Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations

1-1-2004

The efficacy of pantothenic acid as a modifier of body composition in a porcine model of obesity development

Carey Ann Baldwin Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/rtd

Recommended Citation Baldwin, Carey Ann, "The efficacy of pantothenic acid as a modifier of body composition in a porcine model of obesity development" (2004). Retrospective Theses and Dissertations. 20349. https://lib.dr.iastate.edu/rtd/20349

This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. The efficacy of pantothenic acid as a modifier of body composition in a porcine model of obesity development

by

Carey Ann Baldwin

A thesis submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE

Major: Animal Nutrition

Program of Study Committee: Tim Stahly, Major Professor Paul Flakoll Chad Stahl

Iowa State University

Ames, Iowa

2004

Copyright© Carey Ann Baldwin, 2004. All rights reserved. 11

Graduate College Iowa State University

This is to certify that the master's thesis of

Carey Ann Baldwin has met the thesis requirements of Iowa State University

Signatures have been redacted for privacy 111

TABLE OF CONTENTS

ACKNOWLEDGEMENTS Vl

ABSTRACT Vll CHAPTER 1. GENERAL INTRODUCTION 1 Introduction 1 Thesis Organization 2 Literature Cited 2

CHAPTER 2. LITERATURE REVIEW 5 Body Composition and Tissue Accretion 5

Adipose Tissue Accretion 5

Depot Differences in Adipose Tissue Accretion 6 Energy Expenditure and Substrate Oxidation 7 Maintenance Requirements 9

Feed Restriction 10 Muscle Metabolism 11

Endocrine Function of Adipose Tissue 11

Other Factors Affecting Tissue Accretion 12 Glucose-Fatty Acid Cycle 12 Direct Fat Deposition 13

Lipogenesis 14

Fatty Acyl Synthase 14 De Novo Lipogenesis 15

Acetyl-CoA Carboxylase 15 Lipolysis 16 Peroxisomal Fatty Acid Beta-Oxidation 16

Acyl-CoA Oxidase 17 Species Differences in Fat Metabolism 17 lV

Obesity 18

Obesity Characteristics 18

Obesity Complication - Insulin Resistance 19

Animal Models of Obesity 20

Dietary Fat 22

Dietary Carbohydrate 23

Pantothenic Acid 24

Pantothenic Acid Sources 24

Pantothenic Acid Requirements 25

Pantothenic Acid Deficiency 26

Pantothenic Acid Toxicity 27

Methods of Predicting Pantothenic Acid Levels 27 Pantothenic Acid in the Body 27 The Metabolic Role of Pantothenic Acid 28

The Role of Pantothenic Acid in Body Composition 30

Body Composition Measures 31

Dual-Energy X-Ray Absorptiometry 32

Proximate Analysis (Chemical Composition) 32

Subcutaneous Backfat Measures 33

Real-Time Polymerase Chain Reaction 33

Summary/Objectives 36 Literature Cited 37

CHAPTER 3. DUAL-ENERGY X-RAY ABSORPTIOMETRY FOR DETERMINATION OF BODY COMPOSITION IN PORCINE MODEL OF OBESITY DEVELOPMENT Abstract 49

Introduction 49

Materials and Methods 50

Results and Discussion 54 v

Literature Cited 59

CHAPTER 4. EFFICACY OF P ANTOTHENIC ACID AS A MODIFIER OF BODY COMPOSITION IN A PORCINE MODEL OF OBESITY DEVELOPMENT Abstract 64 Introduction 64 Materials and Methods 65 Results and Discussion 69 Literature Cited 73 CHAPTERS. GENERALSUMMARY 91 VI

ACKNOWLEDGEMENTS I would first like to recognize my Major Professor, Dr. Tim Stahly, for the opportunities, guidance and support he has provided throughout my graduate education at Iowa State University. I would also like to thank my committee members, Dr. Chad Stahl and Dr. Paul Flakoll, for their input and contributions to this thesis. In addition, I would like to thank the farm crew (Dan Johnson, Robert Tripp, Harlan Moody and John Simonson) for their humor and assistance with numerous diet mixings. I thank Kyle Dunn, Arlie Penner, Dongyan Wang, Sherri Swanton, and Brody Laabs for help with data collection and analysis. I could not have moved those pigs without your help. I would also like to thank Leslie Lincoln, Monica Perez-Garcia, Martha Jeffrey, and Laura Hittmeier for helping me to analyze laboratory samples. We have learned a lot along the way. I thank the Iowa State University Meats Laboratory for pig processing, Reid Landes for assistance with statistical analysis, and Kathy Hanson for DEXA analysis. Your contributions made the work a lot easier. For their friendship, assistance, and knowledge in countless areas, I thank Rich Clayton and Dr. Trevor Lutz. I am also very appreciative to the other members of the Molecular and Animal Nutrition Group for their support and numerous contributions to my graduate education. I give credit to Dr. Rodney Johnson and fellow Illini in the Laboratory oflntegrative Biology for inspiring me to pursue a graduate education. It is, however, the constant love and support of my husband, parents, family and friends that has allowed me to succeed in the · pursuit of my dreams. Your patience, interest and encouragement have kept me going. vu

ABSTRACT The accuracy and precision of body composition measurement by Dual-Energy X-ray Absorptiometry (DEXA) and the efficacy ofpantothenic acid (PA) as a modifier of body composition in a pig model of obesity development were determined. Heavy weight barrows at six months of age were adjusted to a high fat basal diet with a calorie mix representative of that typically consumed by adults in the US (34 % of calories from fat) that provided daily dietary caloric intakes equivalent to 1.8 times their estimated body maintenance (110 kcal ME/ BW kg ·75 I day) needs based on the weekly mean BW of each animal. The basal diet provided PA in an amount that met or exceeded the current estimated needs of pigs and humans. This diet was expected to cause an obese state over a period of 144 d. At slaughter, the weights and tissue contents (fat, lean and bone mineral) of two body depots (carcass and internal organs) were evaluated by gravimetric, DEXA, and chemical measures. Subcutaneous carcass fat and longissimus muscle area measurements were also performed. The precision and accuracy of the DEXA estimates of the weight and tissue content of the two body depots were evaluated in thirty-three pigs (133-265 kg). DEXA scanning accurately estimated the carcass depot weight (+2 %) relative to that determined by gravimetric weighing. DEXA underestimated the fat tissue contents of the two depots (-19 and -26 %) and overestimated the lean tissue contents (13 and 27 %) relative to those estimated from chemical analysis of the fat and protein contents of the depots. However,

DEXA precisely detected changes in carcass and organ depot weights (R2= .99, .99, respectively) and less precisely predicted changes in the depot's chemically determined fat (R2 = .95, .73) and protein content (R2= .88, .84). Specifically, for each 1 kg change in carcass and organ depot weights, DEXA predicted the changes with a 95 % confidence (2 SE of estimate) within± .008 and .026 kg, respectively. For each 1 kg change in the carcass and organ depot's chemically determined fat content, DEXA predicted the change within± .092 and .338 kg, respectively. The efficacy of supplemental PA (0, 80, 800, 8000 ppm) as a modifier of body composition was determined on pigs (17/treatment) that were randomly allotted to dietary Vlll treatment by body weight and date on test (block). Pigs with an initial BW and fat content of 154 kg and 27 %, respectively, accrued 73 kg ofBW of which 48 % was body fat in the obesity development model. BW gains, BW gain/feed ratios, feed intake, and subcutaneous backfat depths were not altered by PA additions. Whole body fat tissue content responded quadratically to increasing PA additions. Body fat percentage was reduced by .9 percentage units by the 80 ppm added PA and increased by 1.6 and 1.1 percentage units by the 800 and 8000 ppm added PA. Hepatic acetyl-CoA carboxylase, acyl-CoA oxidase, and fatty acid synthetase mRNA expression did not differ between the 0 and 8000 ppm supplemented PA diets. Based on these data, DEXA precisely predicts weight and tissue content in different body depots, and PA is not an efficient modifier of body composition in a porcine model of obesity development induced by a high fat dietary regimen. 1

CHAPTER!. GENERAL INTRODUCTION Introduction Obesity is becoming a worldwide epidemic, affecting both children and adults. The WHO (2003) states that more than one billion adults are overweight with at least 300 million of them being obese. In the U.S., 30.6% of adults were reported as obese in 2000-2001, with 16.5% of children being overweight (CSREES, 2004). The increasing incidence of the disease seems to be due in great part to more sedentary lifestyles coupled with consumption of more energy and nutrient-dense diets. Although some people may be more genetically prone to obesity, environmental factors seem to assist in its development, for its occurrence tends to be greater in urban areas and in individuals previously experiencing sub-optimal levels of nutrition (WHO, 1997; Frisancho, 2003; Jang et al., 2003). Obesity poses a major risk for chronic diseases such as type 2 diabetes, cardiovascular disease, hypertension, stroke and certain forms of cancer (WHO, 2003). Worldwide attention has shifted towards research in obesity prevention and therapy as health care costs skyrocket. Pantothenic acid is involved as a cofactor in lipid, carbohydrate, and protein metabolism. It has been shown to provide protective effects against radioactive and oxidative damage (Slyshenkov et al., 2004), to have a therapeutic role in wound healing (Weimann and Hermann, 1999), to stimulate blastocyst development and be beneficial to fetus survivability (McKieman and Bavister, 2000). Pantothenic acid and its derivatives have gained recently gained attention for their roles in lipid metabolism. They have been used in the treatment of metabolic-related conditions such as atherosclerosis and alcoholic fatty liver, and research suggests they may have a beneficial effect on insulin-independent diabetes and obesity (Obrosova et al., 1988; Naruta and Buko, 2001). Hsu et al. (1992) demonstrated in chick hepatocytes that lipogenesis is decreased as pantethine concentrations are increased, while pantethine addition resulted in a decrease in ACC and FAS enzyme activities. Gaddi et al. (1984) suggested the liver to be the likely site of PA derivative action on lowering lipidemia in humans. Recently, the lipid-mediating effect of PA has been demonstrated in vivo in two studies (Stahly and Lutz, 2001; Autrey et al., 2002) in which 2 supplemental PA linearly reduced backfat depth and increased estimated carcass fat-free lean without altering meat quality in growing pigs. Dual-energy x-ray absorptiometry (DEXA) is a rapid, non-invasive measure of body composition that is commonly used on humans, due to the low radiation dose, reliability, repeatability and precision it provides over other measures. Studies have validated its use in live animals (Lukaski et al., 1999) and carcasses (Mitchell et al., 1996, 1998) to provide precise estimates of bone mineral, fat, lean, and total content. Questions have been raised as to the accuracy ofDEXA soft tissue determination (Jebb et al., 1995) in large and small mammals since DEXA measurements can be affected by depth (Laskey et al., 1992; Mitchell et al., 1998) particularly with soft tissue measurements (Lukaski et al., 1999). These questions have been partially addressed with recent changes in the analysis software prediction equations (Mitchell et al., 1998; Lukaski et al., 1999). Based upon this information, it would be beneficial to determine the accuracy and precision of body composition measurement by Dual-Energy X-ray Absorptiometry and the efficacy ofpantothenic acid as a modifier of body composition on a pig model of obesity development. Also, it would be of value to determine whether or not the supplemental levels of pantothenic acid elicit changes in body composition that can be detected through liver fat enzyme gene express10n. Thesis Oranization This thesis consists of a general introduction to the topic, a literature review, two journal articles, and a general summary. The journal articles are prepared in the style appropriate for submission to the Journal ofAnimal Science. Literature Cited

Autrey, B. A., T. S. Stahly, and T.R. Lutz. 2002. Efficacy of dietary pantothenic acid as an economic modifier of body composition in pigs. J Anim Sci 80 (Suppl. 1): 168 (Abstr.)

CSREES. 2004. Crees obesity white paper. Available: http://www.crees.usda.gov/nea/food/in_focus/obesity _if_ whitepaper.html. Accessed Nov. 23, 2004. 3

Frisancho, A. R. 2003. Reduced rate of fat oxidation: A metabolic pathway to obesity in the developing nations. Am J Human Biol 15: 522-532.

Gaddi, A., G. C. Descovich, G. Noseda, C. Frajiacomo, L. Colombo, A. Craveri, G. Montanari, and C. R. Sirtori. 1984. Controlled evaluation of pantethine, a natural hypolipidemic compound, in patients with different forms of hyperlipoproteinemia. Atherosclerosis 50: 73-83.

Hsu, J.C., K. Tanaka, I. Inayama, and S. Ohtani. 1992. Effects ofpantethine on lipogenesis and co2 production in the isolated hepatocytes of the chick (gallus domesticus). Comp Biochem Physiol Comp Physiol 102: 569-572.

Jang, I., D. Hwang, J. Lee, K. Chae, Y. Kim, T. Kang, C. Kim, D. Shui, J. Hwang, Y. Huh, and J. Cho. 2003. Physiological difference between dietary obesity-susceptible and obesity-resistant sprague dawley rats in response to moderate high fat diet. Exp Anim 52: 99-107.

Jebb, S. A., G. R. Goldberg, G. Jennings, and M. Elia. 1995. Dual-energy x-ray absorptiometry measurements of body compositon: Effects of depth and tissue thickness, including comparisons with direct analysis. Clinical Science 88: 319-324.

Laskey, M.A., K. D. Lyttle, M. E. Flaxman, and R. W. Barber. 1992. The influence of tissue depth and composition on the performance of the lunar dual-energy x-ray absorptiometer whole-body scanning mode. Eur J Clin Nutr 46: 39-45.

Lukaski, H. C., M. J. Marchello, C. B. Hall, D. M. Schafer, and W. A. Siders. 1999. Soft tissue composition of pigs measured with dual x-ray absorptiometry: Comparison with chemical analyses and effects of carcass thicknesses. Nutrition 15: 697-703.

McKieman, S. H., and B. D. Bavister. 2000. Culture of one-cell hamster embryos with water soluble vitamins: Pantothenate stimulates blastocyst production. Hum Reprod 15: 157-164.

Mitchell, A. D., J.M. Conway, and W. J. Potts. 1996. Body composition analysis of pigs by dual-energy x-ray absorptiometry. J Anim Sci 74: 2663-2671.

Mitchell, A. D., A. M. Scholz, V. G. Pursel, and C. M. Evock-Clover. 1998. Composition analysis of pork carcasses by dual-energy x-ray absorptiometry. J Anim Sci 76: 2104- 2114.

Naruta, E., and V. Buko. 2001. Hypolipidemic effect ofpantothenic acid derivatives in mice with hypothalamic obesity induced by aurothioglucose. Exp Toxicol Pathol 53: 393- 398. 4

Obrosova, I. G., M. Ostrovskii Iu, V. L. Tsyruk, A.G. Moiseenok, and A. S. Efimov. 1988. Effect of phosphopantothenate on the biosynthesis of cholesterol and its esters from various precursors in the liver of db/db mice. Biokhimiia 53: 1797-1802.

Slyshenkov, V. S., M. Rakowska, A.G. Moiseenok, and L. Wojtczak. 1995. Pantothenic acid and its derivatives protect ehrlich ascites tumor cells against lipid peroxidation. Free Radie Biol Med 19: 767-772.

Stahly, T. S. and T. R. Lutz. 2001. Role ofpantothenic acid as a modifier of body composition in pigs. J Anim Sci 79 (Suppl. l ): 68 (Abstr.)

Weimann, B. I., and D. Hermann. 1999. Studies on wound healing: Effects of calcium d­ pantothenate on the migration, proliferation and protein synthesis of human dermal fibroblasts in culture. Int J Vitam Nutr Res 69: 113-119.

WHO. 1997. Obesity: Preventing and managing the global epidemic - Report of a WHO Consultation on Obesity, 3-5 June 1997, Geneva. Available: http://www.who.int/nut/documents/obesity_executive_ summary.pdf. Accessed Nov. 23, 2004.

WHO. 2003. Obesity and overweight. Available: http://www.who.int/hpr/NPH/docs/gs_obesity.pdf. Accessed Nov. 23, 2004. 5

CHAPTER 2. LITERATURE REVIEW Body Composition and Tissue Accretion Animal growth or an increase in body mass results from accumulation of protein, fat, ash and the associated energy, with the deposition of one gram of fat resulting in the storage of more energy (9.4 kcal) than the deposition of one gram of protein (5.6 kcal) according to Ewan (2001 ). The deposition of fatty tissue requires more energy per unit of tissue gain (7 .83 kcal) than the deposition of proteineous tissue (1.12 kcal). This is due to the amount of low amount of water (.1 g) associated with the deposition of a gram of fat in fatty tissue relative to the 4 g of water associated with each gram of protein deposited in proteineous tissue (Ewan, 2001). The main body tissues in growing pigs are muscles, fat, visceral organs, bones and skin. The main proteineous tissues in the body are muscle and visceral organs including the gastrointestinal tract, liver, spleen, heart, lungs and reproductive tract. According to de Lange et al. (2001), between 45 and 60 % of the total protein mass present in market-weight pigs is in carcass muscle tissue and 15 % in visceral organs. As animals age and increase in body weight, the partitioning of production energy gradually changes from protein to lipid when constant energy is supplied. In a growing pig, body protein deposition increases linearly with increasing energy intake if no nutrients are limiting until a maximum is reached where protein deposition then remains constant according to Ewan (2001). Further increases in energy intake will increase the rate of body lipid deposition leading to a deterioration in body composition with increases in the ratio between lipid and protein deposition, backfat thickness and muscle tissue gain feed conversion occurring (de Greef et al., 1994; Bikker et al., 1996; Schinckel and de Lange, 1996). Bikker et al. (1996) also demonstrated an increasing ratio of protein to lipid being deposited in the organs and the fat at the expense of the carcass and muscle tissue with increasing energy intake in gilts ( 45-85 kg). It is suggested that in modem genotypes of pigs, the maximum of protein deposition is not reached until higher body weights (over 100 kg) even with ad libitum feeding (Ewan, 2001 also Schinckel and de Lange, 1996). Adipose Tissue Accretion 6

Ingestion of more calories than the body uses to meet its energy needs results in the expansion of total body fat stores, or adipose tissue accretion, the major expandable depot for energy storage. Adipose tissue is composed of adipocytes that store dietary energy, whether derived from carbohydrate, fat or protein and converted into fatty acids, in the form of triacylglycerol. The process is regulated and adipocyte volume determined through a balance of lipogenesis, lipolysis, and lipid oxidation according to Misso et al. (2003). Insulin, catecholamines, cortisol and sex hormones are just a few facfors that regulate the flux of triacylglycerol across the fat cell membrane as well as the activities of capillary lipoprotein lipase, which sequesters fat from the blood stream, and hormone-sensitive lipase, which liberates free fatty acids from stored fat (Prentice, 1999a). Lipoprotein particles in the plasma contain triacylglycerol that is hydrolyzed to release fatty acids by lipoprotein lipase, present in endothelial cells in the capillaries and regulated by insulin (Frayn, 1996). The fatty acids are then able to diffuse into the interstitial space and be taken up into adipocytes by a carrier­ mediated process regulated by concentration gradients. Inside the adipocytes, the fatty acids are esterified by formation of CoA derivatives and linked to glycerol-3-phosphate to form triacylglycerol that joins the lipid droplet (Frayn, 1996). There are two types of adipose tissue - white adipose tissue (WAT) and brown adipose tissue (BAT) - that store triacylglycerol and release fatty acids into the plasma during lipolysis. WAT has lipid stored as one droplet filling the cell with the cytoplasm, mitochondria and nucleus confined around the outside, while BAT has large numbers of mitochondria in the cytoplasm and the stored lipid present in many droplets according to Frayn (1996). BAT has a much higher oxidative capacity and may oxidize a large portion of the fatty acid released from storage, as well as has the ability to uncouple the generation of ATP from the substrate oxidation through an uncoupling protein, generating heat by activation and high vascularization (Frayn, 1996). Depot Differences in Adipose Tissue Accretion Research shows that adipose tissue in different regions of the body respond differently to hormones and changes in the nutritional state. The hierarchy of mean fat cell 7 size according to Vernon (1992) is omental, perirenal, subcutaneous, intermuscular, and intramuscular, largest to smallest in ruminants and pigs with blood flow following a similar hierarchy and little difference being seen between adipocyte mean volume. According to Smith (1983) the abdominal fat cells are more susceptible to body fat changes than those in peripheral regions and that under lipolytic conditions, the abdominal region contributes greatly to energy supply. This was demonstrated in vitro through the abdominal fat cell lipolysis being more correlated with arterial fatty acid level, catecholamine response greater and antilipolytic effect of insulin greater than that in the femoral fat cells (Smith, 1983). Individuals with abdominal obesity are reported to have greater incidences of metabolic complications associated with the obese state (such as increased fasting glucose and insulin, triglycerides and blood pressure and incidence of diabetes) as opposed to those with peripheral obesity (Smith, 1983). Fried and Ross (2004) support this finding with in vivo studies showing that non­ splanchnic, upper body subcutaneous fat depots make a larger contribution to hepatic free fatty acid delivery than visceral fat. Visceral fat produces lower levels of leptin and higher levels oflL-6, a stimulator of hepatic VLDL production and acute phase protein synthesis, and estrogen has less of an effect here as opposed to the subcutaneous parametrial fat according to Fried and Ross (2004). Omental adipocytes seem to have a greater capacity for taking up fatty acids and a lower basal lipolysis and antilipolytic effect of insulin when compared to subcutaneous and greater sensitivity and responsiveness to lipolytic agonists (Fried and Ross, 2004). Factors Affecting Tissue Accretion Energy Expenditure and Substrate Oxidation (Metabolic Factors) Tissue accretion is related directly to energy expenditure and substrate oxidation. Energy expenditure is classically divided into three major components: Basal metabolic rate, thermogenesis and physical activity as stated in Prentice (1999c). BMR represents the fundamental running costs of the organism and is 60-75% of total energy expenditure in sedentary people. Thermogenesis is any heat production specifically generated for the 8 purpose in maintaining body temperature as well as the obligatory heat loss associated with absorption, transport and metabolism of ingested food along with dissipation of excess dietary energy as heat. Physical activity refers to energy for external Newtonian work and is mainly behavioral. The sum of the three components is called total energy expenditure. The organs are quite metabolically active in the body and contribute to approximately 50% of whole-body energy expenditure and whole-body protein turnover in growing pigs, which is closely related to their size (de Lange et al., 2001). When total energy expenditure does not equal or is less than energy intake, tissue accretion occurs and overweight and obesity conditions can develop if this situation happens over an extended period of time. The basal metabolic rate has been shown to have a positive correlation with body weight and is higher in obese individuals. Overweight and obese individuals require a larger heart and skeletal muscle to support weight and more digestive and liver tissue for processing more energy intake (Prentice, 1999c). They have also been shown to have a lower respiratory quotient, but this may be due to higher fat diets that require less energy use (Flatt and Tremblay, 2004). The body requires substrate oxidation to provide energy through ATP, and the requirement for ATP has been shown to vary throughout the day according to feeding and activity (Flatt and Tremblay 2004). Carbohydrate, fat and protein yield different amounts of ATP when oxidized, as well as have different ATP expenditures associated with their oxidation, storage, and handling. Fat has the greatest overall ATP yield when oxidized, followed by carbohydrate and then protein due to substrate handling and storage costs. Some recent studies of substrate oxidation have shown that more energy is retained when excess fat is fed versus excess carbohydrate, while carbohydrate use is shown to elicit greater energy expenditure and metabolic rates, however the practical impact of this is concluded to be negligible (Flatt and Tremblay, 2004). According to Flatt and Tremblay (2004), overall energy expenditure for weight maintaining adults is determined by an individual's size and physical activity and is not markedly affected by variations in food intake, but maintenance of energy balance is overwhelming determined by factors controlling food intake. 9

