AA116099 0.128104 Melanoma antigen, family D, 2 MAGED2 Hs.4943 R71648 0.128104 CDC2-related protein kinase 7 CRK7 Hs.278346 W15390 0.128104 Bone morphogenetic protein receptor, type IA BMPR1A Hs.2534 H10430 0.128104 Hypothetical protein FLJ21939 similar to 5-azacytidine induced gene 2 FLJ21939 Hs.164478 R89716 0.128104 - -- R18742 0.128104 KIAA1896 protein KIAA1896 Hs.5476 N24364 0.128104 Hypothetical protein FLJ13154 FLJ13154 Hs.25303 H44662 0.128104 Talin 1 TLN1 Hs.375001 N28014 0.128104 BRCA1 associated protein BRAP Hs.122764 T39460 0.128104 Protein phosphatase 1, catalytic subunit, alpha isoform PPP1CA Hs.183994 T80880 0.128104 ESTs ESTs Hs.268957 T87890 0.128104 Hypothetical protein FLJ20772 FLJ20772 Hs.9925 N43008 0.128104 Nuclear antigen Sp100 SP100 Hs.77617 N24178 0.128104 ESTs ESTs Hs.293676 T98538 0.128104 Adaptor-related protein complex 3, beta 1 subunit AP3B1 Hs.155172 H39913 0.128104 - - Hs.144532 R16551 0.128104 - -- AA149828 0.128104 Gm117 gm117 Hs.26226 N24276 0.128104 Transaldolase 1 TALDO1 Hs.77290 N62816 0.128104 Hypothetical protein FLJ11236 FLJ11236 Hs.10441 AA005369 0.128104 KIAA1270 protein KIAA1270 Hs.197668 AA011400 0.128104 Dipeptidylpeptidase 9 DPP9 Hs.237617 R72846 0.128104 Branched chain alpha-ketoacid dehydrogenase kinase BCKDK Hs.20644 W33047 0.128104 - - Hs.348976 H51915 0.128104 - - Hs.180372 R59109 0.128104 A kinase (PRKA) anchor protein (yotiao) 9 AKAP9 Hs.58103 AA058864 0.128104 Adenylosuccinate synthase ADSS Hs.90011 R24577 0.128104 Arginine-glutamic acid dipeptide (RE) repeats RERE Hs.194369 R86309 0.128104 Vacuolar protein sorting 35 (yeast) VPS35 Hs.355901 N66247 0.128104 - - Hs.6390 T70741 0.133376 - - Hs.293476 N51855 0.133376 ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2 ADPRTL2 Hs.24284 T79625 0.133376 ESTs ESTs Hs.14064 H91623 0.133376 - -- T66828 0.133376 Hypothetical protein FLJ36748 FLJ36748 Hs.64313 AA134744 0.133376 TERF1 (TRF1)-interacting nuclear factor 2 TINF2 Hs.7797 AA015841 0.133376 Guanine nucleotide binding protein (G protein), gamma transducing activity pol GNGT1 Hs.73112 H12615 0.133376 Hypothetical protein FLJ11273 FLJ11273 Hs.3542 N30514 0.133376 Adenylosuccinate synthase ADSS Hs.90011 R40685 0.133376 SAC1 suppressor of actin mutations 1-like (yeast) SACM1L Hs.5867 W02149 0.133376 Cell division cycle 2-like 1 (PITSLRE proteins) CDC2L1 Hs.214291 H72512 0.133376 HSPC023 protein HSPC023 Hs.279945 H53141 0.133376 ESTs ESTs Hs.268917 AA114842 0.133376 Tripartite motif-containing 3 TRIM3 Hs.321576 R47985 0.133376 - - Hs.378970 R93168 0.133376 Immune associated nucleotide 4 like 1 (mouse) IAN4L1 Hs.26194 AA037078 0.133376 B7-H1 protein B7-H1 Hs.97269 AA056541 0.133376 D component of complement (adipsin) DF Hs.155597 R34439 0.133376 - - Hs.290270 R13546 0.133376 Endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 EDG1 Hs.154210 T79589 0.133376 Transmembrane protease, serine 4 TMPRSS4 Hs.63325 N92570 0.133376 Uncharacterized bone marrow protein BM042 BM042 Hs.324136 N31020 0.133376 KIAA0102 gene product KIAA0102 Hs.77665 R19117 0.133376 ESTs ESTs Hs.169142 AA099636 0.133376 KIAA1039 protein KIAA1039 Hs.301552 H92328 0.133376 Hypothetical protein FLJ10874 FLJ10874 Hs.30318 H93330 0.133376 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factoSLC9A3R1 Hs.184276 T78109 0.133376 - - Hs.296322 AA046321 0.133376 Utrophin (homologous to dystrophin) UTRN Hs.286161 W31430 0.133376 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigMCP Hs.83532 H44309 0.133376 Solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 SLC25A1 Hs.111024 H15059 0.133376 KIAA0582 protein KIAA0582 Hs.79507 H30717 0.133376 GRB2-associated binding protein 2 GAB2 Hs.30687 N50315 0.133376 Pre-mRNA splicing SR protein rA4 KIAA1172 Hs.125134 H89743 0.138815 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS Hs.93199 AA135338 0.138815 ESTs ESTs Hs.132947 W91999 0.138815 Mitogen-activated protein kinase-activated protein kinase 5 MAPKAPK5 Hs.30327 H09315 0.138815 Proprotein convertase subtilisin/kexin type 7 PCSK7 Hs.32978 N55592 0.138815 Ubiquitin specific protease 20 USP20 Hs.5452 AA054477 0.138815 - - Hs.25391 W92270 0.138815 Fc fragment of IgG, low affinity IIa, receptor for (CD32) FCGR2A Hs.78864 N90432 0.138815 Hypothetical protein FLJ10706 FLJ10706 Hs.273193 T66206 0.138815 VCY2 interacting protein 1 VCY2IP1 Hs.66048 H80862 0.138815 Hypothetical protein KIAA1259 KIAA1259 Hs.40193 R18817 0.138815 ESTs ESTs Hs.22550 AA044639 0.138815 - -- N52681 0.138815 Golgi complex associated protein 1, 60kDa GOCAP1 Hs.6831 AA026902 0.138815 GDP-fucose transporter 1 FLJ11320 Hs.12211 W52914 0.138815 - - Hs.188212 T86392 0.138815 Dynein, cytoplasmic, heavy polypeptide 1 DNCH1 Hs.7720 N91510 0.138815 Hypothetical protein from EUROIMAGE 2107395 LOC58492 Hs.38004 W52509 0.138815 Likely ortholog of yeast ARV1 ARV1 Hs.23360 W42543 0.138815 Hexosaminidase A (alpha polypeptide) HEXA Hs.119403 H02545 0.138815 ESTs ESTs Hs.191170 H26567 0.138815 Bone morphogenetic protein 1 BMP1 Hs.1274 R52317 0.138815 Ras-like without CAAX 2 RIT2 Hs.47626 W04602 0.138815 Hypothetical protein FLJ11807 FLJ11807 Hs.285813 R39701 0.144423 - -- AA150253 0.144423 Similar to ecotropic viral integration site 5; Neuroblastoma stage 4S gene LOC115704 Hs.26870 R35157 0.144423 Diacylglycerol kinase, delta 130kDa DGKD Hs.115907 N63417 0.144423 Beta-site APP-cleaving enzyme 2 BACE2 Hs.271411 R55335 0.144423 - -- H08480 0.144423 MDS024 protein MDS024 Hs.286122 R21391 0.144423 Hypothetical protein DKFZp564D0478 DKFZP564D0478 Hs.321214 R66029 0.144423 Bromodomain adjacent to zinc finger domain, 1A BAZ1A Hs.8858 AA053876 0.144423 DKFZP586M1523 protein DKFZP586M1523 Hs.22981 R53661 0.144423 Phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog PDE4D Hs.172081 N70581 0.144423 Centrin, EF-hand protein, 2 CETN2 Hs.82794 H60417 0.144423 - - Hs.20000 T58682 0.144423 Chromosome 1 open reading frame 16 C1orf16 Hs.15087 H43827 0.144423 V-myc myelocytomatosis viral oncogene homolog (avian) MYC Hs.79070 R31649 0.144423 Huntingtin interacting protein 2 HIP2 Hs.155485 T96407 0.144423 - -- R71903 0.144423 Pygopus 2 PYGO2 Hs.356579 N39088 0.144423 - - Hs.356387 H12151 0.144423 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synt GART Hs.82285 H66118 0.144423 - - Hs.285520 H43477 0.144423 PCF11p homolog PCF11 Hs.123654 T81220 0.144423 - -- W02280 0.144423 - - Hs.374582 T79825 0.144423 - EST Hs.332668 H38180 0.144423 DKFZP434C212 protein DKFZP434C212 Hs.172069 N27557 0.144423 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 PSMD9 Hs.5648 R70779 0.150204 - - Hs.352579 N31589 0.150204 Type I sigma receptor SR-BP1 Hs.24447 W05850 0.150204 Emopamil binding protein (sterol isomerase) EBP Hs.75105 R74477 0.150204 Microtubule-associated proteins 1A/1B light chain 3 MAP1A/1BLC3 Hs.121849 N79069 0.150204 - -- H82057 0.150204 - - Hs.372741 N35002 0.150204 Dom-3 homolog Z (C. elegans) DOM3Z Hs.153299 AA099585 0.150204 Phosphodiesterase 7B PDE7B Hs.283016 R77592 0.150204 Chromatin accessibility complex 1 CHRAC1 Hs.279704 AA044954 0.150204 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608 N95573 0.150204 TBP-like 1 TBPL1 Hs.13993 N24689 0.150204 - - Hs.372542 R11580 0.150204 Formin binding protein 3 FNBP3 Hs.107213 W47347 0.150204 Hypothetical protein FLJ11198 FLJ11198 Hs.91251 H20507 0.150204 Similar to ecotropic viral integration site 5; Neuroblastoma stage 4S gene LOC115704 Hs.26870 H45525 0.150204 Ras homolog gene family, member G (rho G) ARHG Hs.75082 AA040372 0.150204 Proline-rich protein HaeIII subfamily 1 PRH1 Hs.278469 H44002 0.150204 - -- AA149043 0.150204 Type I transmembrane protein Fn14 FN14 Hs.10086 R51894 0.150204 Replication factor C (activator 1) 1, 145kDa RFC1 Hs.166563 H59130 0.150204 Sec23 homolog B (S. cerevisiae) SEC23B Hs.173497 AA053340 0.150204 - - Hs.109212 T85558 0.150204 ESTs ESTs Hs.332720 N49211 0.150204 HEMK homolog 7kb HEMK Hs.46907 R94457 0.150204 Guanine monphosphate synthetase GMPS Hs.5398 R78049 0.150204 DKFZP566I1024 protein DKFZP566I1024 Hs.279696 H90964 0.150204 Zinedin ZIN Hs.108665 N53897 0.150204 - - Hs.58966 AA102103 0.150204 Stromal antigen 2 STAG2 Hs.8217 R51179 0.150204 - -- W68672 0.150204 RAB, member of RAS oncogene family-like 2B RABL2B Hs.355874 R80399 0.150204 Dishevelled, dsh homolog 3 (Drosophila) DVL3 Hs.174044 H86108 0.150204 RAB11A, member RAS oncogene family RAB11A Hs.75618 N63795 0.150204 ESTs ESTs Hs.355467 W04510 0.156159 TCF3 (E2A) fusion partner (in childhood Leukemia) TFPT Hs.233765 H47425 0.156159 Proteolipid protein 2 (colonic epithelium-enriched) PLP2 Hs.77422 R64137 0.156159 ESTs ESTs Hs.108887 T78085 0.156159 - - Hs.133407 R51031 0.156159 - - Hs.349283 AA029451 0.156159 Transcription factor 7-like 2 (T-cell specific, HMG-box) TCF7L2 Hs.348412 N79912 0.156159 Guanine nucleotide binding protein (G protein), beta polypeptide 1 GNB1 Hs.215595 R69062 0.156159 Lipidosin BG1 Hs.277543 AA194944 0.156159 - -- AA135731 0.156159 ESTs ESTs Hs.71428 T65042 0.156159 - -- R15444 0.156159 - - Hs.69476 R73223 0.156159 TGFB1-induced anti-apoptotic factor 1 TIAF1 Hs.75822 N34765 0.156159 - -- H50906 0.156159 Stannin SNN Hs.76691 N74700 0.156159 Similar to Caenorhabditis elegans protein C42C1.9 KEO4 Hs.285818 W46553 0.156159 Hypothetical protein FLJ38984 FLJ38984 Hs.112023 N67453 0.156159 Cyclin-dependent kinase inhibitor 1A (p21, Cip1) CDKN1A Hs.179665 N91450 0.156159 - - Hs.141003 W37878 0.156159 - - Hs.294142 T86389 0.156159 ESTs ESTs Hs.100640 T70340 0.156159 General transcription factor IIIC, polypeptide 3, 102kDa GTF3C3 Hs.90847 W47525 0.156159 - - Hs.110771 H86876 0.156159 Heparan sulfate (glucosamine) 3-O-sulfotransferase 1 HS3ST1 Hs.40968 AA001906 0.156159 Thyroid hormone receptor-associated protein, 240 kDa subunit TRAP240 Hs.11861 N36912 0.156159 KIAA1737 protein KIAA1737 Hs.22452 R79688 0.156159 - -- AA135452 0.156159 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041 W33066 0.156159 Mitochondrial ribosomal protein L9 MRPL9 Hs.288936 N29139 0.156159 V-jun sarcoma virus 17 oncogene homolog (avian) JUN Hs.78465 N68626 0.162291 Splicing factor 1 SF1 Hs.180677 H52752 0.162291 Heat shock 70kDa protein 9B (mortalin-2) HSPA9B Hs.3069 AA034317 0.162291 Candidate tumor suppressor protein LOC57107 Hs.16608 T82117 0.162291 ESTs ESTs Hs.191196 AA043530 0.162291 - - Hs.99841 AA047464 0.162291 RAN binding protein 2 RANBP2 Hs.199179 H29857 0.162291 Transducer of ERBB2, 1 TOB1 Hs.178137 R52104 0.162291 Gemin 5 GEMIN5 Hs.25882 AA211825 0.162291 - -- N81096 0.162291 KIAA0614 protein KIAA0614 Hs.7314 T97303 0.162291 Signal sequence receptor, alpha (translocon-associated protein alpha) SSR1 Hs.250773 T84264 0.162291 RAP2B, member of RAS oncogene family RAP2B Hs.239527 R94499 0.162291 Guanine nucleotide binding protein (G protein), beta 5 GNB5 Hs.155090 H21130 0.162291 Ran GTPase activating protein 1 RANGAP1 Hs.183800 N92911 0.162291 Hypothetical protein dJ473B4 DJ473B4 Hs.57549 N80149 0.162291 - - Hs.323017 N40831 0.162291 Microsomal glutathione S-transferase 3 MGST3 Hs.111811 T91993 0.162291 ESTs ESTs Hs.347475 N48163 0.162291 Hypothetical protein MGC13186 MGC13186 Hs.16034 T72620 0.162291 ESTs ESTs Hs.117915 R42028 0.162291 Nardilysin (N-arginine dibasic convertase) NRD1 Hs.4099 R51134 0.162291 ESTs ESTs Hs.378118 R12948 0.162291 NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa NDUFV1 Hs.7744 N30285 0.162291 FUS interacting protein (serine-arginine rich) 1 FUSIP1 Hs.3530 W37084 0.162291 Hypothetical protein FLJ14743 FLJ14743 Hs.169577 AA036794 0.162291 Hypothetical protein MGC3162 MGC3162 Hs.95196 R52048 0.168603 Upstream regulatory element binding protein 1 UREB1 Hs.3383 AA035361 0.168603 Signal transducer and activator of transcription 1, 91kDa STAT1 Hs.21486 N24030 0.168603 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma IKBKG Hs.43505 N99984 0.168603 Hypothetical protein FLJ36666 FLJ36666 Hs.7604 N53193 0.168603 Polymerase (DNA directed), epsilon POLE Hs.166846 AA134529 0.168603 DKFZP566D193 protein DKFZP566D193 Hs.106909 W47014 0.168603 Ts translation elongation factor, mitochondrial TSFM Hs.340959 N64399 0.168603 Oxysterol binding protein-like 1A OSBPL1A Hs.252716 N63791 0.168603 - - Hs.355772 N95498 0.168603 - - Hs.109007 AA046956 0.168603 DAZ associated protein 1 DAZAP1 Hs.65588 R25877 0.168603 Hypothetical protein FLJ10511 FLJ10511 Hs.106768 H79508 0.168603 - -- W42880 0.168603 Tripartite motif-containing 8 TRIM8 Hs.54580 W15295 0.168603 BCL2-associated athanogene 5 BAG5 Hs.5443 AA056486 0.168603 - -- T78498 0.168603 Hypothetical protein FLJ22569 FLJ22569 Hs.234355 W44956 0.168603 2,4-dienoyl CoA reductase 1, mitochondrial DECR1 Hs.81548 W86191 0.168603 Pseudouridylate synthase 1 PUS1 Hs.23723 H10385 0.168603 - - Hs.374535 H19719 0.168603 Gemin 5 GEMIN5 Hs.25882 T95699 0.168603 Chromosome 11 hypothetical protein ORF4 LOC56834 Hs.25274 AA034128 0.168603 - -- N49757 0.168603 Polymerase (DNA directed), mu POLM Hs.46964 H15122 0.168603 Sex comb on midleg homolog 1 SCMH1 Hs.57475 H12660 0.168603 Sarcolemma associated protein SLMAP Hs.4007 AA128183 0.168603 Meningioma expressed antigen 5 (hyaluronidase) MGEA5 Hs.5734 N66188 0.168603 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965 N24109 0.168603 Annexin A11 ANXA11 Hs.75510 T77481 0.168603 LIS1-interacting protein NUDEL; endooligopeptidase A NUDEL Hs.3850 R54733 0.168603 - - Hs.299119 N35485 0.168603 MAD1 mitotic arrest deficient-like 1 (yeast) MAD1L1 Hs.7345 N93186 0.175098 Heme oxygenase (decycling) 2 HMOX2 Hs.284279 AA148461 0.175098 Hypothetical protein LOC51315 LOC51315 Hs.5721 W38730 0.175098 Poly(rC) binding protein 2 PCBP2 Hs.63525 R27762 0.175098 CGI-141 protein LOC51026 Hs.62275 R75976 0.175098 - - Hs.373548 H00846 0.175098 Chromosome 11 hypothetical protein ORF4 LOC56834 Hs.25274 T97206 0.175098 Hypothetical protein FLJ10747 FLJ10747 Hs.189782 AA150265 0.175098 Reticulocalbin 1, EF-hand calcium binding domain RCN1 Hs.167791 AA054495 0.175098 - -- R80243 0.175098 X-box binding protein 1 XBP1 Hs.149923 R25983 0.175098 N-ethylmaleimide-sensitive factor NSF Hs.108802 W04808 0.175098 - - Hs.16346 R45681 0.175098 TRAF and TNF receptor-associated protein AD022 Hs.46847 W31443 0.175098 Hypothetical protein MGC14433 MGC14433 Hs.83572 R49537 0.175098 Met proto-oncogene (hepatocyte growth factor receptor) MET Hs.285754 N20172 0.175098 Tumor protein p53 binding protein, 2 TP53BP2 Hs.44585 R06442 0.175098 TP53 target gene 1 TP53TG1 Hs.274329 R83448 0.175098 - - Hs.331666 AA040043 0.175098 Protocadherin 20 PCDH20 Hs.132892 N49756 0.175098 - - Hs.348978 H58445 0.175098 Nucleoporin 98kDa NUP98 Hs.112255 R71157 0.175098 Hypothetical protein FLJ10759 FLJ10759 Hs.15921 AA128582 0.175098 Translocase of inner mitochondrial membrane 44 homolog (yeast) TIMM44 Hs.123178 R05441 0.175098 MT-protocadherin KIAA1775 Hs.137556 H28053 0.175098 Down-regulated by Ctnnb1, a DRCTNNB1A Hs.85603 H19387 0.175098 Malic enzyme 2, NAD(+)-dependent, mitochondrial ME2 Hs.75342 AA034009 0.175098 Outer dense fibre of sperm tails 2 ODF2 Hs.129055 R16169 0.175098 Stromal cell-derived factor 2 SDF2 Hs.118684 R01226 0.175098 - - Hs.348515 N93807 0.175098 - EST Hs.144224 W89140 0.175098 ESTs ESTs Hs.14691 R89847 0.175098 ESTs ESTs Hs.175979 N/A2 0.175098 - -- R09452 0.181778 Hypothetical protein FLJ10460 FLJ10460 Hs.14347 W87791 0.181778 - -- W33139 0.181778 Hypothetical protein dJ122O8.2 DJ122O8.2 Hs.268115 AA045048 0.181778 Sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmeSEMA5B Hs.61384 R79614 0.181778 KIAA0256 gene product KIAA0256 Hs.118978 N90523 0.181778 Methionyl-tRNA formyltransferase, mitochondrial MtFMT Hs.54627 AA047388 0.181778 Hepatitis C virus core-binding protein 6 HCBP6 Hs.283674 N79649 0.181778 C21orf19-like protein LOC51072 Hs.20814 W86640 0.181778 Receptor (TNFRSF)-interacting serine-threonine kinase 1 RIPK1 Hs.296327 W07372 0.181778 MBIP protein MBIP Hs.16755 AA029551 0.181778 ESTs ESTs Hs.61373 R32270 0.181778 Epithelial membrane protein 2 EMP2 Hs.29191 H61812 0.181778 Cyclin-dependent kinase 4 CDK4 Hs.95577 H16567 0.181778 Hypothetical protein FLJ20195 FLJ20195 Hs.286261 H56735 0.181778 Hypothetical protein FLJ13611 FLJ13611 Hs.282958 N72125 0.181778 - -- AA029926 0.181778 - - Hs.351292 W85882 0.181778 Hypothetical protein FLJ10349 FLJ10349 Hs.19333 H74312 0.181778 Phosphatidic acid phosphatase type 2B PPAP2B Hs.173717 R20808 0.181778 POP7 (processing of precursor, S. cerevisiae) homolog RPP20 Hs.18747 N92371 0.181778 Hypothetical protein, clone 24751 CL24751 Hs.29344 N36898 0.181778 Similar to rat nuclear ubiquitous casein kinase 2 NUCKS Hs.118064 H28667 0.181778 Sterile alpha motif and leucine zipper containing kinase AZK ZAK Hs.115175 R14138 0.181778 - -- W37346 0.181778 DIPB protein HSA249128 Hs.14512 R39264 0.181778 Mitotic phosphoprotein 44 LOC129401 Hs.180591 AA005328 0.181778 V-ski sarcoma viral oncogene homolog (avian) SKI Hs.2969 N49027 0.181778 KIAA0460 protein KIAA0460 Hs.29956 AA044942 0.181778 Eukaryotic translation initiation factor 4 gamma, 1 EIF4G1 Hs.211568 R07187 0.181778 Ornithine decarboxylase antizyme 2 OAZ2 Hs.74563 N22700 0.181778 Hypothetical protein FLJ12584 FLJ12584 Hs.288897 N26378 0.181778 Glycerol kinase GK Hs.1466 R81830 0.181778 Zinc finger protein 217 ZNF217 Hs.155040 T96991 0.181778 Thioredoxin reductase 1 TXNRD1 Hs.13046 H48501 0.181778 SCN Circadian Oscillatory Protein (SCOP) SCOP Hs.38176 N43897 0.181778 Integrin beta 4 binding protein ITGB4BP Hs.5215 R21092 0.181778 Carbonic anhydrase I CA1 Hs.23118 N25348 0.181778 V-ets erythroblastosis virus E26 oncogene homolog 1 (avian) ETS1 Hs.18063 H03156 0.181778 Glutamine-fructose-6-phosphate transaminase 1 GFPT1 Hs.1674 N36043 0.181778 Hypothetical protein FLJ10597 FLJ10597 Hs.90375 R44195 0.181778 DiGeorge syndrome critical region gene DGSI; likely ortholog of mouse expres DGSI Hs.154879 N26506 0.188645 Ribosomal protein S17 RPS17 Hs.5174 W56563 0.188645 Mitochondrial ribosomal protein S28 MRPS28 Hs.55097 R56535 0.188645 ESTs ESTs Hs.106672 W40367 0.188645 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899 R32216 0.188645 P53-induced protein PIGPC1 PIGPC1 Hs.303125 R51914 0.188645 CGI-87 protein LOC51112 Hs.5008 W21221 0.188645 RNA binding motif protein 4 RBM4 Hs.42826 R84726 0.188645 Adenosine A1 receptor ADORA1 Hs.77867 H43602 0.188645 Chondroitin 4-O-sulfotransferase 2 C4S-2 Hs.25204 AA121308 0.188645 TRNA isopentenylpyrophosphate transferase IPT Hs.356554 N47654 0.188645 KIAA0140 gene product KIAA0140 Hs.156016 R94724 0.188645 Phytanoyl-CoA hydroxylase (Refsum disease) PHYH Hs.172887 AA037833 0.188645 Hypothetical protein MGC20496 MGC20496 Hs.12106 H93335 0.188645 Zinc finger protein, subfamily 1A, 4 (Eos) ZNFN1A4 Hs.302031 N32331 0.188645 Hypothetical protein FLJ14825 FLJ14825 Hs.334824 AA011595 0.188645 Zinc finger protein 38 ZNF38 Hs.20082 H89571 0.188645 - -- T93107 0.188645 - - Hs.110771 H57824 0.188645 ESTs ESTs Hs.128746 R35007 0.188645 - -- AA045373 0.188645 Transcription elongation factor A (SII)-like 1 TCEAL1 Hs.95243 N30854 0.188645 Lectin, mannose-binding, 1 LMAN1 Hs.287912 H14085 0.188645 Transmembrane 4 superfamily member tetraspan NET-5 NET-5 Hs.129826 W68622 0.188645 Coatomer protein complex, subunit alpha COPA Hs.75887 R93042 0.188645 - -- T78883 0.188645 ESTs ESTs Hs.268596 N74995 0.188645 RAB35, member RAS oncogene family RAB35 Hs.94308 R01143 0.188645 Solute carrier family 35 (UDP-galactose transporter), member 2 SLC35A2 Hs.21899 N29706 0.195701 Hypothetical protein FLJ10587 FLJ10587 Hs.7296 AA047130 0.195701 - -- N39397 0.195701 Brain acyl-CoA hydrolase BACH Hs.8679 W94116 0.195701 - - Hs.293656 AA045664 0.195701 Uncharacterized hematopoietic stem/progenitor cells protein MDS031 MDS031 Hs.110853 N36138 0.195701 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899 N75060 0.195701 Coatomer protein complex, subunit beta COPB Hs.3059 AA005173 0.195701 Hypothetical protein FLJ21144 FLJ21144 Hs.59584 H08264 0.195701 Splicing factor 3b, subunit 4, 49kDa SF3B4 Hs.25797 N30054 0.195701 - -- N70152 0.195701 CGI-99 protein LOC51637 Hs.110803 AA203242 0.195701 Ankyrin repeat and SOCS box-containing 13 ASB13 Hs.99603 AA053304 0.195701 Hypothetical protein BC017169 LOC91137 Hs.75639 AA149177 0.195701 Autoantigen RCD-8 Hs.75682 AA203387 0.195701 Trophinin associated protein (tastin) TROAP Hs.171955 R45669 0.195701 MORF-related gene 15 MRG15 Hs.6353 R22904 0.195701 8D6 antigen 8D6A Hs.106196 T91747 0.195701 ESTs ESTs Hs.268612 H93200 0.195701 ESTs ESTs Hs.269052 R47941 0.195701 Hypothetical protein BC018453 LOC129531 Hs.14222 N21528 0.195701 Leucine rich repeat (in FLII) interacting protein 2 LRRFIP2 Hs.57672 W63553 0.195701 Hypothetical protein BC001573 LOC134147 Hs.349344 W05750 0.195701 Protein containing CXXC domain 2 PCCX2 Hs.199009 H45307 0.195701 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 DYRK4 Hs.17154 N45679 0.195701 Likely ortholog of mouse variant polyadenylation protein CSTF-64 CSTF2T Hs.21992 AA043812 0.195701 Sentrin/SUMO-specific protease SENP1 Hs.66450 AA120761 0.195701 E74-like factor 1 (ets domain transcription factor) ELF1 Hs.154365 R51937 0.195701 LIM domain kinase 2 LIMK2 Hs.278027 R76834 0.195701 Hypothetical protein FLJ10392 FLJ10392 Hs.20887 H92499 0.195701 ESTs ESTs Hs.289083 R73278 0.195701 Intercellular adhesion molecule 3 ICAM3 Hs.99995 AA047258 0.195701 TNF receptor-associated factor 5 TRAF5 Hs.29736 N66246 0.195701 Activating transcription factor 6 ATF6 Hs.5813 W31281 0.195701 - - Hs.182036 N58731 0.195701 - -- AA057338 0.195701 General transcription factor IIH, polypeptide 1, 62kDa GTF2H1 Hs.89578 H00239 0.195701 ATP-binding cassette, sub-family F (GCN20), member 2 ABCF2 Hs.153612 H01676 0.195701 Hypothetical protein BC002494 LOC92579 Hs.294005 N24671 0.202949 CGI-111 protein LOC51015 Hs.11085 H20342 0.202949 - - Hs.173699 H52953 0.202949 Hypothetical protein MGC20255 MGC20255 Hs.334775 N36282 0.202949 ESTs ESTs Hs.356537 H68838 0.202949 Nuclear receptor subfamily 2, group C, member 1 NR2C1 Hs.108301 T94596 0.202949 Vacuolar protein sorting 26 (yeast) VPS26 Hs.67052 H29296 0.202949 Development and differentiation enhancing factor 2 DDEF2 Hs.12802 H49981 0.202949 - - Hs.113994 W86967 0.202949 KIAA1450 protein KIAA1450 Hs.83243 W74523 0.202949 Aldo-keto reductase family 1, member A1 (aldehyde reductase) AKR1A1 Hs.89529 R39865 0.202949 Jerky homolog (mouse) JRK Hs.142296 W15280 0.202949 Chromosome 9 open reading frame 5 C9orf5 Hs.86412 H40662 0.202949 - -- T96118 0.202949 - - Hs.226313 R23473 0.202949 Hypothetical protein FLJ20624 FLJ20624 Hs.52256 T86315 0.202949 Ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin) RNASE2 Hs.728 R15291 0.202949 - -- T98251 0.202949 - - Hs.288581 R83037 0.202949 Hypothetical protein FLJ20008 FLJ20008 Hs.14235 R12743 0.202949 KIAA1131 protein KIAA1131 Hs.210850 H95278 0.202949 Phosphogluconate dehydrogenase PGD Hs.75888 N34004 0.202949 Signal transducer and activator of transcription 6, interleukin-4 induced STAT6 Hs.181015 R72314 0.202949 - -- AA031347 0.202949 - - Hs.355548 W07487 0.202949 KIAA0870 protein KIAA0870 Hs.18166 AA037447 0.202949 Acid phosphatase 1, soluble ACP1 Hs.75393 AA149333 0.202949 Actinin, alpha 1 ACTN1 Hs.119000 W70111 0.202949 Alcohol dehydrogenase 5 (class III), chi polypeptide ADH5 Hs.78989 H03230 0.202949 - -- R20384 0.202949 Leucine carboxyl methyltransferase LCMT Hs.8054 AA047077 0.202949 Amylase, alpha 2B; pancreatic AMY2B Hs.335493 N36411 0.202949 ESTs ESTs Hs.44754 AA039284 0.202949 Hypothetical protein FLJ10290 FLJ10290 Hs.25516 T77328 0.202949 Similar to HYPOTHETICAL 34.0 KDA PROTEIN ZK795.3 IN CHROMOSOME MGC19606 Hs.91579 H88464 0.202949 KIAA0560 gene product KIAA0560 Hs.129952 R20347 0.202949 Hypothetical protein FLJ22386 FLJ22386 Hs.22795 T97612 0.202949 ESTs ESTs Hs.272066 N33225 0.202949 ESTs ESTs Hs.237749 R99867 0.202949 G protein-binding protein CRFG CRFG Hs.215766 AA037624 0.210391 Hypothetical protein MGC5242 MGC5242 Hs.77365 N36888 0.210391 DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) DCLRE1A Hs.1560 R42203 0.210391 Mitochondrial ribosomal protein S27 MRPS27 Hs.122669 H51393 0.210391 Transient receptor potential cation channel, subfamily V, member 2 TRPV2 Hs.279746 AA131747 0.210391 Scribble SCRIB Hs.239784 H94177 0.210391 High-mobility group nucleosomal binding domain 2 HMGN2 Hs.181163 W39400 0.210391 Matrix metalloproteinase 11 (stromelysin 3) MMP11 Hs.155324 R11158 0.210391 Nuclear localization signal deleted in velocardiofacial syndrome NLVCF Hs.19500 AA043893 0.210391 Neuroepithelial cell transforming gene 1 NET1 Hs.25155 AA002041 0.210391 Zinc finger protein 262 ZNF262 Hs.150390 H24644 0.210391 - -- W86818 0.210391 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-a IKBKAP Hs.31323 N21227 0.210391 Brain protein I3 BRI3 Hs.75922 H07938 0.210391 Hypothetical protein FLJ21044 similar to Rbig1 FLJ21044 Hs.25477 H78210 0.210391 Uridine kinase-like 1 URKL1 Hs.39850 AA203552 0.210391 - - Hs.193007 N21529 0.210391 - -- H96259 0.210391 Similar to putative transmembrane protein; homolog of yeast Golgi membrane LOC90522 Hs.334725 N32500 0.210391 ESTs ESTs Hs.170277 T83198 0.210391 Putative receptor protein PMI Hs.15196 R40412 0.210391 Catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-r CTNND2 Hs.80220 H03273 0.210391 PEST-containing nuclear protein PCNP Hs.283728 AA133495 0.210391 Triggering receptor expressed on myeloid cells 2 TREM2 Hs.44234 H71793 0.210391 X-box binding protein 1 XBP1 Hs.149923 AA054499 0.210391 - - Hs.143885 H15212 0.210391 Transducer of ERBB2, 2 TOB2 Hs.4994 R32023 0.210391 Golgi autoantigen, golgin subfamily a, 5 GOLGA5 Hs.241572 H15131 0.210391 - - Hs.4866 R99528 0.210391 UDP-glucuronate decarboxylase 1 UXS1 Hs.288158 N23942 0.210391 MEP50 protein MEP50 Hs.11039 W04612 0.210391 JM5 protein JM5 Hs.21753 R26509 0.210391 Platelet-derived growth factor receptor, beta polypeptide PDGFRB Hs.76144 AA043739 0.218028 - - Hs.96513 H50774 0.218028 Similar to S. cerevisiae Sec6p and R. norvegicus rsec6 SEC6 Hs.8088 H02832 0.218028 Hypothetical protein FLJ23476 FLJ23476 Hs.46736 R18971 0.218028 Hypothetical protein DKFZp586I021 DKFZp586I021 Hs.181077 H11807 0.218028 CTP synthase CTPS Hs.251871 W63760 0.218028 Coilin COIL Hs.966 R71176 0.218028 Slingshot 3 SSH-3 Hs.29173 N33439 0.218028 Eukaryotic translation elongation factor 2 EEF2 Hs.75309 AA045053 0.218028 Pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1PTN Hs.44 W90154 0.218028 DKFZP434B168 protein DKFZP434B168 Hs.48604 AA047760 0.218028 Phosphodiesterase 6G, cGMP-specific, rod, gamma PDE6G Hs.1857 N80155 0.218028 - - Hs.18672 T87767 0.218028 ESTs ESTs Hs.16439 R80587 0.218028 Protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoforPPP2R2A Hs.179574 N78617 0.218028 Phosphodiesterase 5A, cGMP-specific PDE5A Hs.139271 AA034395 0.218028 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 PIN1 Hs.161362 AA054300 0.218028 Kelch-like 4 (Drosophila) KLHL4 Hs.49075 R05817 0.218028 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa NDUFA7 Hs.19561 H44437 0.218028 - - Hs.324342 AA130297 0.218028 - - Hs.379757 AA133962 0.218028 PRO0149 protein PRO0149 Hs.64056 W47177 0.218028 GCN5 general control of amino-acid synthesis 5-like 1 (yeast) GCN5L1 Hs.94672 T69784 0.218028 Fragile X mental retardation, autosomal homolog 2 FXR2 Hs.52788 AA041277 0.218028 - -- T85009 0.218028 Hypothetical protein FLJ32203 FLJ32203 Hs.351706 N92759 0.218028 Cytoskeleton-associated protein 4 CKAP4 Hs.74368 N74712 0.218028 Similar to RIKEN cDNA 3110001D03 gene (M. musculus) MGC4730 Hs.7517 AA046886 0.218028 Hypothetical protein FLJ20473 FLJ20473 Hs.9096 N68160 0.218028 Hypothetical protein FLJ23306 FLJ23306 Hs.5890 R41834 0.218028 KIAA1116 protein KIAA1116 Hs.227602 H83706 0.218028 ESTs ESTs Hs.141358 W56402 0.218028 Musashi homolog 2 (Drosophila) MSI2 Hs.173179 AA044402 0.218028 Hypothetical protein FLJ11749 FLJ11749 Hs.22897 AA149853 0.218028 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domainCITED4 Hs.355820 N64271 0.218028 - -- AA053221 0.218028 Seven in absentia homolog 2 (Drosophila) SIAH2 Hs.20191 AA127818 0.218028 - -- R50300 0.218028 Hypothetical protein DKFZp434N1923 DKFZP434N1923 Hs.295866 H90643 0.218028 - -- R69610 0.218028 B-cell receptor-associated protein BAP29 BAP29 Hs.27135 W58698 0.218028 - - Hs.63236 R50403 0.218028 Chromosome 20 open reading frame 188 C20orf188 Hs.168073 AA010033 0.218028 CDNA FLJ00103 FLJ00103 Hs.380465 R76960 0.218028 Nei like 2 (E. coli) NEIL2 Hs.293818 H19443 0.218028 MAP/microtubule affinity-regulating kinase 2 MARK2 Hs.157199 R10284 0.218028 Hyaluronan-mediated motility receptor (RHAMM) HMMR Hs.72550 R28109 0.218028 Single stranded DNA binding protein 4 SSBP4 Hs.324618 N92254 0.218028 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965 R68213 0.218028 AD026 protein AD026 Hs.28847 AA029240 0.218028 Ligase III, DNA, ATP-dependent LIG3 Hs.100299 N24303 0.218028 - -- R52828 0.225862 Retinoic acid induced 14 RAI14 Hs.15165 H19488 0.225862 - - Hs.194081 AA193393 0.225862 Hypothetical protein FLJ20294 FLJ20294 Hs.7995 AA036798 0.225862 - - Hs.339024 W90281 0.225862 Sprouty homolog 2 (Drosophila) SPRY2 Hs.18676 N40345 0.225862 Ras homolog gene family, member J ARHJ Hs.243010 H62739 0.225862 - - Hs.14824 H83003 0.225862 Immunoglobulin superfamily, member 1 IGSF1 Hs.22111 T82265 0.225862 Nudix (nucleoside diphosphate linked moiety X)-type motif 4 NUDT4 Hs.92381 AA043334 0.225862 Small nuclear RNA activating complex, polypeptide 3, 50kDa SNAPC3 Hs.164915 R63807 0.225862 CGI-85 protein CGI-85 Hs.267448 H02915 0.225862 Trans-activated by hepatitis C virus core protein 1 TAHCCP1 Hs.118087 H03532 0.225862 Discs, large (Drosophila) homolog 5 DLG5 Hs.170290 AA028124 0.225862 - - Hs.61472 N98333 0.225862 Ribosomal protein L7 RPL7 Hs.153 AA011445 0.225862 Caspase 3, apoptosis-related cysteine protease CASP3 Hs.74552 AA005395 0.225862 - - Hs.187564 H82518 0.225862 Ribokinase RBSK Hs.11916 R54445 0.225862 HSPC189 protein HSPC189 Hs.20768 R20548 0.225862 ESTs ESTs Hs.21119 R16301 0.225862 - -- T75394 0.225862 Eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa EIF2B3 Hs.283627 AA047135 0.225862 Ribonuclease/angiogenin inhibitor RNH Hs.75108 R18453 0.225862 - -- AA033982 0.225862 - - Hs.110059 R67103 0.225862 Bone morphogenetic protein 6 BMP6 Hs.285671 H13047 0.225862 F-box only protein 22 FBXO22 Hs.369030 H98836 0.225862 Sac domain-containing inositol phosphatase 3 SAC3 Hs.10037 N36387 0.225862 ESTs ESTs Hs.93813 W88726 0.225862 Metaxin 1 MTX1 Hs.247551 AA040370 0.225862 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 CDS2 Hs.24812 T67521 0.225862 U2 small nuclear ribonucleoprotein auxiliary factor, small subunit 2 U2AF1RS2 Hs.171909 T77393 0.225862 Hypothetical protein FLJ20297 FLJ20297 Hs.94491 R51977 0.225862 KIAA1402 protein KIAA1402 Hs.86392 N77716 0.225862 Low molecular mass ubiquinone-binding protein (9.5kD) QP-C Hs.3709 R76008 0.225862 RAB11B, member RAS oncogene family RAB11B Hs.239018 AA010187 0.225862 Pericentrin 2 (kendrin) PCNT2 Hs.15896 N32221 0.225862 Solute carrier family 12 (potassium/chloride transporters), member 6 SLC12A6 Hs.4876 W04645 0.233895 ESTs ESTs Hs.322915 AA043235 0.233895 Novel putative protein similar to YIL091C yeast hypothetical 84 kD protein fromDJ434O14.5 Hs.194754 AA150244 0.233895 Aspartylglucosaminidase AGA Hs.207776 H16646 0.233895 Hypothetical protein PP591 PP591 Hs.118666 H23211 0.233895 Hypothetical protein MGC3077 MGC3077 Hs.288649 H23370 0.233895 RAB22A, member RAS oncogene family RAB22A Hs.288968 H51540 0.233895 Hypothetical protein FLJ14641 FLJ14641 Hs.245326 R60330 0.233895 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-DPLOD Hs.75093 H72575 0.233895 Ninein (GSK3B interacting protein) NIN Hs.44054 R87919 0.233895 KIAA0370 protein KIAA0370 Hs.70500 H58459 0.233895 Glycosyltransferase AD-017 AD-017 Hs.283737 H48031 0.233895 Tankyrase 1 binding protein 1, 182kDa TNKS1BP1 Hs.9645 N69464 0.233895 Hypothetical protein FLJ22087 FLJ22087 Hs.17230 N59340 0.233895 Progesterone-induced blocking factor 1 PIBF1 Hs.43913 T75481 0.233895 Ras responsive element binding protein 1 RREB1 Hs.171942 W61013 0.233895 V-abl Abelson murine leukemia viral oncogene homolog 1 ABL1 Hs.146355 W32939 0.233895 Zinc finger protein-like 1 ZFPL1 Hs.155165 AA046217 0.233895 - - Hs.293821 H60343 0.233895 Hypothetical protein LOC57143 LOC57143 Hs.15251 N53940 0.233895 Hypothetical protein MGC20481 MGC20481 Hs.324127 T72646 0.233895 - -- H26015 0.233895 ESTs ESTs Hs.372352 H51325 0.233895 Kinesin family member 13B KIF13B Hs.15711 R72283 0.233895 Hypothetical protein FLJ12089 FLJ12089 Hs.11896 W87755 0.233895 ESTs ESTs Hs.269571 N48161 0.233895 Upstream transcription factor 2, c-fos interacting USF2 Hs.93649 R92201 0.233895 Similar to RIKEN cDNA 1810055D05 LOC131118 Hs.349177 H15848 0.233895 - - Hs.31388 W05126 0.233895 - - Hs.18949 N29497 0.233895 - - Hs.43112 R66525 0.233895 - - Hs.99804 W52126 0.233895 - -- AA069413 0.233895 Hypothetical protein FLJ22709 FLJ22709 Hs.347130 AA044737 0.233895 Flotillin 2 FLOT2 Hs.184488 R67585 0.233895 ESTs ESTs Hs.268748 T96535 0.233895 Zinc finger protein 278 ZNF278 Hs.27801 R24934 0.233895 - - Hs.356564 R75921 0.233895 Serologically defined breast cancer antigen 84 SDBCAG84 Hs.169992 AA059202 0.233895 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransGALNT7 Hs.246315 T89038 0.242129 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206 R51875 0.242129 Breakpoint cluster region BCR Hs.234799 N66473 0.242129 - - Hs.249247 N42428 0.242129 Ribosomal protein S24 RPS24 Hs.180450 AA004836 0.242129 Hypothetical nuclear factor SBBI22 LOC57117 Hs.26323 AA149240 0.242129 Similar to DNA-directed RNA polymerase I (135 kDa) Rpo1-2 Hs.86337 T82048 0.242129 Endothelial differentiation-related factor 1 EDF1 Hs.174050 AA131821 0.242129 Proteasome (prosome, macropain) subunit, beta type, 2 PSMB2 Hs.1390 W88446 0.242129 Natural killer-tumor recognition sequence NKTR Hs.241493 R70785 0.242129 Chromosome 8 open reading frame 2 C8orf2 Hs.125849 T79713 0.242129 SET binding factor 1 SBF1 Hs.112049 W84581 0.242129 Hypothetical protein STRAIT11499 STRAIT11499 Hs.236556 N39320 0.242129 DKFZP564I052 protein DKFZP564I052 Hs.5364 AA101775 0.242129 Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) MCCC1 Hs.47649 AA007350 0.242129 Similar to yeast BET3 (S. cerevisiae) BET3 Hs.288013 R12622 0.242129 FtsJ homolog 2 (E. coli) FTSJ2 Hs.279877 H18113 0.242129 - - Hs.379038 H29484 0.242129 Sjogren syndrome antigen B (autoantigen La) SSB Hs.83715 AA031576 0.242129 - - Hs.143812 R25698 0.242129 - -- AA099154 0.242129 Cell division cycle 34 CDC34 Hs.76932 H00845 0.242129 Mitochondrial ribosomal protein L33 MRPL33 Hs.14454 AA043506 0.242129 CCAAT/enhancer binding protein (C/EBP), delta CEBPD Hs.76722 R72217 0.242129 Acetyl-Coenzyme A carboxylase beta ACACB Hs.183857 AA047156 0.242129 ESTs ESTs Hs.323484 W58375 0.242129 Solute carrier family 2 (facilitated glucose transporter), member 1 SLC2A1 Hs.169902 H50481 0.242129 Dishevelled associated activator of morphogenesis 2 DAAM2 Hs.100113 T49898 0.242129 Bladder cancer associated protein BLCAP Hs.5300 H08978 0.242129 Calcium channel, voltage-dependent, beta 3 subunit CACNB3 Hs.250712 R62439 0.242129 - -- N20501 0.242129 Bioref bioref Hs.5638 N30140 0.242129 Protein kinase, AMP-activated, gamma 1 non-catalytic subunit PRKAG1 Hs.3136 H26200 0.242129 - - Hs.121001 N31721 0.242129 DKFZP434N161 protein DKFZP434N161 Hs.284208 N95811 0.242129 Williams Beuren syndrome chromosome region 22 WBSCR22 Hs.155020 N91148 0.242129 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184 W48875 0.242129 Ras association (RalGDS/AF-6) domain family 1 RASSF1 Hs.26931 AA063424 0.242129 DKFZP586D0623 protein DKFZP586D0623 Hs.44468 W96076 0.242129 Immediate early protein ETR101 Hs.737 H80498 0.242129 KIAA0286 protein KIAA0286 Hs.14912 R36523 0.242129 Neuropilin 2 NRP2 Hs.17778 R40176 0.242129 Chemokine (C-X-C motif) ligand 14 CXCL14 Hs.24395 T78823 0.242129 Hypothetical protein MGC5149 MGC5149 Hs.284741 N72764 0.242129 - -- R05889 0.242129 Chromosome 1 open reading frame 2 C1orf2 Hs.19554 R17839 0.250564 Wolf-Hirschhorn syndrome candidate 2 WHSC2 Hs.21771 R56392 0.250564 Discoidin domain receptor family, member 1 DDR1 Hs.75562 R86128 0.250564 Nucleoporin-like protein 1 NLP_1 Hs.168352 N92370 0.250564 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nucle PCBD Hs.3192 T72626 0.250564 Hypothetical protein DJ971N18.2 DJ971N18.2 Hs.169358 W57953 0.250564 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650 W79028 0.250564 Ribulose-5-phosphate-3-epimerase RPE Hs.125845 N95578 0.250564 - - Hs.5855 R46262 0.250564 Hypothetical protein MGC17515 MGC17515 Hs.350549 N66238 0.250564 Matrix metalloproteinase 19 MMP19 Hs.154057 H98614 0.250564 Zinc finger homeobox 1b ZFHX1B Hs.34871 R51840 0.250564 - -- T86358 0.250564 - - Hs.193931 N33745 0.250564 KIAA0841 protein KIAA0841 Hs.7426 W67706 0.250564 Natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receNPR2 Hs.78518 H90918 0.250564 KIAA0368 protein KIAA0368 Hs.3852 AA193264 0.250564 ESTs ESTs Hs.85875 R14520 0.250564 ESTs ESTs Hs.137129 H09002 0.250564 ESTs ESTs Hs.170267 H80753 0.250564 Chromodomain helicase DNA binding protein 1 CHD1 Hs.22670 R14308 0.250564 - - Hs.107242 W74647 0.250564 Melanoma inhibitory activity MIA Hs.279651 H87311 0.250564 Excision repair cross-complementing rodent repair deficiency, complementationERCC1 Hs.59544 H21773 0.250564 - - Hs.31845 R85666 0.250564 KIAA1634 protein KIAA1634 Hs.49169 W73717 0.250564 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650 N76007 0.250564 - - Hs.141648 H03490 0.250564 Hypothetical protein FLJ10563 FLJ10563 Hs.265960 R76214 0.250564 Protocadherin 16 dachsous-like (Drosophila) PCDH16 Hs.9658 R40254 0.250564 Hypothetical protein DKFZp434L0718 DKFZP434L0718 Hs.59236 N95462 0.250564 ATP-binding cassette, sub-family F (GCN20), member 2 ABCF2 Hs.153612 W39284 0.250564 Pumilio homolog 1 (Drosophila) PUM1 Hs.153834 AA203686 0.250564 Retinoid X receptor, alpha RXRA Hs.20084 N33201 0.250564 Cullin 4B CUL4B Hs.155976 N23380 0.250564 Hypothetical protein MGC33602 MGC33602 Hs.274415 H00122 0.250564 - -- R25107 0.250564 Protein phosphatase methylesterase-1 PME-1 Hs.63304 H83025 0.250564 ESTs ESTs Hs.151692 H59215 0.250564 Solute carrier family 25, member 13 (citrin) SLC25A13 Hs.9599 H83024 0.250564 Phosphatidylethanolamine N-methyltransferase PEMT Hs.15192 AA029848 0.250564 Excision repair cross-complementing rodent repair deficiency, complementationERCC5 Hs.48576 R12039 0.250564 Chromosome 21 open reading frame 108 C21orf108 Hs.18759 H06405 0.259203 PCTAIRE protein kinase 1 PCTK1 Hs.171834 R20008 0.259203 N-acetylglucosaminidase, alpha- (Sanfilippo disease IIIB) NAGLU Hs.50727 R52542 0.259203 IMP (inosine monophosphate) dehydrogenase 1 IMPDH1 Hs.850 AA055757 0.259203 Cysteine and glycine-rich protein 2 CSRP2 Hs.10526 T78200 0.259203 Hypothetical protein HSPC213 HSPC213 Hs.170219 AA007570 0.259203 KIAA0682 gene product KIAA0682 Hs.7482 R45617 0.259203 DNA segment, single copy probe LNS-CAI/LNS-CAII (deleted in polyposis D5S346 Hs.178112 H89834 0.259203 Hypothetical protein BC000919 LOC90736 Hs.33020 R54426 0.259203 - - Hs.96716 H51684 0.259203 PDZ domain protein (Drosophila inaD-like) INADL Hs.321197 R46328 0.259203 Trinucleotide repeat containing 5 TNRC5 Hs.56828 W45590 0.259203 Old astrocyte specifically induced substance OASIS Hs.13456 N20310 0.259203 - -- W21078 0.259203 Exosome component Rrp46 RRP46 Hs.283741 AA043365 0.259203 Origin recognition complex, subunit 4-like (yeast) ORC4L Hs.55055 R59448 0.259203 Aryl hydrocarbon receptor nuclear translocator-like ARNTL Hs.74515 N90789 0.259203 Membrane component, chromosome 11, surface marker 1 M11S1 Hs.278672 H85554 0.259203 V-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog KRAS2 Hs.351221 H09565 0.259203 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, g YWHAG Hs.25001 AA026571 0.259203 Hypothetical protein FLJ21415 FLJ21415 Hs.120170 H03878 0.259203 Eukaryotic translation initiation factor 4 gamma, 2 EIF4G2 Hs.183684 H10393 0.259203 Hypothetical protein FLJ13117 FLJ13117 Hs.152982 T79536 0.259203 - -- AA055314 0.259203 RAB14, member RAS oncogene family RAB14 Hs.5807 AA136693 0.259203 Homolog of C. elegans smu-1 SMU-1 Hs.193128 N90030 0.259203 - -- R54777 0.259203 - - Hs.374908 R45200 0.259203 YME1-like 1 (S. cerevisiae) YME1L1 Hs.206521 R22904 0.259203 8D6 antigen 8D6A Hs.106196 N25253 0.259203 Chromosome 5 open reading frame 8 C5orf8 Hs.75864 N26104 0.259203 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamin OGT Hs.100293 R54424 0.259203 Glutamate dehydrogenase 1 GLUD1 Hs.77508 N41933 0.259203 KIAA0409 protein KIAA0409 Hs.5158 N74019 0.259203 KIAA0265 protein KIAA0265 Hs.192966 H77633 0.259203 Polymerase (RNA) II (DNA directed) polypeptide B, 140kDa POLR2B Hs.296014 R24223 0.259203 Hypothetical protein FLJ21069 FLJ21069 Hs.341806 AA004785 0.259203 Annexin A5 ANXA5 Hs.300711 AA047380 0.259203 Like-glycosyltransferase LARGE Hs.25220 H11708 0.259203 Mitogen-activated protein kinase kinase 4 MAP2K4 Hs.75217 W78864 0.259203 Mouse Mammary Turmor Virus Receptor homolog 1 MTVR1 Hs.18686 AA047640 0.259203 Dolichyl-phosphate mannosyltransferase polypeptide 3 DPM3 Hs.110477 N64620 0.259203 Ribosomal protein S6 kinase, 90kDa, polypeptide 2 RPS6KA2 Hs.301664 R73412 0.259203 NS1-associated protein 1 NSAP1 Hs.46801 N46171 0.259203 Hypothetical protein FLJ32001 FLJ32001 Hs.288742 W85843 0.259203 - - Hs.101282 W78924 0.259203 HSPC142 protein HSPC142 Hs.6468 AA046861 0.259203 Procollagen C-endopeptidase enhancer PCOLCE Hs.202097 H05551 0.259203 Hypothetical protein FLJ34231 FLJ34231 Hs.30503 R60752 0.259203 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme QNDUFS1 Hs.8248 AA045904 0.259203 6-pyruvoyltetrahydropterin synthase PTS Hs.366 W93024 0.259203 - - Hs.373695 T98615 0.268045 Mitogen-activated protein kinase kinase kinase 10 MAP3K10 Hs.30223 R77347 0.268045 Peptidyl-prolyl isomerase G (cyclophilin G) PPIG Hs.77965 R02587 0.268045 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ACTR1A Hs.153961 H17385 0.268045 Hypothetical protein DKFZp564D1378 DKFZP564D1378 Hs.318401 N31736 0.268045 Hypothetical protein FLJ25211 FLJ25211 Hs.44269 W47352 0.268045 Ribosomal protein S6 kinase, 70kDa, polypeptide 2 RPS6KB2 Hs.103081 H95277 0.268045 - - Hs.16773 H16519 0.268045 