Maintenance Requirements Animals and humans require energy to maintain their existing body weight conditions. Maintenance requirements contribute to approximately one third of total energy requirements in growing pigs according to de Lange et al. (2001) with major processes requiring energy including those associated with blood flow, respiration, muscle tone, ion balance, tissue turnover, animal activity, ingestion of feed, excretion of waste, and utilization of dietary nutrients. Estimates of maintenance energy and nutrient requirements are confounded by diet composition, and animal activities associated with feeding and animal interactions can account for 20% or more of maintenance energy requirements as stated in de Lange et al. (2001). Because fat tissue is metabolically a relatively inactive tissue, maintenance energy requirements are lower in fat pigs than in lean pigs as stated by de Lange et al. (2001). Values for animal maintenance requirements have been created based upon animal body weights and metabolic values to be used with known substrate energetic levels in order to provide an estimate of animal energy needs. Animal maintenance values are estimates of the metabolizable energy needed for zero energy retention. These have traditionally been used to estimate the energy needs of an animal through an allometric equation that uses the animal's body weight and is based upon heat production during fasting. The exponent generally used is 0.75, but research suggests that this value may under or over-estimate requirements with a range from 0.56 to 1.0 being possible (Ewan, 2001). Calculations can be performed by an assumption of efficiency of the conversion of energy to meet maintenance, the relationship between retained energy and maintenance energy, and multiple regressions between metabolizable energy intake and retention of fat and proteins according to Ewan (2001). Due to animals still depositing protein and lipid and differences in genetics, physical activity, feed intake, environment and disease-status, the accuracy of this calculated expression for the animal needs is not well known, for Schinckel and de Lange (1996) report that these alternatives, such as maintenance energy as a function of body protein mass, still do not account for every bit of variation. 10

Feed Restriction Tissue growth occurs when energy is fed above that needed to maintain the normal body functions for a specific body weight. Even when an animal is restricted from eating all that it can, it may be depositing energy into tissue, ifthe energy intake is above the maintenance requirement for that animal. Rates of adipose tissue lipid metabolism are modified during feeding, feed restriction and fasting in animals. When the later two occur, the catabolic pathways are increased in order to supply energy while the anabolic pathway activities are decreased to deal with the decreased nutrient intake. Lipogenesis in pigs is suggested to be related to feed intake, however lipolysis is not according to McNeel et al. (2000), who in a study done with obese pigs observed that restriction feeding (50% of ad libitum) did decrease fat accretion, but did not significantly affect several adipose tissue transcript concentrations suggesting that the method of fat accretion was related to post­ translational modifications and substrate availability. Ding et al. (2003) suggests that porcine adipose tissue is refractory to regulation of transcripts by energy intake for impact was only seen from feeding a high fat diet when fasted for several days and not weeks. Pigs fed a restricted diet above maintenance (12.6MJ DE/d for production) at high live weights experience lower rates of live weight gain due to the lipid gain having less water and mineral addition than protein (de Greef et al., 1994). Restriction fed chicks had significant increases in gene expression in liver enzymes such as FAS and ACC after photostimulation at first egg that subsequentially declined as they reached peak egg production according to a study done by Richards et al. (2003). After a feed restriction (2.2 times MEm) in the growing period, compensation in protein retention is likely to occur only in the organs, for there was no evidence of a beneficial effect of a previous restriction on carcass protein accretion in a gilt study performed by Bikker et al. (1996). The animals in these studies were restriction fed, however, the restriction was not severe in that normal functions were compromised, and the animals continued on their paths to production. Restriction of eating behavior may alter some metabolic processes, however the extent of alteration may depend on the severity of the restriction. 11

Muscle Metabolism Skeletal muscle uses both stored fuel (glycogen and triacylglycerol) and substrates (glucose and fatty acids) taken up from the blood. The fatty acids may be either plasma non­ esterified fatty acids (from stored triacylglycerol in the adipose) or esterified fatty acids carried in the form on triacylglycerol in lipoproteins (Frayn, 1996). Fatty acids are taken up by the muscle, particularly in the oxidative fibers. Rate of fatty acid uptake is closely related to the concentration of non-esterified fatty acids in the plasma, and fatty acid oxidation occurs in the cell in accordance with their rate of uptake. Both uptake and oxidation of fatty acids are determined by their delivery rate, which is increased during periods of high energy expenditure and fasting (Frayn, 1996). Muscle can have a large role in fatty acid utilization, particularly in the post­ absorptive state, with about 40%.ofplasma fatty acids being extracted from the plasma by skeletal muscles when fasting, and free fatty acid oxidation able to be about 80% of resting oxygen consumption by muscle according to Kelley and Storlien (2004). Rates of de nova lipogenesis are low in skeletal muscle, but in obesity muscle cells have an increased content of triglyceride, particularly in the intramyocellular area (Kelley and Storlien, 2004). This may assist in implicating skeletal muscle in being associated with insulin resistance for skeletal muscle in obesity is markedly inflexible in modulation of fat utilization as well according to Kelley and Storlien (2004). Endocrine Function of Adipose Tissue Adipose tissue is now recognized as an important endocrine organ that produces protein hormones including leptin, interleukin-6, adiponectin, angiotensinogen, and resistin according to Fried and Ross (2004) that send signals to regulate food intake and energy balance. Research has revealed that leptin, produced by adipocytes and a product of the ob gene, by acting on diverse brain structures and mechanisms, regulates ingestive behavior, metabolism, and neuroendocrine rhythms and controls body energy balance according to Campfield et al. (2004). Circulating levels ofleptin are proportional to adiposity and increase with increasing levels of body fat. 12

Adiponectin has been proposed to be an important mediator of insulin action and glucose metabolism and was shown by Xydakis et al. (2004) to be related to the expression of the metabolic syndrome phenotype independent of total adiposity (decreased in obesity and type 2 diabetes, inversely correlated to insulin and TG levels and positively correlated with HDL-C levels) and have a possible role in modulating HDL metabolism and in regulating inflammatory response. It acts directly on adipocytes to attenuate lipogenesis and in pigs the adiponectin concentration reflects degree of adiposity (Jacobi et al., 2004). Other Factors Affecting Tissue Accretion Genetics, physical activity, and food intake also have a part in tissue accretion. Genetic alterations for key proteins or receptors and decreases in physical activity can change substrate utilization and lead to fat accretion. Insulin is synthesized and secreted from the pancreas and regulates blood glucose concentration as well as central neural networks in the brain to regulate energy balance (Campfield et al., 2004). Neuropeptide Y (NPY), cholecystokinin (CCK), and corticotropin-releasing hormone and enterostatin are neuorpeptides that all have major effects on food intake (Campfield et al., 2004) which is highly associated with tissue accretion as well. Methods and Specific Enzymes Involved in Tissue Metabolism Glucose-Fatty Acid Cycle The glucose-fatty acid cycle occurs in adipose and muscle. When glucose concentrations are high, insulin increases and suppresses the release of fatty acids from adipose tissue. A high glucose concentration leads to a low plasma non-esterified fatty acid concentration and the tissue uses glucose for energy. According to Frayn (1996), in the post­ absorptive phase, glucose concentration falls and so does insulin, so non-esterified fatty acid concentration rises and the body spares carbohydrate use for tissues such as the brain that cannot utilize fatty acids as fuel. Oxidation of fatty acid in muscle suppresses the oxidation and uptake of glucose. More specifically, fatty acid oxidation increases acetyl-CoA and NADH which inhibit pyruvate dehydrogenase and oxidation ofpyruvate (from glycolysis) is suppressed (Frayn, 1996). 13

Direct Fat Deposition Dietary fatty acids enter circulation in the form of chylomicrons targeted for deposition in adipose tissue, where most ends up, even during periods of negative energy balance according to Astrup and Flatt (1996). It is suggested by Prentice (1999b) that under normal circumstances most of the deposited fat in humans is derived directly from dietary fat and that de nova fat synthesis is a rare circumstance. Support for this theory has been demonstrated by the research of several groups. Horton et al. (1995) performed a trial with lean and obese men fed isocaloric amounts of carbohydrate or fat, where carbohydrate overfeeding resulted in increases in carbohydrate oxidation and energy expenditure that led to 75-85% of excess energy being stored. Fat overfeeding had minimal effects on fat oxidation and energy expenditure and led to 90-95% of the excess energy being stored. Leitch and Jones (1993) performed a steady-state feeding study in humans where triglyceride-fatty acid synthesis was calculated to be minimal at either about 9g/day or 1.5g/day, depending on the source, either chylomicron or VLDL respectively. Since the chylomicron model is only expected to be dominant in the body for a short time after a meal, they expected that the average amount of synthesis in a human is closer towards the smaller amount in the VLDL model. Hellerstein et al. (1991) suggested that the majority oflipogenesis in humans occurs in the liver and that the newly synthesized fatty acids enter circulation in the form ofVLDL­ TG and phospholipids. They measured de nova lipogenesis in humans fasted following a carbohydrate load and reported that estimated total VLDL-TG synthesis was less than 500 mg/day, concluding that de nova lipogenesis did not contribute greatly or thermogenically. A review by Stahly (1986) reported that dietary fat increases the energetic efficiency of pigs fed isocaloric and isoprotein diets due to the more efficient use of energy from fat. He also suggests that the energetic value of ME from fat is maximized in animals fed a high level of ME and in turn are depositing large quantities of fat. Lammert et al. (2000) performed a study in men with isoenergetic amounts of fat and carbohydrates that resulted in no difference between body weight and fat mass. However, in the carbohydrate-fed men, 14 increases were seen in hepatic de novo lipogenesis, but these were smaller than the increases seen in whole-body de novo lipogenesis. They concluded that these increases would account for about 40% if the increases in fat mass, and that the extrahepatic de novo lipogenesis may account for about one-third of the total de novo lipogenesis. Because de novo lipogenesis from carbohydrate results in heat loss of about 19% as compared to the 3% occurring from direct fat deposition, they did raise a question of high carbohydrate diets having smaller metabolic rates to compensate for heat loss. Their data, however, showed that excess carbohydrate does still lead to weight gain and fat deposition (Lammert, 2000). Strawford et al. (2004) measured turnover in human lipid and cells to be slow with a half-life of six months or longer and de novo lipogenesis to be about 20% responsible in contributing to newly deposited adipose triglycerides. Lipogenesis The synthesis oflong-chain fatty acids from acetyl-CoA and malonyl-CoA involves numerous sequential reactions and acyl intermediates according to Wakil et al. (1983). Fatty Acyl Synthase Fatty acyl synthase (FAS) is an enzyme with seven active sites that catalyzes all of the reaction steps in the synthesis of long chain fatty acids, primarily palmitate by conversion of acetyl CoA and malonyl CoA with NADPH. A multifunctional homodimer enzyme, FAS is highly expressed in the brain, pulmonary and hepatic tissues - all major sites of de novo fatty acid biosynthesis (Wakil et al., 1983; Jayakumar et al., 1995) - and contains a 4'­ phosphopantetheine prosthetic group (Robishaw and Neely, 1985). Not subject to allosteric regulation and post-translational modification, FAS is regulated mainly by controlling its transcriptional rates through hormones, development and nutrition (Wakil et al., 1983; Sul et al., 2000; Latasa et al., 2000; Moon et al., 2002). Insulin and glucocorticoids stabilizes its mRNA, while glucagon, somatotropin, dietary fats and protein suppress and dietary carbohydrate and thyroid hormone stimulates transcription (Clarke, 1993; Sul and Wang, 1998). Porcine FAS exists in several tissues, but is surprisingly high in liver and regulated by hormones (Mildner and Clarke, 1990; Clarke, 1993 ). 15

De novo Lipogenesis The synthesis of fatty acids and triacylglycerol from substrates other than lipids, particularly glucose and amino acids, is referred to as de novo lipogenesis and may occur in the adipose, liver, and muscle tissues. It provides the means in which excess carbohydrate can be laid down for storage as shown by Frayn (1996). Fatty acids are synthesized from acetyl-CoA that may be produced from the breakdown of glucose, amino acids, or fatty acids. The pathway is stimulated by insulin mainly through activation of acetyl-CoA carboxylase. Preventing the processes of fat oxidation from producing acetyl-CoA and lipogenesis from converting CoA to fatty acids from occurring simultaneously is due to the presence of insulin. When insulin stimulates lipogenesis, it may also suppress fat mobilization from adipose tissue, and thus the supply of fatty acids for oxidation in the liver will be diminished and increased concentrations of malonyl-CoA will divert those fatty acids reaching the liver into esterification rather than oxidation (Frayn, 1996). Acetyl-CoA Carboxylase Acetyl-CoA carboxylase (ACC) is a biotin-containing enzyme that catalyzes the rate­ limiting step in fatty acid synthesis, the carboxylation of acetyl-CoA to malonyl-CoA. This reaction is ATP-dependent and donates all but two of the carbon atoms present in long chain fatty acid synthesis. ACC was discovered by Wakil and Gibson in 1958 and in animals consists of a tightly bound multienzyme complex, with the activated enzyme being a polymer capable of being dissociated into inactive promoters according to Wakil et al. (1983). There are two major isoforms of ACC, each displaying distinct tissue expression and properties relating to energy metabolism, which are hard to isolate from one another in animal tissues (Abu-Elheiga et al., 1997). ACCl carboxylases are found in the adipose tissue, localized to the cytosol. The malonyl-CoA synthesized by ACCl is used in fatty acid synthesis. ACC2 is expressed in the liver, but is predominantly found in heart and skeletal muscle associated with the mitochondrial membrane. The malonyl-CoA synthesized by ACC2 is used in fatty acid oxidation through regulation of CPTl. ACC is regulated in the short term through allosteric regulation of phosphorylation/dephosphorylation events and not new protein 16 synthesis, while long term regulation involves changes in concentration (Hillgartner and Charron, 1997; Sul and Wang, 1998; Abu-Elhiega et al., 2000). Nutritional and hormonal regulation also occurs, with citrate activating transcription and saturated, monosaturated and polysaturated long-chain fatty acids decreasing ACC concentration and CoA and six and eight-chain fatty acids inhibiting ACC transcription (Scott et al., 1982; Hillgartner and Charroh, 1997; Boone et al., 2000). According to Wakil et al. (1983), guanine nucleotides and CoA can regulate ACC, but not by enzyme activity. Recent developments suggest that ACC may be a suitable target for obesity research (Levert et al., 2002) for ACC2 deficiencies in mice resulted in less weight, fat and normal insulin and glucose levels when the animals were subjected to a high fat/high carbohydrate diet (Abu-Elhiega et al., 2003). Lipolysis Hormone-sensitive lipase catalyzes the first two steps oflipolysis, which occurs in the adipose tissue and has the hydrolysis oftriacylglycerol as its the rate-limiting step (Belfrage et al., 1983). Hormone-sensitive lipase is relatively specific to the primary ester-bonds of the acylglycerol substrates (Belfrage et al., 1983). The flow of free fatty acids is controlled by hormonal and neural regulation of free fatty acid mobilization from the adipose tissue. Lipolytic hormones including catecholamines, glucagon and ACTH stimulate, and insulin inhibits this process by regulating the activity of the rate-liming enzyme, the hormone­ sensitive lipase, through phosphorylation and dephosphorylation (Belfrage et al., 1983). The rate oflipolysis is increased with increasing size of the fat cell resulting in an increase in the concentration of free fatty acids in the plasma, and thus leading to increases in the amounts of fatty acids going to the liver (Bray, 1983). Peroxisomal Fatty Acid Beta-Oxidation Yu et al. (1997) states that peroxisomal beta-oxidation is present in many tissues including the liver, kidney, heart, intestinal musoca, and skeletal muscle of many species and may play a role in thermogenesis with energy being released in its first step as heat. It is a carnitine-dependent system that is completed after the chain-shortened acyl-CoA's are exported to the mitochondria. 17

Acyl-CoA Oxidase Acyl-CoA oxidase (ACO) is the rate-limiting enzyme in peroxisomal fatty acid beta­ oxidation. ACO acts on very long-chain and long-chain acyl-CoA's with its two subunits containing FAD-donating electrons to molecular oxygen and generating hydrogen peroxide in the first step. It oxidizes the CoA-esters of medium-chain, long-chain, and very long­ chain fatty acids, medium and long-chain dicarboxylic acids, and prostaglandins according to Reddy et.al. in 2001 and is active to only substrates with longer carbon chain lengths. ACO has been shown to regulated by PPARalpha. Species Differences in Fat Metabolism De novo lipogenesis, which occurs in the liver and adipose tissues, is considered to play a minor role in accumulating fat stores in humans, although modifications can occur within the hepatocytes through diet (particularly high carbohydrate) according to Diraison et al. (2003). In the pig, de novo lipogenesis in the adipose tissue dominates over the liver with FAS and ACO expression being greater coupled with elongation and desaturation of fatty acids occcuring there. The pig liver has low levels of ACC suggesting that is serves as primarily a housekeeping gene and not a main enzyme in the synthesis of fatty acids as Liu et al. (1994) suggests. Yu demonstrated the decline in activity of ACO with age in young pigs while Ding et al. (2000) showed that swine have higher concentrations of the enzyme in the

liver and adipose tissue than skeletal muscle. Work done by Di~g et al. (2003) demonstrates that adipose tissue lipogenesis can be inhibited by high fat diets and individual fatty acids suggesting that at least a portion of the regulation resulted from decreased transcription of mRNA genes associated with lipid synthesis. Since the pig incorporates dietary fatty acids into tissue, the tissue composition is usually a reflection of the diet (Ding et al., 2003). Gatlin et al. (2002) discussed how lean genetics could have greater lipolysis and, along with · specific fatty acids in the diets, could reduce rates of de novo lipogenesis in pigs. Backfat fatty acid composition in their study also reflected dietary fat composition, with the degree of fatness correlating to the proportion of total unsaturated fatty acids. Animals with a greater amount of lean in the study also had a greater amount oflinoleic acid in backfat (Gatlin et al., 18

2002). Vernon (1992) states that studies in pigs have shown that increase in fat cell size with fattening is associated with an increase in activity of a variety of lipogenic enzymes including ACC and lipoprotein lipase and that basal lipolysis increases in pigs with age. Result of Excess Fat Tissue Accretion Obesity Obesity is becoming a worldwide epidemic, affecting both children and adults. The WHO (2003) states that more than one billion adults are overweight with at least 300 million of them being obese. In the U.S., 30.6% of adults were reported as obese in 2000-2001, with 16.5% of children being overweight (CSREES, 2004). The increasing incidence of the disease seems to be due in great part to more sedentary lifestyles and energy and nutrient­ dense diets. Although some people may be more genetically prone to obesity, environmental factors seem to assist in its development, for its occurrence tends to be greater in urban areas and in individuals previously experiencing sub-optimal levels of nutrition{WHO, 1997; Frisancho, 2003; Jang et al., 2003). Obesity poses a major risk for chronic diseases such as type 2 diabetes, cardiovascular disease, hypertension and stroke and certain forms of cancer (WHO, 2003) and has shifted worldwide attention towards research in its prevention and therapy as health care costs skyrocket. Obesity can only occur when energy intake remains higher than energy expenditure for an extended period of time, acting either through increasing energy intake, decreasing energy expenditure, or both according to Prentice (1999a). The human measure for obesity is the body mass index (BM/) where the ratio of the weight in kilograms is divided by the squared height in meters. BMI of20-24.9 is considered normal, while anything over that value is considered overweight, and 30 or above obese (Frayn, 1996). As expected with obesity, the increase in body mass is largely an accumulation of fat - both triacylglycerol and non-fat mass including cytoplasm and supporting connective tissue (Frayn, 1996). Obesity Characteristics Obesity is characterized by both hyperplasia and hypertrophy of adipose cells. It has been discovered that hyperplasia occurs when existing fat cells are full, for under conditions 19 of prolonged positive energy balance, more adipocytes are recruited from the preadipocyte pool under the influence of PP ARgamma2, which is activated by prostaglandins and free fatty acids as stated by Prentice (1999a). Several lipogenic enzymes including ACC and FAS are increased during obesity (Levert et al., 2002; Jang et al., 2003). According to J eanrenaud (1979), regardless of the type and cause of obesity, similar attributes occur including: abnormalities in the liver and adipose (which are responsible for lipid synthesis and accretion), hyperinsulinemia, and hyperglycemia with abnormal glucose tolerance and insulin resistance. In a study he performed with obese rats, Jeanrenaud (1979) observed that both the liver and the adipose had increases in lipogenesis, triglyceride secretion, and decreased ability to oxidize fatty acids into ketone bodies and accumulate triglycerides. Adipocytes at different sites in the body have different functions and different effects, and within the body there are regional differences in the hormone sensitivity of fat cells leading to the suggestion that different depots have specific functions according to Garrow (1999). Vessby (2000) states that obesity, in particular abdominal obesity, tends to be the most important determinant of risk in developing insulin resistance and non-insulin dependent diabetes mellitus. Ramos et al. (2003) reported that obesity is associated with a low-grade systemic inflammation and suggests that it is an anti-inflammatory disease. Through the production of cytokines including TNF-alpha, IL-6, and leptin, which increase in the adipose tissue and correspond directly to the severity of obesity, and enhance activity of 11-Beta HSD-1 which increases corticosterone and is also produced by the adipose tissue and an anti-inflammatory agent. The call for preventative and therapeutic strategies to alleviate obesity will hopefully lead to better understanding of body metabolism and the processes within it. Obesity Complication - Insulin resistance Insulin resistance is becoming a common issue associated with obesity and the metabolic syndrome. Although the mechanism of its occurrence and associations is not yet completely understood, several theories have come about through research. According to Frayn (1996), if muscle cannot oxidize non-esterified fatty acids and glucose at the rates expected from 20 their concentrations in the plasma leading to no mechanism for disposing of excess ATP, the glucose-fatty acid cycle leads to impairment of glucose uptake and metabolism. This has a net effect being that glucose uptake by muscle is reduced compared to that expected at given concentration of insulin and glucose in the plasma (Frayn, 1996). Insulin resistance is a function of both increased body fat and distribution of body fat, with individuals with intra­ abdominal adipose tissue obesity most susceptible. It was thought that these tissues in the mesentary and omentum, which support the intestines, release non-esterified fatty acids directly into the portal vein and thus overloading the liver and altering hepatic metabolism (Frayn, 1996). Kelley and Storlien (2004) show that insulin-resistant muscle is disposed towards anaerobic and glycolytic generation of energy and that increased proportions of saturated fatty acids in muscle stores are related to impaired insulin action and increased adipocity. They suggested that lipid storage is increased out of proportion to the capacity of the cells for substrate oxidation in obese people and that the capacity for lipid oxidation is reduced in human skeletal muscle through decreases in lipoprotein lipase and camitine palmitoyltransferase 1 (CPT-1) activity, cytosolic fatty acid-binding protein, accumulation of malonyl-CoA (which inhibits CPTl and thus lipid oxidation) and increasing in uncoupling proteins, which are implicated in thermogenesis. Further research will verify the conditions of insulin resistant occurrence and lead to therapeutics for the condition. Animal Models of Tissue Accretion Animal Models of Obesity The growing issue of human obesity has led to the interest in research in identifying its cause and developing effective therapy and preventive technologies that requires the availability of appropriate models. Commercial species may not be the best models for extrapolating to humans, but their usefulness in comparative studies and for the identification of basic biological controls should not be ignored as stated in Stock (1996). The rodent models are not suitable for quantitative comparisons, even with appropriate body size scaling, but may be useful qualitatively. There are differences in BAT between rodents 21