Dolichyl-diphosphooligosaccharide-protein glycosyltransferase DDOST Hs.34789 AA045668 0.268045 TRIAD3 protein TRIAD3 Hs.86228 AA041347 0.268045 Hypothetical protein FLJ13984 FLJ13984 Hs.135146 H09771 0.268045 - -- N72697 0.268045 Hypothetical protein FLJ10604 FLJ10604 Hs.26516 N93365 0.268045 Chromosome 21 open reading frame 2 C21orf2 Hs.153452 H87034 0.268045 Bicaudal D homolog 1 (Drosophila) BICD1 Hs.164975 N95771 0.268045 - - Hs.42173 AA121538 0.268045 Homer, neuronal immediate early gene, 3 HOMER-3 Hs.166146 W56877 0.268045 Up-regulated in liver cancer 1 UPLC1 Hs.44579 AA029810 0.268045 - - Hs.79531 AA035055 0.268045 - - Hs.374400 H07105 0.268045 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 DYRK2 Hs.173135 AA128128 0.268045 V-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 YES1 Hs.194148 R39199 0.268045 Notch homolog 2 (Drosophila) NOTCH2 Hs.8121 H43652 0.268045 Conserved gene telomeric to alpha globin cluster CGTHBA Hs.19699 W58197 0.268045 Amyloid beta (A4) precursor-like protein 2 APLP2 Hs.279518 AA035766 0.268045 Spermidine/spermine N1-acetyltransferase SAT Hs.28491 R31309 0.268045 MAP-kinase activating death domain MADD Hs.82548 N47551 0.268045 - -- AA010057 0.268045 Thyroid hormone receptor interactor 11 TRIP11 Hs.85092 R89136 0.268045 - -- R51281 0.268045 Anaphase-promoting complex 1; meiotic checkpoint regulator MCPR Hs.40137 AA043061 0.268045 - - Hs.352417 AA004997 0.268045 Thyroid hormone receptor-associated protein (100 kDa) TRAP100 Hs.23106 AA147549 0.268045 KIAA1999 protein KIAA1999 Hs.9343 AA056558 0.268045 Tight junction protein 2 (zona occludens 2) TJP2 Hs.75608 N93133 0.268045 Promyelocytic leukemia PML Hs.89633 W88496 0.268045 Zizimin1 zizimin1 Hs.8021 R74161 0.268045 Phosphorylase, glycogen; liver (Hers disease, glycogen storage disease type VPYGL Hs.771 AA152304 0.268045 ADP-ribosylation factor 3 ARF3 Hs.119177 R91365 0.268045 G protein-coupled receptor kinase-interactor 2 GIT2 Hs.57734 AA129720 0.268045 - - Hs.286241 R80595 0.268045 - - Hs.177781 N44917 0.268045 - - Hs.324504 H93017 0.268045 Enoyl Coenzyme A hydratase 1, peroxisomal ECH1 Hs.196176 N76065 0.268045 Mitochondrial ribosomal protein S35 MRPS35 Hs.10724 N45464 0.268045 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, suSMARCAL1 Hs.16933 AA053145 0.268045 Coronin, actin binding protein, 1C CORO1C Hs.17377 AA142967 0.268045 Uncharacterized hematopoietic stem/progenitor cells protein MDS029 MDS029 Hs.43549 N27463 0.268045 CCAAT-box-binding transcription factor CBF2 Hs.184760 H39920 0.268045 - -- AA098888 0.268045 Eukaryotic translation termination factor 1 ETF1 Hs.77324 N53948 0.268045 - - Hs.176686 N48162 0.268045 P53-regulated DDA3 DDA3 Hs.77550 N42184 0.268045 Hypothetical protein BC013073 LOC92703 Hs.17481 R62209 0.268045 - - Hs.120785 R65635 0.277093 - - Hs.130352 AA039598 0.277093 Ribosomal protein S6 kinase, 90kDa, polypeptide 1 RPS6KA1 Hs.149957 R13125 0.277093 Similar to CG4995 gene product LOC153328 Hs.129539 H79753 0.277093 Death-associated protein DAP Hs.75189 R31564 0.277093 Prenylcysteine lyase PCL1 Hs.278627 H66475 0.277093 Homolog of rat nadrin RICH1 Hs.14169 AA047407 0.277093 KIAA1600 protein KIAA1600 Hs.192619 W02086 0.277093 Sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinSMPD2 Hs.55235 W60936 0.277093 Tripartite motif-containing 8 TRIM8 Hs.54580 N74625 0.277093 - -- N94608 0.277093 Interferon gamma receptor 2 (interferon gamma transducer 1) IFNGR2 Hs.177559 T80623 0.277093 - -- W55890 0.277093 RNA processing factor 1 RPF1 Hs.287863 H17401 0.277093 Hypothetical protein HSPC232 HSPC232 Hs.281428 AA029590 0.277093 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) NHP2L1 Hs.182255 T79552 0.277093 ESTs ESTs Hs.14585 H52061 0.277093 Hypothetical protein FLJ22313 FLJ22313 Hs.30211 T77325 0.277093 Polycystic kidney disease 2 (autosomal dominant) PKD2 Hs.82001 R76349 0.277093 Ran binding protein 11 LOC51194 Hs.13109 T97533 0.277093 ESTs ESTs Hs.193125 R14307 0.277093 Low density lipoprotein receptor-related protein 4 LRP4 Hs.4930 N34756 0.277093 Sorting nexin 4 SNX4 Hs.267812 W32998 0.277093 - - Hs.355841 R98094 0.277093 2,3-bisphosphoglycerate mutase BPGM Hs.198365 N24941 0.277093 - - Hs.20274 AA142968 0.277093 NS1-associated protein 1 NSAP1 Hs.46801 AA046891 0.277093 Defender against cell death 1 DAD1 Hs.82890 H14838 0.277093 Defender against cell death 1 DAD1 Hs.82890 AA043477 0.277093 Zinc finger protein 36, C3H type, homolog (mouse) ZFP36 Hs.343586 R55277 0.277093 KIAA1143 protein KIAA1143 Hs.173042 N49523 0.277093 DKFZP434C128 protein DKFZP434C128 Hs.222909 W85949 0.277093 - - Hs.339808 N39021 0.277093 Solute carrier family 20 (phosphate transporter), member 1 SLC20A1 Hs.78452 R43082 0.277093 - - Hs.41974 R73076 0.277093 - - Hs.356356 H11043 0.277093 Kinesin family member 3B KIF3B Hs.301206 H17492 0.277093 DnaJ (Hsp40) homolog, subfamily B, member 2 DNAJB2 Hs.77768 N39932 0.277093 Small protein effector 1 of Cdc42 SPEC1 Hs.22065 H75530 0.277093 V-crk sarcoma virus CT10 oncogene homolog (avian) CRK Hs.343220 N39954 0.277093 - - Hs.109012 T77765 0.277093 Nudix (nucleoside diphosphate linked moiety X)-type motif 2 NUDT2 Hs.14142 AA036798 0.277093 - - Hs.339024 N75204 0.277093 - - Hs.107410 W74536 0.277093 Advanced glycosylation end product-specific receptor AGER Hs.184 H55914 0.277093 - -- R24623 0.277093 ATPase, H+ transporting, lysosomal interacting protein 2 ATP6IP2 Hs.183434 AA053007 0.277093 Putative receptor protein PMI Hs.15196 H50403 0.277093 Hypothetical protein FLJ20793 FLJ20793 Hs.96900 H23410 0.286347 CGG triplet repeat binding protein 1 CGGBP1 Hs.86041 H14478 0.286347 Seven in absentia homolog 1 (Drosophila) SIAH1 Hs.295923 T51729 0.286347 Regulator of G-protein signalling 14 RGS14 Hs.9347 N98535 0.286347 Chromosome 20 open reading frame 7 C20orf7 Hs.44296 R49516 0.286347 ESTs ESTs Hs.6653 W38442 0.286347 Acidic 82 kDa protein mRNA HSU15552 Hs.85769 R71483 0.286347 Transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) TFAP2A Hs.334334 AA121519 0.286347 - -- R50868 0.286347 Hypothetical protein FLJ23861 FLJ23861 Hs.380669 H15871 0.286347 Nicotinamide nucleotide transhydrogenase NNT Hs.18136 AA045063 0.286347 Presenilin 2 (Alzheimer disease 4) PSEN2 Hs.25363 N78857 0.286347 - - Hs.82171 H56935 0.286347 Hypothetical protein MGC32124 MGC32124 Hs.284163 H41939 0.286347 Discoidin domain receptor family, member 1 DDR1 Hs.75562 R84594 0.286347 Suppressor of G2 allele of SKP1, S. cerevisiae, homolog of SGT1 Hs.5169 R66559 0.286347 Nuclear receptor binding factor-2 NRBF-2 Hs.27181 R32376 0.286347 Syntaxin 3A STX3A Hs.82240 AA028073 0.286347 - -- N47180 0.286347 Membrane interacting protein of RGS16 MIR16 Hs.107014 AA054447 0.286347 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318 H39162 0.286347 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltranAGPAT1 Hs.240534 W38759 0.286347 - - Hs.356739 AA047337 0.286347 TATA element modulatory factor 1 TMF1 Hs.267632 N63013 0.286347 Hypothetical protein FLJ13194 FLJ13194 Hs.288932 AA040149 0.286347 - - Hs.348989 T74342 0.286347 - -- AA146955 0.286347 Hypothetical protein FLJ20519 FLJ20519 Hs.79457 R47801 0.286347 Protein inhibitor of activated STAT3 PIAS3 Hs.76578 R37031 0.286347 G protein-coupled receptor 108 GPR108 Hs.167641 T76961 0.286347 ESTs ESTs Hs.268586 AA128013 0.286347 - - Hs.261335 AA046086 0.286347 CDC-like kinase 1 CLK1 Hs.2083 W56088 0.286347 Ethanolamine kinase EKI1 Hs.120439 R13742 0.286347 - -- AA132039 0.286347 - - Hs.43266 T87998 0.286347 ESTs ESTs Hs.16414 T95320 0.286347 ESTs ESTs Hs.90953 AA045109 0.286347 Chromosome 7 open reading frame 11 C7orf11 Hs.66666 W93379 0.286347 NIMA (never in mitosis gene a)-related kinase 2 NEK2 Hs.153704 H16710 0.286347 G protein-coupled receptor kinase 6 GPRK6 Hs.76297 R76505 0.286347 - - Hs.325825 H73971 0.286347 ESTs ESTs Hs.53455 R07576 0.286347 L(3)mbt-like (Drosophila) L3MBTL Hs.119021 H91044 0.286347 Mitogen-activated protein kinase phosphatase x MKPX Hs.29106 H83363 0.286347 Translocase of inner mitochondrial membrane 10 homolog (yeast) TIMM10 Hs.355993 AA115252 0.286347 ESTs ESTs Hs.28805 N55283 0.286347 KIAA0469 gene product KIAA0469 Hs.7764 T95061 0.286347 Matrix metalloproteinase 19 MMP19 Hs.154057 AA034109 0.286347 Misshapen/NIK-related kinase MINK Hs.112028 R83247 0.286347 Galactosidase, beta 1 GLB1 Hs.79222 H44375 0.286347 Regulatory factor X-associated ankyrin-containing protein RFXANK Hs.296776 W15154 0.286347 - -- N47456 0.295807 KH domain containing, RNA binding, signal transduction associated 1 KHDRBS1 Hs.119537 N54113 0.295807 Progesterone receptor membrane component 1 PGRMC1 Hs.90061 H04791 0.295807 ESTs ESTs Hs.26490 R36627 0.295807 POU transcription factor 10/11/2002 Hs.227115 AA128271 0.295807 Regulatory factor X, 5 (influences HLA class II expression) RFX5 Hs.166891 AA053322 0.295807 - -- H85213 0.295807 - - Hs.30909 R34766 0.295807 Dipeptidylpeptidase III DPP3 Hs.22880 W81033 0.295807 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 SULT1A3 Hs.274614 N73879 0.295807 - - Hs.109553 N42666 0.295807 Preimplantation protein 3 PREI3 Hs.107942 R12730 0.295807 Ocular development-associated gene ODAG Hs.21145 H77593 0.295807 CDA017 protein CDA017 Hs.39780 H47934 0.295807 Hypothetical protein MGC12760 MGC12760 Hs.333402 R59435 0.295807 HCCA2 protein HCCA2 Hs.19223 H02290 0.295807 SEC10-like 1 (S. cerevisiae) SEC10L1 Hs.29494 R93690 0.295807 Hydroxysteroid (17-beta) dehydrogenase 4 HSD17B4 Hs.75441 W04643 0.295807 Solute carrier family 17 (anion/sugar transporter), member 5 SLC17A5 Hs.117865 AA036785 0.295807 N-myristoyltransferase 2 NMT2 Hs.122647 T66763 0.295807 Hypothetical protein MGC4276 similar to CG8198 MGC4276 Hs.177776 T78441 0.295807 KIAA0553 protein KIAA0553 Hs.105749 N70274 0.295807 CGI-87 protein LOC51112 Hs.5008 R21785 0.295807 Nucleoporin 155kDa NUP155 Hs.23255 T84742 0.295807 Prenylcysteine lyase PCL1 Hs.278627 AA041284 0.295807 GDP dissociation inhibitor 1 GDI1 Hs.74576 AA135742 0.295807 ESTs ESTs Hs.270798 R18790 0.295807 - -- N63584 0.295807 Topoisomerase (DNA) II beta 180kDa TOP2B Hs.75248 N66546 0.295807 KIAA0355 gene product KIAA0355 Hs.186840 T78696 0.295807 GS3955 protein GS3955 Hs.155418 N34887 0.295807 Ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, AngUBE3A Hs.180686 AA053216 0.295807 Zinc finger protein 363 ZNF363 Hs.48297 AA026235 0.295807 - - Hs.31447 AA193346 0.295807 Phosphatidylinositol glycan, class S PIGS Hs.347950 T86348 0.295807 Glycine amidinotransferase (L-arginine:glycine amidinotransferase) GATM Hs.75335 R50246 0.295807 - - Hs.351469 T78280 0.295807 Histone acetyltransferase 1 HAT1 Hs.13340 N71361 0.295807 ESTs ESTs Hs.50019 AA099441 0.295807 Nucleobindin 1 NUCB1 Hs.172609 W32102 0.295807 UDP-glucose pyrophosphorylase 2 UGP2 Hs.77837 N72995 0.295807 Neuroblastoma, suppression of tumorigenicity 1 NBL1 Hs.76307 R50524 0.305474 Ferritin, heavy polypeptide 1 FTH1 Hs.62954 W03006 0.305474 Myristoylated alanine-rich protein kinase C substrate MARCKS Hs.75607 N73090 0.305474 Homolog of yeast MAF1 MAF1 Hs.324157 AA031625 0.305474 S-adenosylhomocysteine hydrolase AHCY Hs.172673 H88463 0.305474 Lysophospholipase I LYPLA1 Hs.12540 R37666 0.305474 Radical fringe homolog (Drosophila) RFNG Hs.12862 W90163 0.305474 RA-regulated nuclear matrix-associated protein RAMP Hs.126774 T91994 0.305474 - - Hs.188626 H89655 0.305474 Hypothetical protein FLJ10607 similar to glucosamine-phosphate N-acetyltransFLJ10607 Hs.27931 AA056174 0.305474 KIAA0082 protein KIAA0082 Hs.154045 H69011 0.305474 SKI-like SKIL Hs.38783 N25612 0.305474 Papillomavirus regulatory factor PRF-1 LOC55893 Hs.27410 H77636 0.305474 CD68 antigen CD68 Hs.246381 R13362 0.305474 - - Hs.262716 AA034352 0.305474 MADS box transcription enhancer factor 2, polypeptide A (myocyte enhancer faMEF2A Hs.182280 W32115 0.305474 Cryptochrome 1 (photolyase-like) CRY1 Hs.151573 H40871 0.305474 Hypothetical protein MGC30022 MGC30022 Hs.179852 H78287 0.305474 Myosin ID MYO1D Hs.39871 R93296 0.305474 - -- R62468 0.305474 Small nuclear RNA activating complex, polypeptide 2, 45kDa SNAPC2 Hs.78403 R48777 0.305474 S100 calcium binding protein A1 S100A1 Hs.292707 R42554 0.305474 T-box, brain, 1 TBR1 Hs.210862 H89477 0.305474 Cyclin D3 CCND3 Hs.83173 AA059201 0.305474 Ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) UBE2E3 Hs.4890 AA053137 0.305474 Nasopharyngeal carcinoma susceptibility protein LZ16 Hs.42390 R93707 0.305474 Calmodulin 1 (phosphorylase kinase, delta) CALM1 Hs.177656 R54993 0.305474 Chromosome 20 open reading frame 167 C20orf167 Hs.26213 AA055863 0.305474 Cytoskeleton-associated protein 4 CKAP4 Hs.74368 R89061 0.305474 Hypothetical protein MGC12909 MGC12909 Hs.33862 AA005168 0.305474 Zinc finger protein 7 (KOX 4, clone HF.16) ZNF7 Hs.2076 R19512 0.305474 Regulator of G-protein signalling 19 RGS19 Hs.22698 N63830 0.305474 - - Hs.6127 T84669 0.305474 HP1-BP74 HP1-BP74 Hs.142442 AA056394 0.305474 Carbonic anhydrase IX CA9 Hs.63287 R64104 0.305474 - -- N58885 0.305474 - -- AA151396 0.305474 Poly(A) binding protein, nuclear 1 PABPN1 Hs.117176 H14471 0.305474 MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (SMCM6 Hs.155462 AA058815 0.305474 Hypothetical protein BC000919 LOC90736 Hs.33020 AA005070 0.305474 Hypothetical protein FLJ10890 FLJ10890 Hs.17283 N69471 0.305474 Protein phosphatase 1, regulatory (inhibitor) subunit 11 PPP1R11 Hs.82887 AA203238 0.305474 GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome) GLI3 Hs.72916 AA043201 0.305474 - - Hs.179891 W23575 0.305474 Phosphofructokinase, platelet PFKP Hs.99910 H30688 0.305474 - -- W47547 0.305474 Adenylate cyclase 9 ADCY9 Hs.20196 W39129 0.305474 Nucleobindin 1 NUCB1 Hs.172609 AA055106 0.305474 Crystallin, zeta (quinone reductase)-like 1 CRYZL1 Hs.330208 N44670 0.305474 Growth arrest-specific 6 GAS6 Hs.78501 H92968 0.305474 - -- N29889 0.305474 UBX domain containing 2 UBXD2 Hs.77495 AA054486 0.305474 V-raf-1 murine leukemia viral oncogene homolog 1 RAF1 Hs.349650 H90824 0.305474 Sec23 homolog A (S. cerevisiae) SEC23A Hs.272927 R43963 0.315348 Hypothetical protein DKFZp761A052 DKFZp761A052 Hs.184029 W93096 0.315348 - -- W93648 0.315348 CD47 antigen (Rh-related antigen, integrin-associated signal transducer) CD47 Hs.82685 R71145 0.315348 KIAA1577 protein KIAA1577 Hs.13913 AA044646 0.315348 HSPC126 protein HSPC126 Hs.181112 T74721 0.315348 ZYG homolog ZYG Hs.29285 T70285 0.315348 - - Hs.271940 AA045457 0.315348 - - Hs.288862 H28138 0.315348 HLA-B associated transcript 1 BAT1 Hs.55296 W37617 0.315348 Transmembrane 7 superfamily member 1 (upregulated in kidney) TM7SF1 Hs.15791 N28908 0.315348 - - Hs.356659 R85053 0.315348 Glucosidase, beta; acid (includes glucosylceramidase) GBA Hs.282997 N25817 0.315348 Spermidine/spermine N1-acetyltransferase SAT Hs.28491 N95821 0.315348 KIAA0768 protein LEC3 Hs.21917 R56270 0.315348 - - Hs.4817 R67127 0.315348 Hypothetical protein FLJ12666 FLJ12666 Hs.23767 R09420 0.315348 Hypothetical protein FLJ20397 FLJ20397 Hs.272688 R56276 0.315348 - -- H97415 0.315348 TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated TAF6L Hs.131846 R78728 0.315348 Kelch-like 5 (Drosophila) KLHL5 Hs.272239 N74713 0.315348 - -- N58114 0.315348 E2F transcription factor 4, p107/p130-binding E2F4 Hs.108371 R34109 0.315348 Mitochondrial ribosomal protein L18 MRPL18 Hs.23038 H62271 0.315348 D11lgp1e-like LGP1 Hs.38039 W47105 0.315348 ELL-related RNA polymerase II, elongation factor ELL2 Hs.98124 AA150731 0.315348 - - Hs.374418 H03079 0.315348 Hypothetical protein FLJ21156 FLJ21156 Hs.26058 H94111 0.315348 Tyrosylprotein sulfotransferase 2 TPST2 Hs.26350 N92087 0.315348 Cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphaCDKN3 Hs.84113 AA134115 0.315348 Sphingosine-1-phosphate lyase 1 SGPL1 Hs.186613 T39635 0.315348 ESTs ESTs Hs.345204 W60229 0.315348 Hypothetical protein FLJ20093 FLJ20093 Hs.172572 N43796 0.315348 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876 H53894 0.315348 Cyclin D-type binding-protein 1 CCNDBP1 Hs.36794 W06829 0.315348 - - Hs.356718 H81847 0.315348 Calpain 3, (p94) CAPN3 Hs.40300 AA135667 0.315348 Early development regulator 2 (polyhomeotic 2 homolog) EDR2 Hs.165263 R78183 0.315348 Pre-B-cell leukemia transcription factor 2 PBX2 Hs.93728 H00554 0.315348 Putative G-protein coupled receptor GPCR41 FLJ11856 Hs.6459 AA016242 0.315348 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965 R32925 0.315348 - -- AA009678 0.315348 - -- R59179 0.315348 Nucleolar protein 3 (apoptosis repressor with CARD domain) NOL3 Hs.278439 AA045670 0.315348 Cell division cycle 34 CDC34 Hs.76932 N62491 0.315348 Folate hydrolase (prostate-specific membrane antigen) 1 FOLH1 Hs.1915 N68522 0.315348 Transforming growth factor, beta 3 TGFB3 Hs.2025 N90643 0.315348 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigMCP Hs.83532 AA055457 0.315348 Down syndrome critical region gene 2 DSCR2 Hs.5198 AA045637 0.315348 Ubiquinol-cytochrome c reductase (6.4kD) subunit UQCR Hs.8372 N29455 0.315348 - -- T87794 0.315348 - -- N70759 0.315348 Zinc-finger protein DZIP1 DZIP1 Hs.60177 H75274 0.315348 Solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 Hs.323878 N56633 0.315348 Syntaxin 12 STX12 Hs.106823 H56686 0.315348 Serine/arginine repetitive matrix 1 SRRM1 Hs.18192 R22600 0.315348 Testis enhanced gene transcript (BAX inhibitor 1) TEGT Hs.74637 R18621 0.315348 - -- AA203625 0.315348 Vacuolar protein sorting 4A (yeast) VPS4A Hs.234839 R77520 0.32543 Mannose-P-dolichol utilization defect 1 MPDU1 Hs.6710 H47495 0.32543 Hypothetical protein MGC15504 MGC15504 Hs.13810 N64639 0.32543 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) DUSP3 Hs.181046 N25320 0.32543 Ceroid-lipofuscinosis, neuronal 6, late infantile, variant CLN6 Hs.43654 N95545 0.32543 Interleukin 11 IL11 Hs.1721 R68381 0.32543 - -- R11709 0.32543 Fatty-acid-Coenzyme A ligase, long-chain 6 FACL6 Hs.14945 H67348 0.32543 - - Hs.61976 R15336 0.32543 KIAA0673 protein KIAA0673 Hs.106487 W38635 0.32543 Protein kinase C substrate 80K-H PRKCSH Hs.1432 AA056554 0.32543 Cold shock domain protein A CSDA Hs.198726 T87973 0.32543 - - Hs.332988 N51196 0.32543 - -- R61690 0.32543 Chondroitin sulfate proteoglycan 4 (melanoma-associated) CSPG4 Hs.9004 AA215407 0.32543 - - Hs.349755 N95418 0.32543 FK506 binding protein 8, 38kDa FKBP8 Hs.173464 T80795 0.32543 - -- R34261 0.32543 Solute carrier family 5 (sodium-dependent vitamin transporter), member 6 SLC5A6 Hs.321579 R34626 0.32543 ESTs ESTs Hs.6795 R35358 0.32543 Hypothetical protein FLJ20011 FLJ20011 Hs.334647 T66786 0.32543 ESTs ESTs Hs.12941 R23189 0.32543 ESTs ESTs Hs.172610 AA130098 0.32543 - - Hs.44829 N79378 0.32543 ESTs ESTs Hs.126688 R32384 0.32543 Deoxyribonuclease I-like 1 DNASE1L1 Hs.77091 N94471 0.32543 Small membrane protein 1 SMP1 Hs.107979 AA035651 0.32543 ESTs ESTs Hs.143813 N27996 0.32543 Hypothetical protein MGC26818 MGC26818 Hs.23765 R88696 0.32543 Sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-aceSIAT7D Hs.3972 AA213556 0.32543 - -- R60613 0.32543 General transcription factor II, i GTF2I Hs.278589 R51348 0.32543 - -- W16436 0.32543 Protein kinase (cAMP-dependent, catalytic) inhibitor gamma PKIG Hs.3407 AA053851 0.32543 ESTs ESTs Hs.63063 W30745 0.32543 Hypothetical protein DJ159A19.3 DJ159A19.3 Hs.10700 W86198 0.32543 Yeast Sec31p homolog KIAA0905 Hs.70266 T80249 0.32543 Carnitine deficiency-associated gene expressed in ventricle 1 CDV-1 Hs.333120 H74279 0.32543 Hypothetical protein DKFZp547B1713 DKFZp547B1713 Hs.349262 W49768 0.32543 Interferon, alpha-inducible protein (clone IFI-6-16) G1P3 Hs.265827 R25543 0.32543 - - Hs.23133 N41715 0.32543 Hypothetical protein FLJ11294 FLJ11294 Hs.107000 N90250 0.32543 ESTs ESTs Hs.94881 R56622 0.32543 ESTs ESTs Hs.274728 AA039526 0.32543 Rabconnectin-3 RC3 Hs.13264 N90844 0.32543 Alcohol dehydrogenase 5 (class III), chi polypeptide ADH5 Hs.78989 H80760 0.32543 Hypothetical protein BM-009 BM-009 Hs.92918 H18154 0.32543 RAB5B, member RAS oncogene family RAB5B Hs.77690 W23773 0.32543 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) BAP1 Hs.106674 T99087 0.32543 5-methyltetrahydrofolate-homocysteine methyltransferase MTR Hs.82283 T85855 0.32543 Hypothetical protein FLJ10209 FLJ10209 Hs.58589 R36970 0.32543 Sec22 homolog SEC22A Hs.183655 N62381 0.32543 Fring LOC117584 Hs.172694 W25036 0.32543 Hypothetical protein BC009925 LOC113246 Hs.9634 T89040 0.32543 CDw92 antigen CDW92 Hs.179902 AA057305 0.32543 - -- AA131302 0.32543 - - Hs.71404 N47249 0.32543 - - Hs.28264 AA102088 0.32543 Tripartite motif-containing 37 TRIM37 Hs.8164 R64704 0.32543 Placental protein 13-like protein PPL13 Hs.24236 R05370 0.32543 - - Hs.233290 H20185 0.32543 Hypothetical protein CAB56184 CAB56184 Hs.241575 H68976 0.32543 - - Hs.375009 AA027815 0.32543 KIAA1311 protein KIAA1311 Hs.61441 W32961 0.32543 ESTs ESTs Hs.271125 H99854 0.32543 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428 W85877 0.335719 PR/SET domain containing protein 07 SET07 Hs.111988 N31736 0.335719 Hypothetical protein FLJ25211 FLJ25211 Hs.44269 N98550 0.335719 TRAM-like protein KIAA0057 Hs.153954 N95539 0.335719 Hypothetical protein BC001563 LOC123016 Hs.55158 H27334 0.335719 Discoidin domain receptor family, member 1 DDR1 Hs.75562 R91253 0.335719 ESTs ESTs Hs.34395 H04946 0.335719 Cytochrome c oxidase subunit Va COX5A Hs.323834 N29771 0.335719 Three prime repair exonuclease 2 TREX2 Hs.251398 T78019 0.335719 - - Hs.5461 W67427 0.335719 Prolylcarboxypeptidase (angiotensinase C) PRCP Hs.75693 T54522 0.335719 Breast cancer metastasis-suppressor 1 BRMS1 Hs.100426 N75343 0.335719 Polymerase (DNA directed), delta 2, regulatory subunit 50kDa POLD2 Hs.74598 N95603 0.335719 Excision repair cross-complementing rodent repair deficiency, complementationERCC3 Hs.77929 T76974 0.335719 Protein x 0004 LOC51184 Hs.284164 N30185 0.335719 Hypothetical protein FLJ11252 FLJ11252 Hs.23495 H63676 0.335719 Optic atrophy 1 (autosomal dominant) OPA1 Hs.147946 N43952 0.335719 - - Hs.236443 N33089 0.335719 CGI-128 protein LOC51647 Hs.9825 H18273 0.335719 Bernardinelli-Seip congenital lipodystrophy 2 (seipin) BSCL2 Hs.293981 R98462 0.335719 Likely ortholog of mouse Abl-philin 2 APH2 Hs.76662 N63416 0.335719 - - Hs.82719 N51465 0.335719 ESTs ESTs Hs.46476 N78331 0.335719 Activator of basal transcription 1 ABT1 Hs.109428 AA132089 0.335719 Hypothetical protein FLJ20522 FLJ20522 Hs.35406 AA055220 0.335719 Cell death regulator aven LOC57099 Hs.63168 W47502 0.335719 Alpha glucosidase II alpha subunit G2AN Hs.76847 R75956 0.335719 Chromosome 22 open reading frame 2 C22orf2 Hs.227637 R71650 0.335719 MUM2 protein MUM2 Hs.24379 W04705 0.335719 Hypothetical protein DKFZp667B1218 DKFZp667B1218 Hs.151293 H50522 0.335719 Proteasome (prosome, macropain) inhibitor subunit 1 (PI31) PSMF1 Hs.75925 AA203694 0.335719 Glucosidase, beta (bile acid) 2 GBA2 Hs.173422 AA031672 0.335719 Dual specificity phosphatase 12 DUSP12 Hs.44229 AA053311 0.335719 KIAA0233 gene product KIAA0233 Hs.79077 N27544 0.335719 Cell division cycle 27 CDC27 Hs.172405 T72663 0.335719 - -- R88034 0.335719 Hypothetical protein MGC3101 MGC3101 Hs.301394 H10444 0.335719 Era G-protein-like 1 (E. coli) ERAL1 Hs.3426 T89586 0.335719 - -- T86070 0.335719 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300 AA151290 0.335719 Double ring-finger protein, Dorfin DORFIN Hs.48320 N92363 0.335719 Ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) UBE2I Hs.84285 N94263 0.335719 Thyroid hormone receptor interactor 10 TRIP10 Hs.73999 N35502 0.335719 Hypothetical protein FLJ22626 FLJ22626 Hs.5565 W85875 0.335719 CHMP1.5 protein CHMP1.5 Hs.380932 R12051 0.335719 - - Hs.264915 H73751 0.335719 Mitogen-activated protein kinase kinase kinase 6 MAP3K6 Hs.194694 R13215 0.335719 Protocadherin 19 PCDH19 Hs.4993 N91929 0.346215 Hypothetical protein FLJ12799 FLJ12799 Hs.22549 H03870 0.346215 Chromosome 20 open reading frame 18 C20orf18 Hs.247280 H20147 0.346215 Chromosome 20 open reading frame 154 C20orf154 Hs.88959 W48584 0.346215 Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alp P4HA2 Hs.3622 AA047443 0.346215 LIM domain containing preferred translocation partner in lipoma LPP Hs.180398 T86448 0.346215 - -- W73052 0.346215 Ring-box 1 RBX1 Hs.279919 AA036785 0.346215 N-myristoyltransferase 2 NMT2 Hs.122647 N33086 0.346215 - -- W04300 0.346215 Similar to hypothetical protein MGC13138 LOC146542 Hs.301463 R13247 0.346215 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262 R52397 0.346215 Pumilio homolog 1 (Drosophila) PUM1 Hs.153834 H51270 0.346215 Ubiquitously transcribed tetratricopeptide repeat gene, X chromosome UTX Hs.13980 N22974 0.346215 Brain expressed, X-linked 1 BEX1 Hs.334370 W52394 0.346215 Activating transcription factor 4 (tax-responsive enhancer element B67) ATF4 Hs.181243 T72619 0.346215 - - Hs.373588 N70129 0.346215 - -- W52940 0.346215 MIL1 protein MIL1 Hs.10267 H12750 0.346215 - -- H97136 0.346215 CGI-41 protein LOC51093 Hs.5056 R64592 0.346215 - -- R22957 0.346215 Hypothetical protein PP1628 PP1628 Hs.7159 R49227 0.346215 - - Hs.13702 N31674 0.346215 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 ALS2CR3 Hs.154248 H15268 0.346215 Nectin-like protein 1 NECL1 Hs.6164 R88035 0.346215 Centrosomal protein 2 CEP2 Hs.27910 W86860 0.346215 Nuclear VCP-like NVL Hs.58927 AA047163 0.346215 Hypothetical protein DKFZp434C0328 DKFZp434C0328 Hs.24583 AA045741 0.346215 Hypothetical protein FLJ14251 FLJ14251 Hs.281462 R26005 0.346215 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa NDUFB7 Hs.661 T99317 0.346215 - - Hs.5250 W32039 0.346215 Hypothetical protein dJ37E16.5 DJ37E16.5 Hs.5790 R31383 0.346215 Hypothetical protein FLJ31131 FLJ31131 Hs.23853 H93264 0.346215 - - Hs.283378 T84975 0.346215 TRAF4 associated factor 1 FLJ14502 Hs.181466 R54946 0.346215 - -- H18767 0.346215 - -- AA034977 0.346215 - -- AA099587 0.346215 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 DDX31 Hs.69331 T85465 0.346215 ESTs ESTs Hs.268613 R47829 0.346215 CD37 antigen CD37 Hs.153053 AA044180 0.346215 - - Hs.373497 R92869 0.346215 - - Hs.356340 T96894 0.346215 ESTs ESTs Hs.181826 W02781 0.346215 Chromosome 12 open reading frame 4 C12orf4 Hs.296198 N25135 0.346215 Suppression of tumorigenicity 7 like ST7L Hs.293483 T79577 0.346215 KIAA0653 protein, B7-like protein B7H2 Hs.14155 AA032065 0.346215 Hypothetical protein BC002942 BC002942 Hs.150540 AA047053 0.346215 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 ATP6V1B2 Hs.1697 AA131566 0.346215 Fatty-acid-Coenzyme A ligase, long-chain 2 FACL2 Hs.154890 N48198 0.346215 Zinc finger protein 151 (pHZ-67) ZNF151 Hs.33532 AA099327 0.346215 General transcription factor IIA, 2, 12kDa GTF2A2 Hs.76362 N93437 0.346215 Paired immunoglobulin-like receptor beta PILR(BETA) Hs.349256 T65350 0.346215 WD repeat domain 13 WDR13 Hs.12142 AA024810 0.346215 S100 calcium binding protein A10 (annexin II ligand, calpactin I, light polypeptidS100A10 Hs.119301 AA129763 0.346215 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/en HADHB Hs.146812 H30702 0.346215 Protein phosphatase 2A, regulatory subunit B' (PR 53) PPP2R4 Hs.236963 H87240 0.346215 Neural precursor cell expressed, developmentally down-regulated 8 NEDD8 Hs.75512 R96334 0.346215 - -- N47468 0.346215 Zinc finger protein 281 ZNF281 Hs.59757 AA114872 0.346215 Aconitase 1, soluble ACO1 Hs.154721 H95221 0.356918 Hypothetical protein MGC12972 MGC12972 Hs.13972 N30234 0.356918 Tripartite motif-containing 33 TRIM33 Hs.287414 H03214 0.356918 Hypothetical protein FLJ14681 FLJ14681 Hs.23317 R38345 0.356918 Transcriptional intermediary factor 1 TIF1 Hs.183858 W03130 0.356918 ESTs ESTs Hs.118191 W90498 0.356918 Sjogren syndrome antigen B (autoantigen La) SSB Hs.83715 R14266 0.356918 - -- N24364 0.356918 Hypothetical protein FLJ13154 FLJ13154 Hs.25303 AA026227 0.356918 - -- N42817 0.356918 Cytochrome c oxidase subunit VIc COX6C Hs.351875 R71158 0.356918 Catenin (cadherin-associated protein), delta 1 CTNND1 Hs.166011 H00874 0.356918 - - Hs.295789 AA115514 0.356918 MAX interacting protein 1 MXI1 Hs.118630 R68212 0.356918 - -- W05762 0.356918 Hypothetical protein MGC24447 MGC24447 Hs.353161 R73881 0.356918 ATP-binding cassette, sub-family D (ALD), member 3 ABCD3 Hs.76781 N64510 0.356918 - - Hs.350475 R19114 0.356918 ESTs ESTs Hs.22634 W15429 0.356918 - - Hs.102951 W52072 0.356918 Ribosomal protein L13 RPL13 Hs.180842 N34679 0.356918 - - Hs.9042 T94382 0.356918 - -- W45565 0.356918 Vacuolar protein sorting protein 18 VPS18 Hs.23876 N34328 0.356918 KIAA1641 protein KIAA1641 Hs.44566 N93055 0.356918 Interferon, gamma-inducible protein 30 IFI30 Hs.14623 R37626 0.356918 - - Hs.6630 H14087 0.356918 LDL receptor adaptor protein ARH Hs.184482 R69288 0.356918 ESTs ESTs Hs.268693 T58031 0.356918 - - Hs.344478 N93342 0.356918 BCL-6 interacting corepressor BCoR Hs.130732 H43176 0.356918 Calcium homeostasis endoplasmic reticulum protein CHERP Hs.6430 R51495 0.356918 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa NDUFB8 Hs.198273 R61132 0.356918 KIAA0943 protein Apg4B Hs.352535 T93603 0.356918 Tumor protein D52-like 1 TPD52L1 Hs.16611 AA017362 0.356918 Glucose-6-phosphate dehydrogenase G6PD Hs.80206 H71225 0.356918 KIAA1673 KIAA1673 Hs.301444 AA194896 0.356918 Peroxisomal membrane protein 3, 35kDa (Zellweger syndrome) PXMP3 Hs.180612 AA152294 0.356918 Presenilin 2 (Alzheimer disease 4) PSEN2 Hs.25363 AA035052 0.356918 Ornithine aminotransferase (gyrate atrophy) OAT Hs.75485 AA150384 0.356918 KIAA0144 gene product KIAA0144 Hs.8127 N32281 0.356918 DKFZP586G011 protein LAP1B Hs.234265 H89293 0.356918 - - Hs.108646 W49707 0.356918 Steroid receptor RNA activator 1 SRA1 Hs.32587 R88190 0.356918 Solute carrier family 5 (sodium/glucose cotransporter), member 2 SLC5A2 Hs.356900 R87400 0.356918 Butyrophilin, subfamily 2, member A1 BTN2A1 Hs.169963 N79577 0.356918 Hypothetical protein MGC4368 MGC4368 Hs.9732 H53723 0.356918 Putative nucleotide binding protein, estradiol-induced E2IG3 Hs.279923 H11041 0.356918 Putative secreted protein ZSIG11 ZSIG11 Hs.279785 N90919 0.356918 - -- AA195759 0.356918 ESTs ESTs Hs.142104 AA043838 0.356918 Cleavage and polyadenylation specific factor 6, 68kDa CPSF6 Hs.64542 R77671 0.356918 - - Hs.20787 H95380 0.356918 Hydroxysteroid (17-beta) dehydrogenase 7 HSD17B7 Hs.187579 R39529 0.356918 Homolog of yeast long chain polyunsaturated fatty acid elongation enzyme 2 HELO1 Hs.250175 W04542 0.356918 Hepatocellular carcinoma-associated protein HCA4 HCA4 Hs.94011 N99506 0.356918 Rag D protein RAGD Hs.238679 T78071 0.356918 Hypothetical protein DKFZp667M2411 DKFZp667M2411 Hs.190488 H15272 0.356918 - - Hs.194478 AA063138 0.356918 - - Hs.356659 AA044234 0.356918 Inositol 1,4,5-trisphosphate 3-kinase C ITPKC Hs.21453 H08432 0.356918 RNA, U transporter 1 RNUT1 Hs.21577 H02835 0.356918 G1 to S phase transition 1 GSPT1 Hs.2707 H78069 0.356918 For protein disulfide isomerase-related PDIR Hs.76901 R62925 0.356918 - - Hs.285193 AA044021 0.356918 Cyclin C CCNC Hs.118442 R75598 0.356918 Neuroblastoma, suppression of tumorigenicity 1 NBL1 Hs.76307 H64918 0.367827 Interferon-stimulated transcription factor 3, gamma 48kDa ISGF3G Hs.1706 AA134754 0.367827 BCL2-associated athanogene 3 BAG3 Hs.15259 R14323 0.367827 MDN1, midasin homolog (yeast) MDN1 Hs.76730 W93342 0.367827 Hypothetical protein FLJ22127 FLJ22127 Hs.59457 W38744 0.367827 Homeodomain interacting protein kinase 3 HIPK3 Hs.30148 R76797 0.367827 Ubiquitin specific protease 21 USP21 Hs.8015 AA043767 0.367827 Runt-related transcription factor 1 (acute myeloid leukemia 1; aml1 oncogene) RUNX1 Hs.129914 N64112 0.367827 CAAX box 1 CXX1 Hs.250708 N89705 0.367827 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) SOD1 Hs.75428 AA147653 0.367827 Plastin 3 (T isoform) PLS3 Hs.4114 R01093 0.367827 Lymphocyte adaptor protein LNK Hs.13131 N43796 0.367827 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876 N25756 0.367827 - -- N55023 0.367827 HSPC150 protein similar to ubiquitin-conjugating enzyme HSPC150 Hs.5199 N32277 0.367827 - -- N21347 0.367827 Hypothetical protein MGC31963 MGC31963 Hs.293984 H50621 0.367827 - - Hs.71523 H78277 0.367827 Hypothetical protein DKFZp761D0211 DKFZP761D0211 Hs.322456 R36593 0.367827 Hypothetical protein FLJ20445 FLJ20445 Hs.343748 W85813 0.367827 Cleavage and polyadenylation specific factor 1, 160kDa CPSF1 Hs.83727 AA035000 0.367827 - -- W88723 0.367827 Peptidyl prolyl isomerase H (cyclophilin H) PPIH Hs.9880 W45561 0.367827 Centromere protein B, 80kDa CENPB Hs.85004 H96619 0.367827 Seven in absentia homolog 1 (Drosophila) SIAH1 Hs.295923 H38062 0.367827 - -- H11855 0.367827 ELK1, member of ETS oncogene family ELK1 Hs.181128 N46534 0.367827 Hypothetical protein FLJ10738 FLJ10738 Hs.5457 AA044119 0.367827 - - Hs.103441 N52230 0.367827 Hypothetical protein H17 H17 Hs.16361 AA149278 0.367827 D15F37 (pseudogene) MN7 Hs.286132 N95196 0.367827 Deoxyribonuclease II, lysosomal DNASE2 Hs.118243 AA031503 0.367827 CGI-20 protein LOC51608 Hs.107387 AA031933 0.367827 Estrogen-related receptor alpha ESRRA Hs.110849 AA195600 0.367827 Follistatin FST Hs.9914 AA040638 0.367827 KIAA1554 protein KIAA1554 Hs.17767 AA011688 0.367827 ATP-dependant interferon responsive ADIR Hs.26267 N41297 0.367827 ESTs ESTs Hs.355658 H02918 0.367827 Hypothetical protein MGC2941 MGC2941 Hs.288217 R14811 0.367827 ESTs ESTs Hs.380463 AA053317 0.367827 Bromodomain adjacent to zinc finger domain, 2B BAZ2B Hs.8383 H40373 0.367827 S164 protein S164 Hs.180789 H08650 0.367827 Egl nine homolog 1 (C. elegans) EGLN1 Hs.6523 H96054 0.367827 Glia maturation factor, beta GMFB Hs.151413 AA045167 0.367827 Hexokinase 2 HK2 Hs.198427 W57808 0.367827 H2A histone family, member J H2AFJ Hs.36727 N22132 0.367827 - - Hs.310359 N79772 0.367827 Mitochondrial ribosomal protein S10 MRPS10 Hs.380887 AA131579 0.367827 Platelet-derived growth factor receptor, beta polypeptide PDGFRB Hs.76144 R71156 0.367827 Programmed cell death 7 PDCD7 Hs.143253 AA115477 0.367827 General transcription factor IIF, polypeptide 1, 74kDa GTF2F1 Hs.68257 W47334 0.367827 Hypothetical protein MGC5560 MGC5560 Hs.233150 AA203444 0.367827 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) COPS5 Hs.198767 H20195 0.367827 Chromosome 12 open reading frame 10 C12orf10 Hs.15760 N59460 0.367827 Hypothetical protein FLJ14824 FLJ14824 Hs.22399 N43819 0.367827 KIAA0036 gene product KIAA0036 Hs.169387 AA099226 0.367827 - - Hs.356377 AA127687 0.367827 - -- H51993 0.367827 Hypothetical protein MGC3260 MGC3260 Hs.15514 W03639 0.367827 Golgi autoantigen, golgin subfamily a, 2 GOLGA2 Hs.24049 R61381 0.367827 Centromere protein B, 80kDa CENPB Hs.85004 T81540 0.367827 Nucleoporin 62kDa NUP62 Hs.9877 R92833 0.367827 - - Hs.285519 H07904 0.367827 Hypothetical protein FLJ38045 FLJ38045 Hs.170226 R41613 0.367827 ESTs ESTs Hs.22514 R01695 0.367827 Dpy-30-like protein LOC84661 Hs.323401 T70331 0.367827 - -- N35859 0.367827 Phosphodiesterase 7A PDE7A Hs.21857 W37211 0.367827 S100 calcium binding protein A13 S100A13 Hs.14331 N74710 0.367827 Signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 STAM Hs.153487 AA007448 0.378941 Retinoblastoma binding protein 4 RBBP4 Hs.16003 N70221 0.378941 KIAA0500 protein KIAA0500 Hs.301478 T65558 0.378941 Angiotensin II receptor-associated protein AGTRAP Hs.12854 W57882 0.378941 Pleckstrin homology domain containing, family A (phosphoinositide binding spePLEKHA4 Hs.9469 AA005304 0.378941 BTB (POZ) domain containing 3 BTBD3 Hs.7935 H11052 0.378941 Kinesin family member 3C KIF3C Hs.21611 R34667 0.378941 Hypothetical protein DKFZP434G1411 DKFZP434G1411 Hs.3837 N23299 0.378941 KIAA0212 gene product KIAA0212 Hs.154332 R68921 0.378941 Exportin 1 (CRM1 homolog, yeast) XPO1 Hs.79090 AA056734 0.378941 KIAA1110 protein KIAA1110 Hs.22479 R71002 0.378941 ESTs ESTs Hs.10957 T96994 0.378941 - - Hs.17240 N66159 0.378941 Cytochrome c oxidase subunit VIc COX6C Hs.351875 N75806 0.378941 ESTs ESTs Hs.109697 R94555 0.378941 Collagen, type IV, alpha 2 COL4A2 Hs.75617 W31628 0.378941 - - Hs.118258 AA149493 0.378941 - -- AA136884 0.378941 Hypothetical protein FLJ21924 FLJ21924 Hs.143509 W78859 0.378941 Emopamil binding related protein, delta8-delta7 sterol isomerase related protei EBRP Hs.298490 R69765 0.378941 Target of myb1 (chicken) TOM1 Hs.9482 T92246 0.378941 Hypothetical protein FLJ20265 FLJ20265 Hs.7099 AA069532 0.378941 - - Hs.287955 AA040219 0.378941 Nuclear transcription factor Y, gamma NFYC Hs.168157 W85899 0.378941 Cytidine monophosphate N-acetylneuraminic acid synthetase CMAS Hs.12492 N90203 0.378941 Hypothetical protein FLJ22347 FLJ22347 Hs.106004 N71038 0.378941 Wiskott-Aldrich syndrome-like WASL Hs.170065 H16828 0.378941 Cyclic AMP phosphoprotein, 19 kD ARPP-19 Hs.7351 H30758 0.378941 Glucose phosphate isomerase GPI Hs.279789 R86031 0.378941 Hypothetical protein FLJ22060 FLJ22060 Hs.29403 R21859 0.378941 Microfibrillar-associated protein 2 MFAP2 Hs.83551 H00836 0.378941 A kinase (PRKA) anchor protein 2 AKAP2 Hs.42322 T97294 0.378941 BCL2-associated athanogene BAG1 Hs.41714 R76588 0.378941 - -- H99841 0.378941 V-ski sarcoma viral oncogene homolog (avian) SKI Hs.2969 T93794 0.378941 - -- R14822 0.378941 RAN binding protein 1 RANBP1 Hs.24763 AA055986 0.378941 Chromosome 20 open reading frame 80 C20orf80 Hs.10726 R12050 0.378941 KIAA0014 gene product KIAA0014 Hs.155650 H89883 0.378941 KIAA0102 gene product KIAA0102 Hs.77665 H82877 0.378941 Testes development-related NYD-SP21 NYD-SP21 Hs.28514 H45501 0.378941 Hypothetical protein MGC10558 MGC10558 Hs.119498 R01094 0.378941 Likely ortholog of mouse brain protein 17 BRP17 Hs.375161 N32620 0.378941 CGI-36 protein LOC51078 Hs.182986 R17312 0.378941 SON DNA binding protein SON Hs.92909 AA036871 0.378941 DnaJ (Hsp40) homolog, subfamily A, member 2 DNAJA2 Hs.21189 H19945 0.378941 Syntaxin 5A STX5A Hs.302300 AA203452 0.378941 - -- N69475 0.378941 Mitochondrial ribosomal protein L48 MRPL48 Hs.82389 H51834 0.378941 Tetratricopeptide repeat domain 1 TTC1 Hs.7733 R98517 0.378941 H1 histone family, member 2 H1F2 Hs.7644 R67271 0.378941 Hypothetical protein FLJ13089 FLJ13089 Hs.285711 N90240 0.378941 Spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, a SCA2 Hs.76253 AA053908 0.378941 - - Hs.59847 H89995 0.378941 - -- W68697 0.378941 Hypothetical protein FLJ10998 FLJ10998 Hs.78110 H79188 0.378941 Excision repair cross-complementing rodent repair deficiency, complementationERCC2 Hs.99987 N23137 0.378941 M-phase phosphoprotein 9 MPHOSPH9 Hs.351230 AA037284 0.378941 Adenine phosphoribosyltransferase APRT Hs.28914 R13557 0.378941 Replication protein A2, 32kDa RPA2 Hs.79411 N21653 0.390259 Synovial sarcoma translocation, chromosome 18 SS18 Hs.153221 T79632 0.390259 ESTs ESTs Hs.189716 H26288 0.390259 Hypothetical protein FLJ13448 FLJ13448 Hs.288945 N64500 0.390259 IDN3 protein IDN3 Hs.225767 W47326 0.390259 - - Hs.194051 R94106 0.390259 - -- H45907 0.390259 - -- W94646 0.390259 Integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alphaITGAE Hs.851 R79455 0.390259 Activating transcription factor 1 ATF1 Hs.36908 H04766 0.390259 - -- AA026113 0.390259 Hypothetical protein FLJ10252 FLJ10252 Hs.53913 W35163 0.390259 Neuron navigator 2 NAV2 Hs.23467 AA150397 0.390259 - -- R32522 0.390259 Endothelial zinc finger protein 2 EZF-2 Hs.24545 R69789 0.390259 Hypothetical protein MGC4701 MGC4701 Hs.116771 AA026136 0.390259 Proteasome (prosome, macropain) subunit, alpha type, 6 PSMA6 Hs.74077 AA043899 0.390259 - -- N21532 0.390259 - EST Hs.331630 H29063 0.390259 Arginyl aminopeptidase (aminopeptidase B)-like 1 RNPEPL1 Hs.5345 AA126902 0.390259 UBX domain containing 1 UBXD1 Hs.11081 W17221 0.390259 Hypothetical protein MGC2217 MGC2217 Hs.323164 T98946 0.390259 Hypothetical protein FLJ12707 FLJ12707 Hs.16157 AA055190 0.390259 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15 DDX15 Hs.5683 R50163 0.390259 Hypothetical protein similar to beta-transducin family FLJ10458 Hs.85570 AA150817 0.390259 Thioredoxin TXN Hs.76136 H01255 0.390259 Ceroid-lipofuscinosis, neuronal 5 CLN5 Hs.30213 R14816 0.390259 - -- AA057144 0.390259 Slit homolog 3 (Drosophila) SLIT3 Hs.57929 N63983 0.390259 O-linked mannose beta1,2-N-acetylglucosaminyltransferase FLJ20277 Hs.183860 R80802 0.390259 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 KDELR1 Hs.78040 N42803 0.390259 - - Hs.356063 N64488 0.390259 Putative homeodomain transcription factor 1 PHTF1 Hs.123637 R20140 0.390259 Mitofusin 1 MFN1 Hs.197877 N54526 0.390259 KIAA1979 protein KIAA1979 Hs.352638 W47002 0.390259 Non-metastatic cells 2, protein (NM23B) expressed in NME2 Hs.275163 T66788 0.390259 Component of oligomeric golgi complex 4 COG4 Hs.108779 AA156867 0.390259 WW domain-containing protein 1 WWP1 Hs.355977 T96934 0.390259 Exportin 5 XPO5 Hs.9805 N95293 0.390259 SPPL2b SPPL2B Hs.284161 AA053325 0.390259 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 ATP6V1G1 Hs.90336 N35067 0.390259 Cell division cycle 2-like 5 (cholinesterase-related cell division controller) CDC2L5 Hs.59498 R77688 0.390259 HSPC003 protein HSPC003 Hs.351629 H17934 0.390259 Hypothetical protein MGC11287 similar to ribosomal protein S6 kinase , MGC11287 Hs.194286 AA007586 0.390259 - - Hs.103441 R85986 0.390259 - -- R34732 0.390259 Cadherin 8, type 2 CDH8 Hs.79133 R22724 0.390259 Hypothetical protein BC011840 LOC93343 Hs.106597 N48615 0.390259 GS3955 protein GS3955 Hs.155418 T95724 0.390259 Solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15SLC25A15 Hs.78457 R68008 0.390259 Fucosidase, alpha-L- 1, tissue FUCA1 Hs.576 N34324 0.390259 Lactotransferrin LTF Hs.105938 R25792 0.390259 Malic enzyme 2, NAD(+)-dependent, mitochondrial ME2 Hs.75342 H11052 0.390259 Kinesin family member 3C KIF3C Hs.21611 W80729 0.390259 - -- N36397 0.390259 CLIP-170-related protein CLIPR-59 Hs.7357 N31840 0.390259 - - Hs.206710 R18713 0.390259 HLA-B associated transcript 8 BAT8 Hs.75196 H89827 0.390259 RAS p21 protein activator (GTPase activating protein) 3 (Ins(1,3,4,5)P4-bindingGAP1IP4BP Hs.119274 H08185 0.390259 Hypothetical protein BC004409 LOC92170 Hs.301693 AA135334 0.390259 TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110k TAF1C Hs.153022 AA127936 0.390259 Ubiquitin-conjugating enzyme E2 variant 1 UBE2V1 Hs.75875 R66397 0.401781 KH domain containing, RNA binding, signal transduction associated 1 KHDRBS1 Hs.119537 AA099134 0.401781 Hypoxia up-regulated 1 HYOU1 Hs.277704 AA044433 0.401781 - - Hs.279607 AA098907 0.401781 Aminolevulinate, delta-, synthase 1 ALAS1 Hs.78712 N52238 0.401781 Hypothetical protein FLJ20531 FLJ20531 Hs.23617 H50924 0.401781 Hypothetical protein FLJ14800 FLJ14800 Hs.62119 R77598 0.401781 Hypothetical protein FLJ22530 FLJ22530 Hs.14570 N64621 0.401781 Regulator of G-protein signalling 19 interacting protein 1 RGS19IP1 Hs.6454 R77518 0.401781 DKFZP434D1335 protein DKFZP434D1335 Hs.8258 T66813 0.401781 - EST Hs.12947 AA058463 0.401781 - -- R28236 0.401781 Hypothetical protein MGC12217 MGC12217 Hs.288193 R79545 0.401781 WD-repeat protein HAN11 Hs.288283 T86807 0.401781 Serine/threonine kinase 19 STK19 Hs.444 R26327 0.401781 - - Hs.374441 R06415 0.401781 Friedreich ataxia FRDA Hs.95998 H84220 0.401781 MIC2 like 1 MIC2L1 Hs.169388 AA151197 0.401781 Integrin, alpha 5 (fibronectin receptor, alpha polypeptide) ITGA5 Hs.149609 AA151232 0.401781 Hypothetical protein MGC15677 MGC15677 Hs.71941 R98516 0.401781 H2B histone family, member G H2BFG Hs.182137 T84038 0.401781 POU domain, class 2, transcription factor 1 POU2F1 Hs.182237 H29536 0.401781 BBP-like protein 1 BLP1 Hs.7471 R63880 0.401781 ESTs ESTs Hs.176220 N26998 0.401781 - - Hs.247240 AA099522 0.401781 Hypothetical protein FLJ11565 FLJ11565 Hs.61763 H00120 0.401781 - -- R88980 0.401781 - - Hs.285165 W87505 0.401781 CGI-62 protein LOC51101 Hs.118821 R56894 0.401781 ESTs ESTs Hs.26010 AA032039 0.401781 Hypothetical protein FLJ13102 FLJ13102 Hs.225160 N27205 0.401781 Hypothetical protein FLJ13855 FLJ13855 Hs.168232 N75331 0.401781 - - Hs.50600 T94446 0.401781 Protein tyrosine phosphatase, non-receptor type substrate 1 PTPNS1 Hs.156114 N80280 0.401781 Actinin, alpha 2 ACTN2 Hs.83672 N32508 0.401781 G-protein gamma-12 subunit LOC55970 Hs.8107 R96053 0.401781 Hypothetical protein LOC51320 LOC51320 Hs.12830 AA040790 0.401781 - - Hs.356395 AA001250 0.401781 - - Hs.118913 R60239 0.401781 Similar to S. cerevisiae SSM4 TEB4 Hs.380875 N51711 0.401781 Hypothetical protein DKFZp761D0614 DKFZp761D0614 Hs.25320 R47837 0.401781 Zinc finger protein 265 ZNF265 Hs.194718 AA040152 0.401781 Cleavage and polyadenylation specific factor 3, 73kDa CPSF3 Hs.16251 AA147572 0.401781 RYK receptor-like tyrosine kinase RYK Hs.79350 H11054 0.401781 Protein kinase C, delta PRKCD Hs.155342 H62940 0.401781 - -- R07975 0.401781 Hypothetical protein MGC955 MGC955 Hs.55608 N91376 0.401781 KIAA0247 gene product KIAA0247 Hs.82426 AA044734 0.401781 ADP-ribosylation factor 3 ARF3 Hs.119177 R31924 0.401781 Hepatoma-derived growth factor (high-mobility group protein 1-like) HDGF Hs.89525 R00798 0.401781 Solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, SLC25A17 Hs.62245 N90939 0.401781 Major histocompatibility complex, class II, DR alpha HLA-DRA Hs.76807 AA137059 0.401781 Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. ATRX Hs.96264 W52111 0.401781 - -- T87161 0.401781 ESTs ESTs Hs.16335 N73980 0.401781 Keratin 8 KRT8 Hs.242463 R72179 0.401781 Hypothetical protein DKFZp761H0421 DKFZp761H0421 Hs.218182 T52348 0.413504 Hypothetical protein FLJ40629 FLJ40629 Hs.99807 AA203162 0.413504 - -- AA001326 0.413504 Ariadne homolog 2 (Drosophila) ARIH2 Hs.241558 AA040805 0.413504 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 PSMD5 Hs.193725 R67243 0.413504 Chromosome 20 open reading frame 99 C20orf99 Hs.28608 W90379 0.413504 - -- T87787 0.413504 Crumbs homolog 1 (Drosophila) CRB1 Hs.169745 H44188 0.413504 - -- W92625 0.413504 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583 N32327 0.413504 Cleavage and polyadenylation specific factor 5, 25 kDa CPSF5 Hs.9605 N42979 0.413504 Sialyltransferase STHM Hs.288215 N51083 0.413504 Hypothetical protein FLJ11159 FLJ11159 Hs.27021 N39446 0.413504 E1A binding protein p300 EP300 Hs.25272 N80289 0.413504 ORM1-like 2 (S. cerevisiae) ORMDL2 Hs.13144 AA045736 0.413504 KIAA1966 protein KIAA1966 Hs.158184 T39368 0.413504 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 SLC7A4 Hs.197116 AA011604 0.413504 - - Hs.278312 N24593 0.413504 - - Hs.170538 AA026250 0.413504 - -- H81036 0.413504 Hypothetical protein FLJ22059 FLJ22059 Hs.13323 AA034006 0.413504 ESTs ESTs Hs.133537 AA116105 0.413504 - - Hs.351649 N94623 0.413504 Peptidylprolyl isomerase (cyclophilin)-like 1 PPIL1 Hs.27693 N31469 0.413504 NCK-associated protein 1 NCKAP1 Hs.278411 AA203636 0.413504 - - Hs.132355 AA040028 0.413504 Hypothetical protein BC014641 LOC129138 Hs.135259 N91920 0.413504 - -- AA150500 0.413504 Interferon stimulated gene 20kDa ISG20 Hs.183487 AA204664 0.413504 SMC1 structural maintenance of chromosomes 1-like 2 (yeast) SMC1L2 Hs.182437 W68810 0.413504 - - Hs.381134 N33237 0.413504 Processing of precursors 1 POP1 Hs.170114 N51128 0.413504 Inositol hexaphosphate kinase 2 IHPK2 Hs.323432 N68522 0.413504 Transforming growth factor, beta 3 TGFB3 Hs.2025 AA136883 0.413504 Poly(rC) binding protein 1 PCBP1 Hs.2853 H59677 0.413504 Hypothetical protein FLJ13909 FLJ13909 Hs.288672 H21785 0.413504 Zinc finger protein 91 homolog (mouse) ZFP91 Hs.46366 H61388 0.413504 Fragile X mental retardation, autosomal homolog 1 FXR1 Hs.82712 AA203677 0.413504 - -- AA047414 0.413504 Lactate dehydrogenase A LDHA Hs.2795 T84135 0.413504 Cytochrome b5 outer mitochondrial membrane precursor CYB5-M Hs.381218 H85363 0.413504 - -- R82447 0.413504 E3 ubiquitin ligase SMURF1 SMURF1 Hs.119120 N47737 0.413504 ESTs ESTs Hs.41272 R88840 0.413504 - - Hs.268832 AA029861 0.413504 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein) BECN1 Hs.12272 N36299 0.413504 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltra COX10 Hs.77513 R87929 0.413504 H326 H326 Hs.110707 H58340 0.413504 RNA binding motif protein 10 RBM10 Hs.154583 R19138 0.413504 Activated p21cdc42Hs kinase ACK1 Hs.153937 H21748 0.413504 Caveolin 2 CAV2 Hs.139851 R88297 0.413504 - - Hs.144531 R61634 0.413504 Hypothetical protein PRO1855 PRO1855 Hs.283558 H03130 0.413504 ESTs ESTs Hs.24370 AA136889 0.413504 ESTs ESTs Hs.62578 H16789 0.413504 CGI-152 protein CGI-152 Hs.9275 H87386 0.413504 Hypothetical protein FLJ11362 FLJ11362 Hs.8929 R86854 0.413504 Chromosome 11 open reading frame 14 C11orf14 Hs.32017 H51380 0.413504 P450 (cytochrome) oxidoreductase POR Hs.167246 H39034 0.413504 Hypothetical protein PRO1489 PRO1489 Hs.197922 W47134 0.425428 CGI-58 protein CGI-58 Hs.19385 T72589 0.425428 Skeletal muscle and kidney enriched inositol phosphatase SKIP Hs.178347 AA210782 0.425428 Signal transducer and activator of transcription 6, interleukin-4 induced STAT6 Hs.181015 R97034 0.425428 Serine hydroxymethyltransferase 1 (soluble) SHMT1 Hs.8889 W60704 0.425428 Hypothetical protein FLJ20312 FLJ20312 Hs.7862 AA213820 0.425428 - - Hs.256533 H53623 0.425428 - -- R59532 0.425428 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synt GART Hs.82285 AA127934 0.425428 Protein kinase, X-linked PRKX Hs.147996 H80498 0.425428 KIAA0286 protein KIAA0286 Hs.14912 T84103 0.425428 - - Hs.377850 AA045266 0.425428 Thymopoietin TMPO Hs.11355 H53969 0.425428 Clone FLB5214 LOC51219 Hs.5486 N21505 0.425428 - - Hs.27048 N58341 0.425428 Mitochondrial ribosomal protein L22 MRPL22 Hs.41007 N72901 0.425428 U5 snRNP-specific 40 kDa protein (hPrp8-binding) HPRP8BP Hs.10290 AA047412 0.425428 Zinc finger protein 23 (KOX 16) ZNF23 Hs.55606 AA203422 0.425428 Splicing factor, arginine/serine-rich, 46kD SRP46 Hs.155160 AA043805 0.425428 Integrin beta 3 binding protein (beta3-endonexin) ITGB3BP Hs.82084 AA150275 0.425428 - - Hs.355877 R81742 0.425428 Solute carrier family 23 (nucleobase transporters), member 1 SLC23A1 Hs.82042 W47031 0.425428 Hypothetical protein LOC51241 LOC51241 Hs.171566 R26854 0.425428 - - Hs.261734 R85333 0.425428 - - Hs.373513 H42146 0.425428 Inositol polyphosphate-5-phosphatase, 40kDa INPP5A Hs.124029 N57339 0.425428 Hypothetical protein FLJ11240 FLJ11240 Hs.339833 N20508 0.425428 Fidgetin FIGN Hs.274281 AA126700 0.425428 Nucleolar and coiled-body phosphoprotein 1 NOLC1 Hs.75337 H10439 0.425428 Hypothetical protein MGC5560 MGC5560 Hs.233150 H90406 0.425428 Deoxythymidylate kinase (thymidylate kinase) DTYMK Hs.79006 R46183 0.425428 Hypothetical protein DKFZp313A2432 DKFZp313A2432 Hs.349096 W85777 0.425428 Kaptin (actin binding protein) KPTN Hs.25441 AA121547 0.425428 IMP (inosine monophosphate) dehydrogenase 2 IMPDH2 Hs.75432 W33123 0.425428 ADP-ribosylation factor-like 3 ARL3 Hs.182215 W33065 0.425428 - - Hs.381204 H18581 0.425428 CD164 antigen, sialomucin CD164 Hs.43910 R72787 0.425428 Immunoglobulin heavy constant mu IGHM Hs.153261 AA099373 0.425428 Glycogen synthase 1 (muscle) GYS1 Hs.772 R95735 0.425428 Hypothetical protein FLJ25804 FLJ25804 Hs.373547 N46182 0.425428 ATP-binding cassette, sub-family A (ABC1), member 1 ABCA1 Hs.211562 H38879 0.425428 Phosphoserine phosphatase PSPH Hs.56407 AA039428 0.425428 - -- AA045730 0.425428 TGFB inducible early growth response TIEG Hs.82173 R05881 0.425428 KIAA0971 protein KIAA0971 Hs.84429 H83405 0.425428 Faciogenital dysplasia (Aarskog-Scott syndrome) FGD1 Hs.1572 T95796 0.425428 Eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa EIF2B1 Hs.78592 R61384 0.425428 ATPase, Cu++ transporting, alpha polypeptide (Menkes syndrome) ATP7A Hs.606 R36140 0.425428 - -- W03758 0.425428 - - Hs.141278 W47349 0.425428 KIAA0592 protein KIAA0592 Hs.13273 N32560 0.425428 Forkhead box M1 FOXM1 Hs.239 AA036798 0.43755 - - Hs.339024 R00710 0.43755 - - Hs.379472 AA028961 0.43755 Hypothetical protein FLJ12150 FLJ12150 Hs.118983 R65826 0.43755 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 ALS2CR3 Hs.154248 R32753 0.43755 Hypothetical protein FLJ12541 similar to Stra6 FLJ12541 Hs.24553 N28966 0.43755 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262 H05616 0.43755 Nuclear receptor co-repressor 1 NCOR1 Hs.144904 AA069527 0.43755 Tuftelin interacting protein 11 TFIP11 Hs.20225 W39596 0.43755 Aldehyde dehydrogenase 1 family, member A1 ALDH1A1 Hs.76392 N79524 0.43755 Zinc finger protein, subfamily 2A (FYVE domain containing), 1 ZNFN2A1 Hs.20047 W67797 0.43755 Laminin, alpha 5 LAMA5 Hs.11669 W45086 0.43755 Multidrug resistance-associated protein 7 SIMRP7 Hs.55879 AA134876 0.43755 - - Hs.71523 R77424 0.43755 - -- R22967 0.43755 Hypothetical protein FLJ12442 FLJ12442 Hs.84753 W39328 0.43755 Hypothetical transmembrane protein SBBI54 SBBI54 Hs.116708 W33069 0.43755 SFRS protein kinase 2 SRPK2 Hs.78353 AA034480 0.43755 Mannose-6-phosphate receptor (cation dependent) M6PR Hs.75709 N93302 0.43755 Hypothetical protein MGC4549 MGC4549 Hs.326422 H56534 0.43755 - -- N48166 0.43755 Histone deacetylase 11 HDAC11 Hs.74280 AA210890 0.43755 - -- R00802 0.43755 ESTs ESTs Hs.191359 R12987 0.43755 - -- H69334 0.43755 Pirin PIR Hs.279663 AA037360 0.43755 - - Hs.90960 H97372 0.43755 Integrin, beta 5 ITGB5 Hs.149846 N66053 0.43755 Butyrophilin, subfamily 3, member A1 BTN3A1 Hs.284283 R84964 0.43755 Hypothetical protein FLJ22127 FLJ22127 Hs.59457 H22827 0.43755 Serine hydroxymethyltransferase 2 (mitochondrial) SHMT2 Hs.75069 T83773 0.43755 Hypothetical protein HSPC216 HSPC216 Hs.13525 H79853 0.43755 - - Hs.14355 R60986 0.43755 - - Hs.348282 R45475 0.43755 Phosphodiesterase 8B PDE8B Hs.78106 AA037777 0.43755 Phosphatidylinositol 4-kinase type II PI4KII Hs.25300 N45678 0.43755 CDC26 subunit of anaphase promoting complex CDC26 Hs.3991 N32304 0.43755 Proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) PSME1 Hs.75348 R50785 0.43755 Tubulin, gamma complex associated protein 6 TUBGCP6 Hs.336431 T97531 0.43755 - -- AA069570 0.43755 Heat shock 27kDa protein 1 HSPB1 Hs.76067 N44874 0.43755 Ubiquitin-protein isopeptide ligase (E3) KIAA0010 Hs.155287 R77965 0.43755 Lipin 1 LPIN1 Hs.81412 AA052907 0.43755 Hypothetical protein DKFZP434G0310 DKFZP434G0310 Hs.334836 AA194092 0.43755 Leukocyte-associated Ig-like receptor 1 LAIR1 Hs.115808 H88485 0.43755 - - Hs.108806 H04220 0.43755 - -- H21648 0.43755 - - Hs.31834 H40074 0.43755 ESTs ESTs Hs.21475 N24725 0.43755 Small nuclear ribonucleoprotein polypeptide B'' SNRPB2 Hs.82575 N54088 0.43755 - - Hs.96566 R66182 0.43755 Reticulocalbin 2, EF-hand calcium binding domain RCN2 Hs.79088 AA039374 0.43755 - -- W70217 0.43755 Catechol-O-methyltransferase COMT Hs.240013 N27488 0.43755 Sarcolemma associated protein SLMAP Hs.4007 R54933 0.43755 Peptidase D PEPD Hs.73947 H89087 0.449868 - -- R80700 0.449868 - - Hs.25218 H65168 0.449868 Solute carrier family 12 (sodium/potassium/chloride transporters), member 2 SLC12A2 Hs.110736 R20026 0.449868 ESTs ESTs Hs.326475 R90829 0.449868 Vascular endothelial growth factor B VEGFB Hs.78781 AA120872 0.449868 - - Hs.27552 N32967 0.449868 KIAA0678 protein KIAA0678 Hs.12707 R12118 0.449868 Heparan sulfate 6-O-sulfotransferase 1 HS6ST1 Hs.6363 H06279 0.449868 Hypothetical protein DKFZp762M136 DKFZp762M136 Hs.351747 R71647 0.449868 Pleckstrin homology, Sec7 and coiled/coil domains 3 PSCD3 Hs.7984 W90523 0.449868 Hypothetical protein FLJ20211 FLJ20211 Hs.311100 R17664 0.449868 Methyltransferase-like 1 METTL1 Hs.42957 R66879 0.449868 KIAA1911 protein KIAA1911 Hs.290931 H50391 0.449868 Acid phosphatase 1, soluble ACP1 Hs.75393 R55688 0.449868 KIAA0349 protein KIAA0349 Hs.15303 AA039984 0.449868 CCR4-NOT transcription complex, subunit 8 CNOT8 Hs.26703 R19011 0.449868 - -- W89149 0.449868 - -- N/A1 0.449868 - -- AA046481 0.449868 Chloride channel 6 CLCN6 Hs.211614 H86793 0.449868 - - Hs.81376 AA121513 0.449868 KIAA0084 protein KIAA0084 Hs.79123 R20590 0.449868 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ABCC4 Hs.139336 N92284 0.449868 Phospholipid transfer protein PLTP Hs.283007 H20853 0.449868 - - Hs.288862 T95014 0.449868 Serine/threonine kinase 4 STK4 Hs.35140 H67893 0.449868 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 SULT1A1 Hs.142 AA029575 0.449868 KIAA0697 protein KIAA0697 Hs.12329 N92723 0.449868 ARF GTPase-activating protein MRIP2 Hs.356559 W46217 0.449868 Tigger transposable element derived 6 TIGD6 Hs.169333 H82729 0.449868 Homeo box C9 HOXC9 Hs.40408 R60660 0.449868 ESTs ESTs Hs.116828 H18810 0.449868 - - Hs.9961 H19718 0.449868 Glutamate receptor, ionotrophic, AMPA 4 GRIA4 Hs.163697 N26046 0.449868 Solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19 SLC25A19 Hs.16786 R28325 0.449868 Hypothetical protein MGC10500 MGC10500 Hs.271599 R88426 0.449868 Ran GTPase activating protein 1 RANGAP1 Hs.183800 N33831 0.449868 Glutathione peroxidase 4 (phospholipid hydroperoxidase) GPX4 Hs.2706 H25157 0.449868 - -- R12692 0.449868 Sterol-C4-methyl oxidase-like SC4MOL Hs.239926 H58957 0.449868 Myeloid cell leukemia sequence 1 (BCL2-related) MCL1 Hs.86386 AA147492 0.449868 - - Hs.343211 W90777 0.449868 Interferon regulatory factor 2 IRF2 Hs.83795 N64693 0.449868 ESTs ESTs Hs.132918 W56249 0.449868 - - Hs.80285 R96346 0.449868 - - Hs.374127 W16753 0.449868 - - Hs.198552 R25789 0.449868 RAB2, member RAS oncogene family-like RAB2L Hs.170160 H43746 0.449868 Hypothetical protein DKFZp761F0118 DKFZp761F0118 Hs.6685 N73731 0.449868 ESTs ESTs Hs.269183 AA148577 0.449868 Zinc finger protein 20 (KOX 13) ZNF20 Hs.110956 N77922 0.449868 - - Hs.343271 AA150683 0.449868 Hypothetical protein FLJ10849 FLJ10849 Hs.8768 H46579 0.449868 - - Hs.141269 H21122 0.449868 Scaffold attachment factor B SAFB Hs.23978 AA056740 0.449868 Heterogeneous nuclear ribonucleoprotein K HNRPK Hs.129548 W24831 0.46238 Dermatopontin DPT Hs.80552 R38502 0.46238 Hypothetical protein FLJ13154 FLJ13154 Hs.25303 H90408 0.46238 Hypothetical protein FLJ13910 FLJ13910 Hs.75277 AA069568 0.46238 CSRP2 binding protein CSRP2BP Hs.301532 R24574 0.46238 Chromosome 7 open reading frame 14 C7orf14 Hs.84790 N89894 0.46238 - -- AA033875 0.46238 Similar to yeast Upf3, variant A UPF3A Hs.274412 N50403 0.46238 Nucleosome assembly protein 1-like 1 NAP1L1 Hs.302649 R25219 0.46238 - - Hs.175652 AA099606 0.46238 - - Hs.24143 N91931 0.46238 NME7 NME7 Hs.274479 H04530 0.46238 Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial ECHS1 Hs.76394 W42426 0.46238 Iron-responsive element binding protein 2 IREB2 Hs.370324 R98672 0.46238 - - Hs.27004 H06281 0.46238 Hypothetical protein FLJ10737 FLJ10737 Hs.261134 AA058318 0.46238 Plastin 3 (T isoform) PLS3 Hs.4114 N33087 0.46238 Myosin regulatory light chain interacting protein MIR Hs.20072 AA046820 0.46238 - - Hs.345588 H25618 0.46238 Hypothetical protein HSPC177 HSPC177 Hs.36237 W31516 0.46238 - - Hs.7000 W70336 0.46238 Hypothetical protein BC007540 LOC144097 Hs.63405 T93721 0.46238 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16 DDX16 Hs.12797 AA045760 0.46238 Thyroid hormone receptor interactor 10 TRIP10 Hs.73999 H86173 0.46238 - -- N52339 0.46238 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) ELAVL1 Hs.12379 T87593 0.46238 ESTs ESTs Hs.111805 AA063044 0.46238 Hypothetical protein MGC4840 MGC4840 Hs.301872 W40179 0.46238 APEX nuclease (multifunctional DNA repair enzyme) APEX Hs.73722 AA029959 0.46238 Regulator of G-protein signalling 16 RGS16 Hs.183601 W90593 0.46238 Ubiquitin-like 4 UBL4 Hs.76480 R17132 0.46238 HSPC055 protein HSPC055 Hs.179898 W56037 0.46238 Ras homolog gene family, member H ARHH Hs.109918 W90343 0.46238 - - Hs.231637 T86708 0.46238 Solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane proSLC4A1 Hs.185923 H18558 0.46238 Transcription factor A, mitochondrial TFAM Hs.75133 N73088 0.46238 Ataxin 2 related protein A2LP Hs.43509 N36659 0.46238 Neuron navigator 1 NAV1 Hs.6298 H64559 0.46238 - -- N23296 0.46238 Dynein, cytoplasmic, intermediate polypeptide 2 DNCI2 Hs.66881 W80603 0.46238 - - Hs.380051 N28259 0.46238 - - Hs.12030 H57134 0.46238 - -- W69443 0.46238 High-mobility group nucleosome binding domain 1 HMGN1 Hs.251064 R20019 0.46238 - -- AA031495 0.46238 Peptidylprolyl isomerase E (cyclophilin E) PPIE Hs.33251 N20259 0.46238 Hypothetical protein MGC2840 similar to a putative glucosyltransferase MGC2840 Hs.155356 W33060 0.46238 Sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase) SIAT4B Hs.343628 N73101 0.475085 Solute carrier family 26 (sulfate transporter), member 2 SLC26A2 Hs.29981 R80525 0.475085 Nucleoporin Nup37 Nup37 Hs.5152 AA131615 0.475085 HRAS-like suppressor 3 HRASLS3 Hs.37189 R50487 0.475085 - - Hs.25717 T84447 0.475085 - -- R25517 0.475085 - -- AA053306 0.475085 Polyglutamine binding protein 1 PQBP1 Hs.30570 R41888 0.475085 - -- W47153 0.475085 Polymerase I and transcript release factor PTRF Hs.29759 R21579 0.475085 GTP binding protein 1 GTPBP1 Hs.283677 H52694 0.475085 WAP four-disulfide core domain 1 WFDC1 Hs.36688 N66072 0.475085 ESTs ESTs Hs.13680 R91933 0.475085 C-Mpl binding protein LOC113251 Hs.26613 R80770 0.475085 Hypothetical protein C40 C40 Hs.30819 AA043836 0.475085 Hypothetical protein BC009518 LOC90799 Hs.135265 R60231 0.475085 KIAA1255 protein KIAA1255 Hs.351633 R88082 0.475085 ESTs ESTs Hs.31755 N29574 0.475085 Rag D protein RAGD Hs.238679 T90545 0.475085 KIAA1536 protein KIAA1536 Hs.156667 H98783 0.475085 Hypothetical protein FLJ31413 FLJ31413 Hs.24643 AA194219 0.475085 - -- R73175 0.475085 Leucine-zipper-like transcriptional regulator, 1 LZTR1 Hs.78788 T85305 0.475085 - -- AA136755 0.475085 ESTs ESTs Hs.29475 T94105 0.475085 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 ABCC1 Hs.89433 N79456 0.475085 Ferritin, heavy polypeptide 1 FTH1 Hs.62954 N51117 0.475085 ESTs ESTs Hs.110028 N47294 0.475085 - - Hs.350001 AA134878 0.475085 KIAA0117 protein KIAA0117 Hs.322478 R50511 0.475085 Hydroxysteroid (17-beta) dehydrogenase 1 HSD17B1 Hs.85279 R20231 0.475085 Raptor raptor Hs.20677 H62770 0.475085 ESTs ESTs Hs.176721 R53645 0.475085 - - Hs.378080 T86360 0.475085 ESTs ESTs Hs.15266 H23225 0.475085 Protein kinase C, epsilon PRKCE Hs.211592 N48314 0.475085 Hermansky-Pudlak syndrome 4 HPS4 Hs.6657 R48933 0.475085 Polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa POLR2J Hs.80475 AA001139 0.475085 Zinc finger protein 274 ZNF274 Hs.83761 H52698 0.475085 Diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 ( DPH2L2 Hs.324830 N69433 0.475085 KIAA0212 gene product KIAA0212 Hs.154332 W37846 0.475085 Hypothetical protein MGC955 MGC955 Hs.55608 H85625 0.475085 Checkpoint suppressor 1 CHES1 Hs.211773 T96983 0.475085 Cerebroside (3'-phosphoadenylylsulfate:galactosylceramide 3') sulfotransferaseCST Hs.17958 R18779 0.475085 - -- N48309 0.475085 Hypothetical protein MGC8721 MGC8721 Hs.279921 AA151305 0.475085 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569 W31103 0.475085 Bromodomain containing 2 BRD2 Hs.75243 AA210725 0.475085 ESTs ESTs Hs.365595 R38638 0.475085 - - Hs.5064 T89662 0.475085 - - Hs.268617 R69935 0.475085 - -- H19514 0.475085 Frizzled homolog 10 (Drosophila) FZD10 Hs.31664 H15553 0.475085 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltra COX10 Hs.77513 R50205 0.475085 - -- N30288 0.475085 Prefoldin 2 PFDN2 Hs.298229 AA032211 0.475085 ESTs ESTs Hs.118493 AA045253 0.475085 ESTs ESTs Hs.161566 AA043249 0.475085 ESTs ESTs Hs.275224 H23019 0.475085 - - Hs.28005 N25562 0.475085 Protein tyrosine kinase 9 PTK9 Hs.82643 W81465 0.475085 Mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase MGAT1 Hs.151513 AA150729 0.475085 Nuclear receptor co-repressor 2 NCOR2 Hs.287994 R62727 0.475085 Ankyrin repeat, family A (RFXANK-like), 2 ANKRA2 Hs.239154 H14473 0.475085 Tetracycline transporter-like protein TETRAN Hs.157145 N25253 0.475085 Chromosome 5 open reading frame 8 C5orf8 Hs.75864 AA010007 0.487978 - - Hs.222505 R01677 0.487978 Ring finger protein 4 RNF4 Hs.66394 AA047406 0.487978 Translocase of outer mitochondrial membrane 70 homolog A (yeast) TOMM70A Hs.21198 N73885 0.487978 CDA02 protein CDA02 Hs.332404 R02110 0.487978 XPMC2 protein LOC57109 Hs.235376 W17370 0.487978 Mitochondrial elongation factor G EFG1 Hs.274543 AA069400 0.487978 Hypothetical protein MGC10974 MGC10974 Hs.111099 R46209 0.487978 Phosphatidylglycerophosphate synthase PGS1 Hs.162604 AA213820 0.487978 - - Hs.256533 AA054468 0.487978 - - Hs.356385 W46270 0.487978 Hypothetical protein FLJ22625 FLJ22625 Hs.106534 H01133 0.487978 - - Hs.30120 R60480 0.487978 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein) BECN1 Hs.12272 N24115 0.487978 - - Hs.323780 AA028907 0.487978 - - Hs.34447 H73128 0.487978 Integrin, beta 5 ITGB5 Hs.149846 W00877 0.487978 - -- T86470 0.487978 - -- R11719 0.487978 Nucleolar protein 1, 120kDa NOL1 Hs.15243 AA056752 0.487978 Hypothetical protein FLJ20568 FLJ20568 Hs.279581 R39405 0.487978 Dishevelled, dsh homolog 2 (Drosophila) DVL2 Hs.118640 H14810 0.487978 - - Hs.303154 W69323 0.487978 - -- H89832 0.487978 Centromere protein F, 350/400ka (mitosin) CENPF Hs.77204 H51316 0.487978 Sestrin 2 SES2 Hs.8026 N92789 0.487978 Hypothetical protein HSPC148 HSPC148 Hs.42743 H95787 0.487978 - - Hs.108745 R40457 0.487978 - -- H21758 0.487978 - - Hs.375003 N75316 0.487978 DKFZP727C091 protein DKFZP727C091 Hs.43141 N71104 0.487978 - - Hs.46506 R62983 0.487978 - - Hs.82276 H11588 0.487978 Bromodomain containing 2 BRD2 Hs.75243 R98467 0.487978 Hypothetical protein FLJ14668 FLJ14668 Hs.334644 H75270 0.487978 Hypothetical protein FLJ14743 FLJ14743 Hs.169577 H19829 0.487978 Rab acceptor 1 (prenylated) RABAC1 Hs.11417 H17141 0.487978 KIAA0376 protein KIAA0376 Hs.4791 N48155 0.487978 - - Hs.46826 H05539 0.487978 Uncharacterized bone marrow protein BM046 BM046 Hs.177812 H52616 0.487978 Beta-amyloid binding protein precursor BBP Hs.333541 N25620 0.487978 Midline 1 (Opitz/BBB syndrome) MID1 Hs.27695 R27190 0.487978 Placental growth factor, vascular endothelial growth factor-related protein PGF Hs.2894 R02573 0.487978 Similar to yeast Upf3, variant A UPF3A Hs.274412 N67638 0.487978 Disrupted in renal carcinoma 2 DIRC2 Hs.11360 H26760 0.487978 KIAA0375 gene product KIAA0375 Hs.26951 AA131280 0.487978 B-cell CLL/lymphoma 6 (zinc finger protein 51) BCL6 Hs.155024 H23029 0.487978 Protein inhibitor of activated STAT X PIASX-BETA Hs.111323 H47146 0.487978 Excision repair cross-complementing rodent repair deficiency, complementationERCC1 Hs.59544 AA044382 0.487978 YY1 transcription factor YY1 Hs.97496 N71546 0.487978 Hypothetical protein FLJ20920 FLJ20920 Hs.288959 AA045366 0.487978 Plastin 3 (T isoform) PLS3 Hs.4114 N93402 0.487978 Guanine nucleotide binding protein-like 1 GNL1 Hs.83147 H46276 0.487978 RNA, U17D small nucleolar RNU17D Hs.196769 H88535 0.487978 - - Hs.153527 R71614 0.487978 - - Hs.233354 N79532 0.487978 - - Hs.378235 N70859 0.487978 Exportin 1 (CRM1 homolog, yeast) XPO1 Hs.79090 AA055333 0.487978 CCAAT/enhancer binding protein (C/EBP), gamma CEBPG Hs.2227 H52742 0.487978 HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae) HRMT1L2 Hs.20521 N99057 0.487978 Likely ortholog of mouse synembryn RIC-8 Hs.7393 W78857 0.487978 - - Hs.339722 R09933 0.487978 - - Hs.355762 R96766 0.487978 Sema domain, transmembrane domain (TM), and cytoplasmic domain, (semapSEMA6A Hs.263395 H20778 0.487978 Pregnancy-induced growth inhibitor OKL38 Hs.31773 H20004 0.487978 WD repeat domain 8 WDR8 Hs.31714 N62934 0.487978 ESTs ESTs Hs.348421 W93284 0.487978 Transcription elongation factor A (SII), 3 TCEA3 Hs.94952 T83961 0.487978 - -- H52728 0.487978 Tripartite motif-containing 35 TRIM35 Hs.137732 AA034330 0.487978 - -- N95162 0.487978 Cytochrome c oxidase subunit Va COX5A Hs.323834 AA035227 0.487978 Unknown LOC51693 Hs.27445 R13347 0.487978 Kelch motif containing protein AB026190 Hs.106290 R56381 0.487978 Hypothetical protein FLJ14775 FLJ14775 Hs.334878 AA045847 0.487978 - - Hs.188361 R17728 0.501058 Molybdenum cofactor synthesis 3 MOCS3 Hs.159410 R63060 0.501058 - -- W42742 0.501058 CGI-29 protein LOC51074 Hs.104058 W93292 0.501058 Mitochondrial carrier homolog 2 MTCH2 Hs.279609 R35255 0.501058 - - Hs.283839 H17405 0.501058 KIAA0435 gene product KIAA0435 Hs.31438 AA040920 0.501058 Chromosome 3p21.1 gene sequence HUMAGCGB Hs.84162 AA043178 0.501058 Mitogen-activated protein kinase 3 MAPK3 Hs.861 R39441 0.501058 - -- W86753 0.501058 Chemokine (C-X-C motif) ligand 16 CXCL16 Hs.82407 W60673 0.501058 Hypothetical protein FLJ21868 FLJ21868 Hs.46829 N73898 0.501058 - - Hs.220656 AA045615 0.501058 Membrane-bound transcription factor protease, site 1 MBTPS1 Hs.75890 H77659 0.501058 Tubulin, gamma 1 TUBG1 Hs.21635 AA039246 0.501058 Transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) TLE2 Hs.332173 R86741 0.501058 HRD1 protein HRD1 Hs.334819 T66845 0.501058 Tax interaction protein 1 TIP-1 Hs.12956 W58176 0.501058 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c'' ATP6V0B Hs.7476 H83830 0.501058 KIAA1096 protein KIAA1096 Hs.69559 H63542 0.501058 Upstream binding protein 1 (LBP-1a) UBP1 Hs.28423 W37381 0.501058 Splicing factor, arginine/serine-rich 2 SFRS2 Hs.73965 N27178 0.501058 T-box 3 (ulnar mammary syndrome) TBX3 Hs.267182 H80175 0.501058 Radixin RDX Hs.263671 T85113 0.501058 Tumor protein, translationally-controlled 1 TPT1 Hs.279860 AA130095 0.501058 Hypothetical protein FLJ21749 FLJ21749 Hs.288761 R97690 0.501058 Limkain beta 2 FLJ22471 Hs.288909 H01172 0.501058 Golgi reassembly stacking protein 2, 55kDa GORASP2 Hs.6880 W58007 0.501058 KIAA0222 gene product KIAA0222 Hs.48450 W90706 0.501058 Chromosome 20 open reading frame 119 C20orf119 Hs.372714 AA043638 0.501058 Crystallin, zeta (quinone reductase) CRYZ Hs.83114 H55916 0.501058 Peptidylprolyl isomerase F (cyclophilin F) PPIF Hs.173125 N32669 0.501058 RPA-binding trans-activator RBT1 Hs.169138 R55696 0.501058 KIAA1107 protein KIAA1107 Hs.21554 AA128278 0.501058 KIAA0326 protein KIAA0326 Hs.301094 R70894 0.501058 TGFB-induced factor (TALE family homeobox) TGIF Hs.90077 W56466 0.501058 ESTs ESTs Hs.130214 AA099036 0.501058 Astrotactin 2 ASTN2 Hs.30898 AA121308 0.501058 TRNA isopentenylpyrophosphate transferase IPT Hs.356554 AA213541 0.501058 Ninein (GSK3B interacting protein) NIN Hs.44054 N42817 0.501058 Cytochrome c oxidase subunit VIc COX6C Hs.351875 H18275 0.501058 - -- R22236 0.501058 KIAA0336 gene product KIAA0336 Hs.278671 N74699 0.501058 Malonyl-CoA decarboxylase MLYCD Hs.150748 N29422 0.501058 Matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV coll MMP2 Hs.111301 R60482 0.501058 DNA methyltransferase 1-associated protein 1 DMAP1 Hs.8008 AA101835 0.501058 - - Hs.374524 R87681 0.501058 MUF1 protein MUF1 Hs.172210 T91710 0.501058 Intersectin 2 ITSN2 Hs.166184 R88993 0.501058 Vesicle trafficking protein SEC22C Hs.12942 AA137220 0.501058 - - Hs.83286 T99307 0.501058 Zinc finger protein 384 ZNF384 Hs.103315 R14556 0.501058 - -- R70121 0.501058 Inositol 1,3,4-triphosphate 5/6 kinase ITPK1 Hs.6453 AA039869 0.501058 Charot-Leyden crystal protein CLC Hs.889 N57645 0.501058 ESTs ESTs Hs.380509 AA001104 0.501058 Regulator of G-protein signalling 3 RGS3 Hs.82294 H66279 0.501058 - - Hs.216226 W45534 0.501058 Laminin, alpha 4 LAMA4 Hs.78672 T88719 0.501058 Baculoviral IAP repeat-containing 5 (survivin) BIRC5 Hs.1578 W74466 0.501058 Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) KRT10 Hs.99936 N23950 0.501058 High-mobility group box 2 HMGB2 Hs.80684 AA190714 0.501058 Cytoskeleton associated protein 2 CKAP2 Hs.24641 H28105 0.501058 Small nuclear ribonucleoprotein polypeptide N SNRPN Hs.48375 N90076 0.501058 Exostoses (multiple)-like 2 EXTL2 Hs.61152 T79588 0.501058 CCR4-NOT transcription complex, subunit 3 CNOT3 Hs.343571 W40227 0.501058 Nucleobindin 2 NUCB2 Hs.3164 R12960 0.514321 KIAA1110 protein KIAA1110 Hs.22479 W55924 0.514321 - - Hs.35962 H82142 0.514321 PC326 protein PC326 Hs.279882 N32330 0.514321 DAZ associated protein 2 DAZAP2 Hs.75416 R93684 0.514321 Hypothetical protein My014 MY014 Hs.67619 H12862 0.514321 Protein inhibitor of activated STAT protein PIASy PIASY Hs.105779 H03709 0.514321 Hypothetical protein RP4-622L5 RP4-622L5 Hs.272299 AA069620 0.514321 - - Hs.198552 N49728 0.514321 KIAA0916 protein KIAA0916 Hs.151411 H50875 0.514321 Hepatocyte nuclear factor 3, gamma HNF3G Hs.36137 W23711 0.514321 Core-binding factor, runt domain, alpha subunit 2; translocated to, 2 CBFA2T2 Hs.153934 AA047581 0.514321 Peroxiredoxin 5 PRDX5 Hs.31731 R31356 0.514321 RE1-silencing transcription factor REST Hs.227630 H28165 0.514321 Chaperone, ABC1 activity of bc1 complex like (S. pombe) CABC1 Hs.273186 R50526 0.514321 - -- W61377 0.514321 Aminolevulinate, delta-, dehydratase ALAD Hs.1227 H23260 0.514321 NDRG family member 3 NDRG3 Hs.355855 AA044244 0.514321 - - Hs.275038 R33946 0.514321 Quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylasQPRT Hs.8935 H00517 0.514321 Chromosome 21 open reading frame 63 C21orf63 Hs.30156 H27907 0.514321 CDK5 regulatory subunit associated protein 2 CDK5RAP2 Hs.32360 N90287 0.514321 - -- H85860 0.514321 - -- N63833 0.514321 Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID) GNS Hs.334534 N91368 0.514321 ALL1-fused gene from chromosome 1q AF1Q Hs.75823 AA045634 0.514321 ESTs ESTs Hs.364644 H13832 0.514321 Hypothetical protein FLJ10404 FLJ10404 Hs.111279 N59563 0.514321 Cyclin D-type binding-protein 1 CCNDBP1 Hs.36794 R69611 0.514321 Karyopherin alpha 6 (importin alpha 7) KPNA6 Hs.301553 H18495 0.514321 ESTs ESTs Hs.8053 R25019 0.514321 ESTs ESTs Hs.21364 T93907 0.514321 - -- T66784 0.514321 Zinc-fingers and homeoboxes 1 ZHX1 Hs.12940 R59315 0.514321 Polymerase (DNA directed), delta 3 POLD3 Hs.82502 AA055329 0.514321 - - Hs.351561 H38592 0.514321 ESTs ESTs Hs.32840 AA114891 0.514321 Syndecan 2 (heparan sulfate proteoglycan 1, cell surface-associated, fibroglycaSDC2 Hs.1501 N48160 0.514321 - - Hs.43619 W31480 0.514321 Coiled-coil protein BICD2 BICD2 Hs.330988 H88566 0.514321 - -- H06742 0.514321 Oxysterol binding protein-like 9 OSBPL9 Hs.21938 W93404 0.514321 Mitotic spindle coiled-coil related protein DEEPEST Hs.16244 R72114 0.514321 Melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) MC1R Hs.380388 N27137 0.514321 Catechol-O-methyltransferase COMT Hs.240013 R40400 0.514321 Cell adhesion molecule with homology to L1CAM (close homolog of L1) CHL1 Hs.210863 AA054757 0.514321 Zinc finger protein 226 ZNF226 Hs.145956 H57284 0.514321 Neural precursor cell expressed, developmentally down-regulated 5 NEDD5 Hs.155595 N91448 0.514321 Protease, serine, 23 SPUVE Hs.25338 R23136 0.514321 Solute carrier family 11 (proton-coupled divalent metal ion transporters), membSLC11A2 Hs.57435 R51845 0.514321 Cyclin-dependent kinase 8 CDK8 Hs.25283 W31584 0.514321 Hypothetical protein MGC3251 MGC3251 Hs.13467 R31364 0.514321 - - Hs.128676 T86146 0.514321 ESTs ESTs Hs.16094 AA055968 0.514321 Synuclein, gamma (breast cancer-specific protein 1) SNCG Hs.349470 H65280 0.514321 ESTs ESTs Hs.38348 W47043 0.514321 Cyclin-dependent kinase 5 CDK5 Hs.166071 N40301 0.514321 Cytoskeleton associated protein 2 CKAP2 Hs.24641 R65748 0.514321 - -- W85883 0.514321 Hypothetical protein FLJ10847 FLJ10847 Hs.48403 N24593 0.514321 - - Hs.170538 N63997 0.514321 - - Hs.373497 R65823 0.514321 Two-pore channel 1, homolog KIAA1169 Hs.26440 AA011350 0.514321 Similar to phosphoserine/threonine/tyrosine interaction protein; STNS (alternatiLOC122792 Hs.224818 AA005152 0.514321 - - Hs.356494 R32787 0.514321 - -- R12233 0.527765 NY-REN-24 antigen LOC58509 Hs.128425 H06635 0.527765 Integrin, alpha 6 ITGA6 Hs.227730 W87502 0.527765 - - Hs.356201 R45115 0.527765 Thyroid hormone receptor interactor 12 TRIP12 Hs.138617 R13172 0.527765 Nuclear receptor co-repressor 1 NCOR1 Hs.144904 H16602 0.527765 - - Hs.356087 W89013 0.527765 Tripartite motif-containing 26 TRIM26 Hs.1287 AA036758 0.527765 S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, mur S100A4 Hs.81256 T87251 0.527765 ESTs ESTs Hs.114604 H08164 0.527765 KIAA1265 protein KIAA1265 Hs.355925 T77424 0.527765 FOXJ2 forkhead factor FHX Hs.120844 N34859 0.527765 Histone deacetylase 10 HDAC10 Hs.26593 T72401 0.527765 Chromosome 8 open reading frame 4 C8orf4 Hs.283683 W92120 0.527765 Splicing factor, arginine/serine-rich, 46kD SRP46 Hs.155160 H68599 0.527765 Hypothetical protein MGC15737 MGC15737 Hs.39122 AA142881 0.527765 - - Hs.154304 H77668 0.527765 Aryl hydrocarbon receptor AHR Hs.170087 AA069271 0.527765 IK cytokine, down-regulator of HLA II IK Hs.8024 AA032250 0.527765 - - Hs.15806 T97307 0.527765 - -- N91767 0.527765 Twisted gastrulation TSG Hs.247302 R18625 0.527765 Proteasome (prosome, macropain) 26S subunit, ATPase, 3 PSMC3 Hs.250758 H42140 0.527765 - - Hs.12311 T85637 0.527765 Hypothetical protein MGC10993 MGC10993 Hs.12199 N44886 0.527765 MGC4170 protein MGC4170 Hs.7041 AA130176 0.527765 SNF-1 related kinase SNRK Hs.79025 N31725 0.527765 TRAF family member-associated NFKB activator TANK Hs.146847 N35485 0.527765 MAD1 mitotic arrest deficient-like 1 (yeast) MAD1L1 Hs.7345 R53519 0.527765 Golgi associated, gamma adaptin ear containing, ARF binding protein 2 GGA2 Hs.155546 AA150924 0.527765 Immunoglobulin (CD79A) binding protein 1 IGBP1 Hs.3631 N46949 0.527765 - -- R71067 0.527765 Low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) LRP1 Hs.89137 R72275 0.527765 Dolichyl-p-mannose:Man7GlcNAc2-PP-dolichyl mannosyltransferase ALG12 Hs.77575 N48159 0.527765 CGI-148 protein LOC51030 Hs.6776 N63996 0.527765 ESTs ESTs Hs.289083 W52943 0.527765 Dudulin 2 FLJ10829 Hs.57655 H78668 0.527765 - - Hs.189869 AA056513 0.527765 Glutaredoxin 2 GLRX2 Hs.5054 R74157 0.527765 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876 N62942 0.527765 Putative membrane protein LOC54499 Hs.93832 R64172 0.527765 ESTs ESTs Hs.260100 T84454 0.527765 COP9 subunit 6 (MOV34 homolog, 34 kD) MOV34-34KD Hs.15591 R22308 0.527765 Nuclear phosphoprotein similar to S. cerevisiae PWP1 PWP1 Hs.172589 H45128 0.527765 - - Hs.293441 N30715 0.527765 ATP binding protein associated with cell differentiation APACD Hs.153884 T87532 0.527765 ESTs ESTs Hs.10739 H26561 0.527765 Serine/threonine kinase 11 interacting protein STK11IP Hs.22410 R26919 0.527765 Down syndrome critical region gene 1-like 2 DSCR1L2 Hs.129319 W58270 0.527765 Karyopherin beta 2b, transportin TRN2 Hs.278378 N46377 0.527765 Beta-galactose-3-O-sulfotransferase, 4 GAL3ST-4 Hs.44856 R77731 0.527765 DKFZP566C0424 protein DKFZP566C0424 Hs.226770 W88941 0.527765 Microspherule protein 1 MCRS1 Hs.25313 T95296 0.527765 - -- N34169 0.527765 Neurofibromin 2 (bilateral acoustic neuroma) NF2 Hs.902 AA213820 0.527765 - - Hs.256533 R34225 0.527765 KIAA0998 protein KIAA0998 Hs.131525 AA040629 0.527765 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); trMLLT6 Hs.349196 R65766 0.527765 SEC22 vesicle trafficking protein-like 1 (S. cerevisiae) SEC22L1 Hs.50785 T75200 0.527765 Hypothetical protein FLJ14566 FLJ14566 Hs.12313 N24302 0.527765 Zinc finger protein 146 ZNF146 Hs.301819 R48321 0.527765 KIAA0450 gene product KIAA0450 Hs.170156 H53410 0.527765 Polymerase (DNA-directed), delta 4 POLD4 Hs.82520 H11615 0.527765 Zinc finger, DHHC domain containing 4 ZDHHC4 Hs.5268 N95220 0.527765 Hypothetical protein MBC3205 MBC3205 Hs.43621 H93832 0.527765 Chromosome 20 open reading frame 16 C20orf16 Hs.92374 R20810 0.527765 Topoisomerase (DNA) I TOP1 Hs.317 R59901 0.527765 Mevalonate kinase (mevalonic aciduria) MVK Hs.130607 R54865 0.527765 Hypothetical protein from EUROIMAGE 2021883 LOC56926 Hs.24983 H22064 0.527765 PHD zinc finger transcription factor PF1 Hs.135890 AA152292 0.541386 Ovarian carcinoma immunoreactive antigen OCIA Hs.132071 AA059128 0.541386 H2A histone family, member Y H2AFY Hs.75258 H38322 0.541386 SET binding factor 1 SBF1 Hs.112049 R27192 0.541386 Putative intramembrane cleaving protease SPPL2A Hs.28980 N45646 0.541386 - -- R53443 0.541386 ESTs ESTs Hs.23691 R96472 0.541386 Hypothetical protein FLJ10276 FLJ10276 Hs.333149 T87888 0.541386 KIAA1046 protein KIAA1046 Hs.89519 N27569 0.541386 - - Hs.218707 H88020 0.541386 ESTs ESTs Hs.114271 AA152026 0.541386 - - Hs.323527 H04597 0.541386 Inner membrane protein, mitochondrial (mitofilin) IMMT Hs.78504 H72617 0.541386 Hypothetical protein FLJ13150 FLJ13150 Hs.169728 N74558 0.541386 Suppression of tumorigenicity 7 ST7 Hs.5814 R79550 0.541386 Lysosomal-associated protein transmembrane 4 alpha LAPTM4A Hs.111894 AA213887 0.541386 Hypothetical protein FLJ21908 FLJ21908 Hs.26750 R94867 0.541386 Ring finger protein 1 RING1 Hs.35384 T75396 0.541386 GMPR2 for guanosine monophosphate reductase isolog LOC51292 Hs.234546 N30177 0.541386 - - Hs.25892 N27188 0.541386 Hypothetical protein from BCRA2 region CG005 Hs.23518 W05091 0.541386 Wilms' tumour 1-associating protein WTAP Hs.119 AA115345 0.541386 Hypothetical protein DKFZp586F2423 DKFZP586F2423 Hs.13659 H92226 0.541386 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, TAF12 Hs.82037 AA028141 0.541386 Pogo transposable element with ZNF domain POGZ Hs.107088 AA033652 0.541386 ATP-dependent RNA helicase MGC2835 Hs.70582 W68734 0.541386 Uncharacterized hematopoietic stem/progenitor cells protein MDS028 MDS028 Hs.29647 H39075 0.541386 Calcium/calmodulin-dependent protein kinase kinase 2, beta CAMKK2 Hs.108708 H53712 0.541386 Protein kinase C, delta PRKCD Hs.155342 H50941 0.541386 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583 H69082 0.541386 KIAA0241 protein KIAA0241 Hs.150275 N23806 0.541386 Similar to envelope protein LOC113386 Hs.132055 N63501 0.541386 YY1 transcription factor YY1 Hs.97496 H19822 0.541386 Leucyl-tRNA synthetase, mitochondrial LARS2 Hs.2450 AA036972 0.541386 Pre-mRNA splicing factor 17 PRP17 Hs.116674 H19984 0.541386 Stromal membrane-associated protein SMAP1 Hs.373517 W46278 0.541386 T-cell activation protein phosphatase 2C TA-PP2C Hs.13854 H50940 0.541386 Nef-associated factor 1 NAF1 Hs.109281 AA037517 0.541386 Chromosome 20 open reading frame 13 C20orf13 Hs.88367 R92026 0.541386 Fracture callus 1 homolog (rat) FXC1 Hs.54943 N90407 0.541386 Ems1 sequence (mammary tumor and squamous cell carcinoma-associated (pEMS1 Hs.119257 AA114905 0.541386 Sperm associated antigen 7 SPAG7 Hs.90436 AA039452 0.541386 YY1 transcription factor YY1 Hs.97496 AA035309 0.541386 Hypothetical protein 20D7-FC4 20D7-FC4 Hs.128702 AA053901 0.541386 - - Hs.60740 H82747 0.541386 ESTs ESTs Hs.295855 AA115581 0.541386 Phosphoglycerate kinase 1 PGK1 Hs.78771 T83724 0.541386 Growth arrest-specific 2 like 1 GAS2L1 Hs.322852 H49479 0.541386 CCR4-NOT transcription complex, subunit 8 CNOT8 Hs.26703 R47931 0.541386 Hypothetical protein DKFZp434M0519 MGC26684 Hs.7001 H17403 0.541386 Hypothetical protein FLJ22318 FLJ22318 Hs.22753 W31293 0.541386 Hypothetical protein FLJ10631 FLJ10631 Hs.238944 H67332 0.541386 GTP binding protein 1 GTPBP1 Hs.283677 AA001116 0.541386 Peroxisomal farnesylated protein PXF Hs.168670 W87701 0.541386 KIAA0981 protein KIAA0981 Hs.158135 T47536 0.541386 Hypothetical protein MGC16924 MGC16924 Hs.85752 AA054522 0.541386 Similar to triple functional domain (PTPRF interacting) LOC115557 Hs.61581 T80727 0.541386 Protease, serine, 25 PRSS25 Hs.115721 AA047678 0.541386 Death associated protein 3 DAP3 Hs.159627 AA134825 0.541386 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 SLC7A6 Hs.10315 W69683 0.541386 Nuclear factor (erythroid-derived 2)-like 1 NFE2L1 Hs.83469 T77588 0.541386 ESTs ESTs Hs.187466 H67809 0.541386 U3 snoRNP-associated 55-kDa protein U3-55K Hs.153768 R72173 0.541386 - -- R19153 0.541386 - - Hs.356751 AA057856 0.541386 ESTs ESTs Hs.63344 N33563 0.541386 Transgelin TAGLN Hs.75777 AA045318 0.541386 Holocytochrome c synthase (cytochrome c heme-lyase) HCCS Hs.211571 AA099608 0.541386 - - Hs.7037 W72903 0.541386 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNDDX9 Hs.74578 AA136882 0.541386 Activin A receptor, type I ACVR1 Hs.150402 R60261 0.541386 Slingshot 2 SSH2 Hs.25127 H26021 0.541386 - - Hs.136235 R55690 0.541386 Ninein (GSK3B interacting protein) NIN Hs.44054 H64513 0.55518 - -- H81680 0.55518 Nucleolar protein ANKT ANKT Hs.279905 N38958 0.55518 CCCTC-binding factor (zinc finger protein) CTCF Hs.57419 R80979 0.55518 Mitogen-activated protein kinase kinase kinase 11 MAP3K11 Hs.89449 H73928 0.55518 Protein translocation complex beta SEC61B Hs.77028 AA099226 0.55518 - - Hs.356377 N46725 0.55518 Hypothetical protein FLJ22679 FLJ22679 Hs.5472 N44176 0.55518 Hypothetical protein MGC2865 MGC2865 Hs.94814 AA039275 0.55518 - - Hs.125073 H80258 0.55518 - - Hs.41352 R18357 0.55518 KIAA1045 protein KIAA1045 Hs.7989 H25699 0.55518 Opa-interacting protein 2 OIP2 Hs.274170 N27829 0.55518 Hypothetical protein BC013035 LOC114926 Hs.10018 R72606 0.55518 Hypothetical protein FLJ20457 FLJ20457 Hs.29276 N93442 0.55518 - -- R52847 0.55518 - -- W72937 0.55518 Caldesmon 1 CALD1 Hs.325474 W67471 0.55518 Ras homolog gene family, member B ARHB Hs.204354 N25190 0.55518 Glutathione peroxidase 1 GPX1 Hs.76686 W88447 0.55518 Cell growth regulatory with ring finger domain CGR19 Hs.59106 N93559 0.55518 Tyrosine kinase 2 TYK2 Hs.75516 H26570 