(major obesity cause) and humans (disappears after infancy), age when tested, and typical diets, however, rodents do have similar gastric emptying, will eat similar diets, have different genetic susceptibilities and show increasing propensity to obesity with age according to

Stock (1 ~96). Rodent models of obesity are all characterized by hyperinsulinemia and insulin resistance accordinng to the Kopelman (1999) and have led to the discovery of several mutations and proteins related to obesity including leptin and the ob gene, melanocortin, beta3-androgenics, and uncoupling proteins. Rodents also deposit about 50% of their total fat mass intra-abdominally, whereas humans only deposit about 20%, with the majority going subcutaneously (Fried and Ross, 2004). Dog models of obesity show promise with high breed susceptibiliy and similar BAT characteristics, however there is little known about their body weight regulation and composition, as well as ethical expense issues as seen with primates (Stock, 1996). Swine have been used as a human model in many aspects of biomedical research (Swindle and Smith, 2000) due to their similarity in anatomy and physiological processes. The predominant systems studied include cardiovascular, digestive, dermal and urinary according to a review by Swindle and Smith (2000). The pig is a particularly good model, both biologically and economically, in nutrition studies due to its omnivorous nature, simple stomach, large litters, a relatively short reproductive cycle, an ability to cross-foster between litters, available genetically defined lines, an ability to be weaned at birth and bottle-fed, rapid growth rates, ready adaptation to confinement in metabolism cages, and ease of tissue and fluid sampling in the conscious animal according to Moughan et al. (1992). The coronary system is 90% similar to humans, while the physiology of digestion, particularly the metabolic functions, intestinal transport times, characteristics of absorption of nutrients, ion transport and motility, neonatal development and splanchnic blood flow characteristics make it useful in human nutritional research as reported by Swindle and Smith (2000). Although differences between pigs and humans do occur, when taken into account in experimental design and result interpretation (Moughan et al., 1992), research shows that the pig model has numerous advantages over other models. In regards to obesity, minipig models have 22 been used to study obesity-related complication of such sleep apnea (Lonergan et al., 1998), while Larsen et al. (2002) implicates the Gottingen minipig as a non-rodent model for insulin resistance or type 2 diabetes and Boullion et al. (2003) uses the Yucatan minipig as a model of diabetic dyslipidemia. Nutrient Impact on Tissue Accretion Dietary Fat Dietary fat is an important macronutrient in the mammalian diet supplying energy and hydrophobic components used in the synthesis of lipids. Dietary fat has been shown to effect gene expression and thus metabolism, cell differentiation and growth. Genomic effects of dietary fat reflect an adaptive response to fat amount or composition (Jump and Clarke, 1999), with animals typically consuming high fat diets increasing the amounts of stored fat in their bodies due to decreasing their fat negative feedback system and leading to the incidence of obesity (Woods et al., 2003). The addition of fat to a diet results in an increase in dietary energy density and a decrease in feed intake for the animal does not need to eat as much to maintain its energy intake. It also has a lower heat increment than carbohydrate that may be beneficial in maintaining feed intake in high environmental temperatures. The American Heart Association recommends that 30 % of dietary energy to come from fat with an even distribution of polyunsaturated, monounsaturated, and saturated fatty acids (Gifford, 2004). Americans consume diets having between 10 and 40% oftl_ie calories from fat and in 1995, Americans consumed about 34% of their dietary calories from fat (Gifford, 2004). Dietary fat is absorbed in the gut as chylomicrons into the lymphatic system. The liver uses dietary fat and de nova fatty acid syntheis to produce very low density lipoproteins. They are taken up by cells through hydrolyis by lipase and lipoprotein lipase, which enable the free fatty acid to enter the cells through membrane-associated transporters (Jump and Clarke, 1999). Fatty acids enter a number of metabolic pathways, including oxidation in mitochondria and peroxisomes, in order to provide energy to tissues such as the skeletal muscle and heart. ACC and FAS catalyze de nova fatty acid synthesis in the cell cytoplasm (Sul and Wang, 1998). Fatty acids are stored as triacylglycerol in adipocytes and the liver, 23 which, according to Reddy and Hashimoto (2001), is a protective mechanism neutralizing excess long and very long chain fatty acid toxicity. Cellular response to a particular fatty acid level will depend on its association with fatty acid-related transcription factors that can be very complex (Jump and Clarke, 1999). Fatty acid metabolism is a tightly regulated system related to energy supply and hormonal status (Sul and Wang, 1998). When glucose supply is high, fatty acid synthesis is enhanced and beta-oxidation decreased to store the excess energy as triacylglycerol. The alternate occurs when glucose supply is low, for synthesis will be decreased and beta-oxidation increased to produce ketone bodies for energy export. Under tight control, insulin inhibits free fatty acid mobilization while glucagons stimulate it (Reddy and Hashimoto, 2001). Studies in numerous species demonstrate that high amounts of dietary fat are associated with increases in body fat content (West and York, 1998) and as shown in pigs, the fatty acid composition of the diet tends to reflect the fatty acid composition of the animal (Ding et al., 2003). High fat diets were shown by Larsen et al. (2002) in the Gottingen minipig to increase body weight, truncal fat, total fat, fasting plasma glucose, insulin and choleserol levels while decreasing total relative lean mass but increasing absolute lean mass. Shillabeer et al. (1990) saw a depression in FAS activity in the liver when feeding rats high fat diets that was greater when the fat type fed was saturated. Recent studies suggest that high fat intake contributes to the development of obesity as well as its association with impaired insulin sensitivity and increased risk of developing diabetes independent of obesity according to Vessby (2000). Dietary Carbohydrate Dietary carbohydrate is the major energy source in diets of people around the world, accounting for 40-80% of total food energy intake, and is recommended to be at least 55% of total dietary energy (F AO/WHO, 1997). Most of dietary carbohydrate is converted to glucose before storage, in the liver as glycogen, or oxidation according to Shadid and Jensen (2004). Since the liver has a limited capacity for glycogen storage, taking in excess carbohydrate leads to greater oxidation of carbohydrate and less oxidation of fat which will 24 end up being stored as stated in Shadid and Jensen (2004). This is verified by Horton et al. (1995) who showed that carbohydrate overfeeding in men produced progressive increases in carbohydrate oxidation and total energy expenditure resulting in 75-85% of excess energy being stored. Massive intakes of carbohydrate can stimulate de nova lipogenesis, but humans seen to have a limited capacity for this according to Shadid and Jensen (2004). Diraison et al. (2003) showed in a study with humans fed high carbohydrate diets that de nova lipogenesis is active in humans, but contributes little to triacylglycerol stores and is less responsive than liver. Even though dietary fat overfeeding in humans led to greater fat accumulation than carbohydrate when fed in isoenergetic amounts according to Horton et al. (1995), all overeating will eventually lead to obesity regardless of diet composition due to the storage of the excess energy. Pantothenic Acid In 1933 Williams discovered 'a substance of universal biological occurrence' that he named Pantothenic Acid (PA) that was closely associated with pyridoxine and found to be an anti-dermatitis factor in chicks (Williams et al., 1933). It was first identified in the development of a deficiency syndrome in chicks by Norris and Ringrose (1930). It was not absorbed on Fuller's earth so originally it was called 'filtrate factor' (Scott et al., 1982). He was able to isolate it and determine its structure in subsequent years and Lipmann and associates figured out the metabolically active form as well as the biochemical function of it in Coenzyme A in the latter 1940's (McDowell, 2000). The chemical structure of PA is N­ (2,4-dihydroxy-3,3-dimethyl-1-oxobutyl)-beta-alanine. Free PA is unstable, highly hygroscopic, viscous oil, easily destroyed by acids, bases and heat and soluble in water according to Scott et al. (1982). D-calcium pantothenate is the naturally occurring form of the vitamin. Pantothenic Acid Sources PA is found in a variety of plant and animal foodstuffs, most commonly as a component of CoA (Sauberlich, 1985, 1987). Good sources of the natural form of the vitamin include animal tissues such as liver and eggs but some plant sources such as whole 25 cereal grains and legumes and yeast are also known to be rich in PA. According to the NRC (1987), smaller amounts are found in milk, fruits, and vegetables. Synthesis of PA is suspected in intestinal microflora, but amounts in vivo are unknown and suspected to be of little benefit to the animal due to the minimal absorption of the vitamin in the large intestine, however it may benefit those animals that practice coprophagy (McDowell, 2000). In ruminants, intestinal mircoflora can produce enough PA to support the animal. PA can be commercially synthesized as well for nutritional supplementation. The two synthetic forms include d-calcium pantothenate and di-calcium pantothenate. The d-form is found to be 92% bioavailable while the racemic mixture is only 46% available (McDowell, 2000). Human intake is thought to be sufficient in most cases (NRC, 1989), however, monogastric animals fed diets based on grains tend to be supplemented with PA because the diets tend to be deficient in the vitamin. According to Southern and Baker in 1981, com was found to contain 4.6±1.3ug PA/g and dehulled soybean has 21.7±1.3ug PA/g that is 100% bioavailable (McDowell, 2000). The bioavailability of PA in the average human diet has a mean of 50% (Sauberlich, 1985, 1987). ·PA is fairly stable in food and feedstuffs but maybe lost due to processing and storage methods, particularly extreme heat for extended periods of time (Scott et al, 1982; Sauberlich, 1985, 1987). Pantothenic Acid Requirements PA requirements for most species are based upon typical consumption levels and range between 5 and 15 mg I kg diet. The human NRC (1989) states that human intakes of 4- 7mg/d should be safe and adequate for all adults, while infants to age eleven should consume 2-3mg/d. The NRC (1998) recommends from 7-12 mg PA/kg feed based upon pig life stage. Many factors affect the requirement including diet, life stage, and the animal itself. Higher concentrations are needed when the animal eats an energy dense diet (McDowell, 2000), is lactating or pregnant (NRC, 1998). Lesser amounts are needed in animals fed high protein diets and those that have antibiotic supplementation (McDowell, 2000). PA is known to have interrelationships with human income levels (Oldham et al., 1946) and other vitamins such as vitamin Bl2, C and biotin with both sparing and increasing effects (McDowell, 2000). 26

With current animal genetic lines that are more efficient in growth and possess greater capacities for proteinaceous tissue growth, recent studies suggest that the current recommended PA concentrations may be inadequate to support maximal lean tissue growth (Stahly et al., 1995). Work done by Stahly et al. (2000) has shown that PA additions above the recommended levels improved pig body composition and performance, showing results similar to and exceeding the benefits of supplementation seen in a study done in chicks by Southern and Baker (1981). Pantothenic Acid Deficiency Signs of PA deficiency are very species-specific but an effect on animal growth and some form of dermatitis usually occur in all species. Colby (1948) observed that young pigs fed a diet deficient in PA had decreased growth, appetite, coordination, and skin and hair condition along with secondary infections. Naturally occurring PA deficiencies in humans are not well documented, but implicated in 'burning feet' syndrome in some cases of extreme malnourishment (NRC, 1989). PA deficiency results in low concentrations of pantothenate and/or CoA in the body tissues (Reibel et al., 1982; Smith et al., 1987; Wittwer et al., 1990). The effect on CoA has not been verified in all cases for some tissues such as the liver may retain enough to function normally (Cupo and Donaldson, 1986; Bender, 1999), however, and it is thought to be related to animal age and severeness of the deficiency (Robishaw and Neely, 1985; Wittwer et al., 1990). Internal signs of PA deficiency give some insight into the importance of this vitamin in the systems throughout the body. In regards to maintaining cellular structural integrity, deficiencies morphologically alter dermal fibroblasts as seen by Weimann and Hermann (1999), while compromises in the elongation and desaturation processes of PUFA were observed by Fidanza and Audisio (1982). The process of its effect on reducing FA metabolism remains unknown as Cupo and Donaldson (1986) showed that no effect of PA deficiency was seen in key lipogenic enzymes in the chick. Deficiencies of this vitamin are rare due to the wide variety of available dietary sources, however PA is supplemented in some animals fed commercial diets in order to avoid these problems. 27

Pantothenic Acid Toxicity PA is generally considered to be a compound with a low risk for toxicity in all species, even when dietary levels of at least 20g PA/kg of diet are fed (NRC, 1987). Unfavorable responses to ingestion of elevated levels have not been seen and, for humans, the upper limit of dietary intake for PA has not been set (Committee, 2002). No toxic symptoms were seen in humans fed as much as 1Og of calcium pantothenate per day, but some studies report that daily doses of 10 to 20 g may cause occasional diarrhea and water retention as stated in NRC (1989). Adverse reactions have been observed when high levels (20mg of sodium pantothenate - about 80 mg/kg of BW) are injected intramuscularly in rats resulting in liver damage and parenteral injections were given to rats having an acute LD 50 of lg PA/kg ofBW (NRC, 1987). Methods of Predicting Pantothenic Acid Levels Numerous methods have been used to determine amounts of PA in various substrates. Chick growth bioassays were originally used, but time has led to the discovery of other quicker and cheaper methods including microbiology and radioimmunoassay since the complex nature of PA has hindered the use of chemical determination. A number of microorganisms are used to determine the amount of PA in various substances, but require the PA be freed from its coenzyme form through enzymes. Radioimmunoassay is reported to be successful for determining the amount of PA in diet, blood and urine (Srinivasan et al., 1981 ). An automated fluorometric assay is also good for blood, while ELISA works well on plasma according to McDowell in (2000). There has been shown to be a positive correlation between dietary intake and milk (Johnston et al., 1981) and urinary excretion of PA (Eissenstat et al., 1986), but this is not age-dependent and no correlation has been seen in the blood levels (Srinivasan et al., 1981 ). Pantothenic Acid in the Body The role of PA in the body centers on its role as an important cofactor in numerous enzymatic reactions. During digestion, PA is freed from its bound forms and dephosphorylated to yield pantothenate that is converted to PA by intestinal pantetheinase in 28 the lumen. PA is then absorbed primarily in the jejunum by a specific transport system that is known to be saturable and sodium ion dependent. It can then be transported in the plasma to other tissues for functional group synthesis (Fenstermacher and Rose, 1986; Sauberlich, 1985, 1987; Stein and Diamond, 1989; McDowell, 2000). According to Olson (1984), PA is present in whole blood in amounts ranging from 100 to 180ug/dl. Serum contains free PA while other tissues, including the red blood cells where most of the PA in blood is found, contain PA in the form of CoA. According to McDowell (2000), the liver and kidney contain the most PA, with the body as a whole not having the capacity to store large amounts. The amount of PA in the body is, however, related to dietary supply. Tissue levels of PA are shown to decline as quantities of the vitamin fed are lowered (McDowell, 2000). As the amount of PA in the diet increases, the amounts in various tissues such as the blood and milk increase (Owen and Bowland, 1952) and excess is excreted (Barnhart et al., 1957). Excess PA is excreted mostly as the free form in the urine, however some is excreted in the feces (Oldham et al., 1946) and as carbon dioxide after lung oxidation (McDowell, 2000). The Metabolic Role of Pantothenic Acid PA's metabolic role stems from it being a component of mainly coenzyme A, but also as a part of acyl CoA synthetase and acyl carrier protein (NRC, 1987). The CoA form and its acyl derivatives participate in numerous carbohydrate, protein and lipid metabolic reactions. These include the acetylation of amines, transferring acyl groups, condensation reactions - particularly those related to the Kreb's cycle, fatty acid beta-oxidation, and the synthesis of several body components including lipids, neurotransmitters and steroid hormones (Scott et al., 1982; Olson, 1984; Cupo and Donaldson, 1986; NRC, 1987; Bender, 1999; McDowell, 2000). Fatty acids require activation by CoA prior to triglyceride synthesis (Wittwer et al., 1990). A PA derivative, 4' -phosphopantetheine, is also a prosthetic group for fatty acid synthetase (FAS), the rate-limiting enzyme in fatty synthesis (Cupo and Donaldson, 1986). The interconversion of PA and CoA in body tissues is suggested by Smith et al. (1987) to be regulated by the hormones of metabolic homeostasis including glucagon, insulin and glucocorticoids. Glucagon can increase the intracellular concentration of pantothenate as 29 well as increase the conversion of pantothenate to CoA like glucocorticoids. Insulin has been shown to inhibit pantothenate incorporation into CoA. Smith et al. (1987) also suggested that changes in the total CoA content observed during the fasting-feeding cycle might be functionally related to changes in other pathways regulated by these hormones. During fasting, the liver enhances glycogenolysis and gluconeogenesis while the heart increases oxidation of fatty acids and ketone bodies. Smith et al. (1987) reported that pantothenate deficient mice have lower levels of liver total CoA and were unable to maintain normal glycogen stores when fasted or exercised, but had normal ketogenic responses. PA deficiency was reported by Fidanza and Audisio (1982) to compromise the elongation and desaturation processes of polyunsaturated fatty acids, particularly linoleic acid, due to its role in CoA, which is involved in linoleate conversion to arachidonate. PA has recently come into interest for clinical uses particularly regarding some of its noncoenzymes effects (Naruta and Buko, 2001). PA has been found to have a therapeutic role in wound healing in cultured human skin cells by accelerating cell migration and proliferation and controlling protein synthesis (Weimann and Hermann, 1999) as well as increasing the fibroblast content of scar tissue (McDowell, 2000). Some other therapeutic effects of PA and its derivatives include administration to increase GI peristalsis, alleviate itching, and protect against radiation sickness according to McDowell (2000). Pantothenate was shown by McKieman and Bavister (2000) to stimulate blastocyst development and be beneficial to fetus survivability after embryo transfer techniques were performed in a hamster model of development. The protection provided by PA and its derivatives against peroxidative damage has been observed in tumor cells and phospholipid liposomes according to Slyshenkov et al. (1995). The action was not due to scavenging of free radicals, though, but as a direct effect of these compounds being components of CoA. Preincubation of cells with these compounds was shown to increase the esterification of fatty acids, particularly those in the synthesis of membrane phospholipids (Slyshenkov et al., 1995). Naruta and Buko (2001) stated that PA and its derivatives exhibit an antiatherogenic effect with a change in ratio between atherogenic LDL, VLDL and the antiatherogenic class HDL. 30

The Role in Pantotbenic Acid in Body Composition Pantethine, a synthetic yet stable disulphate form of PA, along with other derivatives of the vitamin have gained a lot of attention for their roles in lipid metabolism. Pantethine has been used in the treatment of metabolic-related conditions such as athersclerosis and alcoholic fatty liver, and it as well as phosphopantothenate have been demonstrated to have positive effects on insulin-dependent diabetes, hyperlipidemia, and obesity models (Obrosova, 1988; Naruta and Buko, 2001). When 150 ppm of PA derivatives were administered intramuscularly in N aruta and Buko' s study (2001) to an obese mouse model, significant decreases in triglycerides, insulin and glucose levels were observed. Also decreased were the concentrations of total serum cholesterol and LDL, and sum ofLDL, VLDL, and LDL-cholesterol along with inhibited body weight gain and activated LPL in adipose. The mechanisms of PA hypolipidemic effects were suggested to be related to the reduced resistance to insulin, a common issue in obesity, and activation of lipolysis in serum and adipose tissue as stated by Naruta and Buko (2001). Obrosova et al. (1987) in a db/db mouse model showed that administration of phosphopantothenate altered CoA reserves to normal and inhibited dehydrogenase complexes to decrease cholesterol levels not through their biosynthesis from pyruvate. Hsu et al. (1992) discusses pantethine's many beneficial effects when supplemented during various life stages to the chicken and the possibility of it having a direct effect on fatty acid synthesis in the liver and being effective in accelerating cholesterol degradation and bile synthesis and cholesterol excretion via bile. Broilers exposed to high temperatures were able to increase body weight gain and meat production when supplemented with pantethine, while layers improved egg production while decreased lipogenesis and cholesterolpoesis were observed in several of their tissues. Growing chicks showed decreases in lipid contents with increases in bile secretion with pantethine supplementation (Hsu et al., 1992). During Hsu et al. 'sin vitro study (1992) on chick hepatocytes it was demonstrated that lipogenesis is decreased as pantethine concentrations are increased, while pantethine addition resulted in a decrease in ACC and FAS activites. The liver was of most importance in these changes, and 31 is also suggested to the likely site of action in humans by Gaddi et al. (1984). He suggested that pantethine acts on the regulation of liver sterol biosynthesis after observing decreases in plasma cholesterol and triglyceride levels in patients with type IIB hyperlipidemia and decreases in plasma lipids in apoAI type. Different animal model reactions lead to questions about the mechanism but he suggests that the derivative stunts the active acetate from going to sterol synthesis to mitochondrial oxidation and respiratory pathways (Gaddi et al., 1984). When conditions of abnormal lipid metabolism were examined with PA derivatives, altered CoA metabolism was also sometimes found, as a study done by Wittwer et al. (1990) in PA-deficient rats found elevated triglyceride and free fatty acids with decreased levels of CoA. Wittwer et al. (1990) suggests the mechanism to be that of PA coenzymes becoming limiting in an enzyme-catalyzed pathway, resulting in increased circulating lipids. The lipid­ mediating effect of PA has been demonstrated in vivo in two studies (Stahly et al., 2001; Autrey et al., 2002) in which supplemental PA linearly reduced backfat depth and increased estimated carcass fat-free lean without altering meat quality in growing pigs. Methods for Determining Fat Tissue Accretion Body Composition Measures Numerous techniques are available for estimating live animal or carcass composition (Topel and Kauffman, 1988) and relationships between these different measures are valuable in their predictive value of body composition (Rook et al., 1987). Of particular interest in this study is the relation of standard pig carcass measures to practical human measures. Many correlations have been discovered between Dual-energy x-ray absorptiometry measures of body composition and chemical analysis (Mitchell et al., 1996, 1998; Koo et al., 2002). Log-linear relationships have also been reported between chemical and physical

(subcutaneous backfat measures) body composition in pigs (Rook et al., 1987). Body composition changes through their relation to changes at the molecular level can be investigated through analysis of gene expression by real-time polymerase chain reactions that were of interest in this study. 32

Dual-Energy X-Ray Absorptiometry Dual-energy x-ray absorptiometry (DEXA) is a rapid, non-invasive measure of body composition. It is a commonly used procedure for humans, however studies have validated its use in live animals (Lukaski et al., 1999) and carcasses (Mitchell et al., 1996, 1998) to provide precise estimates of bone mineral, fat, lean, and total content. The sample is scanned by x-ray beam at two x-ray energy levels (38 keV and 70 keV), which measure bone and soft tissue mass simultaneously at 0.5 cm intervals (Bessesen and Kushner, 2002). The energy that is lost from the beam as it passes through the sample is determined and related back to components of body composition through previously determined density equations (Ostrowska et al., 2003). A tissue bar serves as an internal standard for tissue composition measurement (Jebb et al., 1995). There are two modes of scanning available, a fan beam technique and a pencil beam technique, and recent validation studies of the fan technique suggest that it has the superior qualities of speed and resolution (Salamone et al., 2000; Koo et al., 2002). Although questions have been raised as to the accuracy of DEXA soft tissue determination (Jebb et al, 1995), for DEXA measurements can be affected by depth (Laskey et al., 1992; Mitchell et al., 1998) particularly when it comes to soft tissue measurements (Lukaski et al., 1999), these seem to be reconciled with recent changes in the analysis software prediction equations (Mitchell et al., 1998; Lukaski et al., 1999). DEXA has been shown to be very reliable and the results reproducible, with having more precision when compared to bioelectrical impedance or skinfold thickness measures of fat estimation (Bessesen and Kushner, 2002). Proximate Analysis (Chemical Composition) Hankins (1946) and Johnson et al. (1990a,b) state that the most accurate, yet time­ consuming method available to determine chemical composition of the carcass is to grind the entire carcass and perform chemical analysis on the resulting ground product. These chemical analyses include dry matter content, ash content, Kjeldahl nitrogen determination, and Goldfisch fat extraction. Unfortunately this method of determining body composition is very time-consuming and is subject to variance due to the fat content in muscle tissue 33

(Breidenstein et al., 1964) and variation in body lipid content (de Lange et al., 2001), a measure of only the sum of total carcass protein instead oflean tissue mass (Ostrowska et al., 2003), and a measure of total carcass lipid instead of fat tissue mass. Subcutaneous Backfat Measurements Subcutaneous backfat measures are standard linear measurements performed on carcasses in order to estimate composition inexpensively, rapidly and easily (Berg, 2000). In market weight pigs, these measurements traditionally consist of determining the fat depth

(including skin) over the loin at the 1oth rib, longissiumus muscle area, and last rib fat thickness (Mitchell et al., 1996; Berg, 2000). Many studies in market weight (90 to 110 kg) pigs have shown the relation of these measures to the various percentages of individual carcass composition as well as to its chemical composition (Hankins, 1946; Topel and Kauffman, 1988). Unfortunately backfat measures are the least objective, but The National Pork Producers Council (Berg, 2000) provides recommendations on how to perform these measurements, eliminating some of the bias. Gene Expression Real-time Polymerase Chain Reaction Quantitative analysis of nucleic acid sequences has led to many discoveries in the field of biology. Gene expression is of wide interest due to its important role in determining cellular function and the development of PCR assists this with the ability to analyze very small quantities of nucleic acid. Real-time PCR is a relatively new technology gaining wide popularity as a quick, relatively inexpensive, accurate and sensitive method used to quantify mRNA during each cycle of the log phase of amplification. The first real-time PCR assay to be developed was the Taqman assay. The probe, which is designed to anneal to the target sequence between the forward and reverse primers, is dually labeled with fluorogenics, having a reporter at the 5' end and a quencher at the 3' end. When intact, the reporter dye emission is absorbed by the quencher. During PCR extension, the 5 '-nuclease activity of Taq polymerase cleaves the probe causing the reporter and quencher to become separated and to release fluorescent emissions that can then be 34 measured by a detector. All of this occurs in 'real-time' and each cycle of amplification is monitored. Specific algorithms used in a computer program calculate the amount of hybridization probe degraded and generate an amplification plot. The cycle in which the amplification reaches a significant threshold above background fluorescence is called the Ct cycle and this exponential term is the end-point of real-time PCR analysis (Livak and Schmittgen, 2001). There is a direct relationship between the amount of fluorescence released and PCR product generated (Overbough et al., 2003) and the Ct value is indirectly correlated to input target mRNA levels (Winer et al., 1999). Optimum conditions for real-time PCR depend on method and equipment used, but generally follow a few basic rules. Amplicon length usually falls within the range of 80 - 400bp for it needs to be short enough for denaturing during heating so that the primers and probes can bind to their specific targets. Bustin (2000) states that the extension rate ofTaq polymerase falls between 30 and 70 bases/s. This allows for short extension times that may benefit in prevention of amplification of contaminating products. Primers should have a very similar Tm (within two degrees), bind to separate exons, be around 20 bases in length and contain about 50% GC content. They are generally used between the 50 and 200mM range according to Bustin (2000). The more template present at the beginning of a reaction, the less number of cycle required to reach the Ct. According to Gibson et al. (1996), most detectors now in use are a combination of thermal cycler, laser, and detection system that automates 5' nuclease-based detection and quantitation of nucleic acid sequences. There are many different instruments and products to choose from for performing real-time PCR. Intercalating dyes such as SYBR Green I or flurogenic dyes such as Taqman are commonly used. Intercalating dyes work by fluorescing when bound to double stranded DNA during elongation. An increase in fluorescence is seen during polymerization and a decrease in fluorescence occurs when DNA is denatured. Specificity of binding to the DNA is determined by the primers used, for no target-specific probes are needed (Bustin, 2000). According to Peters et al. (2004), problems can occur due to primer dimers or low copy numbers but techniques can be done to minimize them. 35

Fluorescent probes are more specific because they use sequence specific oligonucleotides, but carry a higher price tag than the intercalating dyes. Morrison et al. (1998) states that fluorescent probes require a specific probe for each target studied and may be difficult to design and synthesize. Taqman and SYBR green produce comparable dynamic range and sensitivity according to Schmittgen et al. (2000), but SYBR Green has the advantages of being more precise and producing a more linear decay plot while Taqman is better for multiplex assays and is more specific. The type of method used ultimately depends on specific researcher needs and availability. In order to correct or normalize for experimental variation, housekeeping genes are used (Overbough et al., 2003). These are genes that are normally expressed to maintain cell function (Warrington et al., 2000) and ideally should remain constant in all tissues, through all stages of development (Bustin, 2000). They should be unaffected by experimental treatment (Tichopad et al., 2003) as well as expressed at approximately the same level as the RNA of interest (Bustin, 2000). Recent evidence suggests that common housekeeping genes are not as stable as once thought, so studies should be done to determine the validation of the housekeeping gene as an internal control before their use (Thellin et al., 1999; Schmittgen and Zakrajsek, 2000). There are two ways to analyze the data generated from real-time PCR: absolute and relative quantitation. Absolute quantitation is more time-consuming for a standard curve must be generated in order to determine the exact template copy number. Relative quantification is used in more cases, when the absolute transcript copy number is not needed, and provides a measure of a relative change in gene expression. Lehmann and Kreipe (2001) states that since the Ct value of the target sequence is directly proportional to the absolute concentration when compared with the threshold value for reference genes, the factor by which the amount the gene has changed can be calculated. This is done in the 2"-delta delta Ct method of relative quantification by using a housekeeping gene to normalize the gene of interest. According to Winer et al. (1999), it is based on the assumption that the rate of Ct change versus that of the target copy change is identical for both the housekeeping and gene 36 of interest and that a doubling of the target will result in a one-cycle decrease in the measured Ct. There are many advantages to using real-time PCR. In order to eliminate possible contamination and amplicon carry-over, it is performed in a closed-tube system and requires no post-PCR manipulation of the sample. Relating to time management, it allows for higher sample throughput, the ability to analyze multiple genes at the same time, it may be automated, and can incorporate specialized software to assist in data analysis (Schmittgen et al., 2000). It has been shown to have reduced variation, increased accuracy, be highly reproducible, and allows for detection over a large dynamic range according to Heid et al. (1996) when compared to other PCR methods. Gibson et al. (1996) reported an intra-assay CV of <2% and interassay <3% with a minimum detection and quantification ofreportedly 400 RNA molecules. Bustin (2000) reports that the Lightcycler machine CV for Ct data has been shown to be as little as 0.4%. Problems that occur with real-time PCR are not necessarily isolated to this procedure alone. Most of the variation that can occur is related to the operator, template preparation, and project design. According to Bustin (2002), in order to better interpret results, steps to create uniformity in procedures and reporting will benefit the scientific community using this technology. As a whole, real-time PCR methods have revolutionized the biological industry in providing quick and accurate answers to many important questions. Summary/Objectives Although many factors contribute to growing epidemic of overweight and obesity, including genetics, physical activity and environment, excess energy intake has gained a lot of interest in the last few years due to questions of its altering effects on metabolism. Pantothenic acid is involved in numerous metabolic pathways and has shown evidence of altering protein and fat accretion that may make it a promising agent in the prevention or therapy of excess fat accretion. The objectives of this study were to determine the efficacy of dietary pantothenic acid on altering body fat accretion in a pig model of obesity development. This would be done through assessing body composition change over time, 37 determining the efficacy of dietary pantothenic acid additions on measures of body depot composition, and evaluating specific liver fat enzyme expressions. Literature Cited

Abu-Elheiga, L., D. B. Almarza-Ortega, A. Baldini, and S. J. Wakil. 1997. Human acetyl-coa carboxylase 2. Molecular cloning, characterization, chromosomal mapping, and evidence for two isoforms. J Biol Chem 272: 10669-10677.

Abu-Elheiga, L., L. Zhong, S.S. Chirala, G. Woldegiorgis, and SJ. Wakil. 2000. The subcellular localization of acetyl-coa carboxylase 2. Proc Natl Acad Sci US A 97: 1444-1449.

Abu-Elheiga, L., W. Oh, P. Kordari, and S. J. Wakil. 2003. Acetyl-coa carboxylase 2 mutant mice are protected against obesity and diabetes induced by high-fat/high­ carbohydrate diets. Proc Natl Acad Sci US A 100: 10207-10212.

Astrup, A., and J.P. Flatt. 1996. Metabolic determinants of body weight regulation. fu: C. Bouchard and G.A. Bray (eds.) Regulation of body weight: Biological and behavioral mechanisms. p 193-211. John Wiley and Sons, Chichester.

Autrey, B. A., T.S. Stahly and T.R. Lutz. 2002. Efficacy of dietary pantothenic acid as an economic modifier of body composition in pigs. J Anim Sci 80 (Suppl. 1): 168 (Abstr.)

Barnhart, C., D. Catron, G. Ashton, and L. Quinn. 1957. Effects of dietarypantothenic acid levels on the weanling pig. J Anim Sci 16: 396-403.

Belfrage, P., G. Fredrikson, H. Olsson, and P. Stralfors. 1983. Control of adipose tissue lipolysis by phosphorylation/dephosphorylation of hormone-sensitive lipase. fu: A. Angel, Hollenberg, C.H., and D.A.K. Roncari (ed.) The adipocyte and obesity: Cellular and molecular mechanisms. p 217-225. Raven Press, New York.

Bender, D. A. 1999. Optimum nutrition: Thiamin, biotin and pantothenate. Proc Nutr Soc 58: 427-433.

Berg, E. (ed.), 2000. Pork composition and quality assessment procedures. Natl Pork Prod Counc, Des Moines, IA.

Bessesen, D. H., and R. Kushner. 2002. Evaluation and management of obesity. Hanley and Belfus, Inc., Philadelphia. 38

Bikker, P., M. W. Verstegen, and R. G. Campbell. 1996. Performance and body composition of finishing gilts (45 to 85 kilograms) as affected by energy intake and nutrition in earlier life: Ii. Protein and lipid accretion in body components. J Anim Sci 74: 817- 826.

Boone, A. N., A. Chan, J. E. Kulpa, and R. W. Brownsey. 2000. Bimodal activation of acetyl-coa carboxylase by glutamate. J Biol Chem 275: 10819-10825.

Boullion, R. D., B. R. Wamhoff, C.R. Otis, J. Wenzel, J. L. Dixon, and M. Sturek. 2003. Porcine model of diabetic dyslipidemia: Insulin and feed algorithms for mimicking diabetes mellitus in humans. Comp Med 53: 42-52.

Bray, G. A. 1983. Obesity: What comes first. In: A. Angel, Hollenberg, C.H., and D.A.K. Roncari (eds.) The adipocyte and obesity: Cellular and molecular mechanisms. p 19- 29. Raven Press, New York.

Breidenstein, B., R. Kauffman, T. LaPlant, and H. Norton. 1964. Bilateral symmetry of the pork carcass. J Anim Sci 23: 1054-1056.

Bustin, S. A. 2000. Absolute quantification of mrna using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 25: 169-193.

Bustin, S. A. 2002. Quantification of mrna using real-time reverse transcription per (rt-per): Trends and problems. J Mol Endocrinol 29: 23-39.

Campfield, L.A., F. J. Smith, and B. Jeadnrenaud. 2004. Central integration of peripheral signals in the regulation of food intake and energy balance: Role of leptin and insulin. In: G. A. a. C. B. Bray (ed.) Handbook of obesity: Etiology and pathophysiology. p 461-481. Marcel Dekker, Inc., New York.

Clarke, S. D. 1993. Regulation of fatty acid synthase gene expression: An approach for reducing fat accumulation. J Anim Sci 71: 1957-1965.

Colby, R., T. Cunha, C. Lindley, D. Cordy, and M. Ensminger. 1948. Biotin-pantothenic acid interrelationship and enteritis in the pantothenic acid deficient pig. J AmerVet Med Assoc 113: 589-593.

Committee, S. 2002. Opinion of the scientific committee on food on the tolerable upper intake level ofpantothenic acid. SCF/CS/NUT/UPPLEV/61Final18 April 2002, European Commission - Health and Consumer Protection Directorate-General, Brussels, Belgium.

CSREES. 2004. Crees obesity white paper. Available: http://www.crees.usda.gov/nea/food/in_focus/obesity_if_whitepaper.html. Accessed Nov. 23, 2004. 39

Cupo, M., and W. Donaldson. 1986. Effect ofpantothenic acid on lipogenesis in the chick. Nutr Rep Int 33: 147-155.

de Greef, K., M. Verstegen, B. Kemp, and P. van der Togt. 1994. The effect of body weight and energy intake on the composition of deposited tissue in pigs. Anim Prod 58: 263- 270.

de Lange, C. F., S. H. Birkett, and P. C.H. Morel. 2001. Protein, fat, and bone tissue growth in swine. In: A. Lewis (ed.) Swine nutrition. CRC Press, Washington, DC.

Ding, S. T., A. Lapillonne, W. C. Heird, and H. J. Mersmann. 2003. Dietary fat has minimal effects on fatty acid metabolism transcript concentrations in pigs. J Anim Sci 81: 423- 431.

Ding, S. T., A. P. Schinckel, T. E. Weber, and H.J. Mersmann. 2000. Expression of porcine transcription factors and genes related to fatty acid metabolism in different tissues and genetic populations. J Anim Sci 78: 2127-2134.

Diraison, F., V. Yankah, D. Letexier, E. Dusserre, P. Jones, and M. Beylot. 2003. Differences in the regulation of adipose tissue and liver lipogenesis by carbohydrates in humans. J Lipid Res 44: 846-853.

Eissenstat, B. R., B. W. Wyse, and R. G. Hansen. 1986. Pantothenic acid status of adolescents. Am J Clin Nutr 44: 931-937;

Ewan, R. 2001. Energy utilization in swine nutrition. In: A. Lewis (ed.) Swine nutrition. CRC Press, Washington, DC.

F AO/WHO. 1997. Carbohydrates in human nutrition - Report of a joint F AO/WHO Expert Consultation, 14-18 April, 1997, Rome.

Fenstermacher, D. K., and R. C. Rose. 1986. Absorption ofpantothenic acid in rat and chick intestine. Am J Physiol 250: G155-160.

Fidanza, A., and M. Audisio. 1982. Vitamins and lipid metabolism. Acta Vitaminol Enzymol 4: 105-114.

Flatt, J.-P., and A. Tremblay. 2004. Energy expenditure and substrate oxidation. In: G. A. Bray and C. Bouchard (eds.) Handbook of obesity: Etiology and pathophysiology. p. 705-733. Marcel Dekker, Inc., New York.

Frayn, K. N. (ed.), 1996. Metabolic regulation: A human perspective. Frontiers in · metabolism 1. Portland Press, Ltd., London. 40

Fried, S. K., and R. R. Ross. 2004. Biology of visceral adipose tissue. In: G. A. Bray and C. Bouchard (eds.) Handbook of obesity: Etiology and pathophysiology. p. 589-615. Marcel Dekker, Inc., New York.

Frisancho, A. R. 2003. Reduced rate of fat oxidation: A metabolic pathway to obesity in the developing nations. Am J Human Biol 15: 522-532.

Gaddi, A., G.C. Descovich, G. Noseda, C. Fragiacomo, L. Colombo, A. Craveri, G. Montanari, and C.R. Sirtori. 1984. Controlled evaluation ofpantethine, a natural hypolipidemic compound, in patients with different forms of hyperlipoproteinemia. Atherosclerosis 50: 73-83.

Gaitlin, L., M.T. See, J.A. Hansen, D. Sutton, and J. Odle. 2002. The effects of dietary fat sources, levels, and feeding intervals on pork fatty acid composition. J Anim Sci 80: 1606-1615.

Garrow, J. 1999. Clinical assessment of obesity. Pagel 7 in Obesity. British Nutrition Foundation Task Force. Blackwell Science Ltd., Oxford.

Gibson, U. E., C. A. Heid, and P. M. Williams. 1996. A novel method for real time quantitative rt-per. Genome Res 6: 995-1001.

Gifford, K. D. 2002. Dietary fats, eating guides, and public policy: History, critique, and recommendations. Amer J Med 113: 89S-106S.

Hankins, 0. 1946. Estimation of the composition of beef carcasses and cuts, USDA, Washington, DC.

Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams. 1996. Real time quantitative per. Genome Res 6: 986-994.

· Hellerstein, M. K., M. Christiansen, S. Kaempfer, C. Kletke, K. Wu, J. S. Reid, K. Mulligan, N. S. Hellerstein, and C.H. Shackleton. 1991. Measurement of de novo hepatic lipogenesis in humans using stable isotopes. J Clin Invest 87: 1841-1852.

Hillgartner, F. B., and T. Charron. 1997. Arachidonate and medium-chain fatty acids inhibit transcription of the acetyl-coa carboxylase gene in hepatocytes in culture. J Lipid Res 38: 2548-2557.

Horton, T. J., H. Drougas, A. Brachey, G. W. Reed, J.C. Peters, and J. 0. Hill. 1995. Fat and carbohydrate overfeeding in humans: Different effects on energy storage. Am J Clin Nutr 62: 19-29. 41

Hsu, J.C., K. Tanaka, I. Inayama, and S. Ohtani. 1992. Effects ofpantethine on lipogenesis and co2 production in the isolated hepatocytes of the chick (gallus domesticus). Comp. Biochem Physiol Comp Physiol 102: 569-572.

Jacobi, S. K, K. M. Ajuwon, T. E. Weber, J. L. Kuske, C. J. Dyer, and M. E. Spurlock. 2004. Cloning and expression of porcine adiponectin, and its relationship to adiposity, lipogenesis and the acute phase response. J Endocrinol 182: 133-144.

Jang, I., J. Lee, K. Chae, Y. Kim, T. Kang, C. Kim, D. Shin, J. Hwang, Y. Huh, and J. Cho. 2003. Physiological difference between dietary obesity-susceptible and obesity­ resistant sprague dawley rats in response to moderate high fat diet. Exp Anim 52: 99- 107.

Jayakumar, A., W. Y. Huang, W. al-Feel, M. Hsu, L. Abu-Elheiga, S. S. Chirala, and S. S. Wakil. 1995. Human fatty acid synthase: Properties and molecular cloning. Proc Natl Acad Sci U S A 92: 8695-8699.

Jeanrenaud, B. 1979. Animal obesities. Ann Nutr Aliment 33: 27-38.

Jebb, S. A., G. R. Goldberg, G. Jennings, and M. Elia. 1995. Dual-energy x-ray absorptiometry measurements of body compositon: Effects of depth and tissue t hickness, including comparisons with direct analysis. Clin Sci 88: 319-324.