0.55518 V-akt murine thymoma viral oncogene homolog 2 AKT2 Hs.326445 N49737 0.55518 DKFZp434K114 protein DKFZp434K114 Hs.6107 AA101787 0.55518 Hypothetical protein FLJ20442 FLJ20442 Hs.55505 N47087 0.55518 Polymerase (RNA) II (DNA directed) polypeptide C, 33kDa POLR2C Hs.79402 H23264 0.55518 - - Hs.13781 T58690 0.55518 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39 DDX39 Hs.311609 T53682 0.55518 Gene predicted from cDNA with a complete coding sequence KIAA0110 Hs.124 N29018 0.55518 - -- W15595 0.55518 Coactivator for steroid receptors COASTER Hs.172329 W47073 0.55518 Solute carrier family 20 (phosphate transporter), member 1 SLC20A1 Hs.78452 N25636 0.55518 Esterase D/formylglutathione hydrolase ESD Hs.82193 R50785 0.55518 Tubulin, gamma complex associated protein 6 TUBGCP6 Hs.336431 H23269 0.55518 Vacuolar protein sorting 41 (yeast) VPS41 Hs.180941 H27559 0.55518 Conserved gene telomeric to alpha globin cluster CGTHBA Hs.19699 H16467 0.55518 Sorting nexin 11 SNX11 Hs.15827 R67239 0.55518 Bromodomain adjacent to zinc finger domain, 2A BAZ2A Hs.277401 AA029050 0.55518 - -- R14063 0.55518 Hypothetical protein DKFZp586M1819 DKFZp586M1819 Hs.355753 T83747 0.55518 - -- AA147535 0.55518 Retinoic acid induced 1 RAI1 Hs.110953 R55787 0.55518 KIAA1069 protein KIAA1069 Hs.193143 N66086 0.55518 - - Hs.350534 N35908 0.55518 - - Hs.171553 R53559 0.55518 Non-metastatic cells 1, protein (NM23A) expressed in NME1 Hs.118638 N58514 0.55518 Mitochondrial Acyl-CoA Thioesterase MT-ACT48 Hs.18625 T80020 0.55518 Microtubule-associated protein 4 MAP4 Hs.239298 N74655 0.55518 ESTs ESTs Hs.35064 R60915 0.55518 Growth suppressor 1 GROS1 Hs.10114 N70291 0.55518 Apolipoprotein A-II APOA2 Hs.237658 T92561 0.55518 Suppression of tumorigenicity 7 ST7 Hs.5814 R82668 0.55518 Hypothetical protein MGC2577 MGC2577 Hs.30114 R53743 0.55518 Ankyrin 3, node of Ranvier (ankyrin G) ANK3 Hs.75893 AA130374 0.55518 - -- AA043491 0.55518 Chromosome 6 open reading frame 1 C6orf1 Hs.62620 T92153 0.55518 - -- AA039602 0.55518 Hypothetical protein HSPC216 HSPC216 Hs.13525 W24560 0.55518 Pleiomorphic adenoma gene-like 2 PLAGL2 Hs.154104 N94610 0.55518 Hypothetical protein BC010734 LOC147632 Hs.48821 AA009672 0.55518 Tyrosine kinase 2 TYK2 Hs.75516 H61280 0.55518 - -- H16254 0.55518 Pannexin 1 PANX1 Hs.30985 R96178 0.55518 - -- AA043764 0.55518 Putative nucleic acid binding protein RY-1 RY1 Hs.54649 R67214 0.55518 MAD, mothers against decapentaplegic homolog 4 (Drosophila) MADH4 Hs.75862 N39072 0.55518 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypepGNAI1 Hs.203862 N36953 0.55518 Deoxycytidine kinase DCK Hs.709 H88208 0.55518 Suppressor of var1, 3-like 1 (S. cerevisiae) SUPV3L1 Hs.106469 AA122364 0.55518 Receptor tyrosine kinase-like orphan receptor 2 ROR2 Hs.155585 H18310 0.55518 Ecotropic viral integration site 5 EVI5 Hs.179747 H10327 0.55518 - - Hs.374418 H57835 0.55518 Hypothetical protein LOC51240 LOC51240 Hs.7870 AA007617 0.55518 Hypothetical protein AD034 AD034 Hs.281397 W46869 0.55518 - - Hs.356699 N62617 0.55518 Hypothetical protein CL640 CL640 Hs.44563 R83613 0.55518 Cyclin G associated kinase GAK Hs.153227 R02581 0.55518 F-box only protein 9 FBXO9 Hs.11050 N48827 0.55518 FLJ23277 protein FLJ23277 Hs.334477 R88526 0.55518 Scotin SCOTIN Hs.24220 R63806 0.55518 Likely ortholog of mouse heat shock protein, 70 kDa 4 LOC51182 Hs.44581 AA142986 0.55518 Hypothetical protein FLJ11294 FLJ11294 Hs.107000 R39875 0.55518 - -- AA044730 0.55518 FLJ23277 protein FLJ23277 Hs.334477 T69714 0.569143 Polymerase (DNA directed), beta POLB Hs.180107 H50923 0.569143 KIAA0747 protein KIAA0747 Hs.8309 N77380 0.569143 ESTs ESTs Hs.19918 T74462 0.569143 Transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) TAP1 Hs.352018 N68959 0.569143 Adenylate cyclase 6 ADCY6 Hs.12373 W58034 0.569143 Small nuclear ribonucleoprotein polypeptide A' SNRPA1 Hs.80506 R59976 0.569143 KIAA1831 protein KIAA1831 Hs.26714 R88085 0.569143 Quiescin Q6 QSCN6 Hs.77266 R31243 0.569143 Multiple endocrine neoplasia I MEN1 Hs.240443 N29431 0.569143 NEDD8 ultimate buster-1 LOC51667 Hs.279780 H05532 0.569143 Hypothetical protein BC004501 LOC90231 Hs.110906 AA213442 0.569143 ESTs ESTs Hs.148000 W37533 0.569143 Hexokinase 1 HK1 Hs.118625 H75548 0.569143 Tumor protein p53 binding protein, 1 TP53BP1 Hs.170263 H24891 0.569143 - - Hs.293663 W72933 0.569143 Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor)SFRS1 Hs.73737 H62445 0.569143 - -- H52696 0.569143 Hypothetical protein FLJ10101 FLJ10101 Hs.334802 R20374 0.569143 Chromatin assembly factor 1, subunit B (p60) CHAF1B Hs.75238 T94898 0.569143 Hypothetical protein SP192 SP192 Hs.169854 H10452 0.569143 Insulin-like growth factor 1 receptor IGF1R Hs.239176 H16773 0.569143 - - Hs.12245 H43546 0.569143 ESTs ESTs Hs.30258 R59970 0.569143 GABA(A) receptor-associated protein like 1 GABARAPL1 Hs.336429 AA039528 0.569143 - - Hs.37858 H14054 0.569143 Beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) B3GAT3 Hs.26492 R62751 0.569143 Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)SSA1 Hs.1042 H12710 0.569143 KIAA0802 protein KIAA0802 Hs.27657 R59471 0.569143 Protein phosphatase 2A, regulatory subunit B' (PR 53) PPP2R4 Hs.236963 H45196 0.569143 Rho/rac guanine nucleotide exchange factor (GEF) 2 ARHGEF2 Hs.337774 H87111 0.569143 Hypothetical protein FLJ11011 FLJ11011 Hs.21275 R27994 0.569143 - - Hs.83086 N91541 0.569143 Non-metastatic cells 1, protein (NM23A) expressed in NME1 Hs.118638 R22945 0.569143 Hypothetical protein FLJ14511 FLJ14511 Hs.40919 T79365 0.569143 - -- W07427 0.569143 - - Hs.380100 AA156746 0.569143 FLJ00005 protein FLJ00005 Hs.367690 H16830 0.569143 Hypothetical protein FLJ10374 FLJ10374 Hs.21811 AA148608 0.569143 - -- H89555 0.569143 Hypothetical protein FLJ34588 FLJ34588 Hs.375580 H25547 0.569143 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34 DDX34 Hs.151706 R25217 0.569143 Surfeit 6 SURF6 Hs.274430 T75250 0.569143 COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) COPS7B Hs.114432 H85464 0.569143 Deleted in split-hand/split-foot 1 region DSS1 Hs.333495 AA069444 0.569143 Dicer1, Dcr-1 homolog (Drosophila) DICER1 Hs.87889 N35505 0.569143 Ras homolog gene family, member E ARHE Hs.6838 AA043926 0.569143 Tumor necrosis factor receptor superfamily, member 1A TNFRSF1A Hs.159 AA010246 0.569143 Hypothetical protein FLJ10890 FLJ10890 Hs.17283 R77028 0.569143 Lymphotoxin beta receptor (TNFR superfamily, member 3) LTBR Hs.1116 AA142965 0.569143 Protein kinase C binding protein 1 PRKCBP1 Hs.75871 AA193482 0.569143 Hypothetical protein FLJ12287 similar to semaphorins FLJ12287 Hs.7634 AA150246 0.569143 Protein kinase Njmu-R1 NJMU-R1 Hs.9800 H88088 0.569143 Serine/threonine kinase 3 (STE20 homolog, yeast) STK3 Hs.166684 AA115529 0.569143 - - Hs.134202 H58750 0.569143 Similar to RIKEN cDNA 2610030J16 gene MGC2541 Hs.173103 N48895 0.569143 F-box DNA helicase 1 FBH1 Hs.6193 R34387 0.569143 Fatty acid amide hydrolase FAAH Hs.288828 R66676 0.569143 Ets variant gene 5 (ets-related molecule) ETV5 Hs.43697 R20594 0.569143 Glutathione S-transferase M4 GSTM4 Hs.348387 AA156866 0.569143 Uncharacterized bone marrow protein BM045 BM045 Hs.8750 W40330 0.569143 G1 to S phase transition 1 GSPT1 Hs.2707 H79184 0.569143 Hypothetical protein FLJ14981 FLJ14981 Hs.76925 H50029 0.569143 Ubiquitin-conjugating enzyme E2 variant 1 UBE2V1 Hs.75875 T83106 0.569143 Chemokine-like factor 1 CKLF1 Hs.15159 AA044810 0.569143 KIAA0547 gene product KIAA0547 Hs.200596 H81063 0.569143 Citrate synthase CS Hs.239760 W73506 0.583272 Activated RNA polymerase II transcription cofactor 4 PC4 Hs.349506 H08969 0.583272 Hypothetical protein FLJ12529 FLJ12529 Hs.169100 R34257 0.583272 Hepatocyte growth factor-regulated tyrosine kinase substrate HGS Hs.24756 R85099 0.583272 ADP-ribosylation factor 3 ARF3 Hs.119177 T65437 0.583272 R3H domain (binds single-stranded nucleic acids) containing R3HDM Hs.268053 W40409 0.583272 Lysyl-tRNA synthetase KARS Hs.3100 N32572 0.583272 Hypothetical protein FLJ20291 FLJ20291 Hs.8928 N26563 0.583272 Second mitochondria-derived activator of caspase SMAC Hs.169611 AA039596 0.583272 Hypothetical protein FLJ21308 FLJ21308 Hs.29977 R24850 0.583272 - -- AA151625 0.583272 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742 R72865 0.583272 KIAA1285 protein KIAA1285 Hs.119175 R13813 0.583272 Growth factor receptor-bound protein 2 GRB2 Hs.381152 H49289 0.583272 Actin, alpha 2, smooth muscle, aorta ACTA2 Hs.195851 R25125 0.583272 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa NDUFC2 Hs.193313 H71737 0.583272 - -- R91908 0.583272 Transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) TLE1 Hs.28935 N31486 0.583272 Hypothetical protein FLJ37562 FLJ37562 Hs.356734 AA058398 0.583272 - - Hs.6670 N69097 0.583272 - -- AA101984 0.583272 G-protein coupled receptor RE2 Hs.301642 W81709 0.583272 Ornithine aminotransferase (gyrate atrophy) OAT Hs.75485 AA004506 0.583272 LanC lantibiotic synthetase component C-like 2 (bacterial) LANCL2 Hs.134342 H13694 0.583272 Sec15B protein SEC15B Hs.44175 R91278 0.583272 - -- AA039927 0.583272 - - Hs.356843 R43198 0.583272 Nuclear factor (erythroid-derived 2)-like 3 NFE2L3 Hs.22900 N26050 0.583272 Polymyositis/scleroderma autoantigen 1, 75kDa PMSCL1 Hs.91728 R42552 0.583272 ESTs ESTs Hs.351142 H57367 0.583272 - - Hs.335274 H81987 0.583272 - - Hs.117907 AA039224 0.583272 Hypothetical protein MGC14817 MGC14817 Hs.124813 AA059131 0.583272 BTB (POZ) domain containing 1 BTBD1 Hs.21332 AA147010 0.583272 Hypothetical protein BC015148 LOC93081 Hs.13413 AA026354 0.583272 - -- W58007 0.583272 KIAA0222 gene product KIAA0222 Hs.48450 H71112 0.583272 MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae) MCM2 Hs.57101 W94575 0.583272 Cathepsin H CTSH Hs.288181 R72851 0.583272 Phosphatidylinositol glycan, class S PIGS Hs.347950 R72425 0.583272 HLA-B associated transcript 1 BAT1 Hs.55296 AA129848 0.583272 Exosome component Rrp41 FLJ20591 Hs.343589 T86121 0.583272 ESTs ESTs Hs.191445 W01524 0.583272 Splicing factor, arginine/serine-rich 11 SFRS11 Hs.11482 AA005130 0.583272 Chromosome 7 open reading frame 2 C7orf2 Hs.107537 R61777 0.583272 Hypothetical protein MGC14421 MGC14421 Hs.334713 T53417 0.583272 Purinergic receptor P2X, ligand-gated ion channel, 4 P2RX4 Hs.321709 W25075 0.583272 Hypothetical protein MGC23908 MGC23908 Hs.93748 AA029275 0.583272 HTPAP protein HTPAP Hs.169341 R12917 0.583272 - - Hs.21195 R14543 0.583272 KIAA1500 protein KIAA1500 Hs.15420 N22229 0.583272 Protein phosphatase 1, catalytic subunit, gamma isoform PPP1CC Hs.79081 N93294 0.583272 KIAA0076 gene product KIAA0076 Hs.51039 N36628 0.583272 - - Hs.233382 N50068 0.583272 - - Hs.356733 H25911 0.583272 - -- R19166 0.583272 ESTs ESTs Hs.91401 AA156864 0.583272 Hypothetical protein IMAGE3455200 IMAGE3455200 Hs.324844 H43564 0.583272 COX15 homolog, cytochrome c oxidase assembly protein (yeast) COX15 Hs.226581 R15335 0.583272 Importin 4 FLJ23338 Hs.61790 N94435 0.583272 LYST-interacting protein LIP8 LIP8 Hs.348012 H16689 0.583272 RNA binding motif protein 8A RBM8A Hs.10283 R79684 0.583272 KIAA1805 protein KIAA1805 Hs.294122 AA148720 0.583272 PTPL1-associated RhoGAP 1 PARG1 Hs.70983 AA057398 0.583272 - -- R80193 0.583272 Zinc finger protein 261 ZNF261 Hs.9568 AA010162 0.583272 Frizzled homolog 1 (Drosophila) FZD1 Hs.94234 W37098 0.583272 Fukuyama type congenital muscular dystrophy (fukutin) FCMD Hs.55777 N33193 0.583272 Glioma-amplified sequence-41 GAS41 Hs.4029 N93225 0.583272 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919 H46019 0.583272 Hypothetical protein FLJ10201 FLJ10201 Hs.318127 AA011675 0.583272 Adaptor-related protein complex 1, sigma 1 subunit AP1S1 Hs.57600 N51794 0.583272 Transforming growth factor, beta-induced, 68kDa TGFBI Hs.118787 N25631 0.583272 Regulatory factor X-associated ankyrin-containing protein RFXANK Hs.296776 R00553 0.583272 - - Hs.270347 H15020 0.583272 GCN1 general control of amino-acid synthesis 1-like 1 (yeast) GCN1L1 Hs.75354 H68441 0.597562 Hypothetical protein FLJ14054 FLJ14054 Hs.13528 AA057261 0.597562 KIAA0240 protein KIAA0240 Hs.196275 R48937 0.597562 - - Hs.334606 R20820 0.597562 ESTs ESTs Hs.171487 N94606 0.597562 HSCARG protein HSCARG Hs.288969 N47851 0.597562 - -- H90090 0.597562 DKFZP564G0222 protein DKFZP564G0222 Hs.13370 R35160 0.597562 Insulin-like growth factor 2 receptor IGF2R Hs.76473 R42777 0.597562 - - Hs.22216 AA035226 0.597562 KIAA1542 protein KIAA1542 Hs.130541 N67477 0.597562 - - Hs.281561 R74114 0.597562 - - Hs.285833 N71548 0.597562 CDC42 binding protein kinase beta (DMPK-like) CDC42BPB Hs.12908 H75346 0.597562 ESTs ESTs Hs.294014 N90249 0.597562 Protein phosphatase 1, regulatory subunit 10 PPP1R10 Hs.106019 T78869 0.597562 ESTs ESTs Hs.182898 R71048 0.597562 Glycolipid transfer protein GLTP Hs.381256 N72505 0.597562 Hypothetical protein MGC5508 MGC5508 Hs.13662 AA011654 0.597562 KIAA1458 protein KIAA1458 Hs.27263 H00222 0.597562 XPA binding protein 1; putative ATP(GTP)-binding protein NTPBP Hs.18259 H59174 0.597562 Hypothetical protein MGC19556 MGC19556 Hs.334787 N98261 0.597562 Guanine nucleotide binding protein (G protein), beta polypeptide 2 GNB2 Hs.91299 R93504 0.597562 Rag C protein GTR2 Hs.110950 W47099 0.597562 CGI-63 protein LOC51102 Hs.19513 R35372 0.597562 Tetracycline transporter-like protein TETRAN Hs.157145 W04244 0.597562 ESTs ESTs Hs.49829 R25121 0.597562 Uncharacterized hypothalamus protein HCDASE LOC55862 Hs.239218 AA156753 0.597562 Chromosome 14 open reading frame 3 C14orf3 Hs.204041 AA192730 0.597562 - -- N73289 0.597562 - -- N21661 0.597562 BMP-2 inducible kinase BIKE Hs.20137 N94625 0.597562 Protein x 013 AD-020 Hs.82933 R56495 0.597562 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma IKBKG Hs.43505 H11639 0.597562 SH2-B homolog SH2B Hs.15744 W86364 0.597562 ESTs ESTs Hs.58819 N69470 0.597562 Hypothetical protein FLJ10569 FLJ10569 Hs.5105 AA036631 0.597562 Esophageal cancer related gene 4 protein ECRG4 Hs.43125 H11243 0.597562 Bromodomain containing 1 BRD1 Hs.127950 H64625 0.597562 Coproporphyrinogen oxidase (coproporphyria, harderoporphyria) CPO Hs.89866 N36068 0.597562 Nit protein 2 NIT2 Hs.15627 R21449 0.597562 Heterogeneous nuclear ribonucleoprotein K HNRPK Hs.129548 H70778 0.597562 Cell division cycle associated 4 CDCA4 Hs.34045 AA043293 0.597562 Hypothetical protein DT1P1A10 DT1P1A10 Hs.178207 H06932 0.597562 Mitochondrial ribosomal protein L20 MRPL20 Hs.182698 H81760 0.597562 - - Hs.40289 AA055185 0.597562 Splicing factor, arginine/serine-rich 4 SFRS4 Hs.76122 R48060 0.597562 DKFZP564O243 protein DKFZP564O243 Hs.92700 N75518 0.597562 Translocated promoter region (to activated MET oncogene) TPR Hs.169750 W47533 0.597562 A disintegrin and metalloproteinase domain 9 (meltrin gamma) ADAM9 Hs.2442 R61688 0.597562 ATP-binding cassette, sub-family A (ABC1), member 2 ABCA2 Hs.94806 N50370 0.597562 - - Hs.178485 AA029012 0.597562 SMA3 SMA3 Hs.289061 N43796 0.597562 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 ATP6V0D1 Hs.106876 R01336 0.597562 - - Hs.19150 H59203 0.597562 CDC6 cell division cycle 6 homolog (S. cerevisiae) CDC6 Hs.69563 AA037624 0.597562 Hypothetical protein MGC5242 MGC5242 Hs.77365 H28453 0.597562 Hypothetical protein MGC4840 MGC4840 Hs.301872 AA146850 0.597562 - -- N55327 0.597562 Geminin, DNA replication inhibitor GMNN Hs.234896 H26802 0.597562 - - Hs.352614 R34842 0.597562 ESTs ESTs Hs.24185 AA042813 0.597562 Olfactory receptor, family 7, subfamily E, member 38 pseudogene OR7E38P Hs.120017 AA045295 0.597562 - - Hs.376116 H66409 0.597562 ESTs ESTs Hs.108275 R20578 0.597562 ESTs ESTs Hs.90431 W40184 0.597562 Solute carrier family 25 (mitochondrial carrier, Aralar), member 12 SLC25A12 Hs.179866 H63353 0.597562 Hypothetical protein HSPC242 HSPC242 Hs.25199 AA039905 0.597562 Myosin, heavy polypeptide 9, non-muscle MYH9 Hs.146550 H59207 0.597562 SudD suppressor of bimD6 homolog (A. nidulans) SUDD Hs.209061 AA150898 0.597562 FK506 binding protein 9, 63 kDa FKBP9 Hs.302749 N90291 0.597562 DKFZP564J0863 protein DKFZP564J0863 Hs.333403 H16663 0.597562 HSPC049 protein HSPC049 Hs.172622 AA005195 0.597562 Serine/threonine kinase 36 (fused homolog, Drosophila) STK36 Hs.26996 H96934 0.597562 ESTs ESTs Hs.136246 R31387 0.597562 - -- H99570 0.597562 ESTs ESTs Hs.337736 AA099075 0.597562 Single stranded DNA binding protein 3 SSBP3 Hs.266914 T80433 0.597562 HSKM-B protein HSKM-B Hs.66170 AA147503 0.597562 Homolog of yeast ribosome biogenesis regulatory protein RRS1 RRS1 Hs.71827 W51783 0.597562 Argininosuccinate lyase ASL Hs.61258 W60489 0.597562 ESTs ESTs Hs.12253 R38964 0.597562 - -- H09314 0.597562 Protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform PPP2CA Hs.91773 H79411 0.597562 CDC10 cell division cycle 10 homolog (S. cerevisiae) CDC10 Hs.184326 AA004891 0.597562 Ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) UBE2H Hs.372758 N39255 0.597562 Butyrophilin, subfamily 3, member A2 BTN3A2 Hs.87497 AA029014 0.597562 ESTs ESTs Hs.58373 N62518 0.597562 CD22 antigen CD22 Hs.171763 R79279 0.597562 Zinc finger protein 226 ZNF226 Hs.145956 R34513 0.597562 KIAA1468 protein KIAA1468 Hs.23542 N20900 0.612009 ESTs ESTs Hs.32163 AA213820 0.612009 - - Hs.256533 N99927 0.612009 Beta-1,4 mannosyltransferase HMT-1 Hs.44592 AA033871 0.612009 Methionine adenosyltransferase II, alpha MAT2A Hs.77502 T89566 0.612009 ESTs ESTs Hs.16586 AA053850 0.612009 Nucleosome assembly protein 1-like 1 NAP1L1 Hs.302649 W23595 0.612009 HDCMA18P protein HDCMA18P Hs.278635 AA010467 0.612009 Lysyl oxidase-like 1 LOXL1 Hs.65436 AA045081 0.612009 Hypothetical protein FLJ21742 FLJ21742 Hs.306809 H93344 0.612009 - - Hs.41877 R23251 0.612009 Not56 (D. melanogaster)-like protein NOT56L Hs.153591 AA035066 0.612009 Hypothetical protein MGC4268 MGC4268 Hs.22708 W56434 0.612009 ESTs ESTs Hs.201608 AA056762 0.612009 - -- N24066 0.612009 Cold shock domain protein A CSDA Hs.198726 W24852 0.612009 COX11 homolog, cytochrome c oxidase assembly protein (yeast) COX11 Hs.241515 H90078 0.612009 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 ABCC5 Hs.108660 H09452 0.612009 Hypothetical protein MGC13007 MGC13007 Hs.332382 T92003 0.612009 - -- R00749 0.612009 - - Hs.17240 W47189 0.612009 HSPC041 protein LOC51125 Hs.7953 H56572 0.612009 Proteasome activator 200 kDa PA200 Hs.112396 AA044645 0.612009 Hypothetical protein FLJ21127 FLJ21127 Hs.351440 H51376 0.612009 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 PSMD11 Hs.90744 H70392 0.612009 ATP-dependent RNA helicase ROK1 Hs.380430 H21078 0.612009 Makorin, ring finger protein, 2 MKRN2 Hs.279474 R28340 0.612009 MYC-associated zinc finger protein (purine-binding transcription factor) MAZ Hs.7647 H51648 0.612009 Similar to RIKEN cDNA 4933424N09 gene MGC16943 Hs.248437 T84043 0.612009 Chromosome 1 open reading frame 6 C1orf6 Hs.283739 T97149 0.612009 KIAA1533 protein KIAA1533 Hs.83575 N90248 0.612009 Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) ST13 Hs.119222 N68307 0.612009 - - Hs.381077 W52940 0.612009 MIL1 protein MIL1 Hs.10267 H54691 0.612009 Rho guanine nucleotide exchange factor (GEF) 12 ARHGEF12 Hs.6582 R49307 0.612009 Formin 2 FMN2 Hs.24889 R89118 0.612009 Alpha-fetoprotein AFP Hs.155421 W32377 0.612009 Methylmalonyl Coenzyme A mutase MUT Hs.155212 R88122 0.612009 Pericentriolar material 1 PCM1 Hs.75737 R16206 0.612009 - -- R05624 0.612009 - - Hs.293993 W69156 0.612009 KIAA0095 gene product KIAA0095 Hs.155314 R06572 0.612009 Hypothetical protein MGC2550 MGC2550 Hs.169575 T79631 0.612009 ESTs ESTs Hs.374458 T80488 0.612009 Suppressor of Ty 6 homolog (S. cerevisiae) SUPT6H Hs.12303 H16544 0.612009 Autocrine motility factor receptor AMFR Hs.80731 H45110 0.612009 Immediate early response 5 IER5 Hs.15725 H69440 0.612009 NY-REN-25 antigen NY-REN-25 Hs.15301 AA046951 0.612009 Insulinoma-associated protein IA-6 INSM2 Hs.62813 N30625 0.612009 - - Hs.44205 W02039 0.612009 Agouti signaling protein, nonagouti homolog (mouse) ASIP Hs.361642 H52714 0.612009 Ubinuclein 1 UBN1 Hs.21479 R17859 0.612009 DKFZP434C131 protein DKFZP434C131 Hs.7978 H69321 0.612009 Interleukin 14 IL14 Hs.83004 T81538 0.612009 MADS box transcription enhancer factor 2, polypeptide B (myocyte enhancer faMEF2B Hs.78881 R20435 0.612009 ESTs ESTs Hs.167361 N71529 0.612009 - - Hs.183779 R60081 0.612009 - -- R83815 0.612009 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein ID2 Hs.180919 AA136692 0.612009 Transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) TLE3 Hs.287362 H12586 0.612009 Nuclear cap binding protein subunit 1, 80kDa NCBP1 Hs.89563 H15988 0.612009 - - Hs.27048 AA010929 0.612009 N-methylpurine-DNA glycosylase MPG Hs.79396 H85608 0.612009 Protein phosphatase 1, regulatory (inhibitor) subunit 2 PPP1R2 Hs.267819 N93517 0.612009 - - Hs.67317 N53292 0.612009 - - Hs.374344 N20343 0.612009 - -- N36898 0.612009 Similar to rat nuclear ubiquitous casein kinase 2 NUCKS Hs.118064 H41889 0.612009 - - Hs.315270 R66080 0.612009 KIAA1530 protein KIAA1530 Hs.191268 T79185 0.612009 - -- R13700 0.612009 Hypothetical protein MGC5442 MGC5442 Hs.238513 R16987 0.626609 Secretory protein SEC8 SEC8 Hs.107394 R69570 0.626609 Oxysterol binding protein-like 3 OSBPL3 Hs.197955 W00952 0.626609 ESTs ESTs Hs.118163 H77388 0.626609 - - Hs.356560 H99625 0.626609 Histone acetyltransferase HBOA Hs.21907 W31460 0.626609 Aldehyde dehydrogenase 9 family, member A1 ALDH9A1 Hs.2533 R46208 0.626609 PL6 protein PL6 Hs.91566 N99008 0.626609 DnaJ (Hsp40) homolog, subfamily A, member 1 DNAJA1 Hs.94 N50326 0.626609 Hypothetical protein MGC16063 MGC16063 Hs.288544 H06950 0.626609 SMC4 structural maintenance of chromosomes 4-like 1 (yeast) SMC4L1 Hs.50758 R18171 0.626609 Shroom-related protein ShrmL Hs.278628 AA120840 0.626609 ESTs ESTs Hs.323473 N79725 0.626609 Mitochondrial translational initiation factor 2 MTIF2 Hs.149894 T83158 0.626609 Hypothetical protein DJ328E19.C1.1 DJ328E19.C1.1 Hs.218329 AA041283 0.626609 Unc-51-like kinase 1 (C. elegans) ULK1 Hs.47061 N62554 0.626609 Hypothetical protein FLJ39514 FLJ39514 Hs.48565 N27544 0.626609 Cell division cycle 27 CDC27 Hs.172405 H13889 0.626609 - - Hs.259347 R06046 0.626609 KIAA1143 protein KIAA1143 Hs.173042 T81338 0.626609 Trans-golgi network protein 2 TGOLN2 Hs.14894 H58438 0.626609 High-mobility group 20B HMG20B Hs.32317 H95396 0.626609 Elongation factor-2 kinase EEF2K Hs.259855 H20790 0.626609 - - Hs.352590 H00660 0.626609 - - Hs.313342 R64299 0.626609 ESTs ESTs Hs.28507 R22673 0.626609 Chromosome 16 open reading frame 5 C16orf5 Hs.7765 W92898 0.626609 RAE1 RNA export 1 homolog (S. pombe) RAE1 Hs.196209 R43900 0.626609 Calcineurin binding protein 1 CABIN1 Hs.7840 AA045241 0.626609 Hypothetical protein FLJ12118 FLJ12118 Hs.381043 N32803 0.626609 KIAA0494 gene product KIAA0494 Hs.62515 R11714 0.626609 ESTs ESTs Hs.295334 T96942 0.626609 Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial ECHS1 Hs.76394 W93073 0.626609 - - Hs.269180 R08892 0.626609 Hypothetical protein MGC4692 MGC4692 Hs.13561 AA037760 0.626609 Hypothetical protein MGC1203 MGC1203 Hs.17987 T79789 0.626609 ESTs ESTs Hs.154701 H84980 0.626609 Tripartite motif-containing 11 TRIM11 Hs.13543 R67199 0.626609 Ubinuclein 1 UBN1 Hs.21479 T83953 0.626609 Similar to arginyl-tRNA synthetase LOC57038 Hs.15395 H13517 0.626609 ADP-ribosylation factor-like 5 ARL5 Hs.342849 R47912 0.626609 - - Hs.17567 R12657 0.626609 Platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa PAFAH1B3 Hs.6793 R70783 0.626609 BCL2-like 2 BCL2L2 Hs.75244 R64681 0.626609 SPPL3 SPPL3 Hs.21143 AA203338 0.626609 Hypothetical SBBI03 protein SBB103 Hs.153639 H92049 0.626609 LPS-responsive vesicle trafficking, beach and anchor containing LRBA Hs.62354 AA040028 0.626609 Hypothetical protein BC014641 LOC129138 Hs.135259 W58334 0.626609 Hydroxyacyl glutathione hydrolase HAGH Hs.155482 T89676 0.626609 Plasminogen activator, urokinase PLAU Hs.77274 N89606 0.626609 Mitochondrial ribosomal protein S36 MRPS36 Hs.41182 N31931 0.626609 - -- T65539 0.626609 Kinesin heavy chain member 2 KIF2 Hs.113319 N39391 0.626609 Hypothetical protein MGC14799 MGC14799 Hs.333166 R31945 0.626609 Chondroitin sulfate proteoglycan 6 (bamacan) CSPG6 Hs.24485 R88887 0.626609 FLJ00005 protein FLJ00005 Hs.367690 W31553 0.626609 Choline kinase-like CHKL Hs.154886 R60393 0.626609 Makorin, ring finger protein, 2 MKRN2 Hs.279474 N45518 0.626609 NCK-associated protein 1 NCKAP1 Hs.278411 R28329 0.626609 Hypothetical protein MGC16063 MGC16063 Hs.288544 N42424 0.626609 RAB3 GTPase-ACTIVATING PROTEIN RAB3GAP Hs.227881 R06175 0.626609 BCL2/adenovirus E1B 19kDa interacting protein 3 BNIP3 Hs.79428 T89503 0.626609 Hypothetical protein FLJ14166 FLJ14166 Hs.14070 N78568 0.626609 - - Hs.288671 AA142976 0.626609 - - Hs.177781 R52852 0.626609 - - Hs.355780 N66243 0.626609 ESTs ESTs Hs.26575 AA028907 0.626609 - - Hs.34447 H50978 0.626609 ATP-binding cassette, sub-family D (ALD), member 4 ABCD4 Hs.94395 AA037128 0.626609 Cisplatin resistance related protein CRR9p CRR9 Hs.323769 N75375 0.626609 - -- H15341 0.626609 Phosphoribosyl pyrophosphate synthetase 2 PRPS2 Hs.2910 H88042 0.626609 - -- H69511 0.626609 Hypothetical protein FLJ38975 FLJ38975 Hs.27769 R64079 0.626609 KIAA0592 protein KIAA0592 Hs.13273 AA069532 0.626609 - - Hs.287955 H96724 0.626609 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) DAB2 Hs.81988 AA036978 0.626609 Chromosome 20 open reading frame 27 C20orf27 Hs.274422 R97175 0.641357 - - Hs.110783 R34645 0.641357 Kinesin family member 13A KIF13A Hs.146286 W40235 0.641357 Heat shock 105kD HSP105B Hs.36927 H78479 0.641357 Thioredoxin-like 2 TXNL2 Hs.42644 N93335 0.641357 DKFZP566C243 protein DKFZP566C243 Hs.107747 N26672 0.641357 CD83 antigen (activated B lymphocytes, immunoglobulin superfamily) CD83 Hs.79197 N41921 0.641357 - - Hs.33264 R22218 0.641357 Hypothetical protein FLJ10983 FLJ10983 Hs.23363 AA127218 0.641357 ESTs ESTs Hs.71058 N45602 0.641357 - - Hs.250824 N52336 0.641357 Aryl-hydrocarbon receptor nuclear translocator 2 ARNT2 Hs.6111 N92357 0.641357 - - Hs.311977 T65557 0.641357 Dual specificity phosphatase 6 DUSP6 Hs.180383 H05378 0.641357 Down syndrome critical region gene 3 DSCR3 Hs.26146 AA037661 0.641357 - -- N28734 0.641357 Ring finger protein (C3H2C3 type) 6 RNF6 Hs.32597 T93597 0.641357 ESTs ESTs Hs.187429 T50061 0.641357 - -- T97966 0.641357 - -- R42555 0.641357 KIAA0494 gene product KIAA0494 Hs.62515 W92124 0.641357 Hypothetical protein MGC12981 MGC12981 Hs.104203 AA039437 0.641357 Solute carrier family 39 (zinc transporter), member 1 SLC39A1 Hs.7854 N75519 0.641357 - - Hs.367854 T81551 0.641357 - - Hs.380093 H15158 0.641357 HSPC166 protein HSPC166 Hs.279836 W39327 0.641357 LIM domain binding 1 LDB1 Hs.26002 AA054041 0.641357 Protein kinase C substrate 80K-H PRKCSH Hs.1432 N92858 0.641357 U6 snRNA-associated Sm-like protein LSM4 Hs.76719 AA149634 0.641357 - - Hs.182545 AA036844 0.641357 - - Hs.20000 R37898 0.641357 Interleukin 1 receptor accessory protein IL1RAP Hs.173880 W46682 0.641357 ESTs ESTs Hs.21475 W55903 0.641357 Adipose differentiation-related protein ADFP Hs.3416 N69648 0.641357 - - Hs.269135 H79311 0.641357 - -- R17860 0.641357 - - Hs.288361 AA131322 0.641357 Tryptase beta 1 TPSB1 Hs.347933 N31931 0.641357 - -- R45593 0.641357 FLN29 gene product FLN29 Hs.5148 W24575 0.641357 WW domain binding protein 1 WBP1 Hs.375564 AA040295 0.641357 Formin homology 2 domain containing 1 FHOD1 Hs.95231 AA026302 0.641357 Myeloid leukemia factor 1 MLF1 Hs.85195 AA135332 0.641357 ESTs ESTs Hs.71608 H11653 0.641357 - -- AA044588 0.641357 Hypothetical protein FLJ11171 FLJ11171 Hs.72782 T87589 0.641357 Coagulation factor VIII-associated (intronic transcript) F8A Hs.83363 R83637 0.641357 KIAA1204 protein KIAA1204 Hs.300670 AA152194 0.641357 Hypothetical protein FLJ37312 FLJ37312 Hs.181480 AA203467 0.641357 - -- R10991 0.641357 MAD2 mitotic arrest deficient-like 1 (yeast) MAD2L1 Hs.79078 AA127641 0.641357 ESTs ESTs Hs.193657 H61387 0.641357 Reticulon 4 receptor RTN4R Hs.30868 AA203723 0.641357 ESTs ESTs Hs.188016 R14112 0.641357 Cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1 CYP1A1 Hs.72912 T83745 0.641357 Polymerase (RNA) II (DNA directed) polypeptide D POLR2D Hs.194638 H82521 0.641357 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c'' ATP6V0B Hs.7476 AA043201 0.641357 - - Hs.179891 R69813 0.641357 Hypothetical protein MGC4707 MGC4707 Hs.291003 W31714 0.641357 - - Hs.122656 R01692 0.641357 Junctional adhesion molecule 1 JAM1 Hs.12284 R66021 0.641357 - - Hs.378493 R00834 0.641357 SLIT-ROBO Rho GTPase-activating protein 1 SRGAP1 Hs.18995 W72686 0.641357 Diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A bindinDBI Hs.78888 N90754 0.641357 HP43.8KD protein HP43.8KD Hs.332841 H84316 0.641357 Neuroligin 3 NLGN3 Hs.47320 N36913 0.641357 Hypothetical protein DKFZp762N1910 DKFZp762N1910 Hs.321717 R88135 0.641357 Ribonuclease P (30kD) RPP30 Hs.139120 N24920 0.641357 Angiogenin, ribonuclease, RNase A family, 5 ANG Hs.332764 N21349 0.641357 Protein kinase, cAMP-dependent, catalytic, alpha PRKACA Hs.77271 W21233 0.641357 Hypothetical protein FLJ10496 FLJ10496 Hs.379807 R72685 0.641357 Similar to vaccinia virus HindIII K4L ORF HU-K4 Hs.74573 AA045404 0.641357 Squamous cell carcinoma antigen recognized by T cell SART2 Hs.58636 N54731 0.641357 Protein kinase C and casein kinase substrate in neurons 2 PACSIN2 Hs.18842 H45117 0.656247 KIAA0140 gene product KIAA0140 Hs.156016 R55896 0.656247 - -- R24969 0.656247 Gamma-aminobutyric acid (GABA) A receptor, beta 1 GABRB1 Hs.89768 AA034296 0.656247 - - Hs.288613 R35308 0.656247 HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae) HRMT1L1 Hs.235887 R68364 0.656247 - -- H14800 0.656247 - -- H18988 0.656247 Hypothetical protein FLJ12242 FLJ12242 Hs.94810 H25530 0.656247 - -- H15640 0.656247 - - Hs.279607 N63640 0.656247 - - Hs.39911 T86632 0.656247 - -- H69656 0.656247 Nuclear prelamin A recognition factor NARF Hs.256526 H39095 0.656247 Cell cycle progression 2 protein CPR2 Hs.347349 T75267 0.656247 FK506 binding protein 12-rapamycin associated protein 1 FRAP1 Hs.338207 R17445 0.656247 Hypothetical protein MGC10854 MGC10854 Hs.22222 W95000 0.656247 Cell division cycle 25C CDC25C Hs.656 H04784 0.656247 RE1-silencing transcription factor REST Hs.227630 H12149 0.656247 MAX dimerization protein 4 MAD4 Hs.102402 H25007 0.656247 - - Hs.188757 R91821 0.656247 ESTs ESTs Hs.245997 N50342 0.656247 KIAA0725 protein KIAA0725 Hs.26450 H20849 0.656247 Deformed epidermal autoregulatory factor 1 (Drosophila) DEAF1 Hs.6574 R02725 0.656247 Similar to TLH29 protein precursor LOC122509 Hs.19414 AA053984 0.656247 H2B histone family, member Q H2BFQ Hs.2178 N28653 0.656247 Cornichon-like CNIL Hs.201673 R50087 0.656247 GREB1 protein GREB1 Hs.193914 N29558 0.656247 - - Hs.293865 R69858 0.656247 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, e YWHAH Hs.349530 H62319 0.656247 - - Hs.133526 R54762 0.656247 - - Hs.58582 R74573 0.656247 Male-specific lethal 3-like 1 (Drosophila) MSL3L1 Hs.88764 N52015 0.656247 ADP-ribosylation factor 4 ARF4 Hs.75290 R53567 0.656247 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) HMGCS1 Hs.77910 T93605 0.656247 ESTs ESTs Hs.188627 AA134572 0.656247 - -- N21515 0.656247 Choline/ethanolaminephosphotransferase CEPT1 Hs.363572 N23528 0.656247 Arginyl aminopeptidase (aminopeptidase B) RNPEP Hs.283667 W42442 0.656247 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184 W15457 0.656247 HSPC067 protein HSPC067 Hs.279938 R28059 0.656247 Breast carcinoma amplified sequence 2 BCAS2 Hs.22960 R88246 0.656247 Adrenergic, beta, receptor kinase 1 ADRBK1 Hs.83636 N36697 0.656247 ESTs ESTs Hs.41322 H73724 0.656247 Cyclin-dependent kinase 6 CDK6 Hs.38481 W74528 0.656247 Calcium channel, voltage-dependent, beta 1 subunit CACNB1 Hs.635 W68344 0.656247 Chromosome 7 open reading frame 3 C7orf3 Hs.334540 AA026852 0.656247 Chromosome 20 open reading frame 67 C20orf67 Hs.272814 R78346 0.656247 - -- R61014 0.656247 Leucine-zipper-like transcriptional regulator, 1 LZTR1 Hs.78788 N29775 0.656247 Small fragment nuclease DKFZP566E144 Hs.7527 R74405 0.656247 - - Hs.185018 AA069421 0.656247 - -- AA005131 0.656247 - - Hs.37372 H15400 0.656247 Hypothetical protein FLJ12661 FLJ12661 Hs.318526 W58039 0.656247 Regulator of G-protein signalling 10 RGS10 Hs.82280 AA057293 0.656247 Peptidylprolyl isomerase C (cyclophilin C) PPIC Hs.110364 R09962 0.656247 Hypothetical protein MGC2463 MGC2463 Hs.323634 W86640 0.656247 Receptor (TNFRSF)-interacting serine-threonine kinase 1 RIPK1 Hs.296327 W04635 0.656247 Sorbin and SH3 domain containing 1 SORBS1 Hs.108924 W68077 0.656247 Single-stranded DNA binding protein SSBP1 Hs.923 AA120759 0.656247 DnaJ (Hsp40) homolog, subfamily B, member 5 DNAJB5 Hs.237506 R80244 0.656247 BTB and CNC homology 1, basic leucine zipper transcription factor 1 BACH1 Hs.154276 W86915 0.656247 PHD protein Jade-1 Jade-1 Hs.238246 H09552 0.656247 Hypothetical protein FLJ20272 FLJ20272 Hs.26090 AA055269 0.656247 - - Hs.41269 R18944 0.656247 Transcriptional co-repressor Sin3A SIN3A Hs.22583 AA029857 0.656247 RAD1 homolog (S. pombe) RAD1 Hs.7179 T88813 0.656247 Hypothetical protein PRO1855 PRO1855 Hs.283558 T81304 0.656247 Similar to cyclin-E binding protein 1 (H. sapiens) MGC14386 Hs.14870 H15055 0.656247 DNA segment, single copy probe LNS-CAI/LNS-CAII (deleted in polyposis D5S346 Hs.178112 H15642 0.656247 - -- H67165 0.656247 Nitric oxide synthase 2A (inducible, hepatocytes) NOS2A Hs.193788 T85827 0.656247 - -- N69389 0.671276 Nerve injury gene 283 NIN283 Hs.320834 AA053325 0.671276 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 ATP6V1G1 Hs.90336 AA147542 0.671276 Serine/arginine repetitive matrix 1 SRRM1 Hs.18192 N91060 0.671276 Vascular endothelial growth factor VEGF Hs.73793 W24882 0.671276 Hypothetical protein FLJ35779 FLJ35779 Hs.374991 R21804 0.671276 - -- N71958 0.671276 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa NDUFA9 Hs.75227 AA115563 0.671276 Histidyl-tRNA synthetase-like HARSL Hs.278507 N52383 0.671276 Hypothetical protein FLJ20079 FLJ20079 Hs.165948 H18934 0.671276 Ribosomal large subunit pseudouridine synthase C like RLUCL Hs.101742 N70267 0.671276 Integral membrane protein 2B ITM2B Hs.239625 H72121 0.671276 Mitochondrial ribosomal protein S12 MRPS12 Hs.9964 AA059148 0.671276 KIAA1199 protein KIAA1199 Hs.50081 H93850 0.671276 Extracellular link domain containing 1 XLKD1 Hs.17917 N31564 0.671276 - - Hs.111364 W88760 0.671276 Calcium/calmodulin-dependent protein kinase (CaM kinase) II delta CAMK2D Hs.111460 W79682 0.671276 ORF LOC51035 Hs.351296 R74454 0.671276 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 B3GNT1 Hs.173203 AA009512 0.671276 - -- R32813 0.671276 Hypothetical protein MGC2668 MGC2668 Hs.56851 H51004 0.671276 - -- W92517 0.671276 Actin binding LIM protein 1 ABLIM1 Hs.158203 W07077 0.671276 Hematopoietic PBX-interacting protein HPIP Hs.8068 AA054498 0.671276 Hypothetical protein DKFZp566J2046 DKFZP566J2046 Hs.322482 T84193 0.671276 - - Hs.290241 H47578 0.671276 Ring finger protein 34 RNF34 Hs.316809 AA037862 0.671276 Nucleotide-sugar transporter similar to C. elegans sqv-7 SQV7L Hs.90078 R73213 0.671276 RAB40B, member RAS oncogene family RAB40B Hs.302498 W46239 0.671276 Sprouty homolog 4 (Drosophila) SPRY4 Hs.381153 W90242 0.671276 Chromosome 14 open reading frame 1 C14orf1 Hs.15106 N29183 0.671276 - - Hs.289018 H77996 0.671276 KIAA1463 protein KIAA1463 Hs.21104 W15155 0.671276 - -- N45225 0.671276 Vesicle transport-related protein RA410 Hs.27023 H26657 0.671276 Smcx homolog, X chromosome (mouse) SMCX Hs.283429 W37491 0.671276 Biliverdin reductase B (flavin reductase (NADPH)) BLVRB Hs.76289 H38961 0.671276 ADP-ribosylation factor 3 ARF3 Hs.119177 W90758 0.671276 Hypothetical protein FLJ10514 FLJ10514 Hs.59346 N50375 0.671276 Activated RNA polymerase II transcription cofactor 4 PC4 Hs.349506 T75252 0.671276 Hypothetical protein DKFZp434B195 DKFZP434B195 Hs.10748 AA036894 0.671276 Hypothetical protein FLJ20303 FLJ20303 Hs.17138 T66839 0.671276 Hypothetical protein FLJ11806 FLJ11806 Hs.323443 T84763 0.671276 - - Hs.284344 R22203 0.671276 Hypothetical protein FLJ10330 FLJ10330 Hs.342307 R67624 0.671276 Erythrocyte membrane protein band 4.1-like 1 EPB41L1 Hs.26395 H53304 0.671276 - - Hs.117530 AA044383 0.671276 Interferon regulatory factor 2 IRF2 Hs.83795 W78808 0.671276 AFG3 ATPase family gene 3-like 1 (yeast) AFG3L1 Hs.337620 R46554 0.671276 KIAA0930 protein KIAA0930 Hs.13255 W87936 0.671276 ESTs ESTs Hs.14372 H51348 0.671276 F-box only protein 25 FBXO25 Hs.81001 H79770 0.671276 Ret finger protein RFP Hs.142653 N29672 0.671276 V-fos FBJ murine osteosarcoma viral oncogene homolog FOS Hs.25647 H99483 0.671276 - -- T81049 0.671276 Ubinuclein 1 UBN1 Hs.21479 AA054690 0.671276 Epithelial protein lost in neoplasm beta EPLIN Hs.10706 N24811 0.671276 Rho GTPase activating protein 5 ARHGAP5 Hs.267831 N50617 0.671276 Small nuclear ribonucleoprotein polypeptide A' SNRPA1 Hs.80506 R02669 0.671276 Adaptor-related protein complex 3, beta 1 subunit AP3B1 Hs.155172 R92111 0.671276 - -- R17451 0.671276 Male-enhanced antigen MEA Hs.278362 R02682 0.671276 Double-stranded RNA-binding zinc finger protein JAZ JAZ Hs.181012 N30186 0.671276 Hypothetical protein FLJ21615 FLJ21615 Hs.44159 H67335 0.671276 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa NDUFA10 Hs.198271 R72184 0.671276 Hypothetical protein FLJ10948 FLJ10948 Hs.9670 H52618 0.671276 - -- AA004838 0.671276 SOCS box-containing WD protein SWiP-1 WSB1 Hs.187991 W61132 0.671276 - - Hs.301226 N20517 0.671276 Hypothetical protein DKFZp434A1319 DKFZP434A1319 Hs.307084 T94585 0.671276 - - Hs.116691 N92594 0.671276 S-adenosylmethionine decarboxylase 1 AMD1 Hs.262476 R40588 0.671276 - - Hs.21256 W31152 0.671276 Hypothetical protein MGC33177 DMR Hs.55209 AA029328 0.671276 KIAA0073 protein KIAA0073 Hs.1191 H88030 0.671276 Splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) SFRS10 Hs.30035 H21835 0.686437 - -- AA134770 0.686437 Zinc finger protein 24 (KOX 17) ZNF24 Hs.183593 H82166 0.686437 Sorting nexin 17 SNX17 Hs.278569 AA101919 0.686437 Phosphofructokinase, muscle PFKM Hs.75160 H19826 0.686437 Hippocalcin-like 1 HPCAL1 Hs.3618 AA009926 0.686437 - -- R81939 0.686437 - - Hs.13396 AA047517 0.686437 VRK3 for vaccinia related kinase 3 LOC51231 Hs.98289 R35199 0.686437 Hypothetical protein FLJ21080 FLJ21080 Hs.8109 H65158 0.686437 Tumor susceptibility gene 101 TSG101 Hs.118910 W90607 0.686437 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like HERPUD1 Hs.146393 R46527 0.686437 DKFZP434H132 protein DKFZP434H132 Hs.17936 W07300 0.686437 Adaptor-related protein complex 1, gamma 1 subunit AP1G1 Hs.5344 N47660 0.686437 Cyclin-dependent kinase inhibitor 1B (p27, Kip1) CDKN1B Hs.238990 AA156458 0.686437 Spastic paraplegia 7, paraplegin (pure and complicated autosomal recessive) SPG7 Hs.296847 W23579 0.686437 ATP-dependent RNA helicase MGC2835 Hs.70582 AA046800 0.686437 Tuftelin interacting protein 11 TFIP11 Hs.20225 R72133 0.686437 - - Hs.5957 T79317 0.686437 ESTs ESTs Hs.302245 N46251 0.686437 Phafin 2 FLJ13187 Hs.29724 R17999 0.686437 Hypothetical protein FLJ20371 FLJ20371 Hs.267566 AA099404 0.686437 Hypothetical protein MGC22793 MGC22793 Hs.293937 W90375 0.686437 ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H ATP6V1H Hs.19575 AA005020 0.686437 Protein tyrosine phosphatase, non-receptor type 1 PTPN1 Hs.155894 N69412 0.686437 - -- H09667 0.686437 - -- R20746 0.686437 Chloride channel 7 CLCN7 Hs.80768 R12705 0.686437 Thyroid hormone receptor interactor 13 TRIP13 Hs.6566 R50443 0.686437 - -- N78868 0.686437 KIAA1049 protein KIAA1049 Hs.227835 N30286 0.686437 DKFZP564A043 protein DKFZP564A043 Hs.271623 AA099135 0.686437 Hypothetical protein FLJ20186 FLJ20186 Hs.62771 R50698 0.686437 KIAA1938 protein KIAA1938 Hs.25734 N89889 0.686437 - -- H20847 0.686437 KIAA0923 protein KIAA0923 Hs.22587 AA149479 0.686437 CD2 antigen (cytoplasmic tail) binding protein 2 CD2BP2 Hs.202677 AA043760 0.686437 General transcription factor IIB GTF2B Hs.258561 R61551 0.686437 - - Hs.131798 AA045139 0.686437 Hypothetical protein FLJ12592 FLJ12592 Hs.23100 N21144 0.686437 Transcription factor binding to IGHM enhancer 3 TFE3 Hs.274184 AA121546 0.686437 Hypothetical protein PRO0971 PRO0971 Hs.152316 T56959 0.686437 Hypothetical protein FLJ12525 FLJ12525 Hs.321618 W02088 0.686437 - -- AA150894 0.686437 Guanine nucleotide binding protein 11 GNG11 Hs.83381 N92358 0.686437 Hypothetical protein FLJ22029 FLJ22029 Hs.285243 R73484 0.686437 Similar to CG9886 gene product LOC132158 Hs.109414 AA151027 0.686437 Chromosome 21 open reading frame 108 C21orf108 Hs.18759 H77998 0.686437 KIAA0310 gene product KIAA0310 Hs.5716 H24894 0.686437 - -- R87739 0.686437 Transmembrane protein 1 TMEM1 Hs.94479 W88557 0.686437 TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, TAF10 Hs.89657 R80191 0.686437 Microtubule-associated protein, RP/EB family, member 3 MAPRE3 Hs.172740 W92014 0.686437 Alcohol dehydrogenase 6 (class V) ADH6 Hs.76800 T79936 0.686437 ESTs ESTs Hs.119583 R33249 0.686437 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 B4GALT3 Hs.321231 N51791 0.686437 Hypothetical protein FLJ20296 FLJ20296 Hs.6603 N91458 0.686437 T-cell activation WD repeat protein TA-WDRP Hs.175596 H52789 0.686437 DKFZP434P106 protein DKFZP434P106 Hs.236522 W01923 0.686437 A kinase (PRKA) anchor protein 2 AKAP2 Hs.42322 N66260 0.686437 MUS81 endonuclease MUS81 Hs.288798 W60308 0.686437 - - Hs.350200 AA134109 0.686437 Hypothetical protein MGC14327 MGC14327 Hs.231029 R63808 0.686437 TSPY-like TSPYL Hs.278479 N30559 0.686437 - -- R10564 0.686437 Sentrin/SUMO-specific protease 3 SENP3 Hs.118926 N/A1 0.686437 - -- H27593 0.686437 Socius SOC Hs.145061 AA057856 0.686437 ESTs ESTs Hs.63344 H14485 0.686437 Phosphatidylinositol-4-phosphate 5-kinase, type II, beta PIP5K2B Hs.6335 N69552 0.686437 Similar to MOB-LAK LOC148932 Hs.97927 AA001216 0.686437 Paxillin PXN Hs.102497 T92329 0.686437 - - Hs.193969 W33159 0.686437 Phospholipase C, beta 1 (phosphoinositide-specific) PLCB1 Hs.41143 N30606 0.701725 Cyclin H CCNH Hs.514 N62067 0.701725 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742 W86803 0.701725 Exostoses (multiple) 2 EXT2 Hs.75334 W87404 0.701725 Hypothetical protein FLJ10715 FLJ10715 Hs.58974 AA047447 0.701725 - - Hs.201060 H50945 0.701725 Proteasome (prosome, macropain) subunit, beta type, 5 PSMB5 Hs.78596 N27830 0.701725 - - Hs.43047 H58427 0.701725 ESTs ESTs Hs.307940 W78711 0.701725 - - Hs.110069 W90600 0.701725 CGI-92 protein COQ4 Hs.20159 AA152287 0.701725 Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsNFKBIE Hs.182885 AA007449 0.701725 Spastic ataxia of Charlevoix-Saguenay (sacsin) SACS Hs.159492 AA039863 0.701725 Prolylcarboxypeptidase (angiotensinase C) PRCP Hs.75693 T96595 0.701725 ESTs ESTs Hs.302270 H95498 0.701725 ESTs ESTs Hs.42041 AA047410 0.701725 Tafazzin (cardiomyopathy, dilated 3A (X-linked); endocardial fibroelastosis 2; BTAZ Hs.79021 AA136159 0.701725 Microsomal glutathione S-transferase 1 MGST1 Hs.355733 N50349 0.701725 Rho guanine nucleotide exchange factor (GEF) 10 ARHGEF10 Hs.20695 N57249 0.701725 Proteasome (prosome, macropain) subunit, beta type, 5 PSMB5 Hs.78596 R47930 0.701725 Hypothetical protein 669 LOC56267 Hs.180378 H27414 0.701725 Ring finger protein 20 RNF20 Hs.168095 R33011 0.701725 Suppressor of cytokine signaling 5 SOCS5 Hs.169836 R41426 0.701725 ESTs ESTs Hs.175370 N75497 0.701725 RAB1A, member RAS oncogene family RAB1A Hs.3642 H99751 0.701725 Lipidosin BG1 Hs.277543 W44398 0.701725 Function unknown protein 1 FLJ10648 Hs.379758 H98830 0.701725 Glucosamine-6-phosphate isomerase GNPI Hs.278500 R75983 0.701725 Serologically defined colon cancer antigen 28 SDCCAG28 Hs.84700 R95136 0.701725 - -- H69318 0.701725 A disintegrin and metalloproteinase domain 10 ADAM10 Hs.172028 AA031356 0.701725 Hypothetical protein MGC14288 MGC14288 Hs.181073 H91044 0.701725 Mitogen-activated protein kinase phosphatase x MKPX Hs.29106 R24513 0.701725 Low density lipoprotein receptor-related protein 6 LRP6 Hs.23672 H30899 0.701725 - -- R87343 0.701725 Ubiquitin-conjugating enzyme UBC3B UBC3B Hs.11184 AA099685 0.701725 Progesterone-induced blocking factor 1 PIBF1 Hs.43913 W78946 0.701725 Electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II) ETFA Hs.169919 R18833 0.701725 - - Hs.268709 N45664 0.701725 Putative Rab5 GDP/GTP exchange factor homologue RABEX5 Hs.187660 R71436 0.701725 - - Hs.6236 N69431 0.701725 Hypothetical protein FLJ20699 FLJ20699 Hs.15125 R34571 0.701725 Hypothetical protein FLJ20136 FLJ20136 Hs.24817 N75031 0.701725 GDP dissociation inhibitor 2 GDI2 Hs.56845 W05406 0.701725 Phosphatidylinositol glycan, class K PIGK Hs.62187 AA047466 0.701725 RUN and FYVE domain-containing 1 RUFY1 Hs.289064 R76890 0.701725 KIAA1340 protein KIAA1340 Hs.51743 W39690 0.701725 Dickkopf homolog 1 (Xenopus laevis) DKK1 Hs.40499 R48773 0.701725 Nucleosome assembly protein 1-like 4 NAP1L4 Hs.78103 N94831 0.701725 KIAA0013 gene product ARHGAP11A Hs.172652 AA001329 0.701725 Cyclin A2 CCNA2 Hs.85137 T77130 0.701725 ESTs ESTs Hs.268606 H16558 0.701725 Myosin VA (heavy polypeptide 12, myoxin) MYO5A Hs.170157 W87414 0.701725 HLA-B associated transcript 1 BAT1 Hs.55296 W20491 0.701725 TAR (HIV) RNA binding protein 2 TARBP2 Hs.326 N26710 0.701725 Hypothetical protein BC011593 LOC112495 Hs.344097 AA053311 0.701725 KIAA0233 gene product KIAA0233 Hs.79077 R96393 0.701725 ESTs ESTs Hs.184721 N38762 0.701725 Lymphoid enhancer-binding factor 1 LEF1 Hs.44865 R18698 0.701725 Hypothetical protein DKFZp761B1514 DKFZp761B1514 Hs.177537 AA028142 0.701725 SLC2A4 regulator SLC2A4RG Hs.170088 H69659 0.701725 - -- H43854 0.701725 A disintegrin and metalloproteinase domain 11 ADAM11 Hs.6088 R54961 0.701725 PHD zinc finger protein XAP135 XAP135 Hs.7759 H47418 0.701725 - -- T74240 0.717135 Heat shock 70kDa protein 1B HSPA1B Hs.274402 H20126 0.717135 Hypothetical protein PRO2325 PRO2325 Hs.31535 N44136 0.717135 Kinesin family member 1B KIF1B Hs.375193 AA042936 0.717135 My015 My015 Hs.325531 AA045281 0.717135 Phosphoprotein associated with glycosphingolipid-enriched microdomains PAG Hs.266175 H89361 0.717135 Mesoderm development candidate 1 MESDC1 Hs.290356 W45719 0.717135 PAP-1 binding protein PAPA-1 Hs.7709 H85873 0.717135 SUMO-1 activating enzyme subunit 2 UBA2 Hs.4311 N54859 0.717135 Hypothetical protein FLJ11151 FLJ11151 Hs.14992 W45538 0.717135 KIAA0062 protein KIAA0062 Hs.89868 N32385 0.717135 Hypothetical protein FLJ14249 similar to HS1 binding protein 3 FLJ14249 Hs.125520 AA045732 0.717135 LOC147184 LOC147184 Hs.13740 R19920 0.717135 KIAA1464 protein KIAA1464 Hs.6343 T83266 0.717135 Tetraspan 3 TSPAN-3 Hs.100090 T81752 0.717135 Gemin 5 GEMIN5 Hs.25882 N56810 0.717135 CAMP responsive element modulator CREM Hs.155924 W32666 0.717135 TNFRSF1A-associated via death domain TRADD Hs.89862 AA195455 0.717135 Stanniocalcin 2 STC2 Hs.155223 AA156795 0.717135 ESTs ESTs Hs.62772 N34764 0.717135 - - Hs.245537 N77915 0.717135 - -- R18841 0.717135 Neurotrimin HNT Hs.288433 R55296 0.717135 Promyelocytic leukemia PML Hs.89633 R45197 0.717135 Hypothetical protein MGC11349 MGC11349 Hs.288697 R48603 0.717135 - -- R47773 0.717135 Gene with multiple splice variants near HD locus on 4p16.3 RES4-22 Hs.325987 H17690 0.717135 APG12 autophagy 12-like (S. cerevisiae) APG12L Hs.264482 AA029852 0.717135 Hypothetical protein FLJ20259 FLJ20259 Hs.9956 N39216 0.717135 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 CDS2 Hs.24812 AA147539 0.717135 D-dopachrome tautomerase DDT Hs.180015 R28554 0.717135 Hypothetical protein DKFZp313A2432 DKFZp313A2432 Hs.349096 H25201 0.717135 - -- N46331 0.717135 KIAA0675 gene product KIAA0675 Hs.165662 N64002 0.717135 Rap guanine nucleotide exchange factor RA-GEF-2 Hs.174795 R14788 0.717135 - - Hs.293815 W37617 0.717135 Transmembrane 7 superfamily member 1 (upregulated in kidney) TM7SF1 Hs.15791 R98214 0.717135 Chromosome 1 open reading frame 22 C1orf22 Hs.279951 AA127045 0.717135 Hypothetical protein BC009331 LOC92305 Hs.337772 N72553 0.717135 Calmodulin 3 (phosphorylase kinase, delta) CALM3 Hs.334330 W52903 0.717135 Hypothetical protein HSPC177 HSPC177 Hs.36237 H02590 0.717135 - -- R37680 0.717135 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1 ADPRTL1 Hs.77225 T75262 0.717135 - -- N25619 0.717135 ESTs ESTs Hs.269036 AA213820 0.717135 - - Hs.256533 N43860 0.717135 Polymyositis/scleroderma autoantigen 1, 75kDa PMSCL1 Hs.91728 T84624 0.717135 Ets variant gene 6 (TEL oncogene) ETV6 Hs.169081 R66209 0.717135 Synaptosomal-associated protein, 29kDa SNAP29 Hs.194714 R12961 0.717135 Hypothetical protein DKFZp434B044 DKFZP434B044 Hs.262958 T80464 0.717135 Gemin 7 GEMIN7 Hs.102991 N91912 0.717135 Phospholipase A2, group XII PLA2G12 Hs.25206 AA062961 0.717135 Gamma-glutamyltransferase 1 GGT1 Hs.284380 N35507 0.717135 Oxysterol binding protein OSBP Hs.24734 AA131823 0.717135 - - Hs.272198 N79754 0.717135 ElaC homolog 1 (E. coli) ELAC1 Hs.47572 H99886 0.717135 Nuclear receptor subfamily 4, group A, member 3 NR4A3 Hs.80561 H75344 0.717135 ESTs ESTs Hs.167614 AA133284 0.717135 Hypothetical protein FLJ40452 FLJ40452 Hs.339834 AA053319 0.717135 - - Hs.167700 R36586 0.717135 Phosphatidylinositol (4,5) bisphosphate 5-phosphatase homolog; phosphatidyli PPI5PIV Hs.25156 W37775 0.717135 - -- T87547 0.717135 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 PSMD1 Hs.3887 W92121 0.717135 KIAA0618 gene product KIAA0618 Hs.295112 R25090 0.717135 - -- N99946 0.717135 Mesoderm development candidate 2 MESDC2 Hs.78871 AA151305 0.717135 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569 H82880 0.732661 Peptidylprolyl isomerase A (cyclophilin A) PPIA Hs.342389 N48315 0.732661 Hypothetical protein MGC2452 MGC2452 Hs.275711 N92996 0.732661 Retinoblastoma binding protein 7 RBBP7 Hs.31314 N93576 0.732661 Hypothetical protein MGC2477 MGC2477 Hs.9061 T70324 0.732661 - - Hs.13179 N31738 0.732661 Hypothetical protein MGC20262 MGC20262 Hs.351871 N92710 0.732661 Cold inducible RNA binding protein CIRBP Hs.119475 N58497 0.732661 Translocated promoter region (to activated MET oncogene) TPR Hs.169750 N46726 0.732661 KIAA0185 protein KIAA0185 Hs.239499 T86841 0.732661 - -- N71996 0.732661 Macrophage myristoylated alanine-rich C kinase substrate MACMARCKS Hs.75061 N35749 0.732661 - -- H14191 0.732661 MMS19-like (MET18 homolog, S. cerevisiae) MMS19L Hs.288891 H47450 0.732661 - -- AA099555 0.732661 Hypothetical protein FLJ12666 FLJ12666 Hs.23767 W74506 0.732661 Casein kinase 1, alpha 1 CSNK1A1 Hs.283738 R18812 0.732661 Reticulon 1 RTN1 Hs.99947 W90594 0.732661 Hypothetical protein FLJ21174 FLJ21174 Hs.194329 H10223 0.732661 - - Hs.63368 H96032 0.732661 Hypothetical protein MGC11102 MGC11102 Hs.42129 N32733 0.732661 - -- H03349 0.732661 DNA (cytosine-5-)-methyltransferase 3 alpha DNMT3A Hs.241565 N48062 0.732661 - - Hs.13809 R01903 0.732661 Dystonia 1, torsion (autosomal dominant; torsin A) DYT1 Hs.19261 W92260 0.732661 RAB11A, member RAS oncogene family RAB11A Hs.75618 N73861 0.732661 - -- H51386 0.732661 KIAA0202 protein KIAA0202 Hs.80712 W45562 0.732661 - -- AA150112 0.732661 Intermediate filament protein syncoilin SYNCOILIN Hs.348415 N62372 0.732661 Polynucleotide phosphorylase-like PNPASE Hs.356503 AA040149 0.732661 - - Hs.348989 AA056998 0.732661 - -- N46198 0.732661 - - Hs.43744 H03342 0.732661 Hypothetical protein FLJ21939 similar to 5-azacytidine induced gene 2 FLJ21939 Hs.164478 R20452 0.732661 Calpain 10 CAPN10 Hs.112218 AA053903 0.732661 KIAA0826 protein KIAA0826 Hs.169600 AA010668 0.732661 Protein tyrosine phosphatase, receptor type, C-associated protein PTPRCAP Hs.155975 R52315 0.732661 Oculocutaneous albinism II (pink-eye dilution homolog, mouse) OCA2 Hs.82027 AA046822 0.732661 ESTs ESTs Hs.61272 H42051 0.732661 Early growth response 1 EGR1 Hs.326035 N58733 0.732661 - -- N92376 0.732661 Hypothetical protein MGC23918 MGC23918 Hs.43773 R96651 0.732661 ATX1 antioxidant protein 1 homolog (yeast) ATOX1 Hs.279910 W07491 0.732661 - - Hs.58633 AA029802 0.732661 High density lipoprotein binding protein (vigilin) HDLBP Hs.177516 N70264 0.732661 Phosphatidylcholine transfer protein PCTP Hs.285218 H03286 0.732661 3 beta-hydroxy-delta 5-C27-steroid oxidoreductase C(27)-3BETA-HSD Hs.23628 N34766 0.732661 Mannosidase, alpha, class 2A, member 2 MAN2A2 Hs.295605 H80533 0.732661 Interleukin 1 receptor accessory protein IL1RAP Hs.173880 AA029564 0.732661 Component of oligomeric golgi complex 2 COG2 Hs.82399 AA134944 0.732661 - -- H01569 0.732661 ESTs ESTs Hs.30237 H43653 0.732661 Cytochrome c oxidase subunit VIII COX8 Hs.374980 R34762 0.732661 - - Hs.380911 H26621 0.732661 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigMCP Hs.83532 W19134 0.732661 DKFZP564F0522 protein DKFZP564F0522 Hs.23060 N51733 0.732661 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatasCTDP1 Hs.4076 AA031407 0.732661 ESTs ESTs Hs.303016 W85892 0.732661 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (MBTAF1 Hs.180930 R54944 0.732661 Interleukin 18 binding protein IL18BP Hs.325978 N76256 0.732661 Tubulin, gamma complex associated protein 3 TUBGCP3 Hs.9884 N39092 0.732661 ESTs ESTs Hs.44940 N74271 0.732661 Membrane-bound transcription factor protease, site 1 MBTPS1 Hs.75890 H47565 0.732661 NS1-binding protein NS1-BP Hs.197298 AA010546 0.732661 Synuclein, alpha (non A4 component of amyloid precursor) SNCA Hs.76930 R80974 0.732661 WEE1+ homolog (S. pombe) WEE1 Hs.75188 AA040506 0.732661 - - Hs.251865 T78899 0.732661 NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme QNDUFS8 Hs.90443 N70097 0.732661 - -- H92944 0.732661 - -- N59347 0.732661 Hypothetical protein MGC9344 MGC9344 Hs.84131 W56823 0.732661 Paired basic amino acid cleaving enzyme (furin, membrane associated receptoPACE Hs.59242 H83357 0.732661 Hypothetical protein BC012008 LOC144467 Hs.348374 W90295 0.732661 Erbb2 interacting protein ERBB2IP Hs.8117 W63774 0.732661 H2A histone family, member X H2AFX Hs.147097 T71625 0.732661 - -- W49783 0.748297 - - Hs.13328 N95253 0.748297 ESTs ESTs Hs.5669 AA136976 0.748297 KIAA1023 protein KIAA1023 Hs.21361 R82340 0.748297 Pyruvate dehydrogenase complex, lipoyl-containing component X; E3-binding pPDX1 Hs.351622 AA045469 0.748297 Hypothetical protein FLJ20186 FLJ20186 Hs.62771 AA115948 0.748297 Collagen, type V, alpha 2 COL5A2 Hs.82985 AA136669 0.748297 - - Hs.374535 R48434 0.748297 ESTs ESTs Hs.25560 AA039862 0.748297 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated proMCM3AP Hs.168481 W68755 0.748297 Nucleotide binding protein 1 (MinD homolog, E. coli) NUBP1 Hs.81469 R22413 0.748297 Protein phosphatase 1, regulatory (inhibitor) subunit 14B PPP1R14B Hs.100623 H42375 0.748297 Hypothetical protein FLJ10211 FLJ10211 Hs.380134 AA022903 0.748297 Laminin, gamma 1 (formerly LAMB2) LAMC1 Hs.214982 AA193555 0.748297 - - Hs.365589 H96198 0.748297 Heterogeneous nuclear ribonucleoprotein H1 (H) HNRPH1 Hs.245710 N20098 0.748297 CD151 antigen CD151 Hs.75564 T71616 0.748297 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa EIF2S1 Hs.151777 R34114 0.748297 - - Hs.352487 N69956 0.748297 - - Hs.148676 R39287 0.748297 Melanin-concentrating hormone receptor 1 interacting zinc-finger protein MIZIP Hs.128096 H95137 0.748297 Map kinase phosphatase-like protein MK-STYX LOC51657 Hs.11615 N/A1 0.748297 - -- AA063580 0.748297 TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 5TAF7 Hs.155188 R38155 0.748297 - - Hs.351029 AA132067 0.748297 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, suSMARCC2 Hs.236030 AA126385 0.748297 Hypothetical protein BC010736 LOC92609 Hs.355819 N89707 0.748297 Dynein light chain 2A DNLC2A Hs.100002 W86341 0.748297 Hypothetical protein BC006130 LOC93622 Hs.6815 AA043507 0.748297 Kinesin-like 5 (mitotic kinesin-like protein 1) KNSL5 Hs.270845 H29086 0.748297 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300 N42285 0.748297 Lysosomal-associated membrane protein 1 LAMP1 Hs.150101 H90219 0.748297 Inositol(myo)-1(or 4)-monophosphatase 1 IMPA1 Hs.171776 N59525 0.748297 CDC16 cell division cycle 16 homolog (S. cerevisiae) CDC16 Hs.1592 W94597 0.748297 ATPase, Ca++ transporting, plasma membrane 1 ATP2B1 Hs.78546 R34172 0.748297 - - Hs.22968 H16242 0.748297 Serologically defined colon cancer antigen 16 SDCCAG16 Hs.271926 N20844 0.748297 Heat shock 70kDa protein 1A HSPA1A Hs.8997 R46284 0.748297 Lipase, hormone-sensitive LIPE Hs.95351 AA130235 0.748297 Optic atrophy 1 (autosomal dominant) OPA1 Hs.147946 R54646 0.748297 F-box and leucine-rich repeat protein 6 FBXL6 Hs.12271 AA029530 0.748297 Hypothetical protein FLJ20005 FLJ20005 Hs.184634 W03009 0.748297 KIAA0472 protein KIAA0472 Hs.6874 AA134750 0.748297 Hypothetical protein MGC10848 MGC10848 Hs.207443 R79034 0.748297 - - Hs.79204 N49742 0.748297 Nuclear receptor subfamily 1, group D, member 2 NR1D2 Hs.37288 R54308 0.748297 SLIT-ROBO Rho GTPase-activating protein 2 SRGAP2 Hs.5003 R75874 0.748297 KIAA1932 protein KIAA1932 Hs.306121 R13117 0.748297 - - Hs.348516 T97327 0.748297 ESTs ESTs Hs.18041 AA056534 0.748297 ESTs ESTs Hs.110294 R89246 0.748297 KIAA0711 gene product KIAA0711 Hs.5333 AA035448 0.748297 - -- N90171 0.748297 C-myc binding protein MYCBP Hs.78221 R70391 0.748297 Ribonuclease/angiogenin inhibitor RNH Hs.75108 N22357 0.748297 - -- W51986 0.748297 - -- H06274 0.748297 Hypothetical protein MGC2508 MGC2508 Hs.11110 H78466 0.748297 Chromosome 4 open reading frame 1 C4orf1 Hs.270956 AA203681 0.748297 ESTs ESTs Hs.293589 H99520 0.748297 Sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase) SIAT4C Hs.75268 H98718 0.748297 - - Hs.12460 H57851 0.748297 Homo sapiens, clone MGC:29471 IMAGE:4329216, mRNA, complete cds RAB24 Hs.16258 R70183 0.748297 Nuclear receptor coactivator 6 interacting protein NCOA6IP Hs.179909 N30253 0.748297 - -- H75387 0.748297 - -- H15905 0.748297 KIAA0191 protein KIAA0191 Hs.12413 N21334 0.748297 Abl-interactor 2 ABI-2 Hs.343575 R38335 0.748297 Ribonuclease H2, large subunit RNASEH2A Hs.25292 W57806 0.748297 Unknown LOC51693 Hs.27445 AA132068 0.748297 - - Hs.352381 T95687 0.748297 RAP1, GTP-GDP dissociation stimulator 1 RAP1GDS1 Hs.7940 N34202 0.748297 - - Hs.275732 H72703 0.748297 Chromosome 11 open reading frame 10 C11orf10 Hs.90918 N24096 0.748297 - -- R87373 0.748297 - -- H91631 0.748297 Hypothetical protein MGC15416 MGC15416 Hs.41514 H45410 0.748297 Uveal autoantigen with coiled-coil domains and ankyrin repeats UACA Hs.49753 W67797 0.748297 Laminin, alpha 5 LAMA5 Hs.11669 AA058474 0.748297 Hypothetical protein DKFZp586C1924 DKFZp586C1924 Hs.108338 R88064 0.748297 Transcription factor-like 1 TCFL1 Hs.2430 N28292 0.764037 Sec23-interacting protein p125 P125 Hs.300208 AA150909 0.764037 - -- R18865 0.764037 - -- T98226 0.764037 Tropomyosin 4 TPM4 Hs.250641 H86785 0.764037 KIAA0874 protein KIAA0874 Hs.27973 AA098909 0.764037 KIAA0564 protein KIAA0564 Hs.151385 W72939 0.764037 KIAA0097 gene product KIAA0097 Hs.76989 H88039 0.764037 - - Hs.55098 N59677 0.764037 Proteasome (prosome, macropain) subunit, alpha type, 7 PSMA7 Hs.233952 AA005109 0.764037 Oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) OGDH Hs.168669 N80021 0.764037 Origin recognition complex, subunit 4-like (yeast) ORC4L Hs.55055 H07882 0.764037 KIAA0586 gene product KIAA0586 Hs.77724 R35559 0.764037 T-cell activation protein PGR1 Hs.285902 AA044634 0.764037 Sirtuin silent mating type information regulation 2 homolog 1 (S. cerevisiae) SIRT1 Hs.31176 N45309 0.764037 Prenylcysteine lyase PCL1 Hs.278627 R14363 0.764037 Histone deacetylase 5 HDAC5 Hs.9028 AA128275 0.764037 - -- H49493 0.764037 - -- T47567 0.764037 - -- R34443 0.764037 - - Hs.4194 N64388 0.764037 Nuclear receptor subfamily 4, group A, member 1 NR4A1 Hs.1119 R07284 0.764037 Hypothetical protein SP329 SP329 Hs.19928 AA129848 0.764037 Exosome component Rrp41 FLJ20591 Hs.343589 T79597 0.764037 - -- AA044631 0.764037 - -- T47502 0.764037 PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated proPCQAP Hs.8657 N64706 0.764037 KIAA1951 protein KIAA1951 Hs.137282 AA034114 0.764037 Transmembrane protein 5 TMEM5 Hs.112986 W91912 0.764037 G protein-coupled receptor kinase-interactor 2 GIT2 Hs.57734 T86647 0.764037 ESTs ESTs Hs.332087 AA054570 0.764037 Apolipoprotein E APOE Hs.169401 N25927 0.764037 - - Hs.374362 N89687 0.764037 - - Hs.351597 N39086 0.764037 Zinc finger protein AF020591 Hs.142634 N53706 0.764037 Zinc finger protein ZNF-U69274 Hs.301956 H16647 0.764037 Solute carrier family 27 (fatty acid transporter), member 4 SLC27A4 Hs.248953 W16435 0.764037 PXR2b protein PXR2b Hs.46780 H30857 0.764037 MutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) MLH1 Hs.57301 AA047100 0.764037 Hypothetical protein FLJ22584 FLJ22584 Hs.343551 AA044139 0.764037 Hypothetical protein MGC4645 MGC4645 Hs.332381 W70006 0.764037 Cell division cycle 25B CDC25B Hs.153752 N75222 0.764037 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28 DDX28 Hs.155049 H99883 0.764037 KIAA0828 protein KIAA0828 Hs.4984 H93919 0.764037 Glutamate-cysteine ligase, catalytic subunit GCLC Hs.151393 N71478 0.764037 Glutamate dehydrogenase 1 GLUD1 Hs.77508 R11184 0.764037 - - Hs.14337 W42414 0.764037 MAD, mothers against decapentaplegic homolog 3 (Drosophila) MADH3 Hs.288261 AA152215 0.764037 Tubulin-specific chaperone d TBCD Hs.12570 T79802 0.764037 - - Hs.14535 N31735 0.764037 Hypothetical protein FLJ20671 FLJ20671 Hs.180201 W31052 0.764037 Hypothetical protein FLJ12592 FLJ12592 Hs.23100 R23917 0.764037 Three prime repair exonuclease 1 TREX1 Hs.278408 N22158 0.764037 - - Hs.283072 H01923 0.764037 HSPC019 protein HSPC019 Hs.163724 N25873 0.764037 Chromosome 20 open reading frame 36 C20orf36 Hs.184628 W47662 0.764037 Modulator recognition factor I MRF-1 Hs.920 AA039454 0.764037 Split hand/foot malformation (ectrodactyly) type 3 SHFM3 Hs.24307 H29623 0.764037 Bullous pemphigoid antigen 1, 230/240kDa BPAG1 Hs.198689 W07319 0.764037 Zinc finger protein 41 ZNF41 Hs.143700 H10877 0.764037 Ankyrin repeat and SOCS box-containing 1 ASB1 Hs.153489 AA033813 0.764037 Chromatin assembly factor 1, subunit A (p150) CHAF1A Hs.79018 H15247 0.764037 Lipase A, lysosomal acid, cholesterol esterase (Wolman disease) LIPA Hs.85226 W92307 0.764037 Interleukin enhancer binding factor 2, 45kDa ILF2 Hs.75117 H49584 0.764037 KIAA0962 protein KIAA0962 Hs.9059 R82847 0.764037 PHD finger protein 7 PHF7 Hs.30127 R43107 0.764037 Hypothetical protein FLJ10450 FLJ10450 Hs.267604 N80932 0.764037 - -- AA010640 0.764037 N-myristoyltransferase 1 NMT1 Hs.111039 W19744 0.764037 - - Hs.180059 H75843 0.764037 Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed FAU Hs.177415 N51785 0.764037 - - Hs.380911 R22985 0.764037 RCD1 required for cell differentiation1 homolog (S. pombe) RQCD1 Hs.293687 H38496 0.764037 REV3-like, catalytic subunit of DNA polymerase zeta (yeast) REV3L Hs.115521 H49954 0.764037 Hypothetical protein FLJ23469 FLJ23469 Hs.103833 H12628 0.764037 KIAA1237 protein KIAA1237 Hs.10491 H40716 0.764037 ESTs ESTs Hs.121518 H90520 0.764037 Hypothetical protein MGC4643 MGC4643 Hs.226434 H23930 0.764037 Lipin 1 LPIN1 Hs.81412 N35107 0.764037 HSPC019 protein HSPC019 Hs.163724 AA040162 0.764037 Calnexin CANX Hs.155560 W23819 0.764037 Hypothetical protein FLJ11305 FLJ11305 Hs.7049 W86176 0.764037 HT002 protein; hypertension-related calcium-regulated gene HT002 Hs.238928 W94862 0.764037 Adenosine deaminase, RNA-specific ADAR Hs.7957 H00294 0.764037 Hypothetical protein 628 LOC56270 Hs.181349 W90099 0.779875 Neuroepithelial cell transforming gene 1 NET1 Hs.25155 H91088 0.779875 - -- N33169 0.779875 GPAA1P anchor attachment protein 1 homolog (yeast) GPAA1 Hs.4742 R98049 0.779875 Testis intracellular mediator protein PEAS Hs.281706 H50895 0.779875 Microtubule-associated protein 4 MAP4 Hs.239298 AA136072 0.779875 - - Hs.330310 N73706 0.779875 ESTs ESTs Hs.177366 AA150965 0.779875 KIAA1921 protein KIAA1921 Hs.348392 W51779 0.779875 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, suSMARCE1 Hs.332848 R69584 0.779875 - - Hs.269392 R80664 0.779875 Phosphoinositide-binding protein SR1 FENS-1 Hs.44743 H05011 0.779875 - -- AA101861 0.779875 Heat shock transcription factor 4 HSF4 Hs.75486 H52236 0.779875 Adducin 1 (alpha) ADD1 Hs.183706 W31151 0.779875 DNA segment on chromosome X and Y (unique) 155 expressed sequence DXYS155E Hs.21595 H24136 0.779875 - -- T53316 0.779875 Proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) PSME3 Hs.152978 R51286 0.779875 Integrin cytoplasmic domain-associated protein 1 ICAP-1A Hs.173274 R54439 0.779875 ESTs ESTs Hs.26119 AA043297 0.779875 Vacuolar protein sorting 45A (yeast) VPS45A Hs.6650 N34875 0.779875 Hypothetical protein FLJ20373 FLJ20373 Hs.6631 N49891 0.779875 Hypothetical protein FLJ20748 FLJ20748 Hs.91973 H27730 0.779875 Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoformPPP2R1B Hs.108705 AA203304 0.779875 CGI-130 protein LOC51020 Hs.32826 N66544 0.779875 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 PSMD4 Hs.148495 N36401 0.779875 Rad50-interacting protein 1 FLJ11785 Hs.44625 H27352 0.779875 V-Ha-ras Harvey rat sarcoma viral oncogene homolog HRAS Hs.37003 H58225 0.779875 LIM and senescent cell antigen-like domains 1 LIMS1 Hs.112378 AA010958 0.779875 Myogenic factor 6 (herculin) MYF6 Hs.35937 N67741 0.779875 DKFZP586D0919 protein DKFZP586D0919 Hs.49378 AA203622 0.779875 - -- R10734 0.779875 - -- W04197 0.779875 ESTs ESTs Hs.380239 W88660 0.779875 DKFZP586F1524 protein DKFZP586F1524 Hs.241543 H47562 0.779875 Mitochondrial ribosomal protein L11 MRPL11 Hs.152738 AA035296 0.779875 Vasodilator-stimulated phosphoprotein VASP Hs.93183 R17409 0.779875 - -- N51684 0.779875 - - Hs.47315 H77460 0.779875 Lymphocyte adaptor protein LNK Hs.13131 R44307 0.779875 Neurabin II LOC84687 Hs.110095 H71745 0.779875 Proteasome (prosome, macropain) 26S subunit, ATPase, 4 PSMC4 Hs.211594 N79517 0.779875 Fibrinogen, gamma polypeptide FGG Hs.75431 AA056650 0.779875 - - Hs.380129 N47636 0.779875 Hypothetical protein DC42 DC42 Hs.72805 AA156696 0.779875 B-cell translocation gene 1, anti-proliferative BTG1 Hs.77054 R54435 0.779875 - - Hs.352614 R43033 0.779875 - - Hs.374352 R52448 0.779875 Synovial sarcoma translocation, chromosome 18 SS18 Hs.153221 T80857 0.779875 - -- AA011565 0.779875 Squamous cell carcinoma antigen recognised by T cells 3 SART3 Hs.116875 R43282 0.779875 Leucine zipper, putative tumor suppressor 1 LZTS1 Hs.93605 R74076 0.779875 Hypothetical protein FLJ30656 FLJ30656 Hs.349887 H94706 0.779875 - - Hs.349150 N36402 0.779875 Hypothetical protein PRO2032 PRO2032 Hs.372571 T77709 0.779875 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105) NFKB1 Hs.83428 H39829 0.779875 Protein kinase C-like 1 PRKCL1 Hs.2499 R70930 0.779875 Sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase) SIAT4C Hs.75268 R00701 0.779875 Abhydrolase domain containing 1 ABHD2 Hs.99364 N59843 0.779875 Hypothetical protein MGC2217 MGC2217 Hs.323164 W15594 0.779875 Hypothetical protein FLJ20811 FLJ20811 Hs.83530 R31892 0.779875 - -- H63988 0.779875 ESTs ESTs Hs.38264 T71262 0.779875 Neuron navigator 2 NAV2 Hs.23467 N31849 0.779875 - - Hs.282895 W03020 0.779875 Calpain 3, (p94) CAPN3 Hs.40300 R19913 0.779875 ESTs ESTs Hs.22860 R01140 0.779875 Heat shock 90kDa protein 1, alpha HSPCA Hs.289088 H84204 0.779875 Protein phosphatase 1, catalytic subunit, beta isoform PPP1CB Hs.21537 R20723 0.779875 ESTs ESTs Hs.374490 AA040087 0.779875 Collagen, type IV, alpha 3 (Goodpasture antigen) binding protein COL4A3BP Hs.21276 R91950 0.779875 Cytochrome b-5 CYB5 Hs.83834 T86363 0.779875 - -- T92962 0.779875 CD81 antigen (target of antiproliferative antibody 1) CD81 Hs.54457 T79503 0.779875 - -- AA042830 0.779875 Lymphocyte-specific protein 1 LSP1 Hs.56729 H28623 0.779875 Cellular repressor of E1A-stimulated genes CREG Hs.5710 N69904 0.779875 Nuclear receptor coactivator 5 NCOA5 Hs.288140 H49329 0.795806 Breakpoint cluster region protein, uterine leiomyoma, 1; barrier to autointegratioBCRP1 Hs.268763 H53071 0.795806 Phosphatidylserine decarboxylase PISD Hs.8128 H10350 0.795806 Replication factor C (activator 1) 5, 36.5kDa RFC5 Hs.171075 R05480 0.795806 Solute carrier family 26, member 6 SLC26A6 Hs.298476 W85878 0.795806 Transcription factor 19 (SC1) TCF19 Hs.249184 AA156866 0.795806 Uncharacterized bone marrow protein BM045 BM045 Hs.8750 R26193 0.795806 Hypothetical protein FLJ10432 FLJ10432 Hs.143187 W38731 0.795806 - -- W78920 0.795806 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569 AA046623 0.795806 Hypothetical protein FLJ10377 FLJ10377 Hs.274263 R77727 0.795806 Nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs) NOLA2 Hs.23990 H27211 0.795806 Splicing factor 3a, subunit 2, 66kDa SF3A2 Hs.115232 H00903 0.795806 SWAP-70 protein SWAP70 Hs.153026 N68107 0.795806 3-hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR Hs.11899 R83178 0.795806 Hydroxysteroid (17-beta) dehydrogenase 7 HSD17B7 Hs.187579 N90061 0.795806 Sulfotransferase, estrogen-preferring STE Hs.54576 H78385 0.795806 Huntingtin interacting protein 2 HIP2 Hs.155485 N24877 0.795806 Ubiquitin specific protease 8 USP8 Hs.152818 R71120 0.795806 KIAA0831 protein KIAA0831 Hs.103000 W35335 0.795806 - -- AA040160 0.795806 Hypothetical protein BC017335 LOC92715 Hs.292570 R46282 0.795806 - -- W25045 0.795806 General transcription factor IIIA GTF3A Hs.75113 W68588 0.795806 Collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant and re COL7A1 Hs.1640 R22188 0.795806 - - Hs.356392 H17513 0.795806 Heat shock 70kDa protein 1-like HSPA1L Hs.80288 AA115291 0.795806 Epidermal growth factor receptor pathway substrate 15 EPS15 Hs.79095 AA135498 0.795806 CCAAT/enhancer binding protein (C/EBP), beta CEBPB Hs.99029 AA001813 0.795806 KIAA0052 protein KIAA0052 Hs.278608 N80318 0.795806 - - Hs.42834 AA210734 0.795806 ESTs ESTs Hs.291386 R11717 0.795806 Dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) DUSP11 Hs.14611 W37843 0.795806 Vacuolar protein sorting 11 (yeast) VPS11 Hs.234282 H20945 0.795806 - - Hs.379958 N54249 0.795806 - -- R26953 0.795806 Solute carrier family 31 (copper transporters), member 1 SLC31A1 Hs.380728 H15461 0.795806 - - Hs.323409 H14840 0.795806 Hypothetical protein MGC2668 MGC2668 Hs.56851 H49219 0.795806 Muscleblind-like (Drosophila) MBNL Hs.28578 R15788 0.795806 - -- R37394 0.795806 Hypothetical protein MGC3123 MGC3123 Hs.288600 N36412 0.795806 Dynein, cytoplasmic, light intermediate polypeptide 2 DNCLI2 Hs.194625 AA037843 0.795806 Transmembrane 4 superfamily member tetraspan NET-7 NET-7 Hs.95583 H51489 0.795806 Plexin B3 PLXNB3 Hs.380742 R65812 0.795806 Enabled homolog (Drosophila) ENAH Hs.14838 AA004801 0.795806 - -- T78345 0.795806 - - Hs.269116 T79902 0.795806 - - Hs.376652 AA035325 0.795806 Insulin receptor substrate 2 IRS2 Hs.143648 H49312 0.795806 Cytoplasmic linker 2 CYLN2 Hs.104717 H58462 0.795806 Nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs) NOLA3 Hs.14317 W15224 0.795806 KIAA0819 protein KIAA0819 Hs.301866 R00277 0.795806 GS15 LOC51272 Hs.300631 R14297 0.795806 RAS-like, estrogen-regulated, growth-inhibitor RERG Hs.21594 R37954 0.795806 Ras association (RalGDS/AF-6) domain family 2 RASSF2 Hs.80905 H82069 0.795806 Nuclear cap binding protein subunit 2, 20kDa NCBP2 Hs.240770 H44192 0.795806 Nischarin NISCH Hs.26285 H44693 0.795806 Hypothetical protein FLJ25604 FLJ25604 Hs.220745 AA045130 0.795806 Hypothetical protein FLJ10761 FLJ10761 Hs.343154 R21171 0.795806 Electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II) ETFA Hs.169919 N98883 0.795806 General transcription factor IIA, 1, 19/37kDa GTF2A1 Hs.299542 H43455 0.795806 Hypothetical protein PP2447 PP2447 Hs.33026 H77938 0.795806 Eukaryotic translation termination factor 1 ETF1 Hs.77324 W38743 0.795806 Olfactomedin 2 OLFM2 Hs.169743 N50674 0.795806 - - Hs.311051 AA033662 0.795806 Jun dimerization protein 2 JDP2 Hs.154095 R11257 0.795806 DNA directed RNA polymerase II polypeptide J-related gene POLR2J2 Hs.375569 N63947 0.795806 Hypothetical protein FLJ21940 FLJ21940 Hs.104916 R67381 0.795806 - - Hs.330716 H49993 0.795806 Neuron navigator 2 NAV2 Hs.23467 N30036 0.795806 Chorionic gonadotropin, beta polypeptide CGB Hs.348407 R39419 0.795806 - - Hs.351152 T95126 0.795806 - -- AA150238 0.811821 - -- T75241 0.811821 Plasminogen activator, urokinase receptor PLAUR Hs.179657 N36861 0.811821 ESTs ESTs Hs.42344 AA031564 0.811821 - - Hs.221255 R98556 0.811821 Cytochrome b-5 CYB5 Hs.83834 H62252 0.811821 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2 ALS2CR2 Hs.5771 N81095 0.811821 High-mobility group box 3 HMGB3 Hs.19114 N54932 0.811821 Hypothetical protein FLJ22875 FLJ22875 Hs.111222 R60357 0.811821 Alanyl-tRNA synthetase AARS Hs.75102 AA044807 0.811821 - -- AA045796 0.811821 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, suSMARCB1 Hs.159971 AA101823 0.811821 Elastin microfibril interface located protein EMILIN Hs.63348 W46363 0.811821 Host cell factor homolog LCP Hs.20597 R71155 0.811821 RalA binding protein 1 RALBP1 Hs.75447 R61624 0.811821 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35 DDX35 Hs.7174 AA203496 0.811821 - - Hs.20818 N40633 0.811821 AD031 protein AD031 Hs.44004 N59346 0.811821 Protein tyrosine phosphatase, non-receptor type 12 PTPN12 Hs.62 N67658 0.811821 - - Hs.10949 T92286 0.811821 Ral guanine nucleotide exchange factor RalGPS1A RALGPS1A Hs.374518 N64545 0.811821 Flightless I homolog (Drosophila) FLII Hs.83849 AA043545 0.811821 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2 PLOD2 Hs.41270 T99195 0.811821 - - Hs.18593 N41670 0.811821 KIAA1673 KIAA1673 Hs.301444 R98077 0.811821 Anti-oxidant protein 2 (non-selenium glutathione peroxidase, acidic calcium-indAOP2 Hs.120 AA210772 0.811821 Hypothetical protein FLJ22611 FLJ22611 Hs.27774 N/A2 0.811821 - -- H50385 0.811821 Calsenilin, presenilin binding protein, EF hand transcription factor CSEN Hs.13228 N93284 0.811821 Hypothetical protein MGC5627 MGC5627 Hs.237971 H75745 0.811821 Calcium homeostasis endoplasmic reticulum protein CHERP Hs.6430 N50057 0.811821 Cytokine induced protein 29 kDa CIP29 Hs.63908 R12426 0.811821 - -- R81337 0.811821 Colon carcinoma related protein LOC51159 Hs.30343 N99930 0.811821 BDG-29 proten BDG-29 Hs.81505 T77389 0.811821 Leiomodin 1 (smooth muscle) LMOD1 Hs.79386 T97968 0.811821 ESTs ESTs Hs.325159 R06577 0.811821 Deltex homolog 2 (Drosophila) DTX2 Hs.89135 R73991 0.811821 KIAA1160 protein KIAA1160 Hs.33122 W68697 0.811821 Hypothetical protein FLJ10998 FLJ10998 Hs.78110 H43499 0.811821 Immunoglobulin lambda locus IGL@ Hs.181125 W03485 0.811821 MAD, mothers against decapentaplegic homolog 5 (Drosophila) MADH5 Hs.37501 H45746 0.811821 - -- H11384 0.811821 - - Hs.352554 T97916 0.811821 ESTs ESTs Hs.191184 AA099688 0.811821 Melanoma differentiation associated protein-5 MDA5 Hs.293591 T93849 0.811821 Zinc finger protein 185 (LIM domain) ZNF185 Hs.16622 R83176 0.811821 Hypothetical protein FLJ11753 FLJ11753 Hs.62348 AA150973 0.811821 Hypothetical protein MGC10812 MGC10812 Hs.4188 N92448 0.811821 Transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)TCF3 Hs.101047 N59622 0.811821 Integral membrane protein 2A ITM2A Hs.17109 R22272 0.811821 ESTs ESTs Hs.355658 AA010675 0.811821 Glycogen synthase 1 (muscle) GYS1 Hs.772 T87912 0.811821 - - Hs.16478 W56002 0.811821 Acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thioACAA1 Hs.166160 T86617 0.811821 V-myb myeloblastosis viral oncogene homolog (avian)-like 2 MYBL2 Hs.179718 AA043987 0.811821 Parvin, alpha PARVA Hs.44077 T88001 0.811821 ESTs ESTs Hs.294105 H81249 0.811821 - -- W23818 0.811821 Nm23-phosphorylated unknown substrate MGC15437 Hs.55067 T95778 0.811821 SH3-domain binding protein 4 SH3BP4 Hs.17667 W52113 0.811821 - - Hs.106510 R71914 0.811821 - - Hs.17567 R79393 0.827916 Hypothetical protein FLJ25785 FLJ25785 Hs.9070 W03928 0.827916 Ribosomal protein S8 RPS8 Hs.151604 R35019 0.827916 - - Hs.24906 H38703 0.827916 Hypothetical protein FLJ10512 FLJ10512 Hs.93581 AA137064 0.827916 Cerebral cell adhesion molecule LOC51148 Hs.23954 N52496 0.827916 BTG family, member 3 BTG3 Hs.77311 R37843 0.827916 Mannosidase, alpha, class 1A, member 1 MAN1A1 Hs.25253 R13073 0.827916 Dual specificity phosphatase 7 DUSP7 Hs.296938 R72799 0.827916 HpaII tiny fragments locus 9C HTF9C Hs.63609 H01212 0.827916 Dynein, cytoplasmic, light intermediate polypeptide 1 DNCLI1 Hs.266483 N39088 0.827916 - - Hs.356387 AA099734 0.827916 Ribosomal protein L36a-like RPL36AL Hs.336628 N92463 0.827916 - -- N24561 0.827916 - - Hs.290880 AA134766 0.827916 Chromosome 7 open reading frame 11 C7orf11 Hs.66666 R21970 0.827916 General transcription factor IIH, polypeptide 2, 44kDa GTF2H2 Hs.191356 T97814 0.827916 Arrestin, beta 2 ARRB2 Hs.18142 R47758 0.827916 Hypothetical protein MGC2721 MGC2721 Hs.76084 W23577 0.827916 Polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa POLR2J Hs.80475 H05018 0.827916 Hypothetical protein FLJ10379 FLJ10379 Hs.14229 T96932 0.827916 Chromosome 6 open reading frame 11 C6orf11 Hs.17930 AA037862 0.827916 Nucleotide-sugar transporter similar to C. elegans sqv-7 SQV7L Hs.90078 N99001 0.827916 BCL2-associated athanogene 2 BAG2 Hs.55220 N48661 0.827916 KIAA1604 protein KIAA1604 Hs.209464 W05039 0.827916 HLA class II region expressed gene KE2 HKE2 Hs.356468 AA001937 0.827916 ESTs ESTs Hs.59974 AA033787 0.827916 G protein-coupled receptor 108 GPR108 Hs.167641 N30548 0.827916 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator) SLC25A4 Hs.2043 W46155 0.827916 - - Hs.355892 R72609 0.827916 - - Hs.5724 N40607 0.827916 Alpha2,3-sialyltransferase ST3GALVI Hs.34578 AA210722 0.827916 - - Hs.117920 N63007 0.827916 Dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit DPM1 Hs.5085 R48450 0.827916 KIAA1055 protein KIAA1055 Hs.126084 AA007414 0.827916 Copper metabolism gene MURR1 MURR1 Hs.339669 H12016 0.827916 Hypothetical protein FLJ21839 FLJ21839 Hs.348708 H78385 0.827916 Huntingtin interacting protein 2 HIP2 Hs.155485 AA058393 0.827916 - - Hs.40369 AA150315 0.827916 Chromosome 5 open reading frame 3 C5orf3 Hs.166551 H52254 0.827916 - - Hs.356708 W02900 0.827916 Cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, prCYP1B1 Hs.154654 N30559 0.827916 - -- AA046451 0.827916 - - Hs.165200 R28061 0.827916 - - Hs.14846 AA057300 0.827916 Quinoid dihydropteridine reductase QDPR Hs.75438 N22715 0.827916 Glutathione peroxidase 4 (phospholipid hydroperoxidase) GPX4 Hs.2706 R08828 0.827916 Pyruvate kinase, liver and RBC PKLR Hs.95990 R24964 0.827916 ESTs ESTs Hs.23766 H06560 0.827916 F-box and leucine-rich repeat protein 11 FBXL11 Hs.219614 N46615 0.827916 Similar to envelope protein LOC113386 Hs.132055 W73595 0.827916 Spondin 2, extracellular matrix protein SPON2 Hs.288126 T86626 0.827916 Connector enhancer of KSR-like (Drosophila kinase suppressor of ras) CNK1 Hs.16232 R28033 0.827916 Protein tyrosine phosphatase, non-receptor type 18 (brain-derived) PTPN18 Hs.278597 T52361 0.827916 DKFZP434P1750 protein DKFZP434P1750 Hs.7274 T97692 0.827916 Nicotinamide nucleotide transhydrogenase NNT Hs.18136 R23664 0.827916 Colon carcinoma related protein LOC51159 Hs.30343 W49616 0.827916 Villin 2 (ezrin) VIL2 Hs.155191 AA130080 0.827916 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 PSMD12 Hs.4295 AA011676 0.827916 G protein-coupled receptor 44 GPR44 Hs.299567 AA136788 0.827916 - -- H29572 0.827916 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318 AA101710 0.827916 - - Hs.12396 W72029 0.827916 E2F transcription factor 1 E2F1 Hs.96055 W85779 0.827916 Zinc finger protein 133 (clone pHZ-13) ZNF133 Hs.78434 AA046034 0.827916 Retinoblastoma binding protein 1 RBBP1 Hs.380994 AA039915 0.827916 Serum response factor (c-fos serum response element-binding transcription facSRF Hs.155321 AA028143 0.827916 Hypothetical protein FLJ22329 FLJ22329 Hs.367653 W42620 0.827916 RAB5B, member RAS oncogene family RAB5B Hs.77690 H05163 0.827916 FGF receptor activating protein 1 FRAG1 Hs.133968 W31684 0.827916 Hypothetical protein FLJ34969 FLJ34969 Hs.373580 W60866 0.827916 - - Hs.57806 N69403 0.827916 - - Hs.48480 N28915 0.827916 Ceramide kinase CERK Hs.34516 R17350 0.827916 KIAA1387 protein KIAA1387 Hs.301434 R67235 0.827916 HLA-B associated transcript 1 BAT1 Hs.55296 N91882 0.827916 Alpha2,3-sialyltransferase ST3GALVI Hs.34578 H15287 0.827916 P21(CDKN1A)-activated kinase 6 PAK6 Hs.21420 AA029349 0.827916 - -- AA045286 0.827916 Hypothetical protein FLJ10206 FLJ10206 Hs.55014 W57807 0.827916 Xylosylprotein beta1,4-galactosyltransferase, polypeptide 7 (galactosyltransferaB4GALT7 Hs.54702 W60893 0.827916 Polymerase (DNA-directed), delta 4 POLD4 Hs.82520 H14058 0.827916 Similar to HYPOTHETICAL 43.1 KD TRP-ASP REPEATS CONTAINING PROTLOC197336 Hs.12705 AA047792 0.827916 Regulator of G-protein signalling 1 RGS1 Hs.75256 H73169 0.827916 Hypothetical protein MGC2454 MGC2454 Hs.38399 AA029543 0.844084 - - Hs.112619 R21462 0.844084 Rho-GTPase activating protein 10 ARHGAP10 Hs.11611 W90601 0.844084 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/en HADHA Hs.75860 N20054 0.844084 - - Hs.20325 R13023 0.844084 - -- H21214 0.844084 NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme QNDUFS7 Hs.211914 T79037 0.844084 - -- AA035135 0.844084 - -- H88063 0.844084 Chromosome 1 open reading frame 9 C1orf9 Hs.108636 N59378 0.844084 ESTs ESTs Hs.48372 T93661 0.844084 Endogenous retroviral family W, env(C7), member 1 (syncytin) ERVWE1 Hs.373811 R20853 0.844084 KIAA1320 protein KIAA1320 Hs.117414 W46374 0.844084 - - Hs.24435 N20225 0.844084 Polymerase (RNA) II (DNA directed) polypeptide A, 220kDa POLR2A Hs.171880 R08338 0.844084 - - Hs.309257 N33054 0.844084 - - Hs.339654 T96059 0.844084 Uterine-derived 14 kDa protein LOC64150 Hs.173780 N44634 0.844084 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptideATP5C1 Hs.155433 AA054497 0.844084 AND-1 protein AND-1 Hs.72160 H08387 0.844084 Ubiquitin specific protease 3 USP3 Hs.251636 R63034 0.844084 Zinc finger protein 185 (LIM domain) ZNF185 Hs.16622 N92308 0.844084 Protein phosphatase 1, regulatory (inhibitor) subunit 16A PPP1R16A Hs.12185 N92995 0.844084 Monocytic leukemia zinc finger protein-related factor MORF Hs.27590 H06915 0.844084 Hypothetical protein FLJ21919 FLJ21919 Hs.105894 AA135644 0.844084 - - Hs.323511 AA054503 0.844084 - -- AA054080 0.844084 Zinc finger protein 36, C3H type, homolog (mouse) ZFP36 Hs.343586 N77703 0.844084 Unknown MGC21654 product MGC21654 Hs.95631 T97275 0.844084 Histone H2A.F/Z variant H2AV Hs.301005 AA037249 0.844084 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptideATP5C1 Hs.155433 W84774 0.844084 - - Hs.17643 W17368 0.844084 - - Hs.261734 H99877 0.844084 - - Hs.380785 AA099397 0.844084 DEAD-box protein abstrakt ABS Hs.274317 AA010349 0.844084 Slingshot 1 SSH1 Hs.60377 R60545 0.844084 Similar to RIKEN cDNA 2610036L13 MGC16386 Hs.23044 W68273 0.844084 CGI-18 protein LOC51008 Hs.121599 AA054454 0.844084 Proteasome (prosome, macropain) subunit, alpha type, 1 PSMA1 Hs.82159 AA039738 0.844084 KIAA0697 protein KIAA0697 Hs.12329 T80134 0.844084 Tubulin-specific chaperone d TBCD Hs.12570 R76719 0.844084 Microtubule-associated protein 1 light chain 3 alpha MAP1LC3A Hs.134707 N56656 0.844084 Highly charged protein D13S106E Hs.151236 W90103 0.844084 Heterogeneous nuclear ribonucleoprotein A1 HNRPA1 Hs.249495 AA028065 0.844084 Zinc finger protein 36, C3H type-like 2 ZFP36L2 Hs.78909 W15599 0.844084 BCL2/adenovirus E1B 19kDa interacting protein 3 BNIP3 Hs.79428 AA035343 0.844084 - -- H80179 0.844084 DKFZP586N0721 protein DKFZP586N0721 Hs.99843 H42133 0.844084 Retinal short-chain dehydrogenase/reductase retSDR2 LOC51170 Hs.12150 AA033680 0.844084 Hypothetical protein FLJ31657 FLJ31657 Hs.5518 H01162 0.844084 Hypothetical protein FLJ23251 FLJ23251 Hs.170737 W47132 0.844084 Amyotrophic lateral sclerosis 2 (juvenile) ALS2 Hs.27669 R02816 0.844084 KIAA0790 protein KIAA0790 Hs.12002 H70975 0.844084 - -- R97935 0.844084 Cell division cycle 34 CDC34 Hs.76932 AA214455 0.844084 - -- R99052 0.844084 Biliverdin reductase B (flavin reductase (NADPH)) BLVRB Hs.76289 N27136 0.844084 Karyopherin alpha 3 (importin alpha 4) KPNA3 Hs.3886 R74281 0.844084 Protein phosphatase 4 (formerly X), catalytic subunit PPP4C Hs.2903 N32770 0.844084 Likely ortholog of mouse metal response element binding transcription factor 2 M96 Hs.31016 R72784 0.844084 Cysteinyl-tRNA synthetase CARS Hs.159604 AA046082 0.844084 - -- N25294 0.844084 Collagen, type XVI, alpha 1 COL16A1 Hs.26208 W86390 0.844084 Hermansky-Pudlak syndrome 4 HPS4 Hs.6657 H75353 0.844084 - -- N59805 0.844084 Cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa CSTF1 Hs.172865 R20063 0.860318 Translocated promoter region (to activated MET oncogene) TPR Hs.169750 H84657 0.860318 Glutamate rich WD repeat protein GRWD GRWD Hs.218842 H43658 0.860318 Gene overexpressed in astrocytoma GOA Hs.293660 H77475 0.860318 - - Hs.13766 T96870 0.860318 ESTs ESTs Hs.17910 T79657 0.860318 ESTs ESTs Hs.14598 W92051 0.860318 ESTs ESTs Hs.58694 AA195213 0.860318 RAB2, member RAS oncogene family RAB2 Hs.78305 R49415 0.860318 Hypothetical protein BC013576 LOC114928 Hs.348493 H11043 0.860318 Kinesin family member 3B KIF3B Hs.301206 H92449 0.860318 TRIAD3 protein TRIAD3 Hs.86228 R53477 0.860318 - - Hs.4283 R93692 0.860318 Vaccinia related kinase 2 VRK2 Hs.82771 R14285 0.860318 - - Hs.100261 H00227 0.860318 YY1 associated protein YAP Hs.18851 R12731 0.860318 Zinc finger protein 335 ZNF335 Hs.165983 N56703 0.860318 CGI-145 protein LOC51028 Hs.146324 AA029359 0.860318 Laminin, beta 2 (laminin S) LAMB2 Hs.90291 H13238 0.860318 B-cell CLL/lymphoma 3 BCL3 Hs.31210 H09054 0.860318 DNA (cytosine-5-)-methyltransferase 1 DNMT1 Hs.77462 W86913 0.860318 - -- N75222 0.860318 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28 DDX28 Hs.155049 R72977 0.860318 RNA binding motif protein 8A RBM8A Hs.10283 AA004951 0.860318 DKFZP434C212 protein DKFZP434C212 Hs.172069 AA045470 0.860318 Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) KRT10 Hs.99936 W93811 0.860318 Killer cell lectin-like receptor subfamily B, member 1 KLRB1 Hs.169824 R05455 0.860318 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) MLL5 Hs.333300 H10406 0.860318 Profilin 2 PFN2 Hs.91747 AA035378 0.860318 - - Hs.11700 N74404 0.860318 - - Hs.38516 N81046 0.860318 - -- T74007 0.860318 Nicastrin NCSTN Hs.4788 H69509 0.860318 ATP-binding cassette, sub-family B (MDR/TAP), member 10 ABCB10 Hs.1710 AA131782 0.860318 - - Hs.182314 AA151485 0.860318 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206 N24445 0.860318 Synovial sarcoma, X breakpoint 4 SSX4 Hs.278632 AA047136 0.860318 - - Hs.355559 AA054552 0.860318 Chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alphaCXCL1 Hs.789 R45428 0.860318 DnaJ (Hsp40) homolog, subfamily A, member 1 DNAJA1 Hs.94 R36571 0.860318 Neuroglobin NGB Hs.274363 AA053856 0.860318 - -- N72694 0.860318 - -- W84339 0.860318 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6 ATP5J Hs.73851 T94859 0.860318 Ring finger protein 10 RNF10 Hs.5094 H28583 0.860318 - - Hs.31396 R38456 0.860318 - -- AA041350 0.860318 - - Hs.57847 W52466 0.860318 Carboxypeptidase A1 (pancreatic) CPA1 Hs.2879 R75740 0.860318 Hypothetical protein BC011880 LOC113444 Hs.27160 H39778 0.860318 Hypothetical protein MGC11134 MGC11134 Hs.326586 H58724 0.860318 - - Hs.374462 H85459 0.860318 Sortilin 1 SORT1 Hs.351872 H19104 0.860318 - - Hs.23406 N21274 0.860318 Nucleoporin 153kDa NUP153 Hs.211608 R87806 0.860318 ESTs ESTs Hs.356099 R25303 0.860318 Hypothetical protein MGC10940 MGC10940 Hs.47986 R08418 0.860318 KIAA0674 protein KIAA0674 Hs.14799 H84617 0.860318 P300/CBP-associated factor PCAF Hs.199061 R50259 0.860318 Protein kinase C-like 1 PRKCL1 Hs.2499 R07644 0.860318 RuvB-like 1 (E. coli) RUVBL1 Hs.272822 R20737 0.860318 CDC23 (cell division cycle 23, yeast, homolog) CDC23 Hs.153546 T86593 0.860318 ESTs ESTs Hs.16222 R31300 0.860318 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 CDS1 Hs.152981 AA054551 0.860318 - -- N76293 0.860318 Diaphanous homolog 1 (Drosophila) DIAPH1 Hs.26584 N92372 0.860318 Peroxiredoxin 4 PRDX4 Hs.83383 AA029467 0.860318 - -- N52670 0.860318 Likely ortholog of mouse exportin 4 XPO4 Hs.117102 AA047085 0.860318 Synaptotagmin-like 2 SYTL2 Hs.92254 W58500 0.860318 DNA segment on chromosome X (unique) 9928 expressed sequence DXS9928E Hs.54277 AA053136 0.860318 KIAA1982 protein KIAA1982 Hs.22969 H38928 0.860318 DKFZP566B183 protein DKFZP566B183 Hs.12305 N95764 0.860318 Chromosome 20 open reading frame 77 C20orf77 Hs.27192 R53547 0.860318 Elongation factor for selenoprotein translation SELB Hs.6522 AA059125 0.860318 Filamin B, beta (actin binding protein 278) FLNB Hs.81008 N21520 0.860318 Hypothetical protein BC008632 LOC90632 Hs.31917 AA027065 0.860318 LIS1-interacting protein NUDE1, rat homolog NUDE1 Hs.263925 W24394 0.860318 Alpha-2-macroglobulin A2M Hs.74561 T96045 0.860318 - -- N93147 0.860318 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); trMLLT2 Hs.114765 N71955 0.860318 Chromosome 20 open reading frame 111 C20orf111 Hs.75798 H44601 0.860318 ESTs ESTs Hs.134542 N72982 0.87661 Calpastatin CAST Hs.359682 H83499 0.87661 Endothelin converting enzyme 1 ECE1 Hs.288203 R88505 0.87661 Serine arginine-rich pre-mRNA splicing factor SR-A1 SR-A1 Hs.103521 N52622 0.87661 General transcription factor IIH, polypeptide 1, 62kDa GTF2H1 Hs.89578 N21286 0.87661 - -- W31173 0.87661 Hypothetical protein FLJ10326 FLJ10326 Hs.262823 R48041 0.87661 Glucosidase, alpha; acid (Pompe disease, glycogen storage disease type II) GAA Hs.1437 AA046918 0.87661 Splicing factor 3b, subunit 2, 145kDa SF3B2 Hs.75916 N33230 0.87661 High-mobility group 20A HMG20A Hs.69594 T81175 0.87661 - - Hs.355957 W58243 0.87661 - - Hs.134158 H46055 0.87661 KIAA0725 protein KIAA0725 Hs.26450 T51718 0.87661 Hypothetical protein FLJ13263 FLJ13263 Hs.288768 N59459 0.87661 Muscleblind-like protein MBLL39 MBLL39 Hs.283609 W40108 0.87661 - - Hs.346735 H09049 0.87661 Enolase 2, (gamma, neuronal) ENO2 Hs.146580 R68288 0.87661 - -- AA149233 0.87661 Prostaglandin E synthase PTGES Hs.146688 W21172 0.87661 Growth arrest-specific 11 GAS11 Hs.54877 R74460 0.87661 CGI-45 protein LOC51094 Hs.5298 W88742 0.87661 Bridging integrator 3 BIN3 Hs.68090 N36861 0.87661 ESTs ESTs Hs.42344 AA203403 0.87661 Hypothetical protein MGC13064 MGC13064 Hs.333524 N75841 0.87661 H1 histone family, member 2 H1F2 Hs.7644 H49724 0.87661 KIAA1373 protein KIAA1373 Hs.16229 T81697 0.87661 DKFZP434M154 protein DKFZP434M154 Hs.154680 N92218 0.87661 KIAA1598 protein KIAA1598 Hs.23740 H65659 0.87661 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 Hs.379991 AA131505 0.87661 HSPCO34 protein LOC51668 Hs.46967 N69121 0.87661 HSPC159 protein HSPC159 Hs.372208 AA115115 0.87661 Pyruvate dehydrogenase (lipoamide) beta PDHB Hs.979 R71970 0.87661 Retinoic acid receptor, alpha RARA Hs.250505 R77960 0.87661 Ubiquitin specific protease 4 (proto-oncogene) USP4 Hs.77500 W24393 0.87661 Syntaxin 10 STX10 Hs.43812 R02729 0.87661 Wolf-Hirschhorn syndrome candidate 1 WHSC1 Hs.110457 T84053 0.87661 WAS protein family, member 2 WASF2 Hs.288908 R52388 0.87661 KIAA1363 protein KIAA1363 Hs.22941 N62356 0.87661 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa EIF2S1 Hs.151777 AA054102 0.87661 Suppressor of cytokine signaling 5 SOCS5 Hs.169836 R62399 0.87661 Tetraspanin similar to TM4SF9 DC-TM4F2 Hs.101395 H10407 0.87661 KIAA0515 protein KIAA0515 Hs.108945 R61879 0.87661 - -- N21080 0.87661 PAX transcription activation domain interacting protein 1 like PAXIP1L Hs.173854 H85447 0.87661 - -- H27729 0.87661 AD038 LOC85026 Hs.22164 AA036873 0.87661 Chromosome 20 open reading frame 108 C20orf108 Hs.352413 R26320 0.87661 Filamin B, beta (actin binding protein 278) FLNB Hs.81008 W93338 0.87661 Hypothetical protein FLJ12592 FLJ12592 Hs.23100 AA047471 0.87661 Nucleolar protein GU2 GU2 Hs.7392 AA101862 0.87661 Source of immunodominant MHC-associated peptides SIMP Hs.183454 H79855 0.87661 Translational inhibitor protein p14.5 UK114 Hs.18426 AA099910 0.87661 Glutamyl aminopeptidase (aminopeptidase A) ENPEP Hs.291 T95735 0.87661 Phosphatidylinositol-4-phosphate 5-kinase, type I, alpha PIP5K1A Hs.149255 AA005268 0.87661 Chromosome 21 open reading frame 91 C21orf91 Hs.49391 H75644 0.87661 Hypothetical protein BC016005 LOC129642 Hs.356547 AA053141 0.87661 CGI-31 protein LOC51075 Hs.279861 H66591 0.87661 - - Hs.376349 W38337 0.87661 - -- AA029484 0.87661 DKFZP727M111 protein DKFZP727M111 Hs.4849 N70628 0.87661 Polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa POLR2K Hs.351475 N78859 0.87661 Myosin, light polypeptide 4, alkali; atrial, embryonic MYL4 Hs.356717 AA128311 0.87661 Peripheral myelin protein 22 PMP22 Hs.103724 W89153 0.87661 GABA(A) receptor-associated protein-like 2 GABARAPL2 Hs.6518 W20441 0.87661 KIAA0116 protein KIAA0116 Hs.182877 AA035519 0.87661 Chromosome 2 open reading frame 3 C2orf3 Hs.184175 H77990 0.87661 - - Hs.28113 N58742 0.87661 - -- H93203 0.87661 Nesca protein NESCA Hs.226499 T66828 0.87661 Hypothetical protein FLJ36748 FLJ36748 Hs.64313 N29439 0.87661 Sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) SGCD Hs.151899 H78279 0.87661 - - Hs.295789 R55733 0.87661 - - Hs.26454 R18594 0.87661 Hypothetical protein MGC2817 MGC2817 Hs.159406 W39414 0.87661 ESTs ESTs Hs.55327 AA115202 0.87661 - - Hs.136061 N52232 0.87661 NEDD8 ultimate buster-1 LOC51667 Hs.279780 W56565 0.87661 - - Hs.56185 N26031 0.87661 ESTs ESTs Hs.43725 AA040123 0.87661 Solute carrier family 27 (fatty acid transporter), member 4 SLC27A4 Hs.248953 N75008 0.87661 DKFZP564K247 protein DKFZP564K247 Hs.7917 N36780 0.87661 Carbonyl reductase 1 CBR1 Hs.88778 N75516 0.87661 KIAA1096 protein KIAA1096 Hs.69559 H10448 0.87661 Cytochrome b5 reductase 1 (B5R.1) LOC51706 Hs.289113 H70040 0.87661 TIGA1 TIGA1 Hs.12082 R83572 0.87661 Hypothetical protein FLJ10154 FLJ10154 Hs.179972 N35773 0.87661 Laminin, beta 1 LAMB1 Hs.82124 R25275 0.87661 ESTs ESTs Hs.356211 W93973 0.87661 BCL2/adenovirus E1B 19kDa interacting protein 1 BNIP1 Hs.77572 AA203110 0.87661 Androgen-induced basic leucine zipper AIBZIP Hs.372924 H14891 0.87661 Kinesin family member 3B KIF3B Hs.301206 T90647 0.87661 - - Hs.193649 AA009587 0.87661 Hypothetical protein MGC13183 MGC13183 Hs.59791 N54967 0.87661 Hypothetical protein BM-002 BM-002 Hs.367646 R01798 0.87661 LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 Hs.19074 N34234 0.87661 Esterase D/formylglutathione hydrolase ESD Hs.82193 R55009 0.892956 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypepGNAI2 Hs.77269 W21604 0.892956 Novel putative protein similar to YIL091C yeast hypothetical 84 kD protein fromDJ434O14.5 Hs.194754 R24277 0.892956 RAB40C, member RAS oncogene family RAB40C Hs.31408 AA114977 0.892956 Glutaminyl-tRNA synthetase QARS Hs.79322 N26477 0.892956 Iduronate 2-sulfatase (Hunter syndrome) IDS Hs.172458 H63547 0.892956 N-ethylmaleimide-sensitive factor attachment protein, alpha NAPA Hs.75932 R61769 0.892956 Crm, cramped-like (Drosophila) CRAMP1L Hs.15441 N36071 0.892956 - - Hs.28890 AA203115 0.892956 Organic cation transporter OKB1 OKB1 Hs.191996 H06474 0.892956 Fatty acid desaturase 3 FADS3 Hs.21765 AA041346 0.892956 M-phase phosphoprotein 6 MPHOSPH6 Hs.152720 N34626 0.892956 Cadherin 19, type 2 CDH19 Hs.129887 AA039228 0.892956 Farnesyltransferase, CAAX box, beta FNTB Hs.276 N29880 0.892956 Hypothetical protein DKFZp762O076 DKFZp762O076 Hs.21621 R88822 0.892956 - - Hs.26249 H69632 0.892956 Slingshot 1 SSH1 Hs.60377 R70132 0.892956 - - Hs.378751 T66873 0.892956 26S proteasome-associated pad1 homolog POH1 Hs.178761 R36127 0.892956 Filamin B, beta (actin binding protein 278) FLNB Hs.81008 H24175 0.892956 Adaptor-related protein complex 1, mu 1 subunit AP1M1 Hs.3832 N74005 0.892956 Bromodomain and PHD finger containing, 3 BRPF3 Hs.246795 R79187 0.892956 KIAA0101 gene product KIAA0101 Hs.81892 H65687 0.892956 Hypothetical protein FLJ23263 FLJ23263 Hs.288716 R53544 0.892956 - - Hs.4285 N42273 0.892956 Signal-induced proliferation-associated gene 1 SIPA1 Hs.7019 AA156433 0.892956 ESTs ESTs Hs.103864 R76103 0.892956 - - Hs.367898 W15364 0.892956 B-cell CLL/lymphoma 7A BCL7A Hs.211563 R48311 0.892956 - -- H60501 0.892956 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); trMLLT4 Hs.100469 N40830 0.892956 Hypothetical protein FLJ25436 FLJ25436 Hs.29706 H48733 0.892956 Interleukin enhancer binding factor 3, 90kDa ILF3 Hs.256583 R08800 0.892956 Tubulin, gamma 2 TUBG2 Hs.279669 T78404 0.892956 ESTs ESTs Hs.14280 R97943 0.892956 Zinc finger protein 26 (KOX 20) ZNF26 Hs.26432 W57795 0.892956 TSC-22-like THG-1 Hs.102447 H98919 0.892956 - -- AA047454 0.892956 Zinc finger protein 76 (expressed in testis) ZNF76 Hs.29222 AA064765 0.892956 Chromosome 11 hypothetical protein ORF3 LOC56851 Hs.4245 R24727 0.892956 Phosphatidylserine receptor PSR Hs.72660 H18946 0.892956 Leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domai LILRB2 Hs.22405 AA127846 0.892956 ESTs ESTs Hs.348901 H25541 0.892956 STRIN protein STRIN Hs.180403 W51953 0.892956 Tenascin XB TNXB Hs.169886 W60709 0.892956 C-terminal modulator protein CTMP Hs.293691 R17562 0.892956 - - Hs.239666 R28095 0.892956 Solute carrier family 12 (potassium/chloride transporters), member 4 SLC12A4 Hs.10094 N63284 0.892956 Putative protein O-mannosyltransferase POMT2 Hs.132989 W38465 0.892956 Developmentally regulated GTP binding protein 2 DRG2 Hs.78582 AA045672 0.892956 LIM domain protein RIL Hs.79691 AA136473 0.892956 - - Hs.46609 T84334 0.892956 Thymidine kinase 2, mitochondrial TK2 Hs.274701 N99051 0.892956 RNA binding motif, single stranded interacting protein 1 RBMS1 Hs.241567 N72176 0.892956 KIAA1046 protein KIAA1046 Hs.89519 R50031 0.892956 KIAA0602 protein KIAA0602 Hs.37656 AA031859 0.892956 Translocase of inner mitochondrial membrane 13 homolog (yeast) TIMM13 Hs.23410 AA029842 0.892956 Mature T-cell proliferation 1 MTCP1 Hs.3548 AA148637 0.892956 Neurofascin NFASC Hs.13349 N95812 0.892956 Insulin-like growth factor binding protein 6 IGFBP6 Hs.274313 AA036778 0.892956 - -- H81916 0.892956 Transcription termination factor, RNA polymerase II TTF2 Hs.142157 N69957 0.892956 - - Hs.164230 AA004492 0.892956 Cytochrome P450 monooxygenase CYP-M Hs.352566 T81296 0.892956 Glucocorticoid receptor DNA binding factor 1 GRLF1 Hs.102548 AA001748 0.892956 Hypothetical protein FLJ11286 FLJ11286 Hs.12151 AA043886 0.892956 Dystrobrevin binding protein 1 DTNBP1 Hs.43481 AA194139 0.892956 C-Mpl binding protein LOC113251 Hs.26613 R62341 0.892956 Hypothetical protein FLJ35564 FLJ35564 Hs.374836 H95259 0.892956 Membrane protein, palmitoylated 1, 55kDa MPP1 Hs.1861 W47372 0.892956 Zinc finger protein 36, C3H type-like 2 ZFP36L2 Hs.78909 H14586 0.892956 - -- W74233 0.892956 Related RAS viral (r-ras) oncogene homolog RRAS Hs.9651 N68511 0.892956 Hypothetical protein FLJ12085 FLJ12085 Hs.48827 H83414 0.892956 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa NDUFB6 Hs.109646 W40304 0.909347 Apoptosis inhibitor 5 API5 Hs.227913 N27628 0.909347 - -- H87107 0.909347 Ring finger protein 5 RNF5 Hs.216354 AA151307 0.909347 Guanine nucleotide binding protein (G protein), beta polypeptide 2 GNB2 Hs.91299 T39578 0.909347 Mitochondrial ribosomal protein S18C MRPS18C Hs.3385 H37900 0.909347 Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant) RHO Hs.247565 AA151412 0.909347 - -- H89628 0.909347 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+SLC9A1 Hs.170222 R90757 0.909347 Likely ortholog of mouse rabphilin 3A RPH3A Hs.21239 AA054731 0.909347 Hypothetical protein BC014942 LOC89941 Hs.21497 R93735 0.909347 ESTs ESTs Hs.35193 H16934 0.909347 Zinc finger protein 278 ZNF278 Hs.27801 N42162 0.909347 DC2 protein DC2 Hs.103180 H50914 0.909347 Endothelin converting enzyme 1 ECE1 Hs.288203 AA042817 0.909347 Calmodulin 2 (phosphorylase kinase, delta) CALM2 Hs.182278 AA126411 0.909347 - - Hs.15806 R18757 0.909347 - - Hs.13702 AA031411 0.909347 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa PAFAH1B1 Hs.77318 R54992 0.909347 - -- R08498 0.909347 - -- W85972 0.909347 Reserved SYAP1 Hs.47334 W16814 0.909347 Hypothetical protein MGC18257 MGC18257 Hs.350860 W39250 0.909347 Hairy homolog (Drosophila) HRY Hs.250666 AA045331 0.909347 ADP-ribosylation factor 4-like ARF4L Hs.183153 R48247 0.909347 Hypothetical protein MGC15429 MGC15429 Hs.79 N63014 0.909347 Poly (ADP-ribose) glycohydrolase PARG Hs.91390 N36109 0.909347 Macrophage myristoylated alanine-rich C kinase substrate MACMARCKS Hs.75061 H49229 0.909347 Hypothetical protein FLJ20040 FLJ20040 Hs.61960 N77925 0.909347 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa NDUFA1 Hs.74823 N80287 0.909347 KIAA1357 protein KIAA1357 Hs.170162 AA047408 0.909347 Family with sequence similarity 3, member A FAM3A Hs.289108 N25598 0.909347 - - Hs.187908 H49485 0.909347 Cytochrome c oxidase subunit VIIb COX7B Hs.75752 AA130140 0.909347 SnRNP assembly defective 1 homolog SAD1 Hs.12820 N46199 0.909347 Hypothetical protein DKFZp761N0624 DKFZp761N0624 Hs.21893 N76910 0.909347 Ribosomal protein L23a pseudogene 7 RPL23AP7 Hs.247828 R24294 0.909347 Citron (rho-interacting, serine/threonine kinase 21) CIT Hs.15767 AA041282 0.909347 - -- R14521 0.909347 Spectrin SH3 domain binding protein 1 SSH3BP1 Hs.24752 AA115560 0.909347 - - Hs.63368 W90588 0.909347 Synaptogyrin 1 SYNGR1 Hs.6139 N52493 0.909347 Hypothetical protein FLJ21432 FLJ21432 Hs.334854 R90939 0.909347 ESTs ESTs Hs.34180 N40437 0.909347 S-adenosylhomocysteine hydrolase-like 1 AHCYL1 Hs.4113 R22511 0.909347 LAG1 longevity assurance homolog 2 (S. cerevisiae) LASS2 Hs.285976 W04539 0.909347 KIAA0295 protein KIAA0295 Hs.155979 R61363 0.909347 - - Hs.117530 W87783 0.909347 REV1-like (yeast) REV1L Hs.110347 H08342 0.909347 - -- AA034388 0.909347 Sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and SEMA4B Hs.9598 R13348 0.909347 Plexin A1 PLXNA1 Hs.334666 W43007 0.909347 Pregnancy specific beta-1-glycoprotein 5 PSG5 Hs.251850 R55573 0.909347 - - Hs.249365 R89801 0.909347 Hypothetical protein BC001584 LOC124245 Hs.93670 R16440 0.909347 AD024 protein AD024 Hs.21137 W23776 0.909347 ENOS interacting protein NOSIP Hs.7236 N22081 0.909347 PC4 and SFRS1 interacting protein 2 PSIP2 Hs.82110 H69584 0.909347 - -- AA031836 0.909347 ESTs ESTs Hs.131714 H81266 0.909347 Retinol dehydrogenase 5 (11-cis and 9-cis) RDH5 Hs.172914 W87527 0.909347 Hypothetical protein PNAS-131 PNAS-131 Hs.37883 R47922 0.909347 Hypothetical protein FLJ22341 FLJ22341 Hs.25485 H49910 0.909347 Insulin-like growth factor binding protein 7 IGFBP7 Hs.119206 T86612 0.909347 ESTs ESTs Hs.16228 H29171 0.909347 DKFZP564A2416 protein DKFZP564A2416 Hs.5297 R39303 0.909347 Rab geranylgeranyltransferase, alpha subunit RABGGTA Hs.78920 R17223 0.909347 - -- R51929 0.909347 KIAA0864 protein KIAA0864 Hs.84883 AA063161 0.909347 - - Hs.181767 AA027125 0.909347 Hypothetical protein FLJ10385 FLJ10385 Hs.30922 T72638 0.909347 - - Hs.380756 N59818 0.909347 Endocrine regulator HRIHFB2436 Hs.48433 R93572 0.909347 - -- AA136799 0.909347 Growth arrest and DNA-damage-inducible, alpha GADD45A Hs.80409 N29438 0.909347 Mitochondrial ribosomal protein L46 MRPL46 Hs.278328 H93830 0.909347 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9ATP5G1 Hs.80986 AA053299 0.909347 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ1CD59 Hs.278573 N25352 0.909347 Coxsackie virus and adenovirus receptor CXADR Hs.79187 R18959 0.909347 Hypothetical protein FLJ13111 FLJ13111 Hs.288382 H08236 0.909347 KIAA1096 protein KIAA1096 Hs.69559 R51985 0.909347 Uncharacterized hypothalamus protein HT008 HT008 Hs.16206 W06830 0.925776 MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cereMCM5 Hs.77171 R93490 0.925776 Cleavage and polyadenylation specific factor 4, 30kDa CPSF4 Hs.6351 R66367 0.925776 ESTs ESTs Hs.118769 W03106 0.925776 Mitogen-activated protein kinase kinase kinase kinase 5 MAP4K5 Hs.246970 AA033687 0.925776 STAT induced STAT inhibitor-2 STATI2 Hs.110776 H43647 0.925776 Uncharacterized hematopoietic stem/progenitor cells protein MDS033 MDS033 Hs.54960 H23263 0.925776 Spir-1 protein Spir-1 Hs.16758 H10026 0.925776 Zinc finger protein 193 ZNF193 Hs.96448 R36886 0.925776 Chromosome 20 open reading frame 104 C20orf104 Hs.301055 N24229 0.925776 Polypyrimidine tract binding protein 1 PTBP1 Hs.172550 H82739 0.925776 - - Hs.40411 H03425 0.925776 Alpha-1-microglobulin/bikunin precursor AMBP Hs.76177 AA043196 0.925776 Hypothetical protein FLJ10450 FLJ10450 Hs.267604 AA203234 0.925776 KIAA1728 protein KIAA1728 Hs.252748 H50248 0.925776 Prostate derived STE20-like kinase PSK PSK Hs.66141 T87298 0.925776 - -- AA126383 0.925776 Neuropilin 2 NRP2 Hs.17778 H26525 0.925776 LATS, large tumor suppressor, homolog 2 (Drosophila) LATS2 Hs.19074 W60890 0.925776 RAB2, member RAS oncogene family RAB2 Hs.78305 AA115748 0.925776 Interferon-related developmental regulator 1 IFRD1 Hs.7879 N47247 0.925776 - -- R17784 0.925776 ESTs ESTs Hs.21757 T81285 0.925776 Phosphofructokinase, liver PFKL Hs.155455 N80988 0.925776 GTP binding protein 2 GTPBP2 Hs.13011 W24178 0.925776 IlvB (bacterial acetolactate synthase)-like ILVBL Hs.78880 W44390 0.925776 GM2 ganglioside activator protein GM2A Hs.289082 R72158 0.925776 - -- N46186 0.925776 Clone FLB4739 LOC51218 Hs.294083 T83261 0.925776 - - Hs.14456 H84221 0.925776 High-glucose-regulated protein 8 HGRG8 Hs.20993 H10406 0.925776 Profilin 2 PFN2 Hs.91747 AA099731 0.925776 Follicular lymphoma variant translocation 1 FVT1 Hs.74050 AA037207 0.925776 KIAA1668 protein KIAA1668 Hs.8535 AA149643 0.925776 Egl nine homolog 1 (C. elegans) EGLN1 Hs.6523 AA150728 0.925776 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3 ADPRTL3 Hs.271742 AA044084 0.925776 Chromosome 12 open reading frame 5 C12orf5 Hs.24792 H37804 0.925776 Glucose-6-phosphatase, transport (glucose-6-phosphate) protein 1 G6PT1 Hs.132760 R52028 0.925776 Protein tyrosine phosphatase, non-receptor type 23 PTPN23 Hs.25524 N73287 0.925776 Death-associated protein 6 DAXX Hs.336916 N71959 0.925776 Hypothetical protein MGC13204 MGC13204 Hs.157148 W80994 0.925776 Nerve growth factor receptor (TNFRSF16) associated protein 1 NGFRAP1 Hs.381039 N69014 0.925776 SRY (sex determining region Y)-box 12 SOX12 Hs.43627 AA010048 0.925776 Hypothetical protein FLJ11301 FLJ11301 Hs.301724 AA010018 0.925776 Hypothetical protein FLJ22353 FLJ22353 Hs.22157 N79530 0.925776 Clathrin, heavy polypeptide (Hc) CLTC Hs.178710 AA037618 0.925776 - - Hs.109731 R76996 0.925776 Lamin B receptor LBR Hs.152931 H53989 0.925776 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, suSMARCD2 Hs.250581 N77879 0.925776 WD-repeat protein HAN11 Hs.288283 AA131634 0.925776 - - Hs.8172 W02089 0.925776 Hypothetical protein PRO1843 PRO1843 Hs.283330 AA028185 0.925776 Sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase) SPR Hs.301540 AA047076 0.925776 Cytochrome b5 reductase b5R.2 LOC51700 Hs.22142 T93888 0.925776 - -- AA194047 0.925776 Mitogen-activated protein kinase kinase 7 MAP2K7 Hs.110299 AA033710 0.925776 - - Hs.351928 T83736 0.925776 Hypothetical protein FLJ31121 FLJ31121 Hs.350194 AA136694 0.925776 KIAA0229 protein KIAA0229 Hs.20060 N72077 0.925776 - - Hs.196716 N36351 0.925776 Connective tissue growth factor CTGF Hs.75511 AA125942 0.925776 ESTs ESTs Hs.61881 AA043535 0.925776 Lysophosphatidic acid acyltransferase-delta LPAAT-delta Hs.353175 W42881 0.925776 DKFZp434J1813 protein DKFZP434J1813 Hs.1098 AA024415 0.925776 Keratin 1 (epidermolytic hyperkeratosis) KRT1 Hs.80828 H43482 0.925776 Valyl-tRNA synthetase 2 VARS2 Hs.159637 N95455 0.925776 N-acetylgalactosaminidase, alpha- NAGA Hs.75372 N79578 0.925776 ClpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coCLPP Hs.74362 R78873 0.925776 ESTs ESTs Hs.29822 N67708 0.925776 Hypothetical protein FLJ20644 FLJ20644 Hs.49376 H43498 0.925776 MAP/microtubule affinity-regulating kinase 1 MARK1 Hs.12808 AA046075 0.925776 - - Hs.88845 N93577 0.925776 Hypothetical protein HSPC251 HSPC251 Hs.54971 H45175 0.925776 Zinc finger protein 36, C3H type-like 1 ZFP36L1 Hs.85155 AA040886 0.925776 ESTs ESTs Hs.11325 R17452 0.925776 ATPase, Class II, type 9B ATP9B Hs.91471 AA044141 0.925776 Chromosome 20 open reading frame 98 C20orf98 Hs.286128 R35530 0.942237 RAD23 homolog B (S. cerevisiae) RAD23B Hs.178658 R93500 0.942237 - - Hs.34490 R20380 0.942237 ESTs ESTs Hs.12758 AA213820 0.942237 - - Hs.256533 T71576 0.942237 Hypothetical protein MGC5309 MGC5309 Hs.13885 W07170 0.942237 Hepatitis B virus x interacting protein HBXIP Hs.80464 AA031852 0.942237 Synaptophysin-like protein SYPL Hs.80919 H05457 0.942237 - -- AA102111 0.942237 Collagen, type XV, alpha 1 COL15A1 Hs.83164 H61134 0.942237 Solute carrier family 6 (neurotransmitter transporter, creatine), member 8 SLC6A8 Hs.187958 N63482 0.942237 Lysosomal-associated membrane protein 2 LAMP2 Hs.8262 AA057870 0.942237 Solute carrier family 26, member 10 SLC26A10 Hs.353207 R25755 0.942237 ESTs ESTs Hs.106131 W69209 0.942237 Phosphatidylinositol glycan, class H PIGH Hs.177 T78208 0.942237 IQ motif containing GTPase activating protein 1 IQGAP1 Hs.1742 AA046245 0.942237 Osteoblast specific factor 2 (fasciclin I-like) OSF-2 Hs.136348 AA129971 0.942237 - -- R45007 0.942237 Adaptor-related protein complex 3, delta 1 subunit AP3D1 Hs.75056 AA044181 0.942237 Enabled homolog (Drosophila) ENAH Hs.14838 N26062 0.942237 WD40 protein Ciao1 CIAO1 Hs.12109 AA039643 0.942237 Endothelial-derived gene 1 EG1 Hs.380864 T84583 0.942237 KIAA0195 gene product KIAA0195 Hs.301132 N42535 0.942237 Hypothetical protein BC008647 LOC91875 Hs.102480 N77814 0.942237 C-src tyrosine kinase CSK Hs.77793 AA203544 0.942237 Ubiquitin-activating enzyme E1-like UBE1L Hs.16695 R35343 0.942237 Hypothetical protein BC016683 LOC139231 Hs.24968 W87377 0.942237 DNA segment, numerous copies, expressed probes (GS1 gene) DXF68S1E Hs.78991 AA147618 0.942237 - - Hs.71848 AA053736 0.942237 Hypothetical protein FLJ23375 FLJ23375 Hs.285996 R20016 0.942237 - - Hs.22689 R55789 0.942237 Amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like) APBA2 Hs.26468 R72445 0.942237 Sarcospan (Kras oncogene-associated gene) SSPN Hs.183428 H98809 0.942237 Poly(A) binding protein, cytoplasmic 1 PABPC1 Hs.172182 R11669 0.942237 Hypothetical protein LOC56912 LOC56912 Hs.334360 R86233 0.942237 Serum/glucocorticoid regulated kinase SGK Hs.296323 R34021 0.942237 High-mobility group nucleosome binding domain 1 HMGN1 Hs.251064 H64822 0.942237 RNA binding motif protein 8A RBM8A Hs.10283 H21780 0.942237 Craniofacial development protein 1 CFDP1 Hs.296460 H89751 0.942237 KIAA1870 protein KIAA1870 Hs.334604 H53718 0.942237 - -- AA115289 0.942237 Huntingtin-associated protein interacting protein (duo) HAPIP Hs.8004 R99156 0.942237 P53-regulated DDA3 DDA3 Hs.77550 W78790 0.942237 TNF receptor-associated factor 4 TRAF4 Hs.8375 H23344 0.942237 - - Hs.356140 N67802 0.942237 KIAA0871 protein KIAA0871 Hs.7972 H99843 0.942237 Quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylasQPRT Hs.8935 H20174 0.942237 Adenosine monophosphate deaminase 2 (isoform L) AMPD2 Hs.82927 AA011707 0.942237 Ras homolog gene family, member U ARHU Hs.20252 R55337 0.942237 - - Hs.310092 W52798 0.942237 Emerin (Emery-Dreifuss muscular dystrophy) EMD Hs.2985 T67153 0.942237 Inner mitochondrial membrane peptidase 2 like IMMP2L Hs.89576 N95177 0.942237 Replication factor C (activator 1) 1, 145kDa RFC1 Hs.166563 R39195 0.942237 Junctional adhesion molecule 1 JAM1 Hs.12284 N41517 0.942237 Aminoacylase 1 ACY1 Hs.334707 T83291 0.942237 ESTs ESTs Hs.220624 H37821 0.942237 - -- T83125 0.942237 - -- N57339 0.942237 Hypothetical protein FLJ11240 FLJ11240 Hs.339833 AA040084 0.942237 - - Hs.25144 R36505 0.942237 ESTs ESTs Hs.271945 N24957 0.942237 Chromosome 21 open reading frame 6 C21orf6 Hs.34136 AA126874 0.942237 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, e YWHAH Hs.349530 H69302 0.942237 Cyclin-dependent kinase (CDC2-like) 10 CDK10 Hs.77313 R11847 0.942237 - -- AA126734 0.942237 Downstream neighbor of SON DONSON Hs.17834 N71255 0.942237 SAC2 suppressor of actin mutations 2-like (yeast) SACM2L Hs.169407 R80601 0.942237 Zinc finger protein 294 ZNF294 Hs.288773 N90836 0.942237 Fragile X mental retardation 1 FMR1 Hs.89764 AA101783 0.942237 ESTs ESTs Hs.22380 AA099589 0.942237 GDP dissociation inhibitor 2 GDI2 Hs.56845 W35370 0.942237 Nuclear domain 10 protein NDP52 Hs.154230 R10692 0.942237 Hypothetical protein DKFZp762E1312 DKFZp762E1312 Hs.104859 N68460 0.942237 - - Hs.27038 R70771 0.942237 Ubiquitin specific protease 11 USP11 Hs.171501 N68372 0.942237 - -- AA059245 0.942237 ESTs ESTs Hs.32713 R14784 0.942237 ESTs ESTs Hs.268773 N59242 0.942237 Hypothetical protein HH114 HH114 Hs.48348 N25228 0.942237 Heparan sulfate 2-O-sulfotransferase 1 HS2ST1 Hs.169939 W68491 0.942237 KIAA0892 protein KIAA0892 Hs.112751 R66076 0.942237 Hypothetical protein FLJ20038 FLJ20038 Hs.72071 N51466 0.942237 - -- R80226 0.942237 ESTs ESTs Hs.105636 N20843 0.942237 - -- H61334 0.942237 RNA binding protein S1, serine-rich domain RNPS1 Hs.75104 H15851 0.942237 Hypothetical protein FLJ31821 FLJ31821 Hs.351575 AA043766 0.942237 - -- R56380 0.942237 - - Hs.356416 AA150792 0.942237 - -- T75394 0.958723 Eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa EIF2B3 Hs.283627 W39234 0.958723 Mitochondrial ribosomal protein L16 MRPL16 Hs.5080 AA029895 0.958723 Fibrillarin FBL Hs.99853 H04790 0.958723 KIAA1855 protein KIAA1855 Hs.343820 N77027 0.958723 - - Hs.279607 R84556 0.958723 WD repeat domain 10 WDR10 Hs.70202 H10070 0.958723 KIAA0169 protein KIAA0169 Hs.374382 AA045734 0.958723 GS15 LOC51272 Hs.300631 R38371 0.958723 - - Hs.9691 N72504 0.958723 Ferrochelatase (protoporphyria) FECH Hs.26 H82876 0.958723 ESTs ESTs Hs.374415 T79456 0.958723 - -- W16434 0.958723 Testis expressed sequence 27 TEX27 Hs.6120 N80703 0.958723 Chromosome 20 open reading frame 20 C20orf20 Hs.143954 AA115737 0.958723 Solute carrier family 2 (facilitated glucose transporter), member 10 SLC2A10 Hs.305971 W45316 0.958723 XPMC2 protein LOC57109 Hs.235376 R44372 0.958723 KIAA1322 protein KIAA1322 Hs.72242 AA213820 0.958723 - - Hs.256533 N93367 0.958723 Phosphorylase kinase, alpha 2 (liver) PHKA2 Hs.54941 AA151400 0.958723 - - Hs.379188 N33136 0.958723 Translin TSN Hs.75066 N30278 0.958723 KIAA0872 protein KIAA0872 Hs.40109 H75861 0.958723 Apoptotic chromatin condensation inducer in the nucleus ACN Hs.227133 R52052 0.958723 Hypothetical protein BC012357 LOC89953 Hs.53447 H17047 0.958723 Zinc finger protein 133 (clone pHZ-13) ZNF133 Hs.78434 H02626 0.958723 Annexin A6 ANXA6 Hs.118796 H84157 0.958723 Bobby sox homolog (Drosophila) BBX Hs.35380 W58638 0.958723 - -- H82175 0.958723 Sialidase 1 (lysosomal sialidase) NEU1 Hs.118721 R10029 0.958723 ESTs ESTs Hs.20516 T54683 0.958723 DNA helicase homolog PIF1 PIF1 Hs.112160 AA054459 0.958723 DKFZP564O1863 protein DKFZP564O1863 Hs.173074 W58007 0.958723 KIAA0222 gene product KIAA0222 Hs.48450 AA026748 0.958723 Phosphoinositide-3-kinase, class 2, alpha polypeptide PIK3C2A Hs.249235 N20261 0.958723 - - Hs.26418 R07631 0.958723 ESTs ESTs Hs.268640 N27190 0.958723 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) UCHL3 Hs.77917 R94555 0.958723 Collagen, type IV, alpha 2 COL4A2 Hs.75617 N50540 0.958723 - - Hs.346742 AA029709 0.958723 Syntaxin 18 STX18 Hs.13406 AA041273 0.958723 BRG1-binding protein ELD/OSA1 ELD/OSA1 Hs.73287 R71264 0.958723 - - Hs.16798 R66378 0.958723 RAB9A, member RAS oncogene family RAB9A Hs.330994 AA137081 0.958723 Adaptor-related protein complex 1, mu 1 subunit AP1M1 Hs.3832 H27818 0.958723 Hypothetical protein FLJ30656 FLJ30656 Hs.349887 W23753 0.958723 Phosphoprotein enriched in astrocytes 15 PEA15 Hs.194673 H85791 0.958723 - - Hs.380059 N73756 0.958723 KIAA0628 gene product KIAA0628 Hs.43133 W40265 0.958723 NEFA-interacting nuclear protein NIP30 NIP30 Hs.285017 AA002088 0.958723 Pregnancy specific beta-1-glycoprotein 6 PSG6 Hs.252097 AA037306 0.958723 - - Hs.169872 R39304 0.958723 Ephrin-B2 EFNB2 Hs.30942 AA037091 0.958723 Transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) TCEB1 Hs.184693 H44228 0.958723 Calcium/calmodulin-dependent protein kinase kinase 2, beta CAMKK2 Hs.108708 AA149279 0.958723 DNAJ domain-containing MCJ Hs.279884 N89673 0.958723 Peroxisome proliferative activated receptor, gamma, coactivator 1 PPARGC1 Hs.198468 AA047157 0.958723 Kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocy KAI1 Hs.323949 H00619 0.958723 - - Hs.349261 R21825 0.958723 - - Hs.23272 N29648 0.958723 CD164 antigen, sialomucin CD164 Hs.43910 N68917 0.958723 P53 regulated PA26 nuclear protein PA26 Hs.14125 N74870 0.958723 Ring-box 1 RBX1 Hs.279919 AA059073 0.958723 - -- H00267 0.958723 Hypothetical protein FLJ22955 FLJ22955 Hs.83097 H80740 0.958723 Phosphofructokinase, muscle PFKM Hs.75160 AA057871 0.958723 DNA-damage-inducible transcript 3 DDIT3 Hs.337761 H87188 0.958723 Hypothetical protein FLJ14511 FLJ14511 Hs.40919 N69477 0.958723 Cytochrome c oxidase subunit Vb COX5B Hs.1342 N27866 0.958723 Pp21 homolog LOC51186 Hs.15984 T51710 0.958723 Endoglin (Osler-Rendu-Weber syndrome 1) ENG Hs.76753 N50632 0.958723 Leucine-rich and death domain containing LRDD Hs.123136 R83875 0.958723 ATP-binding cassette, sub-family B (MDR/TAP), member 10 ABCB10 Hs.1710 AA044143 0.958723 Molybdenum cofactor synthesis 1 MOCS1 Hs.349416 T85994 0.958723 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa NDUFB4 Hs.227750 AA010417 0.958723 Leukotriene A4 hydrolase LTA4H Hs.81118 W78793 0.958723 Epidermal growth factor receptor pathway substrate 8 EPS8 Hs.2132 R68652 0.958723 Adducin 1 (alpha) ADD1 Hs.183706 H66836 0.958723 - - Hs.224967 N23988 0.958723 RAB13, member RAS oncogene family RAB13 Hs.151536 R49920 0.958723 Pilin-like transcription factor PILB Hs.279754 R77522 0.958723 - - Hs.29643 R41603 0.958723 Secretogranin II (chromogranin C) SCG2 Hs.75426 H28503 0.958723 - -- H09731 0.958723 - - Hs.7133 R82950 0.958723 DKFZP434N093 protein DKFZP434N093 Hs.33363 H22657 0.975227 Carboxylesterase 2 (intestine, liver) CES2 Hs.282975 R31509 0.975227 Arfaptin 1 HSU52521 Hs.301064 R50656 0.975227 Protein phosphatase 1, regulatory (inhibitor) subunit 12C PPP1R12C Hs.235975 H61827 0.975227 KIAA1882 protein MGC4737 Hs.157240 AA056593 0.975227 KIAA0063 gene product KIAA0063 Hs.3094 H00874 0.975227 - - Hs.295789 R86973 0.975227 Hypothetical protein DKFZp434P0531 DKFZp434P0531 Hs.284181 N93056 0.975227 Mitochondrial ribosomal protein L14 MRPL14 Hs.343579 N23302 0.975227 Lysyl oxidase LOX Hs.102267 N25073 0.975227 - EST Hs.322020 R00205 0.975227 KIAA0595 protein KIAA0595 Hs.146957 R92012 0.975227 Death-associated protein DAP Hs.75189 N89829 0.975227 - - Hs.293653 R36748 0.975227 - - Hs.22545 AA147566 0.975227 - -- H03154 0.975227 CAC-1 CAC-1 Hs.343912 AA020869 0.975227 Heterogeneous nuclear ribonucleoprotein C (C1/C2) HNRPC Hs.182447 H26401 0.975227 Serine/arginine repetitive matrix 2 SRRM2 Hs.197114 AA045171 0.975227 - - Hs.25930 R40486 0.975227 Mitogen-activated protein kinase kinase kinase 7 interacting protein 1 MAP3K7IP1 Hs.31472 H12368 0.975227 Mucolipin 1 MCOLN1 Hs.12909 R36697 0.975227 START domain containing 3 STARD3 Hs.77628 N78582 0.975227 Protein kinase, AMP-activated, beta 2 non-catalytic subunit PRKAB2 Hs.50732 H84616 0.975227 Hypothetical protein MGC18216 MGC18216 Hs.104679 AA053859 0.975227 U2 small nuclear ribonucleoprotein auxiliary factor (65kD) U2AF65 Hs.7655 N70558 0.975227 Potassium inwardly-rectifying channel, subfamily J, member 8 KCNJ8 Hs.102308 N29418 0.975227 - - Hs.44024 H79768 0.975227 Activity-dependent neuroprotector ADNP Hs.3657 N36881 0.975227 Hypothetical protein FLJ38968 FLJ38968 Hs.356496 H49229 0.975227 Hypothetical protein FLJ20040 FLJ20040 Hs.61960 W92049 0.975227 - -- N92276 0.975227 Chromosome 4 open reading frame 1 C4orf1 Hs.270956 AA057495 0.975227 EGF-containing fibulin-like extracellular matrix protein 1 EFEMP1 Hs.76224 R23871 0.975227 Poly(rC) binding protein 1 PCBP1 Hs.2853 R62318 0.975227 - - Hs.283402 AA099489 0.975227 KIAA0111 gene product KIAA0111 Hs.79768 R55942 0.975227 - - Hs.4267 T91049 0.975227 - -- AA057033 0.975227 - - Hs.103388 N90234 0.975227 Glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) GCAT Hs.54609 AA046006 0.975227 - - Hs.271541 T85305 0.975227 - -- H63543 0.975227 FK506 binding protein 12-rapamycin associated protein 1 FRAP1 Hs.338207 N30436 0.975227 - - Hs.11556 H00173 0.975227 SH3-domain GRB2-like endophilin B2 SH3GLB2 Hs.30002 AA148906 0.975227 Tumor rejection antigen (gp96) 1 TRA1 Hs.82689 N71041 0.975227 RNA polymerase I 16 kDa subunit LOC51082 Hs.106127 AA135745 0.975227 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma CAMK2G Hs.12436 H52753 0.975227 - - Hs.21213 AA055170 0.975227 - - Hs.265891 W03011 0.975227 MSTP043 protein MSTP043 Hs.306881 H15178 0.975227 - - Hs.352358 H81783 0.975227 ESTs ESTs Hs.40290 H58066 0.975227 HSPC037 protein LOC51659 Hs.108196 AA054758 0.975227 - -- R71531 0.975227 Hypothetical protein FLJ32731 FLJ32731 Hs.380474 AA036809 0.975227 - - Hs.188826 AA032252 0.975227 - -- N59616 0.975227 Hypothetical protein FLJ11274 FLJ11274 Hs.18104 R60395 0.975227 - - Hs.378718 H79385 0.975227 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B APOBEC3B Hs.226307 H87262 0.975227 - -- W90073 0.975227 Sel-1 suppressor of lin-12-like (C. elegans) SEL1L Hs.181300 T83097 0.975227 Hypothetical protein 384D8_6 384D8-2 Hs.180903 N41539 0.975227 Sp1 transcription factor SP1 Hs.2021 N20321 0.975227 Translocase of outer mitochondrial membrane 40 homolog (yeast) TOMM40 Hs.30928 R88266 0.975227 Glutamate receptor, ionotropic, N-methyl D-aspartate 1 GRIN1 Hs.105 T95573 0.975227 Nuclear antigen Sp100 SP100 Hs.77617 H88577 0.975227 Heterogeneous nuclear ribonucleoprotein H1 (H) HNRPH1 Hs.245710 AA099490 0.975227 Squamous cell carcinoma antigen recognised by T cells 3 SART3 Hs.116875 AA036635 0.975227 - - Hs.168450 N62464 0.975227 - - Hs.355530 R05747 0.975227 Ust3 ust3 Hs.19102 AA045083 0.975227 - - Hs.289047 R06564 0.975227 Galactose-4-epimerase, UDP- GALE Hs.76057 R52005 0.975227 Retinoblastoma-associated factor 600 RBAF600 Hs.297641 T83467 0.975227 Inositol 1,4,5-trisphosphate 3-kinase B ITPKB Hs.78877 H24050 0.975227 ESTs ESTs Hs.28039 R50558 0.975227 Transposon-derived Buster1 transposase-like protein LOC58486 Hs.25726 N95400 0.975227 DKFZP564G2022 protein DKFZP564G2022 Hs.16492 T81946 0.975227 - -- H98717 0.975227 Small nuclear ribonucleoprotein polypeptide C SNRPC Hs.1063 R92361 0.975227 ESTs ESTs Hs.34576 R39774 0.975227 KIAA1698 protein KIAA1698 Hs.6259 N48174 0.975227 KIAA0332 protein KIAA0332 Hs.7976 N42484 0.991741 - -- H09083 0.991741 TNF receptor-associated factor 2 TRAF2 Hs.373508 R77735 0.991741 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease) CLN2 Hs.20478 N68686 0.991741 Hypothetical protein FLJ10486 FLJ10486 Hs.173946 N95807 0.991741 Insulin-like growth factor binding protein 4 IGFBP4 Hs.1516 H68528 0.991741 Hypothetical protein FLJ32499 FLJ32499 Hs.27475 R64518 0.991741 - - Hs.16979 H09104 0.991741 Syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic compone SNTA1 Hs.31121 H67177 0.991741 - -- H12745 0.991741 Zinc finger protein 148 (pHZ-52) ZNF148 Hs.355866 N28519 0.991741 Papillomavirus regulatory factor PRF-1 LOC55893 Hs.27410 AA036953 0.991741 Growth arrest and DNA-damage-inducible, alpha GADD45A Hs.80409 W33160 0.991741 Gene predicted from cDNA with a complete coding sequence KIAA0110 Hs.124 AA034995 0.991741 ESTs ESTs Hs.293819 H08451 0.991741 CDC-like kinase 1 CLK1 Hs.2083 N68960 0.991741 Mitochondrial ribosomal protein L45 MRPL45 Hs.19347 R18905 0.991741 Centaurin, delta 1 CENTD1 Hs.22572 H05011 0.991741 - -- AA152298 0.991741 KIAA0800 gene product KIAA0800 Hs.118738 W24084 0.991741 Major histocompatibility complex, class I, B HLA-B Hs.77961 AA133959 0.991741 Brain-specific protein p25 alpha p25 Hs.29353 W04797 0.991741 Dystrobrevin binding protein 1 DTNBP1 Hs.43481 AA043736 0.991741 Actinin, alpha 1 ACTN1 Hs.119000 N70615 0.991741 RAB40A, member RAS oncogene family RAB40A Hs.27453 N36089 0.991741 Yes-associated protein 1, 65kDa YAP1 Hs.84520 R38029 0.991741 Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A ANP32A Hs.285013 N35883 0.991741 Profilin 2 PFN2 Hs.91747 AA025089 0.991741 Voltage-dependent anion channel 1 VDAC1 Hs.149155 N75330 0.991741 Ac-like transposable element ALTE Hs.9933 W32182 0.991741 Hypothetical protein MGC2574 MGC2574 Hs.4253 H38361 0.991741 Vacuolar protein sorting 16 (yeast) VPS16 Hs.302441 H10461 0.991741 Tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 TNKS2 Hs.280776 T96990 0.991741 Ubiquitination factor E4B (UFD2 homolog, yeast) UBE4B Hs.24594 H10415 0.991741 Likely ortholog of mouse Rw1 RW1 Hs.75912 AA099896 0.991741 Hypothetical protein FLJ20604 FLJ20604 Hs.55781 R25268 0.991741 Uracil-DNA glycosylase UNG Hs.78853 N35011 0.991741 - - Hs.20797 AA135928 0.991741 Frequenin homolog (Drosophila) FREQ Hs.301760 W89053 0.991741 Hypothetical protein FLJ20343 FLJ20343 Hs.252692 T84134 0.991741 Hydroxymethylbilane synthase HMBS Hs.82609 N57515 0.991741 - - Hs.46627 H66467 0.991741 F-box only protein 8 FBXO8 Hs.76917 AA131590 0.991741 DiGeorge syndrome critical region gene 6-like DGCR6L Hs.347285 R47739 0.991741 KIAA1332 protein KIAA1332 Hs.62767 N58356 0.991741 HSPC009 protein HSPC009 Hs.16059 R26339 0.991741 Adaptor-related protein complex 2, alpha 2 subunit AP2A2 Hs.19121 AA047259 0.991741 Endometrial bleeding associated factor (left-right determination, factor A; transfEBAF Hs.25195 H16888 0.991741 Protein-L-isoaspartate (D-aspartate) O-methyltransferase PCMT1 Hs.79137 H90564 0.991741 - - Hs.41423 AA047424 0.991741 - -- N20641 0.991741 Chromosome 5 open reading frame 5 C5orf5 Hs.82035 N44758 0.991741 KIAA1036 protein KIAA1036 Hs.155182 H97361 0.991741 - - Hs.36258 H73053 0.991741 Von Hippel-Lindau syndrome VHL Hs.174007 T90893 0.991741 Rab geranylgeranyltransferase, beta subunit RABGGTB Hs.78948 H22702 0.991741 Hypothetical protein MGC10540 MGC10540 Hs.108824 R44852 0.991741 ESTs ESTs Hs.3737 AA010875 0.991741 Proteasome (prosome, macropain) subunit, alpha type, 1 PSMA1 Hs.82159 AA069424 0.991741 ESTs ESTs Hs.20573 R52816 0.991741 Reticulon 3 RTN3 Hs.252831 H22871 0.991741 Peptidase D PEPD Hs.73947 R00402 0.991741 - - Hs.380859 N51951 0.991741 - -- R62469 0.991741 Cylindromatosis (turban tumor syndrome) CYLD Hs.18827 H67560 0.991741 Chaperonin containing TCP1, subunit 8 (theta) CCT8 Hs.15071 T48696 0.991741 Putative nuclear protein ORF1-FL49 ORF1-FL49 Hs.323512 R19007 0.991741 Lysosomal apyrase-like protein 1 LALP1 Hs.22604 N48306 0.991741 PC4 and SFRS1 interacting protein 2 PSIP2 Hs.82110 H26130 0.991741 Hypothetical protein PRO1580 PRO1580 Hs.270863 AA101713 0.991741 - - Hs.19215 N74411 0.991741 Trophinin associated protein (tastin) TROAP Hs.171955 R23635 0.991741 - -- AA142943 0.991741 Docking protein 1, 62kDa (downstream of tyrosine kinase 1) DOK1 Hs.103854 N66548 0.991741 Stearoyl-CoA desaturase (delta-9-desaturase) SCD Hs.119597 AA043774 0.991741 Programmed cell death 5 PDCD5 Hs.166468 H22698 0.991741 General transcription factor IIB GTF2B Hs.258561 AA054119 0.991741 - - Hs.31835 AA069569 0.991741 Lecuine-rich acidic protein-like protein LANP-L Hs.71331 Supporting Table 5 - Genes Ranked within top 80 of SVMs in association with a BRAF mutation