Johnson, L. P.; M. F. Miller, K. D. Haydon, and J. 0. Reagan. 1990. The prediction of percentage of fat in pork carcasses. J Anim Sci 68: 4185-4192.

Johnson, L. P., J. 0. Reagan, K. D. Haydon, and M. F. Miller. 1990. The prediction of percentage of protein in pork carcasses. J Anim Sci 68: 4176-4184.

Johnston, L., L. Vaughan, and H. M. Fox. 1981. Pantothenic acid content of human milk. Am J Clin Nutr 34: 2205-2209.

Jump, D. B., and S. D. Clarke. 1999. Regulation of gene expression by dietary fat. Annu Rev Nutr 19: 63-90.

Kelley, D. E., and L. Storlien. 2004. Skeletal muscle and obesity. In: G. A. Bray and C. Bouchard (eds.) Handbook of obesity: Etiology and pathophysiology. p 733-753. Marcel Dekker, Inc., New York.

Koo, W. W. K., M. Hammami, and E. M. Hockman. 2002. Use of fan beam dual energy x­ ray absorptiometry to measure body composition of piglets. J Nutr 132: 1380-1383.

Kopelman, P. 1999. Aetiology of obesity ii: Genetics. Page 39 in Obesity. British Nutrition Foundation Task Force. Blackwell Sciences, Ltd., Oxford. 42

Lammert, 0., P. Faber, K. S. Bjomsbo, J. Dich, L. 0. Larsen, R. A. Neese, M. K. Hellerstein, and B. Quistorff. 2000. Effects of isoenergetic overfeeding of either carbohydrate or fat in young men. Br J Nutr 84: 233-245.

Larsen, M. 0., B. Rolin, M. Wilken, R. D. Carr, and 0. Svendsen. 2002. High-fat high­ energy feeding impairs fasting glucose and increases fasting insulin levels in the gottingen minipig: Results from a pilot study. Ann NY Acad Sci 967: 414-423.

Laskey, M.A., K. D. Lyttle, M. E. Flaxman, and R. W. Barber. 1992. The influence of tissue depth and composition on the performance of the lunar dual-energy x-ray absorptiometer whole-body scanning mode. Eur J Clin Nutr 46: 39-45.

Latasa, M. J., Y. S. Moon, K. H. Kim, and H. S. Sul. 2000. Nutritional regulation of the fatty acid synthase promoter in vivo: Sterol regulatory element binding protein functions through an upstream region containing a sterol regulatory element. Proc Natl Acad Sci US A 97: 10619-10624.

Lehmann, U., and H. Kreipe. 2001. Real-time per analysis of DNA and ma extracted from formalin-fixed and paraffin-embedded biopsies. Methods 25: 409-418.

Leitch, C. A., and P. J. Jones. 1993. Measurement of human lipogenesis using deuterium incorporation. J Lipid Res 34: 157-163.

Levert, K. L., G. L. Waldrop, and J.M. Stephens. 2002. A biotin analog inhibits acetyl-coa carboxylase activity and adipogenesis. J Biol Chem 277: 16347-16350.

Liu, C. Y., A. L. Grant, K. H. Kim, and S. E. Mills. 1994. Porcine somatotropin decreases acetyl-coa carboxylase gene expression in porcine adipose tissue. Domest Anim Endocrinol 11: 125-132.

Livak, K. J., and T. D. Schmittgen. 2001. Analysis ofrelative gene expression data using real-time quantitative per and the 2(-delta delta c(t)) method. Methods 25: 402-408.

Lonergan, R. P., 3rd, J.C. Ware, R. L. Atkinson, W. C. Winter, and P. M. Suratt. 1998. Sleep apnea in obese miniature pigs. J Appl Physiol 84: 531-536.

Lukaski, H. C., M. J. Marchello, C. B. Hall, D. M. Schafer, and W. A. Siders. 1999. Soft tissue composition of pigs measured with dual x-ray absorptiometry: Comparison with chemical analyses and effects of carcass thicknesses. Nutrition 15: 697-703.

McDowell, L. 2000. Vitamins in animal and human nutrition. 2nd ed. Iowa State University Press, Ames, IA. 43

McKieman, S. H., and B. D. Bavister. 2000. Culture of one-cell hamster embryos with water soluble vitamins: Pantothenate stimulates blastocyst production. Hum Reprod 15: 157-164.

McNeel, R. L., S. T. Ding, E. 0. Smith, and H.J. Mersmann. 2000. Effect of feed restriction on adipose tissue transcript concentrations in genetically lean and obese pigs. J Anim Sci 78: 934-942.

Mildner, A. M., and S. D. Clarke. 1991. Porcine fatty acid synthase: Cloning of a complementary DNA, tissue distribution of its mma and suppression of expression by somatotropin and dietary protein. J Nutr 121: 900-907.

Misso, M. L., W. C. Boon, M. E. Jones, K. L. Britt, and E. R. Simpson. 2003. Cellular and molecular characterization of the adipose phenotype of the aromatase-deficient mouse. Endocrinology 144: 1474-1480.

Mitchell, A. D., J.M. Conway, and W. J. Potts. 1996. Body composition analysis of pigs by dual-energy x-ray absorptiometry. J Anim Sci 74: 2663-2671.

Mitchell, A. D., A. M. Scholz, V. G. Pursel, and C. M. Evock-Clover. 1998. Composition analysis of pork carcasses by dual-energy x-ray absorptiometry. J Anim Sci 76: 2104- 2114.

Moon, Y. S., M. J. Latasa, M. J. Griffin, and H. S. Sul. 2002. Suppression of fatty acid synthase promoter by polyunsaturated fatty acids. J Lipid Res 43: 691-698.

Morrison, T. B., J. J. Weis, and C. T. Wittwer. 1998. Quantification oflow-copy transcripts by continuous sybr green i monitoring during amplification. Biotechniques 24: 954- 958, 960, 962.

Moughan, P. J., M. J. Birtles, P. D. Cranwell, W. C. Smith, and M. Pedraza. 1992. The piglet as a model animal for studying aspects of digestion and absorption in milk-fed human infants. World Rev Nutr Diet 67: 40-113.

Naruta, E., and V. Buko. 2001. Hypolipidemic effect ofpantothenic acid derivatives in mice with hypothalamic obesity induced by aurothioglucose. Exp Toxicol Pathol 53: 393- 398.

Norris, L. C. and A. T. Ringrose. 1930. The occurrence of a pellagrous-like syndrome in chicks. Science 71: 463.

NRC. 1987. Vitamin tolerance of animals. National Academy Press, Washington, DC.

NRC. 1989. Recommended dietary allowances. 10th ed. National Academy Press, Washington, DC. 44

NRC. 1998. Nutrient requirements of swine. 10th ed. National Academy Press, Washington, DC.

Obrosova, I. G., M. Ostrovskii lu, V. L. Tsyruk, A. G. Moiseenok, and A. S. Efimov. 1988. Effect of phosphopantothenate on the biosynthesis of cholesterol and its esters from various precursors in the liver of db/db mice. Biokhimiia 53: 1797-1802.

Oldham, H., M. Davis, and L. Roberts. 1946. Thiamine excretions and blood levels of young women on diets containing varying levels of the b vitamins, with some observations on niacin and pantothenic acid. J Nutr 32: 163-180.

Olson, R. 1984. Pantothenic acid Nutrition reviews' present knowledge in nutrition. The Nutrition Foundation, Inc., Washington, DC.

Ostrowska, E., D. Suster, M. Muralitharan, R. F. Cross, B. J. Leury, D. E. Bauman, and F. R. Dunshea. 2003. Conjugated linoleic acid decreases fat accretion in pigs: Evaluation by dual-energy x-ray absorptiometry. Br J Nutr 89: 219-229.

Overbergh, L., A. Giulietti, D. Valckx, R. Decallonne, R. Bouillon, and C. Mathieu. 2003. The use of real-time reverse transcriptase per for the quantification of cytokine gene expression. J Biomol Tech 14: 33-43.

Owen, B., and J. Bowland. 1952. The pantothenic acid content of the blood and the milk of swine fed supplemental levels of the vitamin. J Nutr 48: 317-324.

Peters, I. R., C. R. Helps, E. J. Hall, and M. J. Day. 2004. Real-time rt-per: Considerations for efficient and sensitive assay design. J lmmunol Methods 286: 203-217.

Prentice, A. 1999a. Aetiology of obesity i: Introduction. Page 37 in Obesity. British Nutrition Foundation Task Force. Blackwell Science Ltd., Oxford.

Prentice, A. 1999b. Aetiology of obesity v: Macronutrient balance. Page 69 in Obesity. British Nutrition Foundation Task Force. Blackwell Science, Ltd., Oxford.

Prentice, A. l 999c. Aetiology of obesity iv: Metabolic factors. Page 61 in Obesity. British Nutrition Foundation Task Force. Blackwell Science, Ltd., Oxford.

Rajeevan, M. S., D. G. Ranamukhaarachchi, S. D. Vernon, and E. R. Unger. 2001. Use of real-time quantitative per to validate the results of cdna array and differential display per technologies. Methods 25: 443-451.

Ramos, E. J., Y. Xu, I. Romanova, F. Middleton, C. Chen, R. Quinn, A. lnui, U. Das, and M. M. Meguid. 2003. Is obesity an inflammatory disease? Surgery 134: 329-335. 45

Reddy, J. K., and T. Hashimoto. 2001. Peroxisomal beta-oxidation and peroxisome proliferator-activated receptor alpha: An adaptive metabolic system. Annu Rev Nutr 21: 193-230.

Reibel, D. K., B. W. Wyse, D. A. Berkich, and J. R. Neely. 1982. Coenzyme a metabolism in pantothenic acid-deficient rats. J Nutr 112: 1144-1150.

Richards, M. P., S. M. Poch, C. N. Coon, R. W. Rosenbrough, C. M. Ashwell, and J.P. McMurtry. 2003. Feed restriction significantly alters lipogenic gene expression in broiler breeder chickens. J Nutr 133: 707-715.

Robishaw, J. D., and J. R. Neely. 1985. Coenzyme a metabolism. Am J Physiol 248: El-9.

Rook, A. J., M. Ellis, C. T. Whittemore, and P. Phillips. 1987. Relationships between whole­ body chemical composition, physically dissected carcass parts and backfat measurements in pigs. Anim Prod 44: 263-273.

Salamone, L. M. T. F., Marjolein Visser, Marialice Kem, Thomas Lang, Maurice Dockrell, Jane A. Cauuley, Michael Nevitt, Francis Tylavsky, and Tim G. Lohman. 2000. Measurement of fat mass using dexa: A validation study in elderly adults. J Appl Phys 89: 345-352.

Sauberlich, H. 1987. Vitamins - how much is for keeps. Nutrition Today: 20-28.

Sauberlich, H. E. 1985. Bioavailability of vitamins. Prog Food Nutr Sci 9: 1-33.

Schinckel, A. P., and C. F. de Lange. 1996. Characterization of growth parameters needed as inputs for pig growth models. J Anim Sci 74: 2021-2036.

Schmittgen, T. D. 2001. Real-time quantitative per. Methods 25: 383-385.

Schmittgen, T. D., and B. A. Zakrajsek. 2000. Effect of experimental treatment on housekeeping gene expression: Validation by real-time, quantitative rt-per. Journal of Biochemical and Biophysical Methods 46: 69-81.

Schmittgen, T. D., B. A. Zakrajsek, A. G. Mills, V. Gorn, M. J. Singer, and M. W. Reed. 2000. Quantitative reverse transcription-polymerase chain reaction to study mma decay: Comparison of endpoint and real-time methods. Anal Biochem 285: 194-204. Scott, M., M. Nesheim, and R. Young. 1982. Nutrition of the chicken. 1st ed. M. L. Scott and Associates, Ithaca, NY.

Shadid, S., and M. D. Jensen. 2004. Nutrient partitioning. In: G. A. Bray and C. Bouchard (eds.) Handbook of obesity: Etiology and pathophysiology. p 753-767. Marcel Dekker, Inc., New York. 46

Shillabeer, G., J. Homford, J.M. Forden, N. C. Wong, and D. C. Lau. 1990. Hepatic and adipose tissue lipogenic enzyme mrna levels are suppressed by high fat diets in the rat. J Lipid Res 31: 623-631.

Slyshenkov, V. S., M. Rakowska, A.G. Moiseenok, and L. Wojtczak. 1995. Pantothenic acid and its derivatives protect ehrlich ascites tumor cells against lipid peroxidation. Free Radie Biol Med 19: 767-772.

Smith, C., C. Narrow, Z. Kendrick, and C. Steffen. 1987. The effect ofpantothenate deficiency in mice on their metabolic response to fast and exercise. Metabolism 36: 115-121.

Smith, U. 1983. Regional differences and effect of cell size on lipolysis in human adipocytes. In: A. Angel, Hollenberg, C.H., and D.A.K. Roncari (ed.) The adipocyte and obesity: Cellular and molecular mechanisms. p 245-251. Raven Press, New York.

Southern, L., and D. Baker. 1981. Bioavailable pantothenic acid in cereal grains and soybean meal. J Anim Sci 53: 403-408.

Srinivasan, V., N. Christensen, B. W. Wyse, and R. G. Hansen. 1981. Pantothenic acid nutritional status in the elderly--institutionalized and noninstitutionalized. Am J Clin Nutr 34: 1736-1742.

Stahly, T. S. 1986. Energy metabolism in pigs - a review of the tenth international symposium on energy metabolism. In: Animal Nutrition Seminar at the AGRIFAIR, Leitzig, East Germany

Stahly, T. S., N. Williams, S. Swenson, and R. Ewan. 1995. Dietary b vitamin needs of high and moderate lean growth pigs fed from 20 to 62 pounds body weight, Iowa State University, Ames, IA.

Stahly, T. S., and T. R. Lutz. 2000. Biological role ofpantothenic acid in the pig. J Anim Sci 78 (Suppl. 2).

Stahly, T. S., and T. R. Lutz. 2001. Role ofpantothenic acid as a modifier of body composition in pigs. J Anim Sci 79 (Suppl. I): 68 (Abstr. ).

Stein, E., and J. Diamond. 1989. Do dietary levels of pantothenic acid regulate its intestinal uptake in mice? J Nutr 119: 1973-1983.

Stock, M. J. 1996. Models of nutrient partitioning. In: G. A. Bray and C. Bouchard (eds.) Regulation of body weight: Biological and behavioral mechanisms. p 33-45. John Wiley and Sons, Chichester. 47

Strawford, A., F. Antelo, M. Christiansen, and M. K. Hellerstein. 2004. Adipose tissue triglyceride turnover, de novo lipogenesis, and cell proliferation in humans measured with 2h2o. Am J Physiol Endocrinol Metab 286: E577-588.

Sul, H. S., M. J. Latasa, Y. Moon, and K. H. Kim. 2000. Regulation of the fatty acid synthase promoter by insulin. J Nutr 130: 315S-320S.

Sul, H. S., and D. Wang. 1998. Nutritional and hormonal regulation of enzymes in fat synthesis: Studies of fatty acid synthase and mitochondrial glycerol-3-phosphate acyltransferase gene transcription. Annu Rev Nutr 18: 331-351.

Swindle, M. M., and A. C. Smith. 2000. Information resources on swine in biomedical research, United States Department of Agriculture: Agricultural Research Service, Beltsville.

Thellin, 0., W. Zorzi, B. Lakaye, B. DeBorman, B. Coumas, G. Hennen, T. Grisar, A. Igout, and E. Heinen. 1999. Housekeeping genes as internal standards: Use and limits. J Biotechnol 75: 291-295.

Tichopad, A., A. Didier, and M. W. Pfaffl 2003. Inhibition ofreal-time rt-per quantification due to tissue-specific contaminants. Molecular and Cellular Probes 18.

Topel, D., and R. Kauffman. 1988. Live animal and carcass composition measurement. In: NRC (ed.) Designing foods - animal product options in the marketplace. p 258-268. National Academy Press, Washington, DC.

Vernon, R. G. 1992. Control oflipogenesis and lipolysis. In: K. N. Boorman, Buttery, P.J. and D.B. Lindsay (ed.) The control of fat and lean deposition. Butterworth­ Heinemann Ltd., Oxford.

Vessby, B. 2000. Dietary fat and insulin action in humans. Br J Nutr 83 Suppl 1: 891-96.

Wakil, S. J., J. K. Stoops, and V. C. Joshi. 1983. Fatty acid synthesis and its regulation. Annu Rev Biochem 52: 537-579.

Warrington, J. A., A. Nair, M. Mahadevappa, and M. Tsyganskaya. 2000. Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes. Physiol Genomics 2: 143-147. Weimann, B. I., and D. Hermann. 1999. Studies on wound healing: Effects of calcium d­ pantothenate on the migration, proliferation and protein synthesis of human dermal fibroblasts in culture. Int J Vitam Nutr Res 69: 113-119.

West, D. B., and B. York. 1998. Dietary fat, genetic predisposition, and obesity: Lessons from animal models. Am J Clin Nutr 67: 505S-512S. 48

WHO. 1997. Obesity: Preventing and managing the global epidemic- Report ofa WHO Consultation on Obesity, 3-5 June 1997, Geneva Available: http://www.who.int/nut/documents/obesity_executive_ summary.pdf. Accessed Nov. 23, 2004.

WHO. 2003. Obesity and overweight. Available: http://www.who.int/hpr/NPH/docs/gs_ obesity.pdf. Accessed Nov. 23, 2004.

Williams, R., C. Lyman, G. Goodyear, J. Truesdail, and D. Holaday. 1933. "Pantothenic acid," a growth determinant of universal biological occurrence. J Amer Chem Soc 55: 2912-2927.

Winer, J., C. K. Jung, I. Shackel, and P. M. Williams.1999. Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal Biochem 270: 41-49.

Wittwer, C. T., S. Beck, M. Peterson, R. Davidson, D. E. Wilson, and R. G. Hansen. 1990. Mild pantothenate deficiency in rats elevates serum triglyceride and free fatty acid levels. J Nutr 120: 719-725.

Woods, S. C., R. J. Seeley, P.A. Rushing, D. D'Alessio, and P. Tso. 2003. A controlled high­ fat diet induces an obese syndrome in rats. J Nutr 133: 1081-1087.

Xydakis, A. M., C. C. Case, P.H. Jones, R. C. Hoogeeveen, M.Y. Liu, E. 0. Smith, K. W. Nelson, amd C. M. Ballantyne. 2004. Adiponectin, inflammation, and the expression of the metabolic syndrome in obese individuals: The impact ofrapid weight loss through caloric restriction. J Clin Endocrinol Metab 89: 2697-2703.

Yu, X. X., J. K. Drackley, and J. Odle. 1997. Rates of mitochondrial and peroxisomal beta­ oxidation of palmitate change during postnatal development and food deprivation in liver, kidney and heart of pigs. J Nutr 127: 1814-1821. 49

CHAPTER 3. DUAL-ENERGY X-RAY ABSORPTIOMETRY FOR DETERMINATION OF BODY COMPOSITION IN PORCINE MODEL OF OBESITY DEVELOPMENT A paper to be submitted to the Journal ofAnimal Science

C.A.Baldwin1 and T.S. Stahly1•2 Abstract The precision and accuracy of the Dual Energy X-ray Absorptiometry (DEXA) estimates of the weight and tissue (fat, lean and bone mineral) content of two body depots (carcass and internal organs) were evaluated in thirty-three heavy weight pigs (133-265 kg) serving as a model for obesity development. DEXA (Hologic, fan beam) scanning accurately estimated the carcass weight (+2%) relative to that determined by gravimetric weighing. DEXA underestimated the fat tissue contents of both the carcass and organ depots (-19 and - 26 %) and overestimated the lean tissue contents (13 and 27 %) relative to those estimated from chemical analysis of the fat and protein contents of the depots. However, DEXA precisely detected changes in carcass and organ depot weights (R2= .99, .99 respectively) and less precisely predicted changes in the depot's chemically determined fat (R2 = .95, .73) and protein content (R2= .88, .84). Specifically, for each 1 kg change in carcass and organ depot weights, DEXA predicted the changes with a 95 % confidence (2 SE of estimate) within± .008 and .026 kg, respectively. For each 1 kg change in the two depot's chemically determined fat content, DEXA predicted the changewithin ± .092 and .338 kg, respectively. Introduction Dual-energy x-ray absorptiometry (DEXA) is becoming the standard measure in humans for body composition analysis due to its non-invasiveness, rapid results, low radiation dose, and precise and accurate measurements (Ellis et al., 1994). Numerous studies have evaluated the use of this instrument for body composition measures in various stages of human development (Mazess et al., 1990; Ellis et al., 1994; Salamone et al., 2000; Sopher et

1 Department of Animal Science, 201 Kildee Hall, Iowa State University, Ames, lA 50010 2 To whom correspondence should be addressed 50 al., 2004) as well as in whole growing pigs (Mitchell et al., 1996, 2000; Lukaski et al., 1999; Koo et al., 2000) and growing and market-weight pig half-carcasses (Mitchell et al., 1998; Mitchell et al., 2000). However, the validation of the use ofDEXA for estimating the body composition of carcass and organs depots in a porcine model of obesity development has not been determined. With the growing epidemic of obesity in the world (WHO, 2003) and research focusing on preventative and therapeutic methods to alleviate the problem, there is a need to identify a suitable animal model for obesity development studies and to determine the precision and accuracy ofDEXA for measuring body composition in such a model. In heavy weight animals, body growth will consist mainly of fatty tissue accretion (Wagner et al., 1999), particularly when the caloric intake of the animal is above its body maintenance needs and a high proportion of the calories are provided by fat (West and York, 1998; Ding et al., 2003). The purpose of this study was to evaluate DEXA for determination of fat and lean tissue content oflarge body weight (133-265 kg) animals serving as a model of obesity development. The precision and accuracy ofDEXA estimates of body composition relative to those estimated from the chemically determined content of the animal tissue depots was determined. The precision and accuracy ofDEXA estimates of percentage fat and lean in predicting subcutaneous carcass fat depths and longissimus muscle area also was assessed. Materials and Methods All procedures involving animals were approved by the Iowa State University Committee on Animal Care. The precision and accuracy of the DEXA estimates of the weight and tissue (fat, lean and bone mineral) content of two body depots (carcass, internal organs) relative to actual gravimetric weights and chemically determined nutrient (fat, protein and mineral) content of these tissue depots were determined in heavy weight pigs serving as a model of obesity development. DEXA analyses were performed using a Hologic QDR-2000 (Hologic, Inc.; Waltham, MA) fan-beam scan with software version 5.73A or a Hologic Delphi W (Hologic, Inc.; Waltham, MA) with software version 11.2.1:7. No difference between the two instruments was detected in the accuracy and precision of their 51 estimates of carcass body weight in relation to gravimetrically determined weights. The chemical composition of each depot was obtained using AOAC (1990}procedures for dry matter, ash, Kjeldahl nitrogen, and ether-extractable lipid. Animals and Body Depots Thirty-two barrows derived from a single, high lean genetic strain were evaluated in an obesity development model study. Pigs at six months of age and weighing 150.5 ± 2.0 kg were individually penned and fed a dietary regimen that would result in obesity development (body fat accretion equivalent to 35kg /animal and representing 48% ofBW gain) in a 144 day feeding period. Specifically, pigs were fed twice daily caloric intakes equivalent to 1.8 times their individual caloric needs for body maintenance. Pigs representative of the range of weights existing in animals at the initiation (13 pigs, BW range 133 to 171 kg, pre-or low obesity state) and at the completion of the 144 day study (19 pigs, BW range of 185 to 266 kg, obesity development state) were evaluated. The weight and composition of two body depots were determined in each pig. The two depots consisted of the right -carcass halve and the major internal organs. The carcass consisted of the right half of the live body following longitudinal splitting along the midpoint of the vertebral column and minus the head, internal organs, lower portion (distal to the tarsal/carpal bone) of each leg, hair and blood. The internal organs consisted of two subparts: 1) the heart-lungs with surrounding thoracic fatty tissue and the liver with gallbladder and 2) the gastrointestinal tract with contents and spleen with the surrounding mesentery and omental fat tissues. Procedures for Isolation ofBody Depots Pairs of pigs from outcome groups based on body weight and days on the obesity · inducing regimen were fasted overnight and at 0700 h were transported 4 km to the Iowa State University Meat Laboratory. Within .5-3 h post-arrival, pigs were electrically stunned and killed by exsanguination. The lower portion of each leg (distal from the carpal/tarsal bone) was removed and the animal scalded at 63° C and dehaired. The following organs were isolated from the body and weighed: heart-lungs with surrounding thoracic fatty tissue, 52 liver with gallbladder, gastrointestinal tract with contents and spleen and surrounding mesentery and omental fat, head, left perirenal (leaf) fat pad, left kidney, and urethra and surrounding sheath. The remaining body component (i.e., carcass) was split longitudinally along the midpoint of the vertebral column into the right and left carcass halves. The perirenal fat pad and kidney remained attached to the right half of the carcass. Procedures for Measurement ofBody Depot Composition Components of the organ and carcass depots were chilled at 2° C for 4 and 22 h, respectively and then transported chilled .1 km to the Iowa State University Center for Designing Food to Improve Nutrition for DEXA analysis. The two organ depots and the reference tissue bar were placed in separate clear plastic containers and a maximum depth of 20 cm of tissue was maintained. The two organ depots were placed side-by-side on the scanning table for analysis and division lines were set in the program in order to differentiate each depot. Prior to each day's scanning, the DEXA unit was calibrated to manufacturer's specifications to optimize the accuracy of the estimates and to minimize baseline drift. Triplicate scans were made on each depot. The two scanned organ depots were then combined into one organ depot, chilled for 2-4 hrs, and transported .1 km back to the ISU Meats Lab where they were bagged and frozen (-20° C). The frozen organs were subsequently cut into 5 cm wide pieces and ground through a 2 mm die (Buffalo Grinder, Buffalo, NY), mixed and reground to ensure sample. One 500 g of sample was obtained from each organ depot and refrozen (-20° C) for subsequent chemical analyses in triplicate following freeze-drying according to AOAC (1990) procedures for meat samples. The organ lean tissue content was estimated from the chemical analysis by adding the amount of water determined to be associated with each unit of protein in the carcass to the organ protein content. Similarly, the organ fatty tissue content was estimated from the chemical analysis by adding the amount of water associated with adipose tissue in the carcass to the chemically determined organ fat. Carcass Depots 53

Following scanning, each chilled carcass was immediately transported back to the Iowa State University Department of Animal Science (.1 km) where it was then cut into five sections, bagged and refrozen (-20° C) for subsequent grinding (1.9 cm die), subsampling and chemical analyses as outlined above for the organ depots. The percentage ofDEXA estimated tissues and chemically analyzed nutrient content determined to be present in the right carcass half were assumed to be the same in the left carcass half. The chemically determined carcass fat tissue content was estimated from the analyzed carcass fat content on the assumption that fat tissue consisted of 94 % chemical fat and 6 % water. The chemically determined carcass lean tissue content was estimated from the analyzed carcass protein (Kjeldahl N * 6.25) and water (minus the water assumed to be associated with fat tissue) contents. The chemically determined bone mineral content in the carcass was calculated by subtracting the estimated mineral content (.85 %) in boneless pork meat (Jebb et. al., 1995) from the chemically determined mineral content of the carcass. Subcutaneous Carcass Fat Depth and Longissimus Muscle Area In each pig, the subcutaneous fat depth on each chilled carcass half was measured using a backfat ruler (to the nearest .13 cm) at three sites (first rib, last rib, and last lumbar vertebrae) along the midline of the carcasses. The left carcass halve was cut at the tenth rib and subcutaneous fat depth was measured 6.5 cm distal from the vertebrae, and the tenth rib longissimus muscle area was estimated by tracing the cross-sectional loin surface. Statistical analysis To determine the accuracy ofDEXA estimates of depot composition, the weight of tissue depots (expressed as kg I pig) as estimated by DEXA and chemical nutrient content adjusted for water content of tissues were analyzed by ANOVA techniques using the GLM procedures of SAS (2001). To evaluate the precision ofDEXA for predicting changes in body depot composition, the chemically determined nutrient content of each depot was regressed on DEXA estimated tissue content of the respective depot using the REG procedure of SAS (2001). No quadratic effect ofDEXA estimated depot weights or two-way interactions ofDEXA depot and body weight were detected, thus the linear relationships are 54 reported. To evaluate the precision ofDEXA for predicting subcutaneous fat depth and longissimus muscle area, subcutaneous fat depths and longissimus muscle area were regressed on DEXA estimated carcass fat and lean content percentages, respectively, using the REG procedure of SAS (2001). Results and Discussion Porcine Model of Obesity Development The pigs being evaluated in the current study were larger, heavier animals and contained significantly more fat tissue that those previously used in validating DEXA analysis of body composition (Mitchell et al., 1996a, 1996b, 1998, 2000; Lukaski et al., 1999; Koo et al., 2000) as was to be expected (Wagner et al., 1999). The live weights of the pigs averaged 205.2 kg (range of 132.5 to 265.5 kg). The gravimetrically determined weights of the whole, carcass (right half) and organ tissue depots were 202.9, 77.8 and 19.1 kg, respectively. The range of chemically determined fat content, expressed as a percentage of the tissue depot weight, were 3 7-4 7 % for the whole body, 29-4 7 % for the carcass and 41.6- 42 % for the organ depot. The body fat was accrued principally in the carcass (92% of total body fat) with 8 % of the body fat present in the organ depots. Accuracy ofDEXA Estimates ofBody Composition Carcass DEXA accurately predicted carcass weight relative to that determined gravimetrically (-1.4 kg or 2%, P= .57) and via chemical analysis(+ .66 kg or 1%, P= .79) (Table 1). Moisture loss during the transportation and scanning of the chilled carcass likely accounts for a portion of the lower DEXA estimated carcass weight. The unanalyzed carbohydrate content of the carcass tissue (---0.5 %) would largely account for the difference between the DEXA and chemically determined carcass weights. A high DEXA accuracy in predicting total weight has been previously reported in both light (Ellis et al., 1994 in 5-35 kg pigs; Mitchell et al., 1996a in 10-61 kg pigs) and market weight (Mitchell et al., 1998 in 10-51 kg half­ carcasses of pigs; Lukaski et al., 1999 in 52-113 kg pigs) pigs. But in 120 kg BW pigs (Mitchell et. al., 2000), DEXA was reported to underestimate carcass weights and the authors 55 indicated that the depth of the body tissues exceeded the capacity of the DEXA. Laskey et al. (1992) using a tank and known amounts of water and lard showed that DEXA estimated amounts of simulated tissues closely matched the calculated values with the exception of the lowest volumes of water where fat values were lower and fat-free values higher than the calculated. DEXA underestimated carcass fat tissue content (-19.0 %, P< .01) relative to that determined by chemical analysis and overestimated lean tissue (+13 %, P< .01). A similar underestimation of fat tissue has been reported in 90 (-16.5 %), and 120 kg (-10.8 %) whole pigs (Mitchell et. al., 2000) and in 10-51 kg half carcasses (-21. 7%; Mitchell et. al., 1998). The significant underestimation of fat tissue by DEXA has been theorized to be due in part to tissue depth. Since DEXA assumes that the composition and amount of soft tissue behind bone is similar to that in front of bone, areas with large amounts of bone and non-uniform distribution of adipose such as the truncal region of pigs could be estimated erroneously by DEXA according to Lukaski et al. (1999). Mitchell et al. (1998) investigated the DEXA estimates of truncal regions of pigs by splitting pork half-carcasses into the primal cuts of shoulder, ham, loin and side and observed significant decreases in total mass measures when compared to scale weights (5.8, 3.6, .7, and 11.1 % respectively) in all cuts but the loin. DEXA also underestimated the fat content in the loin and the side by 20.3 and 28.0% and overestimated the lean content of these regions by 11.8 and 20.4%, with the ham fat content overestimated by 7.7% (Mitchell et al., 1998). This confirmed the findings of Mitchell et al. (1996a) who observed overestimation of DEXA measures of total mass, fat and fat percent in the shoulders of 10-60 kg pigs and who indicated possible regional dependency ofDEXA measurement. Mitchell et al. (1996b) reported that growth of the total body and each body region (truncal, ham, and shoulder) of 26-87 kg pigs remains relatively constant, but regional deposition varies with increasing fat with increasing body weight. Several researchers have looked into the issue of tissue depth. Kohrt (1998) placed fat packets of known content on thigh or truncal regions of human subjects and showed that 56 updated versions ofDEXA analysis programs were able to accurately assess changes in fat mass of about 1.5 kg. Salamone et al. (2000) in another human study demonstrated that changes in fat mass through placement of lard packets (1 and 2 kg) on the legs could be identified accurately but not those placed on the truncal area. Both studies used Hologic (Waltham, MA) instruments, but different models, with the Salamone et al. (2000) study using a more current (V8.21) analysis program than the Kohrt et al. (1998) study (V5.64). A Hologic (Waltham, MA) instrument with a more current version of analysis program was used in the current study. Looking at layers of pork meat, Jebb et al. (1995) saw that at thicknesses of up to 26 cm, that DEXA significantly underestimated (6-8 %) fat compared with chemically determined quantities. But with thicknesses under 10 cm and over 26 cm, DEXA overestimated fat. DEXA also overestimated fat when tissue depths were between 10 and 20 cm (4 % over) and over 22 cm (25 % over) in a fat layer experiment reported by Laskey et al. (1992). Conversely, DEXA underestimated the amount oflean tissue by 1-2 % at depths below 20 cm and by 6 % at depths of 22 cm (Laskey et al., 1992). Overall, the precision of DEXA estimates of chemical fat with increasing depth of soft-tissue and was least precise for fat tissue and most precise for total tissue (Laskey et al., 1992). Thickness (15-28 cm) was reported, however, not to alter the accuracy ofDEXA estimates of carcass fat in pigs weighing 52-113 kg prior to slaughter (Lukaski et al., 1999). In the current study, tissue depth in the carcasses (right carcass half) was less then 24 cm. This thickness of tissue is compatible with DEXA underestimating fat tissue and overestimating lean tissue contents. Other factors that can lead to the underestimation of fat by DEXA include the contribution of fat from the yellow marrow in the bone and the brain according to Lukaski et al. (1999). In the current study, the problems described by Mitchell et al. (2000) relative to the thickness or density of bones exceeding the limits ofDEXA measurements and resulting in uncalculated areas of tissue did not occur. As seen in our study, percentage of lean content was overestimated by DEXA compared to chemical composition in pork half-carcasses from 10 to 51kg (Mitchell et al., 57

1998) with the DEXA lean mass estimates being 4.3% greater. DEXA also overestimated lean in 90kg pigs in a study by Mitchell et al. (1996b ). Our estimates of the ratio of protein to lean (.232) were in agreement with Mitchell et al. (2000) who reported for the half carcasses of 90 and 120 kg pigs combined the ratio of protein to DEXA lean being .225 ± .015, which they expected to remain nearly constant in the adult population. Organs Numerically, DEXA overestimated organ weights determined gravimetrically (+ .7 kg, 3.3%; P<. 01) and those estimated from chemically determined contents(+ 1.6 kg, 8.3%; P< .01). Accounting for the estimated unanalyzed carbohydrate content in the organ tissues as well as the carbohydrate (i.e., fiber) fraction in the undigested digesta (i.e., 1.8% ofBW with a 20 % carbohydrate content) present in the lower gastrointestinal tract would result in an additional .5 and 4.6 percentage units of chemically determined organ weight . As observed for carcass tissues, DEXA underestimated organ fat tissue content (-1.9 kg, -26 %, P< .01) relative to that determined by chemical analysis and overestimated lean tissue (3.9 kg, +27 %, P< .01). The depth of the organ depots during DEXA measurement were at most 20 cm, which as discussed above has been reported to contribute to an underestimation of fat tissue and overestimation of lean tissue. Precision ofDEXA Estimates ofBody Composition Carcass DEXA had a high precision in detecting changes in chemically determined weights of carcass (R2= .99) as well as fat (R2= .95) and protein (R2= .88) contents (Table 2). The standard error of the estimates (SEE) for DEXA predicting a unit change in chemically determined carcass weight, fat and protein content were .004, .046, .013 kg, respectively. Based on these data, for each one kg change in carcass weight, DEXA predicted the change with a 95% confidence interval (±2 SEE) within± .008kg. Similarly for each one kg change in chemically determined carcass fat and protein content, DEXA predicted the change within 58

± .092 kg and .026 kg, respectively. DEXA was substantially less precise (R2= .50) in predicting changes in carcass bone mineral content (SE.E= ± .216 kg) Organs DEXA also had a high precision in detecting changes in chemically determined organ weight (R2= .99) but was less precise in detecting changes in fat (R2= .73) and protein (R2= .84) content (Table 3). The SE of the estimates for DEXA predicting a unit change in chemically determined organ weight, fat and protein content were .013, .169, .016 kg, respectively. Based on these data, for each one kg change in organ weight, DEXA predicted the change with a 95% confidence interval (±2 SEE) within± .026 kg. Similarly for each one kg change in chemically determined organ fat and protein content, DEXA predicted the change within± .338 and .032 kg, respectively. Precision ofDEXA Estimates of Carcass Subcutaneous Fat Depth and Muscle Cross­ Sectional Area DEXA estimates of body fat and lean tissue contents (expressed as percent of body weight) related to subcutaneous carcass fat depths and longissimus muscle cross sectional area. DEXA estimates of body fat accounted for a majority of the variation in subcutaneous fat depth at the tenth rib and midline last lumbar, last rib and first rib with R2 values of. 76, .78, .63 and .61, respectively, and SE of the estimates of.158, .159, .166, and .206 mm, respectively. DEXA estimates of lean tissue content were not associated with tenth rib longissimus muscle area (R2= .003). Our results are similar to that observed by Mitchell et al. ( 1998) in 10-51 kg half pig carcasses, where a high correlation between tenth rib and average (combination of measurements at first and last ribs and last lumbar) carcass backfat depth and DEXA estimates of total and percentage carcass fat was demonstrated and the longissimus muscle area was correlated with DEXA measurements of total lean content but not with percentage of lean. In conclusion, DEXA precisely predicted changes in body depot weight and fat and lean tissue contents in large, heavy weight pigs being used in a model of obesity development. The precision was less in the internal organ depots than carcass depots. 59

Literature Cited

AOAC. 1990. Official methods of analysis. 15th Ed., Washington, DC.

Ding, S. T., A. Lapillonne, W. C. Heird, and H.J. Mersmann. 2003. Dietary fat has minimal effects on fatty acid metabolism transcript concentrations in pigs. J Anim Sci 81: 423- 431.

Ellis, K. J., R. J. Shypailo, J. A. Pratt, and W. G. Pond. 1994. Accuracy of dual-energy x-ray absorptiometry for body-composition measurements in children. Am J Clin Nutr 60: 660-665.

Jebb, S. A., G. R. Goldberg, G. Jennings, and M. Elia. 1995. Dual-energy x-ray absorptiometry measurements of body compositon: Effects of depth and tissue thickness, including comparisons with direct analysis. Clinical Science 88: 319-324.

Khort, W. M. 1998. Preliminary evidence that dexa provides an accurate assessment of body composition. J Appl Physiol 84: 372-377.

Koo, W. W. K., M. Hammami, and E. M. Hockman. 2002. Use of fan beam dual energy x­ ray absorptiometry to measure body composition of piglets. Journal of Nutrition 132: 1380-1383.

Laskey, M.A., K. D. Lyttle, M. E. Flaxman, and R. W. Barber. 1992. The influence of tissue depth and composition on the performance of the lunar dual-energy x-ray absorptiometer whole-body scanning mode. Eur J Clin Nutr 46: 39-45.

Lukaski, H. C., M. J. Marchello, C. B. Hall, D. M. Schafer, and W. A. Siders. 1999. Soft tissue composition of pigs measured with dual x-ray absorptiometry: Comparison with chemical analyses and effects of carcass thicknesses. Nutrition 15: 697-703.

Mazess, R. B., H. S. Barden, J.P. Bisek, and J. Hanson. 1990. Dual-energy x-ray absorptiometry for total-body and regional bone-mineral and soft-tissue composition. Am J Clin Nutr 51: 1106-1112.

Mitchell, A. D., J.M. Conway, and W. J. Potts. 1996a. Body composition analysis of pigs by dual-energy x-ray absorptiometry. J Anim Sci 74: 2663-2671.

Mitchell, A. D., J.M. Conway, and A. M. Scholz. 1996b. Incremental changes in total and regional body composition of growing pigs measured by dual-energy x-ray absorptiometry. Growth Dev Aging 60: 95-105.

Mitchell, A. D., A. M. Scholz, and V. G. Pursel. 2000. Dual-energy x-ray absorptiometry measurements of the body composition of pigs of90- 130-kilograms body weight. Annals New York Academy of Sciences 904: 85-93. 60

Mitchell, A. D., A. M. Scholz, V. G. Pursel, and C. M. Evock-Clover. 1998. Composition analysis of pork carcasses by dual-energy x-ray absorptiometry. J Anim Sci 76: 2104- 2114.

O'Hea, E. K., and G. A. Leveille. 1969. Influence of feeding frequency of lipogenesis and enzymatic activity of adipose tissue and on the preformance of pigs. J Anim Sci 28: 336-341.

Dockrell, Jane A. Cauuley, Michael Nevitt, Francis Tylavsky, and Tim G. Lohman. 2000. Measurement of fat mass using dexa: A validation study in elderly adults. J Appl Phys 89: 345-352.

SAS. 2001. Sas for windows (release 8.2). SAS Inst. Inc. Cary, NC: 1999-2001.

Sopher, A. B. et al. 2004. Measurement of percentage of body fat in 411 children and adolescents: A comparison of dual-energy x-ray absorptiometry with a four­ compartment model. Pediatrics 113: 1285-1290.

Wagner, J. R., A. P. Schinckel, W. Chen, J.C. Forrest, and B. L. Coe. 1999. Analysis of body composition changes of swine during growth and development. J Anim Sci 77: 1442-1466.

West, D. B., and B. York. 1998. Dietary fat, genetic predisposition, and obesity: Lessons from animal models. Am J Clin Nutr 67: 505S-512S.