*ID's of clones on chip were sequence verified by the manufacter and have been updated below. ID on Verified ID Verified GenBank Description Gene Symbol UniGene Cytoband Chromo- some Chip Assigned* Accession ID* W88806 W88806 W88806 uroporphyrinogen III synthase (congenital erythropoietic porphyria) UROS Hs.75593 10q25.2-q26.3 10 W46396 W46504 W46504 dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex) DLAT Hs.157101 11q23.111 R60317 R60374 R60374 dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate compleDLD Hs.74635 7q31-q32 7 H78941 AL520209 AL520209 hypothetical protein MGC43399 MGC43399 Hs.7299 1p36.23 1 N63044 AW968122 AW968122 poly (ADP-ribose) glycohydrolase PARG Hs.91390 10q11.23 10 R52086 R52179 R52179 hypothetical protein FLJ31657 FLJ31657 Hs.409076 8q12.1 8 H12076 H12076 H12076 dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate compleDLD Hs.74635 7q31-q32 7 AA133960 AA134026 AA134026 ubiquitin-conjugating enzyme E2A (RAD6 homolog) UBE2A Hs.80612 Xq24-q25 23 W42423 BG770889 BG770889 Rab11-family interacting protein 2 Rab11-FIP2 Hs.173656 10q26.12 10 H08441 H08441 H08441 protein tyrosine phosphatase, receptor type, A PTPRA Hs.26045 20p13 20 T83153 T83153 T83153 dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate compleDLD Hs.74635 7q31-q32 7 N29673 N56629 N56629 hypoxia up-regulated 1 HYOU1 Hs.277704 11q23.1-q23.3 11 W58034 W58034 unknown Unknown W42634 W42634 unknown Unknown T91050 T85912 T85912 KIAA1586 protein KIAA1586 Hs.391492 6p11.1 6 N27557 N40375 N40375 proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 PSMD9 Hs.5648 12q24.31-q24.32 12 N72115 W00390 W00390/N72115 cyclin-dependent kinase inhibitor 2C /Unknown CDKN2C/unkown Hs.4854/unkown 1p32/unknown 1/unknown R59224 BM707054-01 BM707054 fatty acid desaturase 1 FADS1 Hs.132898 11q12.2-q13.1 11 R36627 AL553069 AL553069 putative protein similar to nessy (Drosophila) C3F Hs.300423 12p13 12 T79604 BI670486 BI670486 fatty acid desaturase 1 FADS1 Hs.132898 11q12.2-q13.1 11 AA001144 AA001144 AA001144 similar to RIKEN cDNA 5730528L13 gene MGC17337 Hs.78531 9q22.33 9 AA033605 BM564823 BM564823 thioredoxin related protein MGC3178 Hs.409203 6p24.3 6 AA102088 AA099340 AA099340 tripartite motif-containing 37 TRIM37 Hs.8164 17q22-q23 17 R13127 R13127 R13127 suppressor of potassium transport defect 3 SKD3 Hs.21263 11q13.2 11 N/A2 (N/A2)/T85663/AU123(N/A2)/T85663/AU123 Unknown/EST/dihydrolipoamide dehydrogenase (E3 component)/EST/EST/EST/integrin, alpha L /elongation factor-2 kinase N53295 N53295 N53295 ribosomal protein L39-like RPL39L Hs.132748 3q27 3 H90879 H90225 H90225 hypothetical protein MGC8974 MGC8974 Hs.40094 1p33-p32.1 1 AA001333 AA001333 AA001333 FUS...CHOP [human, myxoid liposarcoma specimens, mRNA Partial Mutant, 3 genes, 652 nt] TRAP1 Hs.182366 16p12.3 16 N73284 BG484990 BG484990 SEC22 vesicle trafficking protein-like 3 (S. cerevisiae) SEC22L3 Hs.12942 3p21.32 3 R33452 R33553 R33553 protein O-fucosyltransferase 1 POFUT1 Hs.178292 20q11 20 AA034917 AA034982 AA034982 Hermansky-Pudlak syndrome 1 HPS1 Hs.83951 10q23.1-q23.3 10 N51855 BI256660/N51855 BI256660/N51855 ribosomal protein L32/ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2 RPL32/ADPRTL2 Hs.169793/Hs.24284 3p25-p24/14q11.2-q1 3/14 AA041401 AA041500 AA041500 ESTs, Moderately similar to hypothetical protein FLJ20378 [Homo sapiens] [H.sapiens] Hs.57967 1 1 AA099636 AA099636 AA099636 KIAA1039 protein KIAA1039 Hs.394589 17p13.3 17 H09315 H09374 H09374 proprotein convertase subtilisin/kexin type 7 PCSK7 Hs.32978 11q23-q24 11 W87530 W87530 unknown Unknown 0 R32855 R31353 R31353 glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID) GNS Hs.393206 12q14 12 N21289 N31224 N31224 melanoma cell adhesion molecule MCAM Hs.211579 11q23.3 11 R80243 R80353 R80353 X-box binding protein 1 XBP1 Hs.149923 22q12.1 22 N52744 N52744 N52744 HSPC043 protein HSPC043 Hs.356633 9q32 9 AA101823 BM464072 BM464072/AA101823 claudin 12/Unknown CLDN12/unknown Hs.258576/unknown 7q21/unknown 7/unknown N63458 N63458 N63458 sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase) SIAT6 Hs.48793 1p34.1 1 N64618 N79947 N79947 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) BUB3 Hs.40323 10q26 10 N66208 N99208 N99208 protein phosphatase 1, regulatory (inhibitor) subunit 8 PPP1R8 Hs.356590 1p35 1 T96118 AL579290 AL579290 protein phosphatase 2, regulatory subunit B (B56), delta isoform PPP2R5D Hs.118244 6p21.1 6 R54062 R54062 R54062 Crn, crooked neck-like 1 (Drosophila) CRNKL1 Hs.268281 20p11.2 20 R35157 R35157 R35157 diacylglycerol kinase, delta 130kDa DGKD Hs.115907 2q37.1 2 N20259 N20259/BM692643 N20259/BM692643 Unknown/ESTs, Weakly similar to pancreas-enriched phospholipase C [Homo sapiens] [H.sapiens] AA215407 AA215407 unknown Unknown AA029361 BM695433/AA029361 BM695433/AA029361 DNA methyltransferase 1-associated protein 1/Homo sapiens cDNA FLJ33489 fis, clone BRAMY2003585. DMAP1/EST Hs.8008/Hs.31841 1p34/unknown 1/unknown T80625 BM449526 BM449526 chromodomain protein, Y chromosome-like CDYL Hs.16081 6p25.1 6 R55182 R55182 R55182 hypothetical protein DKFZp547C195 DKFZp547C195 Hs.374526 11 11 H10318 H10318 H10318 HLA-B associated transcript 4 BAT4 Hs.247478 6p21.3 6 R54777 R54777 R54777 Homo sapiens, Similar to transmembrane protein induced by tumor necrosis factor alpha, clone MGC:32944 IMAGE:5277668, mR Hs.374908 7 7 H15871 H15871 H15871 nicotinamide nucleotide transhydrogenase NNT Hs.18136 5p13.1-5cen 5 H20850 H20901 H20901 thioredoxin 2 TXN2 Hs.211929 22q13.1 22 W31471 W31471 unknown Unknown R80802 R81004 R81004 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 KDELR1 Hs.78040 19q13.3 19 W33047 W33047 W33047 Homo sapiens cDNA FLJ40810 fis, clone TRACH2009743. Hs.389265 1 1 AA059311 BM969053 BM969053 protein tyrosine phosphatase type IVA, member 2 PTP4A2 Hs.82911 1p35 1 T96379 T96463 T96463 protein phosphatase 2, regulatory subunit B (B56), delta isoform PPP2R5D Hs.118244 6p21.1 6 W90083 BM541374 BM541374 peptidyl prolyl isomerase H (cyclophilin H) PPIH Hs.9880 1p34.1 1 N36349 N36349 unknown N62816 BM750142 BM750142 Homo sapiens cDNA: FLJ22141 fis, clone HEP21327. Hs.391485 T39460 T39460 T39460 protein phosphatase 1, catalytic subunit, alpha isoform PPP1CA Hs.183994 11q13 11 AA135740 BQ009475 BQ009475 annexin A7 ANXA7 Hs.78637 10q21.1-q21.2 10 R34632 AL708726 AL708726 sorting nexin 2 SNX2 Hs.11183 5q23 5 W37210 W37210 W37210 3-hydroxyisobutyrate dehydrogenase HIBADH Hs.284170 7p15.1 7 AA031913 AA032024 AA032024 hypothetical protein LOC123803 LOC123803 Hs.351573 16p13.11 16 R06281 R06339 R06339 ubiquitin ligase E3 alpha-II KIAA0349 Hs.15303 6p21.1 6 N79912 N79912 unknown R25789 R25789 R25789 RAB2, member RAS oncogene family-like RAB2L Hs.170160 6p21.3 6 W15337 W63762 W63762 COX15 homolog, cytochrome c oxidase assembly protein (yeast) COX15 Hs.226581 10q24 10 AA033545 AA033545 AA033545/BG548895/ Unkkown/tumor necrosis factor receptor superfamily, member 6/Homo sapiens cDNA FLJ32248 fis, clone PROST1000123. unknown/Hs.82359/Hunknown/10q24.1/18 unknown/10/18 W03395 W03395 W03395 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 ELOVL1 Hs.25597 1p34.1 1 AA099341 AA099341 AA099341 golgi-specific brefeldin A resistance factor 1 GBF1 Hs.155499 10q24 10 R49336 R35700 R35700 SKI-interacting protein SNW1 Hs.79008 14q24.3 14 H49981 H50023 H50023 hypothetical protein LOC90624 LOC90624 Hs.391468 5q31.1 5 R61759 R61759 R61759 Homo sapiens clone FBD3 Cri-du-chat critical region mRNA Hs.409167 5 5 N59182 N59182/N75919 N59182/N75919 Unknown/Homo sapiens cDNA FLJ10705 fis, clone NT2RP3000850. unknown/PCYT1A unknown/Hs.273558 unknown/3q29 unknown/3 R07295 R07295 unknown Unkown AA121306 AA121306 AA121306/BQ072893 unknown/KDEL endoplasmic reticulum protein retention receptor 1 unknown/KDELR1 unknown/Hs.78040 unknown/19q13.3 unknown/19 R80585 R80585 R80585 CD2-associated protein CD2AP Hs.374340 6p12 6 Supporting Table 6a - PTPRA -Quantitative RT-PCR data PTPRA: Protein tyrosine phosphatase, receptor type, A