WHO. 2003. Obesity and overweight. Available: http://www.who.int/hpr/NPH/docs/gs_obesity.pdf. Accessed Nov. 23, 2004. 61

Table 1. Mean Body Weights and Tissue Contents Estimated by Chemical, DEXA and Gravimetric Analyses. a Method of Anal}:'.sis, kg Body Component Chemical DEXA Gravimetric p De ot

Carcassb Weight d 75.69±3.33 76.35±3.26 77.75±3.30 .78 Fat 30.70±1.59 24.87±1.62 <.01 Lean 43.67±1.94 50.26±1.87 <.01 BMCe 1.32±0.08 1.32±0.06 .99 Organc,f Weightg 18.13±0.65 19.76±0.58 19.11±0.56 <.01 Fat 7.34±0.29 5.45±0.20 <.01 Lean 10.44±0.36 14.31±0.51 <.01 BMC 0.35±0.01 ND

Wholec,h Weighti 197.37±4.28 202.36±3.75 202.91±3.72 .02 Fat 84.29±3.21 68.42±2.83 <.01 Lean 109.57±2.93 130.80±3.15 <.01 BMC 3.50±0.16 3.15±0.09 .08 aValues are means±SEM ~=32 for carcass analyses cN=l9 for organ and whole analyses dNo difference between DEXA and gravimetrical carcass weight (P= .57) eChemical determined depot weights and fat and lean tissue contents were calculated from the chemically analyzed fat, protein, water and mineral content of the tissues. Bone mineral content (BMC) of the carcass and whole body was calculated by subtracting the ash content (.85%) of pork meat from the analyzed ash content of the carcass and whole body. fLungs-heart and associated thoracic fat and liver; gastrointestinal tract with contents and associated mesentery and omental fat and spleen gSignificant difference between DEXA and gravimetrical organ weight (P< .01) hWhole body tissue, kg= right half carcass, kg+ (right half percent of component* left half carcass, kg) + organs, kg iNo difference between DEXA and gravimetrical whole weight (P= .79) 62

Table 2. Regression of Chemically Determined Body Depot Weight and Fat and Lean Tissue Content on DEXA Determined Weights and Tissue Contents. a,e Intercept (a) Slope (b1) Body Tissue Mean SEE Probability Mean SEE Probability Depot Component Carcass6 Fat 1.59 1.27 .22 1.101 0.048 <.01 .95 Lean 0.86 0.64 .19 0.188 . 0.013 <.01 .88 BMCC 0.39 0.295 .20 1.186 0.216 <.01 .50 Total 0.57 0.31 .08 1.011 0.004 <.01 .99

Organd Fat 0.69 0.94 .47 1.143 0.1695 <.01 .73 Lean 0.23 0.24 .34 0.156 0.016 <.01 .84 Total 0.90 0.25 <.01 0.926 0.013 <.01 .99 aChemically determined tissue component, kg= a+ b1(DEXA determined tissue weight, kg) 1xight carcass half cChemical determined depot weights and fat and lean tissue contents were calculated from the chemically analyzed fat, protein, water and mineral content of the tissues. Bone mineral content (BMC) of the carcass was calculated by subtracting the ash content (.85%) of pork meat from the analyzed ash content of the carcass. dLungs-heart and associated thoracic fat and liver; gastrointestinal tract with contents and associated mesenteric and omental fat and spleen ~=32 for carcass and N= 19 for organs 63

Table 3. Regression of Subcutaneous Backfat Depth and Longissimus Muscle Area on DEXA Estimated Carcass Fat and Lean Tissue Percentage. a,b,c Intercept (a) Slope (b1) Criteria Mean SEE Probability Mean SEE Probability R2 Average subcutaneous backfat depth, mma AtMidline First Rib 9.024 6.644 .18 1.401 .206 <.01 .61 Last Rib -4.154 5.341 .44 1.177 .166 <.01 .63 Last Lumbar -16.974 5.129 <.01 1.646 .159 <.01 .78

Off-Midline (6.5cm distal to vertebrae), mm Tenth Rib -15.398 5.084 <.01 1.522 .158 <.01 .76

Longissimus muscle 7.783 2.867 .01 .012 .043 .78 .003 area, cm2 aCarcass subcutaneous backfat depth, mm= a+ b1(DEXA carcass fat,% of carcass) bCarcass longissimus muscle area, cm2 =a+ b1(DEXA carcass lean,% of carcass) cN=32 pigs dAverage of the measure taken on both carcass halves 64

CHAPTER 4. EFFICACY OF P ANTOTHENIC ACID AS A MODIFIER OF BODY COMPOSITION IN A PORCINE MODEL OF OBESITY DEVELOPMENT A paper to be submitted to the Journal ofAnimal Science

C.A.Baldwin1 and T.S. Stahly1•2 Abstract The efficacy of dietary pantothenic acid (PA) as a modifier of body composition was evaluated in a porcine model of obesity development. Pigs (17 individually penned barrows/treatment) were randomly allotted to one of four dietary regimens consisting of a basal diet (8 ppm PA) supplemented with 0, 80, 800, 8000 ppm added PA. Pigs with an initial BW and fat content of 154 kg and 27 %, respectively, were provided daily caloric intakes equivalent to 1.8 times body maintenance needs for 144 days from a dietary nutrient mix representative of the American diet (34 % of calories from fat). Pigs accrued 73 kg of BW tissue of which 48 % was body fat in the obesity development model. BW gains, BW gain/feed ratios and subcutaneous backfat depths were not altered by PA additions. Whole body fat tissue content responded quadratically to increasing PA additions. Body fat percentage was reduced by .9 percentage units by the 80 ppm added PA and increased by 1.6 and 1.1 percentage units by the 800 and 8000ppm added PA. Hepatic ACO, ACC, and FAS mRNA expression did not differ between the 0 and 8000ppm supplemented PA diets. Based on these data, PA is not an efficient modifier of body composition in a porcine model of obesity development induced by a high fat dietary regimen. Introduction The WHO (2003) states that more than one billion adults are overweight with at least 300 million of them obese. In the U.S., obesity rates have doubled among children and tripled among adolescents since 1980 (USDHHS, 2002). Obesity occurs when the balance of energy intake and energy expenditure is disrupted over a period of time leading to high adipose tissue accretion.

1 Department of Animal Science, 201 Kildee Hal~ Iowa State University, Ames, IA 50010 2 To whom correspondence should be addressed 65

Research is focusing on preventative and therapeutic methods to alleviate the problem. PA has become of interest due to research showing its ability to alter body composition in animals. Stahly et al. (2001) and Autrey et al. (2002) observed that PA additions in amounts greater than that needed to maximize BW gain resulted in linear reductions in subcutaneous carcass fat depth and increases in the carcass lean (fat-free) tissue content of growing pigs. A PA derivative also has been reported in vitro to decrease fatty acid synthesis through decreased incorporation of 1-[ l 4C] acetate into various lipid fractions and decreased ACC and FAS activities in chick hepatocytes (Hsu et al., 1984). PA derivatives also have been observed to elicit a hypolipidemic effect in an obese mouse model (Naruta and Buko, 2001). Overall, the subjects in the above studies consumed low fat, high starch diets ad libitum, thus de novo lipogenesis (DNL) would be expected to play a large role in body fat accretion. In contrast, Americans typically consume a diet that is high in fat (Morton and Guthrie, 1998), which would limit the role ofDNL relative to direct fat deposition in body fat accretion. The objective of the current study was to determine the efficacy of dietary PA as a modifier of body composition in a porcine model of obesity development induced by a high fat dietary regimen. Materials and Methods Dietary Treatments The treatments consisted of a high fat, basal diet (8 ppm PA) supplemented with four concentrations of PA (0, 80, 800 and 8000ppm) as provided by d-calcium pantothenate. The basal diet provided PA in an amount that met or exceeded the current estimated needs of pigs (NRC, 1998) and humans (NRC, 1989). These treatments were equivalent to .0025, .025, .25, and 2.5 mg/kcal of ME expended or daily intakes of .12, 1.2, 12 and 120 mg/kg BW. The basal diet was formulated to provide a calorie mix representative of that typically consumed by adults in the US (Wilkinson-Enns et al., 1997; Morton and Guthrie, 1998; Crooks, 2000) and to provide nutrient intakes that met or exceeded the animal's needs for body maintenance (150 kg BW) and expected tissue growth (NRC, 1998). The calorie 66 sources in the diet, expressed as% of total calories, were 33 % fat, 17 % protein and 9 % fiber. The proportion of the fat calories provided by saturated, monounsaturated and polyunsaturated fat was 29, 36 and 35 %, respectively. The basal diet, as shown in Table l, consisted of a mixture of com, soybean meal, soybean oil and choice white grease supplemented with crystalline amino acids, minerals, vitamins, and an antimicrobial agent. Cumulative, representative feed samples from each diet were analyzed for PA content (NP Analytical Laboratories; St. Louis, MO). The bioavailability of the PA contents of the basal diet were calculated by multiplying the analyzed PA concentration in each ingredient by the estimated bioavailability of the PA in the ingredient. The bioavailability of PA in com was estimated as 20 % (Roth-Maier et al., 1996), in soybean meal as 100 % (Southern and Baker, 1981), and in all other ingredients as 100 %. The PA content of d-calcium pantothenate was 92 % with an assumed bioavailabilty of 100 %. Throughout the study a single source of each ingredient was used to eliminate variation in dietary nutrient content. Amino acid content relative to lysine was equivalent to a minimum of l 00 % of the ideal amino acid ratio (NRC, 1998). Water-soluble vitamins were fed at ten times NRC (1998) requirements and fat­ soluble vitamins at six times NRC (1998) estimated needs of pigs to minimize the possibility that another vitamin was limiting the ability of the animal to respond to the test nutrient. Animals All procedures involving animals were approved by the Iowa State University Committee on Animal Care. Pigs (barrows) from a high lean strain were randomly allotted from outcome groups based on BW and date on test (block) to one of the four dietary treatments. Pigs (17 pigs/treatment) were individually penned in an environmentally regulated facility. Pigs were provided daily dietary caloric intakes equivalent to 1.8 times their estimated body maintenance (110 kcal ME/ BW kg .75/ day) needs based on the weekly mean BW of each animal. Their daily feed allocation was divided equally into a 0700 and 1600 hr feeding. Pigs were allowed ad libitum access to water and their daily feed allocation. Any wasted or unconsumed feed was collected weekly, weighed and subtracted from their allocated amounts to determine actual feed consumption. Pigs were adjusted to the basal diet 67 and feeding regimen for a minimum of 17 days before being placed on placed on their respective experimental diets at a BW of 155.7 ± .78kg. Body Composition Determination Pigs received their experimental diets for 144 ± 1 d. Pigs were then transported 4 km to the ISU Meats lab, killed, and individual body components were isolated and the composition of body depots determined as outlined by Baldwin and Stahly (2004). Briefly, the weight and tissue content of two major body depots (carcass and major internal organs with associated fat depots) were determined. The carcass consisted of the right body half (split longitudinally along the midpoint of the vertebrael column) with attached perirenal fat pad and kidney minus the head, internal organs, lower portion (distal to the tarsal/carpal bone) of each leg, hair and blood. The internal organ depot consisted of two sub-depots: 1) heart-lungs with surrounding thoracic fat tissue and liver and 2) gastrointestinal tract with contents and surrounding mesentery and omental fat tissue. The composition (fat, lean and bone mineral content) of each depot was determined by Dual-Energy X-Ray Absorptiometry (DEXA) analysis (Hologic, fan beam scan). Triplicate scans were performed on each depot. The DEXA analysis preformed was determined by the authors to precisely estimate changes in the weight and tissue (fat, lean) content of the body depots (Baldwin and Stahly, 2004). Subcutaneous carcass backfat depths also were determined at 3 sites (first rib, last rib, last lumbar vertebrae) along the midline of both carcass sides and at one site off-midline (6.5 cm distal to the vertebrae) at the tenth rib on the left carcass side. Weights of individual organs and the perirenal fat pad also were obtained. Liver - RNA Isolation and First-Strand cDNA Synthesis Livers from pigs receiving 0 and 8,000 ppm supplemental PA in each of six replications were sampled following exsanguination and scalding and stored at -80 C. RNA was isolated from 50 mg ofliver tissue using the Ambion RNAqueous kit (Ambion; Austin, TX). The RNA was then reverse transcribed in a 20 ul reaction containing 200 units of SSIII (lnvitrogen Life Technologies; Carlsbad, CA) according to manufacturer's recommendations. Synthesis time was 50 min at 50°C. The cDNA was purified by a 20-min 68 incubation at 3 7 °C with E. coli RNAse H and stored at -80°C until analyzed by real-time PCR. Real-time PCR In order to measure specific RNA levels, quantitative PCR was performed using the MyiQ™ Single Color Real-Time PCR Detection System (Bio-Rad Laboratories; Hercules, CA). The resulting cDNA was used for each reaction. Primer oligonucleotides (Table 2) were designed using the "PrimerQuest" software available from Integrated DNA Technologies, Inc. (Coralville, IA)(Rozen and Skaletsky, 1998). Reactions were performed using 12.5 ul of 2X SYBR Green Supermix, 200-450 nM of each primer, and 100 ng of the above-described cDNA reaction for a final volume of25 ul. The thermal-cycling conditions were: 3 min at 95°C and then 41 cycles of 30 s at 95°C followed by 30 s ~t 60°C. All samples were then subjected to a melt curve in which they were slowly heated at 1°C/30 s from 60°C to 95°C. Gene expression was presented using the z-MCt method (Livak and Schmittgen, 2001). All results were measured against the internal control 60S ribosomal RNA (RPL35). PCR products from each set of primers were sequenced for confirmation of identity. Initial Body Composition Determination For determination of initial pig composition, thirteen pgs were randomly selected from outcome groups based on BW and date on test (block). The pigs were killed and the weight and composition of the body depots were determined using the same procedures as outlined above. Based on the relationship ofBW and DEXA estimated depot weights and tissue contents in pigs killed at the initiation of the study as determined through the REG procedure of SAS (2001), the initial body depot weights and tissue contents were estimated for pigs at the time they were placed on the experimental diets {Table 3). Statistical Analysis Data were analyzed as a randomized complete block design by variance techniques using the GLM procedures of SAS (2001). The pig was considered the experimental unit. 69

Orthogonal linear, quadratic and cubic contrasts for exponential treatment increments were determined. LSMeans are reported. Results and Discussion Dietary Regimens In the basal diet (0 added PA), PA was provided in amounts that met the estimated PA needs for optimal body growth of pigs and humans, when expressed per unit of estimated energy expenditure (.0018mg/kcal energy expended). The second diet (80 ppm added PA) provided PA in amounts per unit of estimated body energy expenditure that have been shown to effectively reduce body fat accretion (i.e., carcass and abdominal fat) and increase body lean accretion in growing pigs consuming a high starch diet ad libitum (Stahly and Lutz, 2000; Stahly and Lutz, 2001; Autrey et. al., 2003). No toxicity dose for PA has been established (NRC, 1987; Committee, 2002), because of the minimal occurrence of unfavorable biological responses to high PA intakes. Humans fed as much as 1Og of calcium pantothenate per day have not expressed symptoms of toxicity, but some studies report that daily doses of 10 to 20 g may cause occasional diarrhea and water retention (NRC, 1989). The fourth diet (8000 ppm added PA) provided P N kcal of energy expenditure at levels equivalent to only 37 to 75 % of these intakes. No toxicity symptoms were observed in animals in the current study. The analyzed added PA for each experimental diet were (0, 72.5, 810.8, and 8375.8 mg/kg of feed) representing the 10, 100 and 1000 fold changes of the calculated PA additions of 0, 80, 800 and 8000 ppm. The basal diet consisted of a calorie mix representative of that typically consumed by adults in the US (Wilkinson-Enns et al., 1997; Morton and Guthrie, 1998; Crooks, 2000.) The calorie sources in the diet, expressed as% of total calories, were 33% fat, 17% protein and 9% fiber. The proportion of the fat calories provided by saturated, monounsaturated and polyunsaturated fat was 29, 36 and 35 %, respectively. The recommended percent of fat calories for human consumption is 30% with no more than 10% of that fat being saturated and a fat ratio of saturated/monounsaturated/polyunsaturated of 113: 1/3: 1/3 (Crooks, 2000), however Americans typically consume about 33-34% of their dietary calories as fat (Morton 70 and Guthrie, 1998) with 11 % of these being saturated and 16-17% of calories coming from protein (Wilkinson-Enns et al., 1997). Ingestion of high fat diets in amounts greater than the individual's metabolic needs for body maintenance is associated with development of body obesity (Vessby, 2000), increased in the proportion of dietary fat calories that are directly deposited in the body (Horton et al., 1995), and decreased de novo lipogenesis (Horton et al., 1995; Brunengraber et al., 2003). Model of Obesity Development A state of obesity development occurred over the duration of the study. Animals accrued 72.85 kg BW consisting of 67.49 kg of carcass and 5 .36 kg of organ tissues (Table 4). Total body fat accretion was 34.88 kg and represented 48 % of the accrued body weight as shown in Table 4. Of the accrued body fat, 32.3 kg or 93 % was deposited in the whole carcass depot and 2.58 kg or 7 % were accrued in the organ depot. Although the proportion ofBW gain accrued as fat was 48 % compared with 27 % prior to the initiation of the study, the proportional distribution of body fat among the carcass and organ depots remained the same. Dietary PA Effects BW Gain and Feed Consumption Pig BW at the initiation and completion of the study were similar among treatment groups. Daily net feed consumption and BW gains also did not differ among dietary PA groups (Table 5). A similar lack of change in BW gain due to PA additions has been observed in growing pigs consuming high starch diets ad libitum (Stahly and Lutz, 2001; Autrey et. al., 2003). Net intake of ME averaged 1.69 times daily body maintenance needs over the duration of the study, which was close to our estimated goal of 1.8. Carcass and Offal Component weights and Subcutaneous Carcass Fat Depth Cold carcass weights did not differ among PA treatment groups (Table 6). Gastrointestinal tract, left kidney, and trim weights increased linearly as dietary PA additions increased. Weights of the remaining offal components (leaf fat, liver, lung-heart, head) were not altered by dietary PA regimen. Subcutaneous carcass fat depth at four points along the back (first 71 rib, tenth rib, last rib, last lumbar vertebrae) was not altered by PA addition (Table 7), but longissimus muscle area at the tenth rib decreased quadratically as PA additions increased. DEXA Body Composition Carcass fat tissue content, expressed as kg of tissue (P= .10) or % of carcass weight (P= .14), responded quadratically as dietary PA additions increased (Table 8). Carcass fat was lowered by .9 percentage units with the incremental addition of 80 ppm PA and increased by 1.8 and 1.0 percentage units by the additions of 800 and 8000 ppm PA. Organ fat tissue as well as total organ weights increased quadratically (P< .03) as PA additions increased (Table 9). Organ fat content, expressed as a % of organ weight, was numerically lowered by .6 percentage units with the 80 ppm Pa addition and increased by .7 and 2.7 percentage units by the 800 and 8000 ppm PA additions. These shifts in organ fat content were largely due to changes in the fat content of the gastrointestinal tract depot and less from the heart-lung-liver depot. Whole body fat tissue increased quadratically (P< .09) as dietary PA additions increased (Table 10). Whole body fat percentages were shifted by-.8, +1.6 and + 1.1 percentage units with the addition of 80, 800 and 8000 ppm PA, respectively. Expressed per unit of body energy expenditure, the 80 ppm PA addition in the current study provides about same amount of PA (.025 mg PA/kcal expended energy) as a 45 ppm PA addition in growing pigs consuming a high starch diet ad libitum (Autrey, et. al., 2003). This represents about a ten-fold increase in PA/kcal energy expenditure compared with the animals receiving the basal diets in both studies. In the current obesity development study, body fat tissue contents were reduced by a smaller magnitude and less consistently with this ten fold increase in PA than that observed in pigs with a high capability for de novo fat synthesis through high carbohydrate feeding (Autrey, et. al., 21003; Stahly and Lutz, 2001). The lower response in the current study is hypothesized to be due in part to a low rate of de novo fat synthesis (DNL) occurring relative to direct deposition of ingested fat (Horton et al., 1995; Brunengraber et al., 2003). 72

Liver Enzyme Gene Expression Enzyme activity and mRNA abundance are generally closely related as shown for ACC by Liu et al. (1994). Gene expression of ACC, the rate-limiting enzyme in fatty acid synthesis, and ACO, the rate-limiting enzyme in peroxisomal oxidation of fat, did not differ between the 0 and 8000 ppm PA addition groups (Figures 1and2). Gene expression of FAS, a rate-limiting enzyme in fatty acid synthesis, also was not altered by PA additions (Figure 3). A PA derivative has been reported to decrease the activities of ACC and FAS in vitro in chick hepatocytes (Hsu et al., 1992). However, a PA deficiency in the chick associated with a reduction in overall deposition of lipid did not alter hepatic ACC or FAS activity (Cupo and Donaldson, 1986). In the current study, the opportunity for PA addition to modify gene expression'of these enzymes may have been limited due to the high fat diets that were fed. Because high fat diets were being fed, a high proportion of the fat consumed would be expected to be directly deposited within the animal (Horton et al., 1995). High fat diets, relative to high carbohydrate diets, have been demonstrated to result in only one-third of the DNL contribution to lipid accretion in whole mice (Brunengraber et al., 2003) as well in human livers (Lammert et al., 2000). Moderately high fat diets, and in particular those with the highest amounts of saturated fatty acids, also have been reported in lean strains of pigs to lower lipogenesis in adipose tissue (Smith et. al., 1996) and mRNA for a transcription factor (ADD) regulating fatty acid synthesis and adipocyte differentiation in the liver (Ding et al., 2003). Feeding of polyunsaturated fatty acids (PUFA) has been shown to suppress hepatic DNL in rodents through the suppression of ACC mRNA expression (Jump and Clarke, 1999) as well as to inhibit ACC and FAS transcription (Hillgartner and Charron, 1997; Clarke, 1993; Jump and Clarke, 1999; Moon et al., 2002). In a porcine model of obesity, the liver may not contribute much to fat accretion through DNL as in humans (Diraison et al., 2003). Concentrations of ACC and FAS mRNA in pigs consuming high starch diets ad libitum has been reported to be lower in liver as compared with adipose tissue (Liu et al. 1994; Ding et al., 2000), implicating adipose tissue 73 in such dietary regimens as being the major site ofDNL (O'Hea and Leveille, 1969). Concentration of ACO mRNA in the pig has been reported to be similar between liver and adipose tissues, while low in the muscle (Ding et al., 2000). The method by which PA exerts its lipid-mediating action has not been delineated, although several theories are in place. Naruta and Buko (2001) suggest that PA derivatives reduced resistance to insulin and activation of lipolyis in serum and adipose. This is supported by Gaddi et al. (1984) who demonstrated a PA derivative to reduce plasma triglyceride in two human hyperlipoproteinemmia types. Gaddi et al. (1984) suggested that the liver is the likely site of action through the regulation of sterol biosynthesis, with the PA derivative decreasing the acetyl-CoA going to the sterol form and increasing it going to mitochondrial oxidation and respiratory pathways. The importance of PA in CoA is also demonstrated by a study done by Wittwer et al. (1990) were PA-deficient rats that had elevated triglycerides and free fatty acids also had decreased levels of CoA. They suggest the mechanism to be that of PA coenzymes becoming limiting in an enzyme-catalyzed pathway resulting in increased circulating lipids. Further investigations using scenarios where de novo lipogenesis may contribute to adipose tissue gain may help to solve the mechanism of PA alteration of tissue accretion. In conclusion, a porcine model of obesity development was effectively created by feeding a high dietary fat regimen at 1.8 .times body maintenance needs. Dietary PA additions in this model resulted in quadratic responses in fat tissue content in carcass and organ depots but did not affect hepatic fat metabolism enzyme gene expression. A ten fold increase in PA intake above that needed to maximize BW gain resulted in small reductions in body fat content; whereas, 100 and 1000 fold increases in PA intake resulted in increases in body (carcass and organ depots) fat content. Literature Cited

Autrey, B. A., T. S. Stahly, and T. R. Lutz. 2002. Efficacy of dietary pantothenic acid as an economic modifier of body composition in pigs. J Anim Sci 80 (Suppl. 1): 168 (Abstr.) 74

Baldwin, C. A. and T. S. Stahly. 2004. Dual-energy x-ray absorptiometry for determination of body composition in a porcine model of obesity development. J Anim Sci Forthcoming.

Brunengraber, D. Z., B. J. McCabe, T. Kasumov, J.C. Alexander, V. Chandramouli, and S. F. Previs. 2003. Influence of diet on the modeling of adipose tissue triglycerides during growth. Am J Physiol Endocrinol Metab 285: E917-925.

Clarke, S. D. 1993. Regulation of fatty acid synthase gene expression: An approach for reducing fat accumulation. J Anim Sci 71: 1957-1965.

Committee. 2002. Opinion of the scientific committee on food on the tolerable upper intake level ofpantothenic acid. SCF/CS/NUT/UPPLEV/61 Final18 April 2002, European Commission - Health and Consumer Protection Directorate-General, Brussels, Belgium.

Crooks, D. L. 2000. Food consumption, activity, and overweight among elementary school children in an appalachian kentucky community. American Journal of Physical Anthropology 112: 159-170.

Cupo, M., and W. Donaldson. 1986. Effect ofpantothenic acid on lipogenesis in the chick. Nutr Rep Int 33: 147-155.

Ding, S. T., A. Lapillonne, W. C. Heird, and H.J. Mersmann. 2003. Dietary fat has minimal effects on fatty acid metabolism transcript concentrations in pigs. J Anim Sci 81: 423- 431.

Ding, S. T., A. P. Schinckel, T. E. Weber, and H.J. Mersmann. 2000. Expression of porcine transcription factors and genes related to fatty acid metabolism in different tissues and genetic populations. J Anim Sci 78: 2127-2134.

Diraison, F., V. Yankah, D. Letexier, E. Dusserre, P. Jones, and M. Beylot. 2003. Differences in the regulation of adipose tissue and liver lipogenesis by carbohydrates in humans. J Lipid Res 44: 846-853.

Gaddi, A., G. C. Descovich, G. Noseda, C. Frajiacomo, L. Colombo, A. Craveri, G. Montanari, and C. R. Sirtori. 1984. Controlled evaluation of pantethine, a natural hypolipidemic compound, in patients with different forms ofhyperlipoproteinemia. Atherosclerosis 50: 73-83.

Hillgartner, F. B., and T. Charron. 1997. Arachidonate and medium-chain fatty acids inhibit transcription of the acetyl-coa carbo:Xylase gene in hepatocytes in culture. J Lipid Res 38: 2548-2557. 75

Horton, T. J., H. Drougas, A. Brackey, G. W. Reed, J.C. Peters, and J. 0. Hill. 1995. Fat and carbohydrate overfeeding in humans: Different effects on energy storage. Am J Clin Nutr 62: 19-29.

Hsu, J.C., K. Tanaka, I. Inayama, and S. Ohtani. 1992. Effects ofpantethine on lipogenesis and co2 production in the isolated hepatocytes of the chick (gallus domesticus). Comp Biochem Physiol Comp Physiol 102: 569-572.

Jump, D. B., and S. D. Clarke. 1999. Regulation of gene expression by dietary fat. Annu Rev Nutr 19: 63-90.

Lammert, 0., N. Grunnet, P. Faber, K. S. Bjornsbo, J. Dich, L. 0. Larsen, R. A. Nesse, M. K. Hellerstein, and B. Quistorff. 2000. Effects of isoenergetic overfeeding of either carbohydrate or fat in young men. Br J Nutr 84: 233-245.

Liu, C. Y., A. L. Grant, K. H. Kim, and S. E. Mills. 1994. Porcine somatotropin decreases acetyl-coa carboxylase gene expression in porcine adipose tissue. Domest Anim Endocrinol 11: 125-132.

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative per and the 2(-delta delta c(t)) method. Methods 25: 402-408.

Moon, Y. S., M. J. Latasa, M. J. Griffin, and H. S. Sul. 2002. Suppression of fatty acid synthase promoter by polyunsaturated fatty acids. J Lipid Res 43: 691-698.

Morton, J. F. and J. F. Guthrie. 1998. Changes in children's total fat intakes and their food group sources of fat, 1989-91 versus 1994-95: Implications for diet quality. Family Economics and Nutrition Review 11: 44-57.

Naruta, E., and V. Buko. 2001. Hypolipidemic effect ofpantothenic acid derivatives in mice with hypothalamic obesity induced by aurothioglucose. Exp Toxicol Pathol 53: 393- 398.

NRC. 1987. Vitamin tolerance of animals. National Academy Press, Washington, DC.

NRC. 1989. Recommended dietary allowances. 10th ed. National Academy Press, Washington, DC.

NRC. 1998. Nutrient requirements of swine. 10th ed. National Academy Press, Washington, DC.

O'Hea, E. K., and G. A. Leveille. 1969. Influence of feeding frequency oflipogenesis and enzymatic activity of adipose tissue and on the preformance of pigs. J Anim Sci 28: 336-341. 76

Roth-Maier, D. A., and M. Kirchgessner. 1996. [pre-cecal digestibility of natural thiamine, riboflavin and natural pantothenic acid in the swine animal model]. Z Emahrungswiss 35: 318-322.

Rozen, S. and H.J. S Skaletsky. 1996,1997,1998. Primer3 No. 2004. Whitehead Institute for Biomedical Research.

Smith, D.R., D. A. Knabe, and S. B. Smith. 1996. Depression oflipogenesis in swine adipose tissue by specific dietary fatty acids. J Anim Sci 74: 975-983.

Southern, L., and D. Baker. 1981. Bioavailable pantothenic acid in cereal grains and soybean meal. J Anim Sci 53: 403-408.

Stahly, T. S. a. T. R. L. 2000. Biological role ofpantothenic acid in the pig. J Anim Sci 78(Suppl. 2): (Abst.)

Stahly, T. S. a. T. R. L. 2001. Role ofpantothenic acid as a modifier ofbody composition in pigs. J Anim Sci 79 (Suppl.l): 68 (Abstr.)

USDHHS. 2002. Prevalence of overweight and obesity among children and adolescents: United states, 1999-2000.

Vessby, B. 2000. Dietary fat and insulin action in humans. Br J Nutr 83 Suppl 1: S91-96.

WHO. 2003. Obesity and overweight. Available: http://www.who.int/hpr/NPH/docs/gs_obesity.pdf. Accessed Nov. 23, 2004.

Wilkinson-Enns, C., J.D. Goldman, and A. Cook. 1997. Trends in food and nutrient intakes by adults: NFCS 1977-78, CSFII 1989-91, and CSFII 1993-95. Family Economics and Nutrition Review 10: 2-15.

Wittwer, C. T., S. Beck, M. Peterson, R. Davidson, D. E. Wilson, and R. G. Hansen. 1990. Mild pantothenate deficiency in rats elevates serum triglyceride and free fatty acid levels. J Nutr 120: 719-725. 77 Table 1. Basal diet compositiona,b Ingredient Amount,% Com, ground 60.41 Soybean meal, dehulled 21.95 Choice white grease 7.61 Corn oil 5.08 L-Threonine 0.02 Calcium Carbonate 0.97 Dicalcium Phosphate 1.44 Salt, iodized 0.45 Trace mineral mixc 0.15 Vitamin mixd 0.68 Antibiotic mixe 0.06 Pantothenic acid mixf 1.17 aDietary amino acid concentrations relative to lysine met or exceeded 100% of the ideal amino acid ratio for l 50kg gilts during gestation (NRC, 1998). bProvided 3840 kcal of ME/kg of diet. cProvided per kg of diet: Fe, 210mg; Zn, 180mg; Mn, 72mg; Cu, 21mg; I, .24mg; Se, .18mg. dProvided per kg of diet: biotin, 2mg; niacin, 1OOmg; pantothenic acid, Omg; riboflavin, 37.5mg; folic acid, 13mg; pyridoxine, lOmg; thiamin, lOmg; vitamin B 12, 150mg; choline chloride, 2.5g; vitamin E, 264 IU; vitamin A, 24,000 IU; vitamin D3, 1200 IU; menadione, 3mg. econtributed 88ppm tylosin fConsist of a Solka Floe, calcium carbonate and d-calcium pantothenate mix. D-calcium pantothenate was added at the expense of calcium carbonate (isocalcium levels) and Solka floe. 1 . Table 2. P · d fc - - Gene Forward Reverse ACC TGATCAAGGTCAGCTGGTCCACAT TGCTCCACTGTTGGCAGCTACATA ACO TCGCAGACCCAGATGAAATCCTGT TCCAAGCCTCGAAGATGAGTTCCA FAS TGTGGATGATGCTGAGGATGGACT CAAGGTCTCGGTGCACGTCAT 60S Ribosomal protein L35 AACCAGACCCAGAAAGAGAAC TTCCGCTGCTGCTTCTTG

-J 00 79 Table 3. Eguations for Eredicting initial body com2osition of Eigs. ae Interce2t {a) Slo2e (bi) Body Tissue Mean, SEE, Probability Mean, SEE, Probability R2 De2ot ComEonent kg kg kg kg Carcass6 Fat -.392 6.809 .96 .104 .044 .04 .33 Lean -9.861 6.492 .16 .321 .042 .01 .84 BMC -.411 .356 .27 .009 .002 .01 .58 Total -.011 .004 .02 .001 .001 .01 .97

Organc Fat -2.041 2.819 .50 .032 .019 .16 .36 Lean 14.427 5.707 .05 -.017 .038 .67 .04 BMC Total 12.385 5.384 .07 .015 .036 .70 .03

Who led Fat 26.044 .71 .293 .174 .15 .36 10.349 Lean -6.178 25.116 .75 .646 .168 .01 .82 BMC .349 .962 .73 .010 .006 .18 .33 Total 4.718 .02 .949 .032 .01 .99 16.180 aTissue component, kg= a+ b 1( pig body weight, kg) bRight carcass half cLungs-heart and liver and associated thoracic fat, and gastrointestinal tract with spleen and associated mesenteric and omental fat dWhole body= right carcass half, kg + (percentage of component in right carcass half* left carcass half weight, kg) + organs. kg eEquations based off on 13 pigs for carcass and 7 pigs for organ and whole body components Table 4. Pig tissue accretion by body depot. a

Tissue ComQ_on~ntW ~ghtLkg __ Accrued Tissue, kg Accrued Tissue Body Depot Tissue Initial° Final Mean SE % of Depot Accrued ComQonent ______Weight

Carcassd Fat 15.63 31.89 16.26 .65 47 Lean 39.56 57.26 17.70 .64 51 BMC 0.99 1.55 0.56 .02 2 Total 56.18 90.64 34.46 .71

Organe Fat 2.83 5.41 2.58 .11 48 Lean 11.80 14.57 2.77 .28 52 BMC 0 0 0 0 0 Total 14.62 19.98 5.36 .30 00 Whole Bodyc 0 Fat 34.86 69.74 34.88 1.34 48 Lean 93.36 130.12 36. 76 1.39 50 BMC 1.92 3.13 1.21 .05 2 Total 130.14 202.99 72.85 1.54 aLSMeans values reported for all 54 pigs used in the study regardless of dietary treatment. bPredicted from relationship ofDEXA estimated tissue.weight to body weight as shown in Table? cWhole body= right carcass half, kg+ (percentage of component in right carcass half* left carcass half weight, kg)+ organs, kg dRight carcass half eLungs-heart and liver and associated thoracic fat, and gastrointestinal tract with spleen and associated mesenteric and omental fat Table 5. Effect of dietary pantothenic acid additions on feed intake, body weight gain, and efficiency of feed utilization of pigs. a Added pantothenic acid, ppm P= Criteria 0 80 800 8000 SEM DL 6 DQ 6 Pig Weight, kg Initial 153.2 153.0 154.7 153.4 .42 .99 .12 Final 233.2 241.0 242.5 241.4 1.79 .47 .19 Growth and Feed Utilization (DO to 144) MEi/ MEm c 1.68 1.68 1.72 1.68 .014 .74 .23

Feed, kg/d 2.50 2.52 2.61 2.53 .028 .95 .17

BW Gain, .56 .61 .61 .61 .012 .45 .29 kg/d Gain/Feed .221 .242 .234 .241 .003 .18 .55 aLSMeans reported. Values of 14, 13, 14, 13 pigs for the four treatment groups, respectively. bLinear (L) and Quadratic (Q) response to dietary (D) pantothenic acid additions. 00 cME intake, kcal/d divided by ME required for body maintenance (1 lOkcal ME/ BW, kg ·75/d). - 82 Table 6. Effect of dietary pantothenic acid additions on body carcass and offal component weights of pigs. a Added pantothenic acid, ppm P= Criteria 0 80 800 8000 SEM DL6 DQ 6

Carcass Weight, kg Left Cold 87.30 88.92 88.82 88.27 .68 .99 .61 Right Cold 89.59 91.65 92.78 92.11 .75 .58 .22 Total 176.90 180.57 181.60 180.39 1.39 .77 .37

Offal Component Weight, kg Liver 2.18 2.18 2.22 2.30 .03 .13 .67 Lung-heart 2.28 2.47 2.38 2.31 .04 .50 .75 GITracf 13.18 14.62 15.20 15.53 .22 .02 .02 Left leaf fat 3.52 3.75. 3.82 3.95 .10 .24 .45 Left kidney .21 .20 .21 .22 .003 .04 .79 Head 12.79 12.44 12.73 12.92 .13 .39 .85 Otherd 2.37 2.93 2.86 3.08 .09 .07 .32 aLSMeans reported. Values of 14, 13, 14, 13 pigs for the four treatment groups, respectively. bLinear (L) and Quadratic (Q) response to dietary (D) pantothenic acid additions. cGastrointestinal tract with contents and associated mesentery and omental fat and spleen. dReproductive tract and trimmed carcass tissues. 83 Table 7. Effect of dietary pantothenic acid additions on subcutaneous backfat depths and longissimus muscle area of pigs. a Added pantothenic acid, ppm P= Criteria 0 80 800 8000 SEM DL 6 DQ 6 Subcutaneous backfat depth, mm At Midline First Rib 56.2 58.2 61.0 59.5 1.1 .62 .18 Last Rib 38.6 34.4 35.5 37.4 .9 .58 .51 Last Lumbar 42.7 39.3 43.7 42.1 .9 .87 .29

Off-Midline (6.5cm distal to vertebrae), mm TenthRib 37.9 35.5 40.2 38.7 1.1 .65 .23

Longissimus muscle 65.0 61.2 56.0 58.7 1.1 .33 .01 area, cm2 aLSMeans reported. Values of 14, 13, 14, 13 pigs for the four treatment groups, respectively. bLinear (L) and Quadratic (Q) response to dietary (D) pantothenic acid additions. 84 Table 8. Effect of dietary pantothenic acid additions on DEXA estimated carcass tissue content. a Added Eantothenic acid, EEm P= Criteria 0 80 800 800 SEM DL 6 DQ& Carcass Tissue, kg Fat 30.86 30.87 33.48 32.68 .61 .42 .10 Lean 56.09 57.71 56.11 56.48 .61 .88 .66 BMCC 1.54 1.56 1.57 1.53 .02 .65 .71 Total 88.27 90.15 91.16 90.67 .73 .57 .26

Carcass Tissue,% Total Carcass Tissue Weight Fat 35.02 34.13 36.77 35.98 .56 .52 .14 Lean 63.47 64.13 61.50 62.35 .55 .50 .11 BMCC 1.75 1.73 1.72 1.69 .03 .46 .84 aLSMeans reported. Values of 14, 13, 14, 13 pigs for the four treatment groups, respectively. bLinear (L) and Quadratic (Q) response to dietary (D) pantothenic acid additions. cBone mineral content. Table 9. Effect of dietary PA additions on DEXA estimated organ tissue content. a Added Eantothenic acid, EEm P= Criteria 0 80 800 8000 SEM DL 6 DQ6 Total Organ Tissue, kg c Fat 4.80 5.17 5.56 6.08 .08 <.01 .01 Lean 13.41 14.74 14.87 14.74 .24 .41 .15 Total 18.21 19.90 20.44 20.82 .25 .02 .03

Total Organ Tissue,% Total Organ Weightc Fat 26.76 26.15 27.37 29.47 .43 .01 .58 Lean 73.23 73.84 72.62 70.52 .43 .01 .57

GI Tract Tissue, kg d Fat 4.14 4.43 4.82 5.31 .08 <.01 .01 Lean 9.57 10.78 10.97 10.83 .44 .39 .87 00 Total 13.71 15.22 15.79 16.15 .22 .01 .02 Vl

GI Tract Tissue,% Total GI Tract Weight d Fat 30.80 29.36 30.77 33.29 .56 .03 .03 Lean 85.32 83.96 83.63 .56 .03 .84 .84

LHL Tissue, kg e Fat 0.66 0.73 0.74 0.76 .01 .10 .21 Lean 3.84 3.95 3.91 3.91 .05 .92 .89 Total 4.50 4.69 4.64 4.67 .05 .59 .64

LHL Tissue,% Total LHL Weighte Fat 14.67 15.78 16.02 16.36 .30 .19 .28 Lean 69.19 70.63 69.22 66.70 .30 .19 .28 aLSMeans reported. Values of 14, 13, 14, 13 pigs for the four treatment groups, respectively. bLinear (L) and Quadratic (Q) response to dietary (D) pantothenic acid additions. cTotal organ tissue= GI Tract(gastrointestinal tract with contents and associated mesentery and abdominal fat and spleen)+ LHL (lungs-heart and associated thoracic fat with liver). eGastrointestinal tract with contents and associated mesentery and omental fat and spleen fLungs-heart with associated thoracic fat and liver hDetection of BMC assumed to be an arbitrary artifact of dense contents in the GI tract. Bone mineral content not detectable in LHL.

00 O'\ 87 Table 10. Effect of dietary pantothenic acid additions on DEXA estimated whole body tissue content. a,d Added 12antothenic acid, 1212m P= Criteria 0 80 800 8000 SEM DL6 DQ6 Whole Body Tissue, kg Fat 67.17 67.56 72.87 71.82 1.26 .30 .09 Lean 126.87 131.39 127.64 128.31 1.29 .89 .73 BMC 3.11 3.15 3.15 3.07 .05 .56 .80 Total 197.15 202.09 203.66 203.19 1.55 .47 .22

Whole Body Tissue,% of Total Body Tissue Fat 34.2 33.4 35.8 35.3 .005 .41 .14 Lean 64.2 65.1 62.6 63.2 .005 .43 .13 BMC 1.58 1.56 1.55 1.51 2.51 *10"-4 .36 .76 3 LSMeans reported. Values of 14, 13, 14, 13 pigs for the four treatment groups, respectively. bLinear (L) and Quadratic (Q) response to dietary (D) pantothenic acid additions. cWhole body tissue=right carcass half, kg+ (percentage of component in right carcass half!' left carcass half weight, kg) + organs, kg dEquivalent mean whole body weights determined gravimetrically for the four treatment groups were 197.46, 202.98, 204.66 and 203.93 kg with a SEM of 1.55 (DL= .47 and DQ= .22) Chart 1. Hepatic ACC gene expression in pigs receiving 0 or 8000 ppm added PA (N=6 pigs/ trt; P=.47)

2.5

2 c 0 ·c;; eI/) ~ 1.5 w 00 Q) 00 c Q) (!) c ~ Q) :E Q) ;> ~ Q; 0:::

0.5

0 ACC Chart 2. Hepatic ACO gene expression in pigs receiving 0 or 8000 ppm added PA (N=6 pigs/ trt; P=.42)

1.6

1.4

1.2 c: 0 ·c;; II) ...Cl,) ~ ~ 00 Cl,) c: Cl,) "° (!) 0.8 c: C'CS Cl,) :E Cl,) .~... 0.6 -;C'CS 0::

0.4

0.2

0 ACO Chart 3. Hepatic FAS gene expression in pigs receiving 0 or 8000 ppm added PA (N=6 pigs/ trt; P=.20)

3

2.5

c: 0 ·u; 2 C/) C1> ~c. >< w \0 C1> 0 c: C1> C> 1.5 c: ca C1> ~

C1> ;> !i! C1> a:::

0.5

0 FAS 91

CHAPTERS. GENERALSUMMARY A study was conducted to determine the accuracy and precision of body composition measurement by Dual-Energy X-ray Absorptiometry (DEXA) and the efficacy of pantothenic acid (PA) as a modifier of body composition on a pig model of obesity development. Heavy weight barrows at six months of age were adjusted to a high fat basal diet with a calorie mix representative of that typically consumed by adults in the US (34 % of calories from fat) that provided daily dietary caloric intakes equivalent to 1.8 times their estimated body maintenance (110 kcal ME/ BW kg .75/ day) needs based on the weekly mean BW of each animal. The basal diet provided PA in an amount that met or exceeded the current estimated needs of pigs and humans, and was expected to develop an obese state over a period of 144 d. Pigs were individually penned and allowed ad libitum access to water and their daily feed allocation that was divided equally into a 0700 and 1600 hr feeding. At slaughter, the weights and tissue contents (fat, lean and bone mineral) of two body depots (carcass and internal organs) were evaluated by gravimetric, DEXA, and chemical measures. Subcutaneous carcass fat and longissimus muscle area measurements were also performed The precision and accuracy of the DEXA estimates of the weight and tissue content of the two body depots were evaluated in pigs (133-265 kg). DEXA scanning accurately estimated the carcass depot weight (+2 %) relative to that determined by gravimetric weighing. DEXA underestimated the fat tissue contents of the two depots (-19 and-26 %) and overestimated the lean tissue contents (13 and 27 %) relative to those estimated from chemical analysis of the fat and protein contents of the depots. However, DEXA precisely

detected changes in carcass and organ depot weights (R2= .99, .99, respectively) and less precisely predicted changes in the depot's chemically determined fat (R2 = .95, . 73) and

protein content (R2= .88, .84). Specifically, for each 1 kg change in carcass and organ depot weights, DEXA predicted the changes with a 95 % confidence (2 SE of estimate) within± .008 and .026 kg, respectively. For each 1 kg change in the two depot's chemically determined fat content, DEXA predicted the change within± .092 and .338 kg, respectively. 92

The efficacy of supplemental PA (0, 80, 800, 8000 ppm) as a modifier of body composition was determined on pigs that were randomly allotted to dietary treatment by body weight and date on test (block). Pigs with an initial BW and fat content of 154 kg and 27 %, respectively, accrued 73 kg ofBW tissue of which 48 % was body fat in the obesity development model. BW gains, BW gain/feed ratios, FI, and subcutaneous backfat depths were not altered by PA additions. Whole body fat tissue content responded quadratically to increasing PA additions. Body fat percentage was reduced by .9 percentage units by the 80 ppm added PA and increased by 1.6 and 1.1 percentage units by the 800 and 8000ppm added PA. Hepatic ACO, ACC, and FAS mRNA expression did not differ between the 0 and 8000ppm supplemented PA diets. Based on these data, DEXA precisely predicts weight and tissue content in different body depots, and PA is not an efficient modifier of body composition in a porcine model of obesity development induced by a high fat dietary regimen.