PTPRA qRT-PCR vs. microarray expression data

qRT-PCR Array Ratio Name PTPRA / PTPRA / qRT-PCR / GAPDH GAPDH array A07 0.24 0.67 0.35 A11 1.06 0.61 1.74 CJM 0.75 0.57 1.32 D04 0.84 0.76 1.10 D08 0.79 0.65 1.21 D10 0.36 0.16 2.20 D11 1.17 1.26 0.93 D24 1.57 1.33 1.18 Me1007 1.49 1.23 1.21 Me4405 1.81 1.22 1.49 Mel-FH 0.82 1.32 0.62 Mel-RM 0.83 1.08 0.77 MM127 1.20 0.94 1.28 MM329 1.00 0.89 1.13 MM415 0.77 0.63 1.23 MM485 0.43 0.74 0.59 RPMI7932 2.13 0.80 2.67 A02 0.21 2.34 0.09 A05 0.35 1.21 0.29 A15 0.99 0.50 1.98 A2058 0.42 1.41 0.30 BL 0.37 1.12 0.33 C32 0.58 0.96 0.60 COLOF 2.03 0.95 2.15 D05 3.91 1.46 2.67 D14 1.82 0.83 2.18 D17 1.51 1.29 1.18 D20 2.02 1.28 1.58 D23 1.32 1.06 1.25 D25 1.96 1.17 1.67 HT144 0.82 0.44 1.84 JA 0.67 0.94 0.71 Me10538 1.10 0.81 1.35 Me1402 0.91 0.81 1.13 Mel-RMU 0.77 1.45 0.53 MM170 2.08 1.75 1.19 MM200 2.15 0.98 2.18 MM229 2.72 2.30 1.18 MM253 1.49 1.14 1.31 MM370 0.84 0.82 1.03 MM383 1.43 0.66 2.18 MM386 0.70 0.71 0.98 MM426 0.38 0.42 0.90 MM455 1.58 1.10 1.43 MM466 0.83 1.31 0.64 MM470 1.67 1.43 1.17 MM472 0.84 0.83 1.02 MM473 2.38 1.50 1.59 MM537 1.24 0.63 1.96 MM540 0.55 0.82 0.68 MM595 0.67 0.93 0.73 MM603 1.30 0.96 1.36 MM608 0.74 0.64 1.15 MM622 2.92 2.19 1.33 MM629 1.12 1.18 0.95 MM648 1.29 1.75 0.74 MM649 0.80 1.92 0.42 MM96L 0.87 1.27 0.68 SkMel13 1.33 1.57 0.85 WSB 1.52 1.44 1.06 WW 0.55 1.05 0.52

WT BRAF Mutant BRAF Supporting Table 6b - RAB2L -Quantitative RT-PCR data RAB2L: RAB2, member RAS oncogene family-like

RAB2L qRT-PCR vs. microarray expression data

qRT-PCR Array Ratio qRT- Name RAB2L / RAB2L / PCR / array GAPDH GAPDH A07 0.22 2.20 0.10 A11 1.46 1.10 1.33 CJM 0.93 1.00 0.94 D04 1.52 2.20 0.69 D08 3.02 1.35 2.23 D10 0.88 1.06 0.82 D11 2.02 1.62 1.25 D24 1.66 1.67 0.99 Me1007 1.72 2.00 0.86 Me4405 3.62 1.48 2.45 Mel-FH 1.21 1.68 0.72 Mel-RM 0.99 1.00 0.99 MM127 1.37 1.27 1.07 MM329 1.00 0.94 1.07 MM415 0.72 0.99 0.72 MM485 0.58 1.59 0.37 RPMI7932 2.44 1.32 1.85 A02 0.20 2.62 0.08 A05 0.25 2.00 0.13 A15 1.70 1.24 1.38 A2058 0.16 2.10 0.07 BL 0.15 1.65 0.09 C32 0.66 1.44 0.46 COLOF 3.32 1.43 2.32 D05 6.92 1.86 3.72 D14 3.64 1.39 2.62 D17 2.75 1.61 1.71 D20 2.84 1.77 1.60 D23 3.35 2.58 1.30 D25 2.76 1.77 1.56 HT144 1.31 1.17 1.12 JA 0.78 1.11 0.70 Me10538 1.04 0.92 1.14 Me1402 1.43 1.44 1.00 Mel-RMU 0.72 0.97 0.75 MM170 1.71 1.66 1.03 MM200 1.54 0.62 2.50 MM229 3.44 2.59 1.33 MM253 3.51 2.27 1.54 MM370 0.87 1.24 0.70 MM383 1.23 0.71 1.73 MM386 1.97 1.85 1.07 MM426 1.57 2.06 0.77 MM455 1.93 2.21 0.87 MM466 1.13 3.50 0.32 MM470 2.24 1.57 1.43 MM472 1.30 1.44 0.91 MM473 2.70 2.01 1.35 MM537 1.38 1.29 1.07 MM540 0.85 1.96 0.43 MM595 1.72 3.14 0.55 MM603 1.08 1.04 1.04 MM608 0.99 1.11 0.89 MM622 3.16 2.33 1.36 MM629 1.09 1.59 0.69 MM648 1.39 2.12 0.66 MM649 1.17 2.15 0.54 MM96L 1.28 1.37 0.94 SkMel13 0.86 0.60 1.43 WSB 1.12 1.93 0.58 WW 0.43 1.06 0.40

WT BRAF Mutant BRAF Supporting Table 6c - ANXA7 -Quantitative qRT-PCR data ANXA7: Annexin A7

ANXA7 qRT-PCR vs. array expression data

qRT-PCR Array Ratio Name ANXA7 / ANXA7 / qRT-PCR / GAPDH GAPDH array A07 0.32 0.79 0.40 A11 1.22 0.83 1.47 CJM 1.65 1.85 0.89 D04 0.83 0.82 1.00 D08 1.25 1.27 0.99 D10 0.95 1.55 0.61 D11 1.51 0.98 1.54 D24 3.47 2.36 1.47 Me1007 2.05 2.09 0.98 Me4405 2.15 1.99 1.08 Mel-FH 1.36 1.80 0.76 Mel-RM 1.13 1.35 0.84 MM127 1.87 1.67 1.12 MM329 1.00 0.88 1.14 MM415 1.81 0.93 1.94 MM485 0.58 0.87 0.67 RPMI7932 3.28 1.05 3.13 A02 0.52 1.50 0.34 A05 0.91 1.23 0.74 A15 1.87 1.41 1.33 A2058 0.55 1.46 0.38 BL 0.38 1.04 0.37 C32 0.74 1.02 0.72 COLOF 4.06 0.96 4.24 D05 1.24 0.51 2.44 D14 2.08 0.81 2.56 D17 1.32 0.75 1.76 D20 1.80 1.00 1.81 D23 2.55 1.82 1.40 D25 1.12 0.61 1.84 HT144 1.06 0.65 1.63 JA 1.48 1.64 0.90 Me10538 1.07 0.67 1.58 Me1402 0.94 0.84 1.12 Mel-RMU 0.91 1.21 0.75 MM170 0.96 1.02 0.94 MM200 0.96 0.33 2.88 MM229 1.98 1.12 1.76 MM253 0.50 0.85 0.59 MM370 0.60 0.66 0.91 MM383 0.90 0.68 1.33 MM386 1.00 1.09 0.92 MM426 1.51 1.45 1.04 MM455 1.22 0.68 1.78 MM466 0.78 1.39 0.56 MM470 1.39 0.71 1.95 MM472 1.34 1.48 0.91 MM473 1.55 1.25 1.25 MM537 1.39 0.61 2.28 MM540 0.59 0.73 0.82 MM595 0.92 1.21 0.76 MM603 0.71 0.59 1.20 MM608 1.04 0.79 1.31 MM622 1.74 0.97 1.80 MM629 0.69 0.83 0.84 MM648 0.44 0.45 0.99 MM649 0.72 0.92 0.78 MM96L 1.71 1.16 1.47 SkMel13 1.18 1.19 0.99 WSB 0.71 0.70 1.02 WW 0.39 0.77 0.51

WT BRAF Mutant BRAF Supporting Table 6d - CD2AP -Quantitative RT-PCR data CD2AP: CD2-associated protein

CD2AP qRT-PCR vs. microarray expression data

qRT-PCR Array Ratio Name CD2AP / CD2AP / qRT-PCR / GAPDH GAPDH array A07 1.70 0.73 2.33 A11 2.03 0.92 2.20 CJM 1.01 0.84 1.21 D04 1.44 0.93 1.55 D08 1.14 0.67 1.70 D10 1.06 1.91 0.55 D11 1.67 0.76 2.20 D24 1.83 0.71 2.58 Me1007 1.23 0.83 1.47 Me4405 7.28 0.47 15.34 Mel-FH 1.51 1.04 1.44 Mel-RM 0.88 0.89 0.99 MM127 1.94 1.33 1.47 MM415 1.38 0.92 1.50 MM485 0.43 0.99 0.44 RPMI7932 2.11 0.81 2.62 MM329 1.00 0.86 1.17 A15 1.92 0.91 2.10 A05 0.83 0.78 1.06 A2058 1.10 0.98 1.12 C-32 0.70 1.00 0.70 D05 5.43 1.51 3.60 Me10538 2.41 0.89 2.70 MM200 3.09 0.56 5.53 MM455 1.99 1.16 1.71 MM472 1.22 1.21 1.01 MM473 1.74 1.26 1.39 MM595 3.64 2.41 1.51 MM603 2.20 1.47 1.50 MM608 1.20 0.47 2.58 MM629 0.69 0.73 0.95 MM648 1.87 1.02 1.83 MM649 1.02 1.00 1.02 MM96L 1.78 1.08 1.64

WT BRAF Mutant BRAF Supporting Table 6e - DLAT -Quantitative RT-PCR data DLAT: Dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)

DLAT array vs qRT-PCR expression data

qRT-PCR Array Ratio Name DLAT / DLAT / qRT-PCR / GAPDH GAPDH array A07 0.43 1.81 0.24 A11 1.03 1.21 0.85 CJM 0.85 1.25 0.68 D04 0.65 2.10 0.31 D08 0.26 0.55 0.46 D10 0.35 0.65 0.53 D11 0.82 1.58 0.52 D24 1.43 1.16 1.24 Me1007 0.74 1.51 0.49 Me4405 2.44 1.27 1.92 Mel-FH 1.64 1.53 1.07 Mel-RM 1.21 1.53 0.79 MM127 1.90 1.08 1.76 MM415 0.65 1.36 0.48 MM485 0.51 1.42 0.36 RPMI7932 1.66 1.38 1.20 MM329 1.00 1.01 0.99 A15 0.78 1.65 0.47 A05 1.29 1.76 0.73 BL 0.51 1.09 0.47 D05 2.68 2.46 1.09 D17 1.36 2.32 0.59 HT144 0.83 1.15 0.73 JA 2.29 1.57 1.46 MM170 1.57 1.96 0.80 MM253 0.70 1.69 0.42 MM370 1.70 1.48 1.15 MM455 1.70 1.10 1.55 MM470 7.18 1.08 6.62 MM473 3.54 2.35 1.51 MM603 2.67 1.25 2.14 MM622 0.88 1.67 0.53 MM629 1.73 2.61 0.66

WT BRAF Mutant BRAF Supporting Table 6f - DLD -Quantitative RT-PCR data DLD: Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex) DLD array vs. qRT-PCR expression data

qRT-PCR Array Ratio Name DLD / DLD / qRT-PCR / GAPDH GAPDH GAPDH A07 0.20 0.80 0.25 A11 2.21 1.45 1.53 CJM 1.05 1.07 0.98 D04 1.00 0.82 1.21 D08 1.31 0.50 2.62 D10 0.26 0.33 0.81 D11 1.77 1.28 1.38 D24 2.88 1.51 1.90 Me1007 1.61 1.17 1.37 Me4405 1.44 0.83 1.74 Mel-FH 0.99 1.49 0.66 Mel-RM 1.15 1.36 0.85 MM127 0.76 0.79 0.96 MM415 0.94 0.80 1.17 MM485 0.38 0.68 0.56 RPMI7932 2.69 1.21 2.22 MM329 1.00 0.89 1.13 A2058 0.27 1.39 0.20 BL 0.24 1.34 0.18 C32 1.12 2.04 0.55 D05 3.33 1.24 2.68 D20 2.21 1.09 2.03 HT144 1.00 0.64 1.56 JA 1.86 1.75 1.06 Mel-RMU 0.47 0.59 0.81 MM386 1.53 1.40 1.10 MM426 1.51 1.21 1.25 MM466 2.27 2.07 1.10 MM472 1.64 1.58 1.03 MM622 1.66 1.10 1.50 MM649 3.04 3.35 0.91 MM96L 1.98 1.76 1.13 WSB 1.71 1.39 1.23 WW 1.20 1.91 0.63

WT BRAF Mutant BRAF Supporting Table 6g - MCAM -Quantitative RT-PCR data MCAM: Melanoma cell adhesion molecule

MCAM array vs. real time expression data

qRT-PCR Array Ratio Name MCAM / MCAM / qRT-PCR / GAPDH GAPDH array A07 0.11 0.44 0.25 A11 0.04 0.05 0.78 CJM 0.04 0.10 0.39 D04 0.49 0.66 0.74 D08 0.30 0.09 3.31 D10 0.08 0.02 3.90 D11 0.42 1.13 0.38 D24 0.17 0.23 0.73 Me1007 0.03 0.05 0.61 Me4405 0.37 0.02 18.18 Mel-FH 0.86 1.69 0.51 Mel-RM 0.42 0.12 3.36 MM127 0.26 0.40 0.65 MM415 0.42 0.50 0.83 MM485 0.52 0.29 1.76 MM329 1.00 0.74 1.35 RPMI7932 1.52 0.32 4.73 A02 0.21 1.22 0.17 C-32 0.28 0.29 0.97 D14 1.52 0.60 2.54 D25 0.85 0.60 1.41 HT144 0.36 0.12 3.00 Me10538 2.83 1.65 1.72 Me1402 2.69 1.67 1.61 MM200 0.25 0.26 0.95 MM253 0.10 0.41 0.25 MM370 0.20 0.76 0.26 MM470 2.34 1.62 1.44 MM473 0.83 1.33 0.62 MM537 0.22 0.26 0.82 MM608 0.97 0.67 1.45 MM629 0.52 1.42 0.37 WSB 0.69 0.78 0.89 MM229 1.98 0.96 2.06

WT BRAF Mutant BRAF Supporting Table 6h - BUB3 -Quantitative RT-PCR data BUB3: BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast)

BUB3 qRT-PCR vs. array expression data

qRT-PCR Array Ratio Name BUB3 / BUB3 / qRT-PCR / GAPDH GAPDH array Mel-RM 1.02 1.12 0.91 Me1007 1.12 1.54 0.73 D11 1.28 1.11 1.15 Me4405 2.42 1.41 1.72 MM485 0.61 1.38 0.44 A11 1.21 0.93 1.31 D24 2.18 1.19 1.83 RPMI7932 2.66 1.34 1.98 A07 0.61 0.88 0.69 D10 0.56 1.30 0.43 MM540 0.43 0.97 0.44 Me10538 0.96 0.90 1.06 A05 0.88 0.85 1.04 A02 0.43 0.95 0.46 SkMel13 1.05 1.05 1.00 MM96L 1.03 1.07 0.96 D20 1.17 0.95 1.24 MM648 0.20 0.25 0.78 MM229 0.94 0.82 1.15 D23 1.46 1.04 1.41

WT BRAF Mutant BRAF Supporting Table 6i - Rab11-FIP2 -Quantitative RT-PCR data Rab11-FIP2 : Rab11-family interacting protein 2

Rab11 array vs real time expression data

qRT-PCR Array Ratio Name RAB11 / RAB11 / qRT-PCR / GAPDH GAPDH array A11 1.76 0.69 2.55 D04 2.07 1.19 1.75 D11 1.36 0.78 1.74 D24 1.89 1.28 1.48 Me1007 1.40 0.72 1.96 Mel-RM 0.73 0.68 1.07 MM329 1.00 1.36 0.74 MM415 0.96 0.77 1.24 MM485 2.58 0.93 2.78 RPMI7932 1.72 0.74 2.34 A15 0.93 0.88 1.05 C32 1.60 1.14 1.40 COLOF 1.02 0.62 1.64 D20 0.61 0.26 2.35 ME1402 1.28 0.42 3.07 MM426 1.13 1.00 1.13 MM470 0.99 0.45 2.21 MM537 0.34 0.24 1.41 SkMel13 0.85 1.00 0.85 WW 0.17 0.39 0.43

WT BRAF Mutant BRAF Figure 1 – ROC Curve for BRAF Prediciton

The ROC curve area was used as a measure of the prediction performance on samples not used to train the SVMs, obtaining an area of 82%.